Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Fri, 21 Oct 2011 20:35:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. DOI 10.1600/036364411X583547 © Copyright2011 bythe American SocietyofPlantTaxonomists Systematic Botany are farinose)tothegenus et al.1990 ) assignedallspeciesof Rolla Tryon andcollaborators( Tryon andTryon 1982 ; mary sourceTryon ofconflictamongearliertaxonomictreatments. Windham. Variation infarinawithinthisgroup wasthepri- and non-farinosespeciesisthe genus defined primarilyonthepresence orabsenceoffarina. ary interest, andseveralcheilanthoidferngenerahavebeen tive significanceoffarinahasmadeitatraitevolution- 1984 ; Wollenweber andSchneider2000 ). Thepotentialadap- heating inhighlightenvironments ( Hevly 1963 ; Wollenweber layer overthestomataandareflective surfacetoreduce over- water lossinaridhabitatsbyproviding bothaninsulating functional standpoint,farinahasbeenhypothesizedtoreduce ( Wollenweber andSchneider2000 ; Fig. 1Achemical compositionthatisexcreted byglandulartrichomes and 1B white oryellow(rarely orange)powderysubstanceofvarying ). From a faces (andsometimesotherpartsoftheleaf)are covered bya “farina” ontheleaves.Infarinosespecies,abaxialleafsur- has received muchattention isthepresence orabsenceof insight intotheevolutionarylineswithingroup.” need forthedevelopmentofnewdatawhichwillgiveabetter by Tryon andTryon (1973 : page146)thatthere is“anobvious 1973 ). Thosestudyingthegroup frequently echothecomment driven byadaptationtoaridenvironments ( Tryon andTryon thoids havelongbeenattributedtoconvergent evolution identifying discrete generic boundariesamongthecheilan- ( Schuettpelz etal.2007 ; Rothfels etal.2008 Doryopteris ). Difficulties in have proven tobepolyphyletic, including 1998 ; Schuettpelz etal.2007 phyly ofcheilanthoidsasawhole( Gastony andRollo1995 ), more thanhalfof thegenera , tion ofnonmonophyleticgenera.Despitetheapparent mono- morphological homoplasyhascontributedtothedelinea- the familyPteridaceae,provide aprimeexampleofhow In contrast, Morton (1950) advocatedthe placement ofthese was exclusively farinoseascircumscribed bytheseauthors. One group ofxeric-adaptedfernsincludingbothfarinose Among cheilanthoidferns,onemorphologicalfeature that Cheilanthoid ferns,alineageofxeric-adaptedspeciesin New World cheilanthoidgenus of thelargest cheilanthoidgenerahavebeenshowntobepolyphyletic.Here wereconstruct thefirstcomprehensive phylogenyof ferns. Dependenceondistinctive,butpotentiallyhomoplasticcharacters,todefinemajorcladeshasresulted inataxonomicco played aprominent role inthecircumscription ofcheilanthoidgenera.Ourdataindicatethat ously undetectedtaxaof genus. Evidencefrom thesedatasetsprovides testablehypothesesregarding reticulate evolutionandsuggeststhepresence ofse with spore dataandchromosome counts,alsoprovides acriticalcontextforaddressing theprevalence ofpolyploidyandapomixi (loss) offarinaandthedevelopmentmajorchemicalvariantsthatcharacterizespecificclades.Ourphylogenetichypothesis, groups: oneexclusivelynon-farinoseandtheotherprimarilyfarinose.Within thelattergroup, there hasbeenatleastoneevo Abstract— Keywords— rn . Sigel, M. Erin J.Smith, Species RelationshipsandFarinaEvolutionintheCheilanthoidFernGenus (2011), 36(3):pp.554–564 Convergent evolutiondrivenbyadaptationtoaridhabitatshasmadeitdifficult toidentifymonophyletictaxainthecheilan pmxs, hmpay, pyoey, plpod spores. polyploidy , phylogeny , homoplasy , Apomixis, Notholaena 1 1 Department ofBiology, DukeUniversity, Durham, NorthCarolina 27708U.S. A. , 3 Mcal . Windham , D. Michael Argyrochosma.

2 Notholaena Missouri BotanicalGarden, P.O. Box299,St.Louis,Missouri63166U.S. A. Argyrochosma R.Brown, and Argyrochosma , theremainder ofwhich

Argyrochosma 3 Author forcorrespondence ( [email protected] ) . We useourreconstruction toexaminetheevolutionoffarina(powderyleafdeposits),whichhas Cheilanthes Argyrochosma (mostofwhich Communicating Editor:Lynn Bohs Pellaea 1 (J.Smith) Lye Huiet, Layne Swartz, Link 554 (Pteridaceae) other 52specimens ( Table 1 ). We were unable tosuccessfullyamplify were entirely orpartiallyamplified andsequencedfornearlyallof the not sequenced.Each ofthree plastidregions ( A.nivea the 57samplesincludedinthisstudy; Schuettpelz andPryer(2007) . DNA sequenceswere obtainedfrom 52of tion, amplification,andsequencing followed Nagalingum etal.(2007) and from bothsilica-driedandherbariummaterial.Protocols forDNA extrac- (Appendix 1; Kirkpatrick 2007 ; Rothfels etal.2008 ). as theclosestrelatives to tae Paragymnopterisdelavayi Ponce (1996) , and Mickel andSmith(2004) This includesalltaxaassignedtothegenusby . Windham (1987 , ing 16species,twosubspecies,andthree varieties( 1993 Table 1 ), ; Appendix 1). ferns asawhole. standing ofmorphologicalhomoplasyacross cheilanthoid of hybridizationinthegenusandcontributestoanunder- tern. Thisinvestigationalsoidentifiesseveralpossiblecases origin withinthegenusoramore complexevolutionarypat- mine whethervariationinfarinaproduction reflects asingle tionships amongallpreviously recognized taxaanddeter- of molecular, cytological,andspore data,weinfertherela- plastid loci( eny of Argyrochosma raises questionsregarding theevolutionofthistraitwithin same speciesinthegenus not behomologoustofarinaobservedin farina hasarisenindependentlyin is more distantlyrelated to et al.2007 ; Rothfels etal.2008 ), andindicatethat Gastony andRollo1995 , 1998 sister tocore pellaeids(sensu ; WindhamKirkpatrick 2007 etal.2009 ; ; seealso Schuettpelz phylogenies support sporangial placement,andspore ornamentation.Molecular apparent farina)basedon similaritiesinleafarchitecture, 1 Gog Yatskievych , George (L.)K.H.Shingwere selectedasoutgroups basedontheirposition Here wereconstruct acomprehensive species-levelphylog- DNA Extraction,Amplification, andSequencing— Sampling— Taxon var. Argyrochosma nivea rbcL .

4and5were subjectedtocytogeneticstudybutwere Argyrochosma , , aeil ad Methods and Materials atpA We sampled57 (Baker)K.H.Shing,and , utilizingDNA sequencedatafrom three Argyrochosma Argyrochosma , and 2 n ahen . Pryer M. Kathleen and comprisestwomajormonophyletic Pellaea Notholaena trnG-trnR Argyrochosma A. incana inrecent molecular phylogenies (whichotherwiselacksan asamonophyleticgroup Argyrochosma . Hence,itappearsthat ). Usingacombination Pellaea breweri rbcL 5and6, lutionary reversal Paragymnopteris maran- , , specimenscompris- incombination atpA Notholaena nundrum: all N ws isolated was DNA s withinthe veral previ- thestrictly , and Argyrochosma A. jonesii D.C.Eaton, and may thoid trnG-trnR 1

. This . 4,and rbcL )

Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Fri, 21 Oct 2011 20:35:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. A.nivea atpA New primerswere developedhere toamplifyand sequenceportionsof 555 Schuettpelz etal.(2007) , Nagalingum etal.(2007) , and amplification andsequencingwere takenfrom Beck etal.(2010) Schuettpelz etal.(2006) . , for SIGELETAL.:ARGYROCHOSMAPHYLOGENY 2011] men wasvisuallyinspectedunder10 described above( Table 3 ). were combinedandanalyzed togetherusingtheMP andML approaches different plastidregions. Forthisreason, thethree separatedatasets nificant incongruence wasdetectedwhencomparingphylogeniesacross MP andML phylogeniesforthesameplastid region. Additionally, nosig- ( Mason-Gamer andKellogg1996 ). Noincongruence wasdetectedbetween ally inspectedforconflictbasedona70%bootstrapsupportcriterion strap replicates. Topological supportforthebesttree wasassessedwith500(MLBS)boot- tree wasdeterminedasthat withthehighestlikelihoodscore ( Table 3 searches withrandomstarting trees were performed,andthesinglebest ). of invariantsitesandstatefrequencies were estimated.Eight“besttree” model withfourdistinctratecategorieswasemployed.Theproportion three datasetsusingGarli0.95l( Zwickl 2006 ). A GTR+IGsubstitution RAS eachwere carriedout. majority-rule consensustree, 1,000bootstrap(MPBS)replicates with10 saved perreplicate. To address topological supportoftheresulting MP random additionsequence(RAS)replicates. Nomore than10trees were with tree bisectionandreconnection branchswapping (TBR)and1,000 as unordered andequallyweighted.Heuristicsearches were employed (MP) inPAUP* 4.0b10( Swofford 2002 ). All includedcharacterswere coded ducted foreachofthethree plastiddatasetsusingmaximumparsimony (study numberS10649). tid regions. Datasetsandphylogenetictrees are depositedinTreeBASE analysis. Three datasetswere compiled,oneforeach ofthethree plas- (also confinedto acter state. Ambiguously alignedregions twoormore basepairsinlength base pairindelspresent in portions ofplastidregions were codedasmissing data. Unambiguousone aligned withMacClade4.05( Maddison and2005 ). Unsequenced Corporation, Ann Arbor, Michigan).Eachplastidregion wasmanually were manuallyeditedandassembledusingSequencher4.5(GeneCodes 2). (Table region entire regions, where brancheswithlow support(MLBS tion onthebestML tree from the combinedanalysisofallthree plastid tigate theevolutionoffarinawithin thegenus,weplottedfarinacondi- character states:(0)absent,(1)white farina,or(2)yellowfarina.To inves- ( Maddison 1993 ), eachspecimenwasscored usingoneofthree discrete leaf surfaces.To avoid the complicationofcodinginapplicablecharacters Mesquite 2.5( Maddison andMaddison2008 ). Characters were reconstructed usinganunordered parsimony modelin Fig. A. palmeri Rcntutn Frn Evolution— Farina Reconstructing Maximum parsimonyand ML trees foreachplastidregion were visu- Maximum likelihood(ML)analyseswere conductedfor eachofthe Analyses— Phylogenetic Sqec Ainet n Datasets— and Alignment Sequence and 1 var. . . rbcL Abaxial leafsurfaceforthethree varietiesof flava 1and from samplesforwhichwewere notabletoamplifythe 4withyellowfarina.C. trnG-trnR trnG-trnR and trnG-trnR Separate phylogeneticanalyseswere con- for atpA A. chilensis ) were excludedpriortophylogenetic and × Herbarium materialfor eachspeci- magnification for farina on abaxial magnificationforfarinaonabaxial N sqec chromatograms sequence DNA A. nivea atpA and were codedasafifthchar- var. A. jonesii < 75%)were collapsed. tenera Argyrochosma nivea 3. Primersfor 2lackingfarina.Referto Table 1 and Appendix forvoucherinformation. , eachwithadistinctfarina-morph. A. steps; thebest ML tree hadamaximum log-likelihoodscore analysis resulted in9,800most-parsimonious trees of1,252 comparable support(see Table 3 fortree statistics).TheMP duced phylogenetichypotheses ofsimilartopologyand parsimony andML analyses ofthecombineddatasetpro- have beendepositedinGenBank (Appendix1).Maximum used inthisstudy, 147were generated aspartofthisstudyand Previous studiesof cycle ( Manton 1950 ; Tryon andBritton1958 ; Gastony andWindhamwhen theypredominate 1989 inanindividual,are indicative ofanapomicticlife ). spores (32or16)generallyresult from nonreductive meioticeventsthat, dence ofsexualreproduction. Sporangiacontaining reduced numbersof the presence ofsporangiacontaining~64spores provides primafacieevi- both sexualandapomicticlifecycles. Among core leptosporangiateferns, Argyrochosma major cladesof mean spore lengthsofspecimens representing different ploidylevelsand performed inJMP version 7(SASInstituteInc.2007)todeterminewhether deviation were calculated foreachspecimen. A Mann-Whitney 2004 ) calibratedwithaslidemicrometer. Mean spore lengthandstandard the perispore) wasmeasured usingImageJversion1.38( Abramoff etal. a Zeiss AxioCam HRmorCanonEOSRebelXSi.Spore length(excluding ing microscope. Imagesof 10–40spores perspecimenwere obtainedusing Axioplan 2compoundmicroscope orat100 reproductive modewere examinedat400 sary dataonspore size,the glycerol-mounted spores usedtodetermine data derivedfrom chromosome voucherspecimens. To obtaintheneces- mosome countvouchersbycomparingtheirmeanspore sizestosimilar it ispossibletoestimatetheploidylevelofspecimensthatare notchro- Barrington etal.1986 ; Guoetal.2003;Grusz etal.2009; Beck etal.2010 ), phyte ploidylevelinmostferns( Wagner 1974 ; Pryer andBritton 1983 ; for obtainingthesecountsfollowed Windham and Yatskievych (2003) . 1, sources, butnewcountsare presented here for mosome countspresented in Table 1 are derivedfrom thesepublished (summarized by Windham and Yatskievych 2003 ). Mostofthechro- the glycerol drop withadissectingneedleandcounted. drops ofglycerol. Spores from eachsporangiumwere dispersedwithin sporangia from eachspecimenwere removed andopenedinindividual was determinedforallspecimenswithmature sporangia.Multiple,intact tion forthesamplesincludedhere, thenumberofspores persporangium genus ( Windham and Yatskievych 2003 ). To determine modeofreproduc- between spore numberpersporangiumandreproductive modeinthis A. microphylla hlgn o Argyrochosma— of Phylogeny Assessing Reproductive ModeandPloidyLevel— Because there isadirect correlation betweenspore size andsporo- Chromosome countsare availableformanyofthetaxain exhibitvariabilityinreproductive mode,encompassing Argyrochosma 3, A. nivea Argyrochosma var. were significantlydifferent. nivea Results haveconfirmedthestrong correlation A. nivea 4,and Of the162DNA sequences var. A. nivea × × onaLeicaMZ125dissect- nivea magnificationonaZeiss A. limitanea 2withwhitefarina.B. var. nivea subsp. Argyrochosma 5.Protocols pce of Species U testwas mexicana

Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Fri, 21 Oct 2011 20:35:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. A.fendleri A.limitanea A.jonesii A.formosa able forallthree plastidgenes, on herbariummaterial,whitefarinaobservedthefirstleafofasporophyte grown from spore; DNA sequencedata:checkmark A.incana 5 SSEAI OAY [Volume 36 SYSTEMATIC BOTANY A.dealbata A.chilensis 1 able (specimensterile).Chromosome count(meioticcount,unlessotherwisenoted): reproduction: blackcircles =sexual,opencircles =apomict,partiallyfilledcircles =sexualbutproducing asubsetofunred 556 A.delicatula A.limitanea A.nivea A.nivea A.lumholtzii A.nivea A.microphylla count previously publishedby Windham and Yatskievych (2003 ), NA =notavailable.Farina: A =absent,Wwhite, Y =yellow, Table A.incana A.incana A.fendleri A.limitanea A.jonesii A.jonesii A.jonesii A.incana A.incana A.incana Windham A.fendleri A.fendleri A.fendleri A.limitanea A.jonesii Windham A.incana A.nivea A.nivea A.microphylla A.microphylla Windham A.limitanea A.limitanea A.limitanea A.nivea A.nivea A.nivea A.nivea A.nivea A.nivea A.nivea A.nivea A.nivea A.nivea A.nivea A.nivea A.limitanea A.limitanea A.limitanea A.nivea A.nivea A.microphylla A.nivea Argyrochosma var. (Poir.) Windham var. var. (Maxon)Windham (C.Presl) Windham 1 (Kunze)Windham Lim)ida MEXICO,Oaxaca, (Leibm.)Windham Prh ida U.S. A., Kansas, (Pursh)Windham . . (Fée&Remy) var. var. var. var. var. var. var. var. var. var. var. var. var. var. var. var. var. (Maxon&Weath.) subsp. (Maxon)Windham subsp. (Maxon&Weath.) U.S. A., California, U.S. A., California, U.S. A., California, 3 2 1 U.S. A., Arizona, 4 MEXICO,Sonora, U.S. A., Arizona, 3 2 U.S. A., Arizona, DOMINICANREPUBLIC,SanJuan, 5 4 U.S. A., Arizona, 1 U.S. A., NewMexico, 6 tenera nivea U.S. A., NewMexico, 3 U.S. A., Colorado, 2 U.S. A., NewMexico, 4 U.S. A., NewMexico, 1 yoss f of Synopsis (Mett.exKuhn)Windham subsp. subsp. subsp. subsp. subsp. subsp. subsp. subsp. tenera nivea tenera tenera tenera tenera tenera nivea nivea nivea flava flava flava flava flava flava nivea U.S. A., NewMexico, U.S. A., NewMexico, 3 2 MEXICO,Coahuila, 1

Taxon (GilliesexHook.)Ponce mexicana BOLIVIA,SantaCruz, BOLIVIA,Chuquisaca, BOLIVIA,Chuquisaca, ECUADOR, Azuay, 6 4 3 2 PERU,Cajamarca, 5 BOLIVIA,Chuquisaca, 1 PERU,Junín, 5 PERU, BOLIVIA,Oruro, BOLIVIA,Oruro, 4 3 2 PERU,Cusco, 1 mexicana limitanea mexicana limitanea limitanea mexicana limitanea limitanea BOLIVIA,LaPaz, 1 6 ARGENTINA,Jujuya, BOLIVIA,Tarija, BOLIVIA,LaPaz, BOLIVIA,Tarija, 5 4 3 2 Argyrochosma (Maxon)Windham 1 U. S. A., Arizona, S. A.,Arizona, U. 1 3 U. S. A., Arizona, S. A.,Arizona, U. S. A.,Arizona, U. 3 2 MEXICO,Sonora, S. A.,Arizona, U. 5 4 flava MEXICO,Coahuila, 1 U.S. A., NewMexico, 3 U.S. A., NewMexico, 2 † msig missing (Hook.)Ponce CHILE, JuanFernándezIslands, BOLIVIA, Chuquisaca, MEXICO, NuevoLeón, MEXICO, Sonora, limitanea specimensusedinthisstudy. Taxa represented bymore thanonespecimenare numbered sequentially. Modeof Howard 9113 2005–931 rbcL Tryon s.n. , , ‡ msig missing

(MO) Correll &SmithP759 Galiano etal.6865 (US) Brooks 16997 (HUH) Serrano etal.6182 Beck St.G.23950 Schuettpelz 491 Schuettpelz 487 Windham &Yatskievych 332 Schuettpelz 472 Windham &Yatskievych 249 Windham etal.171 Rothfels 2532 Windham etal.459 Linneo 301 Torrico &Castillo622 trnG-trnR Reeb VR26-V-02/12 Sperling &King5394 Reina &Van Devender Van Devenderetal.98–923 Fishbein etal.4458 Windham etal.539 Correll &SmithP912 Windham &Beck3529 Morefield 1664a Windham &Pryer3437 Windham &Pryer3429 Voucher Information Aedo etal.13066bis Windham etal.575 Windham etal.576 H. vanderWerff 22303 Windham &Yatskievych 374 Rothfels 2514 Windham 3494 Worthington 34623 Windham &Rabe90–377 Windham 352 Metzgar 120 Morrone etal.2360 Kessler etal.5323 Huaylla 65 Huaylla etal.2207 Huaylla 70 Wood 8744 Windham etal.482 , NA =notavailable. (MO) (UE • (DUKE) (DUKE) (MO) (UE AW W NA NA • NA (DUKE) (DUKE) (DUKE) Stottsberg 100 (UC) (MO) (MO) (HUH) (UC) (UE AW NA • (DUKE) (MO) (T • (UT) (DUKE) (O • (MO) (UT) (UT) (O AA NA • (MO) (UE • (DUKE) (DUKE) R. A.&E.S. (DUKE) (MO) (DUKE) (UE • (DUKE) (MO) (US) (US) (US) (UE AN W NA NA (DUKE) (UE AN A NA NA (DUKE) (MO) (O AN Y NA NA (MO) (UE AA A NA NA • NA (DUKE) (UT) DK)• (DUKE) (MO) (O AN W NA NA (MO) (O • (MO) (T • (UT) (MO) (DUKE) § gametophyte mitoticcount, (T • (UT) Reproduction Mode of •NA W •NA W  •                         ¶ n n n n n n NA AW W W NA NA W n W NA n n NA NA n n n n n AA W W A W* NA NA NA NA W NA W NA W 2 Y 2 Y NA NA Y NA Y Y NA NA NA NA NA count takenfrom aduplicatespecimen, Chromosome n n =54 =27 =27 =27 =27 =2 =2 =2 =2 =2 =27 =27 7A =27 =27 =81 =81 Count n n n n n 1 1 1 1 1 1 1 1§ =81 =81 =81 =81 =162 W W ANA WNA WNA A WNA § § A WNA WNA 1 1 1 1 uced spores, NA =notavail- W W W *althoughfarinaabsent Farina = sequencedataavail- W W W DNA Sequence ( Continued Data Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö

‡

‡

) Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Fri, 21 Oct 2011 20:35:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. A.palmeri MTA0RGTCGGTAAGCCTGGGCTTGTTTRG TATGACGAYCTTTCYAAACAAGC GGGAAGATCGCCCAAATACCAG G ESRBCL1F ATTGTATCTGTAGCTACTGC rbcL ACAGCAGTAGCTACAGATAC EMATPA102R GARCARGTTCGACAGCAAGT EMATPA1009F EMATPA505F ESTRNR46F* ESATPA557R* ESATPA535F* ESATPA412F* MBL9RTGTCTATCRATRACRGCATGCATTRNR22R GATTTATTTGAGGAAGGTTCCG TRNG63R TRNG43F1 TRNG1F trnG-trnR EMRBCL894R EMRBCL320F RBCL1361R ESRBCL654R ESRBCL628F TRNGJBF atpA 2007 ; * Schuettpelz etal.2006 ; and erately supported(MLBS=82%,MPBS74%)subcladein mens of an equallywell-supportedcladecomprisingthethree speci- specimen of composed offourspecies,allwhichlackfarina.Thesingle comprising CladesB,C,D,E,andF. Group 1(=Clade A) is and aprimarilyfarinoseGroup 2(MLBS=93%,MPBS91%) Group 1(MLBS=99%,MPBS =100%)comprisingClade A dichotomy ( Fig. 2 ), dividingthegenusinto anon-farinose ships within we usethebestML phylogramtoshowevolutionaryrelation- set, nonewere well-supported (MLBSandMPBS 557 ences betweentheMP andML trees from thecombineddata- of -11,400.55077 ( Table 3 ). Whilethere were topologicaldiffer- SIGELETAL.:ARGYROCHOSMAPHYLOGENY A.pallens 2011] this study. A.peninsularis A.stuebeliana A.pilifera Table The phylogenyof Table A.palmeri A.pallens A.stuebeliana A.palmeri A.pallens A.peninsularis A.stuebeliana A.peninsularis Windham A.peninsularis trnG-trnR §

Beck etal.2010 . Primersinboldwere developedspecificallyfor Argyrochosma ‡ (Weath. exR.M.Tryon) Windham (R.M.Tryon) 1 (Baker)Windham 2 § ‡ ‡ . . † . . A. microphylla ‡ † MEXICO,Oaxaca, 1 MEXICO,Oaxaca, 2 (Hieron.) Windham † MEXICO,Guanajuato, 1 MEXICO,Guanajuato, 2 † Continued Primers usedforamplifyingandsequencing (Maxon&Weath.) Windham plastidregions. Publishedsource ofprimersequence: A. formosa Argyrochosma 2 PERU,Cajamarca, 1 MEXICO,BajaCaliforniaSur, 1 MEXICO,BajaCaliforniaSur, 2 MEXICO,BajaCaliforniaSur, 3 Taxon Argyrochosma † Schuettpelz andPryer2007 ; issister(MLBSandMPBS=100%)to . Theothertwospeciesformamod-

AGGAGCCGAATGGGCCGAAA CTATCCATTAGACGATGGACG GCGGGAATCGAACCCGCATCA TGATGCGGGTTCGATTCCCG GCGGG TCAGGACTCCACTTACTAGCTTCACG GAARCGATCTCTCCAACGCAT CCATTYATGCGTTGGAGAGATCG ATGTCACCACAAACGGAGACTAAAGC (Fg 2). (Fig. TATAGGTTCRARTCCTATTGGACG PERU, Amazonas, PERU, Amazonas, MEXICO, Morelos, TATAGTTTAGTGGTAA hasawell-supportedbasal 5 ′ -primer sequence-3 ‡ aaigm t al. et Nagalingum Windham etal.527 Yatskievych &Gastony89–280 Hutchison &Wright 5288 Plowman 5551 Yatskievych &Gastony89–287 Voucher Information < Pray 3078 Correll &Correll 28817 70%).Here ′ atpA de laLuz9784 Dominguez 2981 de laLuz9687 , , rbcL (S)•N W NA • (RSA) (HUH) , (UE • (DUKE) o ftes4618349909,800 1252 9,990 0.889 659 0.653 8,304 0.892 4,691 0.671 160 0.945 0.800 MaximumLikelihood 401 0.887 No. oftrees Tree length(steps) 0.618 Retention index Consistency index isn aa72 44 30 5.59 Best –ln 13.07 4,237 14.41 1,104 7.23 1,309 Parsimony informative MaximumParsimony 1,824 % missingdata Included characters Alignment length “?” and“-”inthedatamatrices. weighted parsimonymodel.%missingdataisthesummedpercentages of ysis. Parsimonyinformativecharacterswere calculatedusinganequally- tree statisticsforeachplastid region sequencedandforthecombinedanal- 85%) assistertothetwosubspeciesof of MPBS =90%)unitesthree taxa,withthesinglespecimen clades, designatedCladesEandF. CladeE(MLBS=92%, them are poorlyresolved bythisdataset. of CladeCare generally well-supported, relationships among A.pilifera 1 ) ismoderatelysupportedassistertotheonly sampleof specimen from theDominican Republic( clade (MLBSandMPBS=100%),thegeographicallyisolated groups, theonlyexception being form strongly supported (MLBS=100%,MPBS97–99%) four speciesinCladeCrepresented bymultiplespecimens whereas CladeCiscomposed ofsixspecies.Three ofthe monospecific (includingjustthethree specimensof relationships amongthem are poorlyresolved. CladeBis each well-supported(MLBS=100%,MPBS99–100%),but of thethree sampled supported (MLBS=100%,MPBS99%)subcladecomposed which theonlyspecimenof the fourspecimensidentifiedas (US) (O AW NA • (MO) (O AW NA • (MO) (IH AW NA • (MICH) Table Clade D(MLBS=100%,MPBS99%)comprisestwosub- Within Group 2,thethree mainclades(B, C,andD)are A. dealbata characters (O AW NA • (MO) (N)N AW NA NA (IND) (O AW NA • (MO) L score 3 . . (MLBS=61%,MPBS82%). Although thespecies Summary detailsforDNA sequencedata(inbasepairs)and moderatelysupported(MLBS=77%,MPBS = Reproduction Mode of  

8 39 557 95 83 182 4,156.54738 1,853 A. jonesii atpA n AW NA NA Chromosome =27 A. lumholtzii specimens. 2,928.77560 1,309 Count A. incana 1 rbcL A. incana W

A. limitanea 4,057.27134 1,267 trnG-trnR formarobust sub- issistertoawell- . Although three of Farina A. incana W 11,400.55077 A. fendleri DNA Sequence 4,429 . CladeF 4; Table Combined Analysis Data Ö Ö Ö Ö Ö Ö Ö Ö Ö Ö

†

) Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Fri, 21 Oct 2011 20:35:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 5 SSEAI OAY [Volume 36 SYSTEMATIC BOTANY 558 specimen; see Table 1 ). See Table 3 fortreefor eachfertilespecimen (blackcircle statistics. =sexual, opencircle =apomict, partiallyfilledcircle =sexual butproducing asubse MP bootstrap supportvaluesare given atnodes.Two groups andsixmajorclades (A-F)are recognized inthisstudy. Modeofrep ing allcurrently recognized taxa( Windham 1987 ; Ponce 1996 ). Thetree isrooted with Fig. 2 . . The bestML phylogramfrom thecombinedanalysisof atpA , , rbcL , and trnG-trnR Paragymnopteris delavayi sequencedatafor51specimensof , , P. marantae t ofunreduced spores, ?=sterile , and Argyrochosma, Pellaea breweri roduction isindicated represent- . ML and Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Fri, 21 Oct 2011 20:35:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. color indicatesfarina condition(seeboxonfigure). were collapsed. Circled lettersrefer toClades A-F in Fig. 2 . Character stateforeachincludedspecimen wasdeterminedusin 01 SGLE L:AGRCOM HLGN 559 SIGELETAL.:ARGYROCHOSMAPHYLOGENY (MLBS =92%,MPBS80%)comprises 2011] liana followed bytwolossesrepresented bysamples white farinaoccurred atthenodeunitingCladesB,C,andD, siomorphic state.Inthisreconstruction, asingleoriginof Under aparsimonymodel,theabsenceoffarinaisple- from thephylogeneticanalysis( Fig. 2 ) andisshownin Fig. 3 evolution in . this cladeare onlymoderatelytoweaklysupported. tenera However, limited numberofintactsporangiaavailableforanalysis. the 50specimenssampled.Thisisnotsurprisinggiven sexual specimensis49.49 A.incana sexual specimensinCladeC( Fig. 2 ), withtheexceptionof groups were revealed ( Fig. 4 ). Average spore lengthforthe cally different ( gium. Among thesexualspecimens,twodistinctandstatisti- from apomicticspecimenswith32or16spores per sporan- spores persporangiumwere consistentlysmaller than those ( Table 1 ). Spore measurements from sexualspecimenswith64 14 oftheseare vouchersformeiotic( mean spore lengthandstandard deviationsfor50specimens; synapomorphy unitingallspecimensof duced both64-spored and 32-spored sporangia,and Fig. Frn Evolution— Farina Spore numberpersporangium wasconsistentin47of Mode ofReproduction andPloidy— , andthethree varietiesof 2and 3 . . 4,is40.85 Parsimony reconstruction offarinacondition mappedonthebestML tree shown in Fig. 2 , butwhere brancheswithlowsuppo A. nivea A. nivea Argyrochosma p

< var. 0.0001;Mann-Whitney var. μ m. Themeanspore length forallother A parsimonyreconstruction offarina tenera tenera μ wasplottedonthebestML tree m. 2and 5. Yellow farinaappearstobea A. nivea A. nivea n Fgr 4 lutae the illustrates 4 Figure ) chromosome counts ; relationships within A. chilensis A. nivea U var. test)spore size var. tenera A. nivea , , A. stuebe- A. limita- flava 5pro- var. . to reproduce sexually( Knobloch 1967 ; Table 1 A.jonesii ; Fig. 4 ). Spore Three ofthefourspecies ( unites thefournon-farinosespeciesof regions ( on thecombinedanalysisofsequencedatafrom three plastid the NewWorld cheilanthoidferngenus mostly well-resolved androbustly supportedphylogeny of cana ( Fig. 4 ). The16-spored sporangiaof whereas 32-spored specimensare mostlyapomictictriploids confirm that64-spored specimensare mostlysexual diploids, based onthe14meiotic( of 82.70 the largest observedinourstudy, withameanspore length sporangia. Spores from the16-spored sporangiawere byfar nea thoid ferns. acter ofhistoricalsignificanceintheclassificationcheilan- examine theevolutionoffarinawithin ous researchers. Usingourbestestimateofthephylogeny, we and compare ourresults tohypothesesproposed byprevi- inter- andintraspecificrelationships within prising sixclades(Clades A-F) are resolved. Here wediscuss Group hlgn o Argyrochosma— of Phylogeny

subsp. 1yieldedahexaploidchromosome count( Table 1 ). μ ) have64-spored sporangiaand,hence,are inferred rbcL m. Meanspore lengths,calibratedwithploidylevel 1 mexicana — , , This group comprisesasingleclade(A),which atpA , and 1produced both32-spored and16-spored Discussion trnG n ) chromosome vouchers( Table 1 ), A. microphylla - trnR ), twomajorgroups com- This studyprovides a A. limitanea g 10 Argyrochosma Argyrochosma Argyrochosma × , , magnification.Branch A. lumholtzii, Argyrochosma rt (MLBS sbp subsp. ( Figs. 2 , 3 ). 3). 2, (Figs. , achar- . Based . < mexi- and 75%) , Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Fri, 21 Oct 2011 20:35:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. that n ticular plantasanapomictictriploid. and Yatskievych 2003 ) forthisspecimenestablishespar- study. A publishedchromosome count( confirmed fortheonlyspecimenof have 32spores persporangium ( Tryon 1956 ), andthiswas 4). Fig. that oursamplesofthesetaxaare uniformlydiploid( Table 1 ; for size data,incombinationwithmeioticchromosome counts chromosome countvoucherslistedin Table 1 . number ofspores persporangium.Lettersbeloweachdatapointcorrespond tomajorcladesindicatedin Figs. 2 and 3 . Ploid per sporangium(seeboxonfigure). Linesbeginningandendinginarrows indicatespecimensobservedtohavetwosporangiatype [Volume 36 SYSTEMATIC BOTANY 560 sporangium, while ourspore measurements represent thefor- Windham and Yatskievych (2003) came from thelattertypeof pect thatthediploidgametophyte mitoticcountreported by (common) andthosewith32 diploidspores (rare). We sus- duced twotypesofsporangia: thosewith64haploidspores ment ofchromosomes. We hypothesizethat leads totheproduction of32spores withadiploidcomple- the spore mothercellsjustpriortomeiosis( Steil 1951 ). This out cytokinesis)occursduringthefourthmitoticdivision of duction, whereby endomitosis(chromosome doublingwith- Occasionally, developingsporangiaundergo mitoticnonre- enon thatoccurssporadicallyinmanylineagesofferns. This apparent discrepancy maybeexplainedbyaphenom- lar insizetospores ofknowndiploidsporophytes ( Fig. 4 ). the spores of =54( Table 1 ) led Windham and Yatskievych (2003) toinfer A publishedgametophytemitoticchromosome countof Fig. A. jonesii A. jonesii 4 . . Argyrochosma formosa Average spore lengthsforspecimenslistedin Table 1 ; error barsindicateonestandard deviation.Symbolshadingdepicts 4, 3wasasexualtetraploidindividual.However, A. jonesii A. microphylla 3analyzedforthisstudy are simi- previously hasbeenreported to 1,and A. formosa A. microphylla n =2 n includedinour A. jonesii =81; Windham 3,indicate 3pro- two specimensof observed inonespecimenof few intactsporangia),suchbimodalspore production was mer. Although notdirectly observedin are confirmed: “Mode ofReproduction and Ploidy cheilanthoid ferns ( Gastony and Yatskievych 1989 ), would be plastid genome, whichisknowntobematernally inheritedin specific hybridization.Under thisallopolyploidscenario,the that thispolyploidtaxonmay haveoriginatedthrough inter- an undetecteddiploid,thedata suggestanotherpossibility: ple of have notbeenidentified. Although itispossiblethatoursam- mosa molecules mayprovide someinsightintotheoriginof tid loci.Thisapparent discrepancy betweenmorphologyand than do mosa and shapeoftheultimateleafsegments.Interestingly, including shapeoftherachises,texture oftherhizome scales, of features considered importantincheilanthoidtaxonomy, A.formosa related (e.g. Tryon 1956 ; Mickel andSmith2004 ). Bycontrast, rachises), andmostauthorshaveassumedtheyare closely logically (differing primarilyinthecolorofpetiolesand A.jonesii Within Group 1,twowell-supportedsister-species pairs , anapomictictriploidwhose sexualdiploidprogenitors and A. A. formosa A. lumholtzii ( Fig. 2 ). Thelattertwospeciesare similarmorpho- and microphylla A. formosa A. microphylla represents anautopolyploidderived from A. nivea and showlessoverallsequencedivergence A. jonesii + var. A. microphylla are distinguished byanumber A. limitanea tenera forthethree combinedplas- ” (seediscussionbelowin y isindicatedfordocumented section). A. jonesii subsp. and s, eachwithadifferent the numberofspores A. lumholtzii 3(whichhad mexicana A. for- A. for- and + Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Fri, 21 Oct 2011 20:35:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. supported clade( Fig. 2 ). However, onespecimen( western U.S. A. andnorthernMexico( Table 1 ) formarobustly synapomorphy forthespeciesofCladeC. suggesting thatasmalleraveragespore sizemayconstitutea cantly smallerthanthoseofothersexualdiploids( Fig. 4 ), below), meanspore lengths fortaxainCladeCare signifi- polytomy. these cladesare notwell-supported( Fig. 2 ), resulting ina entirely (orprimarily)offarinosetaxa.Relationshipsamong clades (B,C,andD; Fig. 2 ), eachofwhichiscomposed diversity of suggesting thatwehaveyettofullysamplethetaxonomic undetected sexualdiploidresembling polyploid scenario presupposes theexistence(noworinpast)ofan similar topolyploid from anundiscovered diploidtaxonmorphologically more The paternalgenome,ontheotherhand,wouldbederived the unexpectedsequencesimilaritytoextant 1984 ; Windham 1993 ). Thisraisesthepossibilitythat wide morphologicalandchemicaldiversity( Wollenweber tribution knownforanyspeciesof pected. While initiallysurprising,thisresult wasnotentirely unex- Republic formsamoderatelysupportedcladewith Table 1 ) representing adisjunctpopulationintheDominican ( Figs. 2 , imens impliesthatallbutoneoftheseare sexualdiploids 4 ). With theexceptionof ( Table 1 ), ourcomparisonofspore sizesamongfertilespec- for justfourofthe13specimenssampledfrom thisclade ( Fig. 2 ; Table 1 per sporangiumandare thus inferred toreproduce sexually ). Although chromosome countsare available A.pilifera icatula, A.incana,pallens,palmeri,peninsularis, lar study( Table 1 ; Fig. 4 ). fendleri Similar countsandmeasurements were obtainedfrom sporangium withanaveragespore lengthof48 tive modeandploidylevel.Thisspecimenhad64spores per the mature sporangiaand spores neededtoassessreproduc- imen includedinourmolecularanalyses( 1956 ; Windham 1993 ; Mickel andSmith2004 branching patternsoftheleafrachisesandcostae( ). Onlyonespec- Tryon of A.fendleri cant ramifications forestimatesoftaxonomic diversityin origin ofthis putative polyploid,itsdiscovery hassignifi- sexual tetraploid. Although itispremature toreflect onthe et al.1986 ), andsuggeststhattheDominican specimenisa ciated withadoublingofchromosome number( Barrington This approximates theexpectedincrease inspore lengthasso- other 7.22 has anaveragespore lengthof46.93 undescribed taxon.Ouronesampledspecimen( that theDominicanpopulationof previously overlooked. as traditionallydefined,includescryptictaxathathavebeen 01 SGLE L:AGRCOM HLGN 561 SIGELETAL.:ARGYROCHOSMAPHYLOGENY derived from an 2011] Three specimensof Clade Group Clade Spore lengthdata( Fig. 4 ) tentativelysupportthenotion Argyrochosma μ m (18%)longerthantheaverage spore lengthsofall A. incana 4,aknownsexualdiploidnotincludedinourmolecu- Argyrochosma incana

C

( Figs. 2 , 3 ). All samplesinthiscladehad64spores B ( Fig. 2 ), probably themostrecognizable species 2 — — — Argyrochosma This lineagecomprisesallthree specimensof This cladeincludessixfarinosespecies: This group comprisesthree well-supported samplesincludedinouranalyses ( Table 1 ). becauseofthestrongly angular(flexuose) A. microphylla A. formosa A. incana . hasthebroadest geographicdis- -like progenitor, accountingfor . Itshouldbenotedthateither (1–3)collectedfrom thesouth- A. incana Argyrochosma A. incana μ m ( Fig. 4 ), whichis mayrepresent an A. fendleri A. microphylla 4(discussed anddisplays μ A. incana A. incana A. formosa m ( Fig. 3 ). A. pilifera A. incana 1)had A. del- and 4) 4) 4; A. , . . , beyond thediscoveryofapreviously undetected,molecularly Argyrochosma distinctive polyploidwithin species of to interpreting theevolutionofgenusasawhole. taxonomic diversity, includingundiscovered diploidscritical var. ( Fig. 2 ). Although mostof these taxaare strictlyfarinose, cies dividedbetweentwowell-supportedsubclades,EandF 2004 ). ters ( Tryon 1956 ; Pray 1967 ; Windham 1993 tinct geographicrangesanddiagnosticmorphologicalcharac- ; Mickel andSmith A.pallens der ofCladeCconsiststhree well-supportedsubcladesof taining allsexualdiploidspecimensof it isclearlydistinctfrom thestrongly supported clade con- with regard totheothertaxainCladeCremains unresolved, ports thislatterview. Although thepositionof maintained asaseparatespecies.Ourphylogeny( Fig. 2 ) sup- data, Windham (1987) argued that that widespread species.Onthebasisofunpublishedisozyme delicatula Tryon (1956) and Mickel andSmith(2004) able overlapinmorphologyandgeographywith suggestedthat Clade C,hasbeenhistoricallycontentious.Citingconsider- through additionalspore studiesofthegroup. (and likelyothernewtaxaaswell)wouldbeeasilydetected data pointtotheexistenceofanothermissingdiploid.This the combinationofmorphological,molecular, andgeographic the Dominicantaxonarose through auto-orallopolyploidy, netic analyses,thethree specimensofsubsp. can bedifficult todistinguishinthisregion. Inourphyloge- of thesouthwesternU.S. A. andnorthernMexico, and they 2004 ). Thegeographicrangesofthetwotaxaoverlapinparts ( Tryon 1956 ) orsubspecies( Windham 1993 ; Mickel andSmith spore studiesof lished meioticchromosome countof dealbata ported assisterto four offivespecimenssubsp. a monophyleticgroup withmoderatesupport( Fig. 2 ), asdo within that allare apomictictriploids ( Fig. 4 ). and correlations between spore sizeandploidylevelconfirm included inourstudyproduced 32spores persporangium, Yatskievych 2003 ; Table 1 ). All eightspecimensof 81, indicatingthattheyare apomictictriploids( Windham and A.limitanea Yatskievych 2003 ; Table 1 ). Three oftheeightspecimens limitanea resolved untilthemissingsexualdiploidprogenitor(s) of the potentialtobecomplexand thesituationcannotbefully itanea raises thepossibilityofathird independentoriginof ment ofthespecimendesignatedsubsp. from oneormore diploidprogenitors. Theunresolved place- subspecies of gruent withearlierhypotheses( Windham 1993 ) thatthe two Clade Clade Clade The taxonomicstatusof Previous authorshave recognized twoinfraspecifictaxa tenera s.l.Interrelationships amongthesepolyploidshave includedhere isaknownsexualdiploid,withpub- Argyrochosma limitanea are found. As with D perhaps shouldbetreated asageographicvariantof F E , , , ispolymorphicforthistrait( Table 1 ; Figs. 2 , 3 ). Argyrochosma A. palmeri, — — — havepublishedchromosome countsof This cladecomprisesfivespeciesandsubspe- This cladecomprisesallthree South American . Inthiscase,theincrease indiversityextends Within CladeE, A. limitanea A. limitanea and A. limitanea ( Fig. 2 ; Table 1 ) andiswell-supported A. peninsularis hadindependentpolyploidorigins A. delicatula A. incana are certaintoreveal additional A. formosa A. dealbata , treated aseithervarieties . Theonlyspecimenof limitanea . Regardless ofwhether A. delicatula n and ( Fig. 2 ), eachwithdis- A. incana =27( Windham and , anothermemberof ismoderatelysup- . Thisresult iscon- limitanea A. incana mexicana . h remain- The . A. delicatula shouldbe A. limitanea 5( Fig. 2 ) A. incana n , further , =2 A. nivea A. lim- form n A. A. A. = ,

Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Fri, 21 Oct 2011 20:35:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. tenera extends tothevarietallevelaswell,withspecimenvar. and var. sister toacladecontainingspecimensof clade with Argyrochosma stuebeliana (a rare Peruvian endemic)are notcloselyrelated ( Fig. 2 ). A.nivea to bemonophyletic.However, itisclearlynestedwithin sented here byasinglespecimenandmayultimatelyprove chilensis as species,noneisdemonstrablymonophyletic. present. the relationships inCladeF, severalintriguingpatternsare additional sequencemarkerswillbeneededtofullyresolve (var. with brightyellowfarina(var. are recognized within A.stuebeliana diploids (represented byvar. identified asvar. cytotypes ofthesetaxa.Furtherexaminationspecimens it mayhavearisenthrough hybridizationbetweendiploid documented inthe is acommonpatternincheilanthoidfernsandhasbeenwell ing bothautopolyploidandallopolyploiddescendents.This diploids were involvedin pasthybridizationevents,produc- ity observedamongthesepolyploidssuggeststhatseveral from sexualdiploids.The morphologicalandgeneticdispar- are apomicticpolyploids thatalmostcertainlywere derived counts andspore data.The majorityofspecimensinthisclade comprising CladeFcanbepartlyexplainedbychromosome [Volumeappears tobemonophyletic( 36 Fig. 2 ). only Argyrochosma SYSTEMATIC BOTANY wide-ranging 1989 ), butmostrecent treatments recognize three species:the group hasbeencontentious( Tryon 1956 ; nizer from NorthorCentral America. Thetaxonomyofthis Tryon andStolze suggest thatthesetaxamaybedescendentsofasinglecolo- South American cladeanditsnestedpositionwithinthetree in ourphylogeneticanalyses.Theapparent monophylyofthis 562 phyletic group ( Fig. 2 ) mayalso reflect pasthybridization able hybridsbetweenvar. and Yatskievych 1989 ), wehypothesizethattheseare prob- expected ifthistaxonwere thematernalprogenitor; Gastony latter specimensgroup withdiploidvar. sparse whitefarinaontheabaxial leafsurfaces. Although the imens ofvar. 4 ) completelylackfarina( Fig. 3 ; Table 1 ). Theremaining spec- ate betweenvar. Thus, weconsiderthisspecimenmorphologicallyintermedi- young sporophytes thatwere grown from spores ( Table 1 ). farinose, scattered whitefarinoseglandswere observedon clade. Although theherbariumvoucherofvar. ploid var. nivea et al.2010 ), bothofwhichare closelyrelated to complex (Grusz etal.2009)andinthegenus Among thethree South American taxatraditionallytreated The lackofspeciesmonophylyobservedamongthetaxa The failure of According toourphylogeneticreconstruction ( Fig. 2 ), var. A. nivea nivea 1nestedwithin , endemictotheJuanFernándezIslands,isrepre- s.l.Thetwospecimensidentified as flava tenera ), andonewithoutfarina(var. A. nivea tenera var. tenera taxatraditionallyrecognized inSouth America, . Inaddition,three infraspecifictaxacurrently . NonmonophylyoftheSouth American taxa A. nivea 1nestedwithinthewhitefarinosevar. isparaphyletic,withtheapomicticpoly- tenera A. stuebeliana tenera flava var. (3, 4,6)are apomicticpolyploids andhave Cheilanthes yavapensis andtworare endemics , withitsunique,brightyellowfarina, revealed thatonlytheputativesexual nivea andvar. A. nivea A. nivea 1isnestedwithinawell-supported tenera , whereas tenera specimenstoform amono- ( Fig. 1 ; Ponce 1996 ): aform var. andvar. flava nivea 2andvar. ), onewithwhitefarina nivea A. stuebeliana andhypothesizethat ReevesexWindham nivea tenera . Thus,ofthefive A. nivea tenera Astrolepis tenera A. chilensis aswell. tenera Argyrochosma (aswouldbe A. stuebeliana Argyrochosma ) Although ). var. 2appears 5; Figs. 2 , 1isnon- (Beck tenera nivea and A. .

and Tryon (1982) toinclude thoid ferns.Thisfeature waspivotalinthedecisionby Tryon tant characterusedtocircumscribe generainthecheilan- absence offarinaonabaxialleafsurfaceshasbeenanimpor- more thorough spore analysis. our understandingofthisgroup wouldbenefitgreatly from a explain theevolutionarypatternsobservedinCladeF, and to hypothesizetheexistenceofundetectedsexualdiploids non-farinose genus is awellsupportedmonophyleticgroup thatissistertothe defining genera.Indeed,wenowknowthat Rothfels etal.2008 ) thatshouldnotbetheprimarybasis homoplastic characterstate( Gastony andRollo1995 , onstrated thatthepresence orabsenceoffarinaisahighly cheilanthoids in 4’-methoxy chalcone andcontainsno(iso)notholaenic acid A.nivea acid ( Wollenweber etal.1993 ). Theunique yellowfarinaof of bibenzylcompounds,either notholaenicorisonotholaenic As with hybridization betweendiploidcytotypesofthesetwotaxa. we hypothesizethat reported that Wollenweber (1984) and Wollenwebercone (eriodictyol-7-methylether)rarely encountered inferns. andSchneider(2000) equally distinctive,asitisdominatedbyaflavonoidagly- According to Wollenweber (1989) , itsfarinacomposition is species earlyintheevolutionofgenus( Fig. 2 , CladeB). with itsdistinctmorphology, diverged from theotherfarinose into theevolutionoffarinachemistry. forms, andexperiencedtwoindependentreversals (losses). once nearthebaseofclade,diversifiedintoseveralcolor ( Rothfels etal.2008 ), inwhichfarinaappearstohaveevolved is similartothatdocumentedamongthenotholaenidferns within CladeF. Thepatternobservedhere in ter ofvar. specimens of A.nivea occurred inthecommon ancestorofextantpopulations Group 2andasubsequent transitiontoyellowfarinathat single transitiontowhitefarinainthecommonancestorof the plesiomorphiccharacterstate.Parsimonyreconstructs a simony reconstruction indicatesthat theabsenceoffarinais on ourbestML phylogenyof clade ( Windham etal.2009 ). Pellaea Schuettpelz etal.2007 ; Rothfels etal.2008 ). This Notholaena and most taxainCladeD(i.e. composition isasynapomorphy forthatlineage.Bycontrast, to CladeC( Figs. 2 , 3 (with tracelevelsofflavonoids). All ofthesespecies belong ), suggesting thatthisparticularfarina the primaryconstituentsare variousterpenoidcompounds laris shape) between logically intermediate(specificallyinrhizome scalecolorand Closer examinationof ploid designated events. Ourphylogenyindicatesthattheapomicticpoly- aia vlto i Argyrochosma— in Evolution Farina Our phylogeneticreconstruction alsoprovides insights Here wehavemappedandreconstructed farinaevolution , , A. nivea A. palmeri cladeis,inturn,sistertothenon-farinosemyriopterid var. var. A. formosa,incana tenera ( Gastony andRollo1995 , 1998 ; Kirkpatrick 2007 ; var. flava. flava A. nivea A. delicatula , and ) represents atleastoneevolutionaryreversal A. nivea nivea Notholaena ( Fig. 1 ) isdominated by2’,6’-dihydroxy- Itappearsthatthelackoffarinainsome stuebeliana Pellaea, ) havewhitefarinaprimarily composed (considered tobethedefiningcharac- stuebeliana A. pilifera stuebeliana var. A. chilensis,dealbata,limitanea , , . Subsequentstudieshavedem- rather thanthefarinosegenus A. incana Argyrochosma , and 1isnestedwithinvar. nivea Agyrochosma havewhitefarinainwhich 1mayhavearisenthrough 1reveals thatitismorpho- and A. limitanea , , A. pallens A. stuebeliana Argyrochosma fendleri, withotherfarinose h peec or presence The ( Fig. 3 ). Ourpar- , itisnecessary Argyrochosma Argyrochosma Argyrochosma , , A. peninsu- 2.Thus, nivea 1998 ; 1998 ; for + , .

Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Fri, 21 Oct 2011 20:35:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 01 SGLE L:AGRCOM HLGN 563 49.49 other cladesfallinthelarge-spored group (meanspore length entirely ofspeciesfrom CladeC,whereas specimensfrom all small-spored group (meanspore length40.85 lated withcladesidentifiedinourphylogeneticanalysis.The Instead, thetwosexualspore sizegroups are strongly corre- indicating thatthesizedifferences donotreflect ploidylevel. Both groups proved tobepredominantly diploid( Table 1 ), statistically distinctspore sizegroups were revealed ( Fig. 4 ). an apomicticlifecycle. Among the64-spored specimens,two just 32(orrarely 16)spores persporangium,characteristic of SIGELETAL.:ARGYROCHOSMAPHYLOGENY indicating thattheyreproduced sexually. Theremainder had gia thatproduced 64well-formedspores persporangium, mens includedinourspore studyhadmature, intact sporan- taxon of us toassessthemodeofreproduction andploidy foreach number persporangiumandaveragespore lengthallowed morphy forvar. farina biosynthesisthatmayrepresent abiochemical autapo- ( Wollenweber etal.1993 ). Thissuggestsasignificantshiftin 2011] Argyrochosma nivea sporangia, spore number persporangiumproved variable. However, inthree ofthe50specimenswithmature, intact level, respectively, andare generally consistentacross clades. These datacorrelate with reproductive modeandploidy standing speciesdiversificationandevolutionin per sporangiumandmeanspore length,are criticaltounder- doubling ofchromosome number ( Barrington etal.1986 ). ent withtheexpectedincrease inspore sizeassociatedwitha sexual tetraploid,andthelarger meanspore lengthiscongru- we hypothesizethatthisspecimenrepresents anundescribed, falls inthelarge-spored group ( Fig. 4 ). As discussedearlier, tion tothispatternis size maybeasynapomorphyforCladeC.Theonlyexcep- nea duced both64-spored and 32-spored sporangia,and of ploidylevel.Thespecimendesignated specimen whenattemptingtousespore sizeasanindicator verifying spore number per sporangiumforanyparticular sporangia. Thesethree examples highlighttheimportanceof by ~15 cana the 32-and16-spored sporangiaof mosome numberofthetriploid apomict.Spores produced by even larger, unreduced spores withdoublethenormalchro- sis justpriortomeiosis.Thisresulted intheproduction of specimen underwentnotone,buttworounds ofendomito- number observedinthe32-spored sporangia( Table 1 ). important implications forcorrelating spore sizewithploidy studied phenomenon inferns(e.g. Windham 1983 ) and has number persporangiumappears tobeacommonbutunder- deviations ( Fig. 4 ). Suchvariationinspore lengthandspore rangia yieldedcountsof 16 spores ( Fig. 4 ). Chromosome preparations from thesespo- small proportion ofsporangiaonthisspecimenproduced just spore countsperformedduringthisstudyrevealed thata true ofthemajoritysporangiaonspecimen,additional ber of loid with32spores persporangiumandachromosome num- mexicana Mode ofReproduction andPloidy— We haveshownthatspore data,includingnumberofspores Our studiessuggestthatthe16-spored sporangiaofthis subsp. 1shownooverlapinlength,theirmeansare separated μ n m). Thissuggeststhatasignificantreduction inspore =2 μ 1waspreviously reported tobeanapomictictrip- m, andthere isa10 Argyrochosma mexicana n =81( Windham and Yatskievych 2003 ). Although flava var. 1produced both32-spored and16-spored . A. incana ( Fig. 4 ). Twenty-five ofthe50speci- tenera n =2 n μ 2and =162,doublethechromosome m gapbetweentheirstandard 4,amemberofClade Cthat A. nivea A. limitanea nlss f spore of Analyses A. limitanea var. μ m) is composed m) iscomposed Argyrochosma subsp. tenera A. limita- subsp. 5pro- mexi- . Pne M M. 19 uvs obncoe e en combinaciones Nuevas 1996. M. M. Ponce, 1950. system I. modular a Manton, Mesquite: 2008. Maddison. R. D. and P. W. Maddison, phylog- of Analysis 4: McClade 2005. Maddison. P. W. and R. D. Maddison, phyloge- in characters missing versus data Missing 1993. P . W. Maddison, Mce, . . n A R Sih . 20 2004. Smith. R. A. and T. J. Mickel, con- phylogenetic for Testing 1996 . Kellogg. A. E. and J. R. Mason-Gamer, Kolc, . 97. Crmsm nmes n in numbers Chromosome 1967. W . I. Knobloch, Nglnu, . . H Shedr ad . . re 07. Mlclr phy- Molecular 2007. Pryer . M. K. (con- and Schneider States , H. United S., eastern N. the Nagalingum, of ferns the on Notes 1950. V . C. Morton, Krptik R E B. 20 netgtn te oohl o of monophyly the Investigating 2007. B. E. environ- desert R. to ferns Kirkpatrick, cheilanthoid of Adaptations 1963. H. R. distri- Hevly, and diversity history, Life 2003. Ricklefs. E. R. and Kato, M. Q., Guo, ori- the Deciphering 2009. Pryer . M. K. and Windham, D. M. L., A. Grusz, chlo- the of inheritance Maternal 1989. Yatskievych . G. and J. G. Gastony, Gsoy G J ad . . ida 99. Seis ocps n pterido- in concepts Species 1989. Windham . D. M. and J. G. Gastony, Gsoy G J ad . . ol 98. Celnhi frs (Pteridaceae: ferns Cheilanthoid 1998. Rollo. R. D. and J. G. Gastony, Gsoy G J ad . . ol 95. Pyoey n gnrc circumscrip- generic and Phylogeny 1995. Rollo. R. D. and J. G. Gastony, dip- A 2010 . Pryer . M. K. and Yatskievych , G. Windham , D. infer- M. B., Systematic J. 1986. Beck, Ranker . A. T. and Paris, A. C. S., D. Barrington, Armf, . . P J Mglas ad . . a 04. Iae processing Image 2004. Ram. J. S. and Magelhaes, J. P. D., M. Abramoff, awards toK.M.P., M.D.W., andG. Y. (DEB-0717398andDEB-0717430). the startingpointforthisproject. ThisworkwasfundedinpartbyNSF and D.Swofford fortheir2008SystematicBiologycourse,whichwas ments, edits,andcriticism.E.M.S.gratefullyacknowledgesF. Lutzoni Rothfels, E.Schuettpelz,andtwoanonymousreviewers fortheircom- for ourDNA andspore studies.We are gratefultoJ.Beck, A. Grusz, C. osity inlendingtheircollectionsandforallowingdestructive sampling DUKE, F, HUH,IND,MICH,MO,NY, RSA,UC,US,UTfortheirgener- fern evolution. tively usespore sizeasaproxy forploidylevelin studying sible toeliminatethispotentialsource ofconfusionandeffec- number persporangiumforaparticularspecimenisitpos- sporangia sampled.Onlybyverifyingaconsistentspore nificantly dependingontheproportion of32-and16-spored age spore lengthcalculatedforthisspecimenwouldvarysig- level. Inthecaseof Acknowledgments. for evolutionaryanalysis.v. 2.5 . http://mesquiteproject.org . eny andcharacterevolution.v. 4.08 . Sunderland : Sinauer Associates . netic analysis . Cmrde: Cmrde nvriy Press . University Cambridge Cambridge: SystematicBiology flict amongmoleculardatasetsinthetribeTriticeae (Gramineae) . Llavea sporous ferngenus logenetic relationships andmorphologicalevolutioninthe hetero- cluded) . The New York BotanicalGarden Press . en ferns . (Pteridaceae) inthecontextofaphylogeneticanalysischeilanthoid ments . bution: astudyofJapanesepteridophytes . (Pteridaceae) . gins ofapomicticpolyploidsinthe Journal ofBotany roplast andmitochondrialgenomesincheilanthoidferns . AmericanFernJournal phytes: thetreatment anddefinitionofagamosporous species . Aliso Mexico—a molecularphylogeneticreassessment ofgenericlines . Cheilanthoideae) inthesouthwesternUnitedStatesandadjacent from tions ofcheilanthoidferns(Pteridaceae:Cheilanthoideae)inferred Botany ploid evolutionintheferngenus loids-first approach tospeciesdelimitationandinterpreting poly- 149–159. 76: ences from spore andstomatesizeintheferns . with ImageJ . Hickenia 7 131–144. 17: rbcL and Systematic Botany 5 223–234. 35: Journal oftheArizonaAcademyScience : 177–178. 2: American FernJournal nucleotidesequences . Polypodium Biophotonics International Problems ofcytologyand evolution inthePteridophyta American JournalofBotany Systematic Biology 9 716–722. 79: 5 524–545. 45: Marsilea A. limitanea We thanktheherbariumcuratorsandstaff at 9 65–77. 79: . ieaue Cited Literature American JournalofBotany 2 504–518. 32: . Systematic Botany 0 241–252. 40: The PteridophytesofMexico 2 576–581. 42: American FernJournal subsp. Astrolepis Cheilanthes yavapensis : 36–42. 7: 6 1636–1645. 96: Argyrochosma Ecography mexicana (trdca). (Pteridaceae). Cheilanthes, Notholaena, 2 16–25. 32: : 164–175. 2: American FernJournal 4 461–464. 54: 6 129–138. 26: 5 341–360. 85: 1,theaver- (Pteridaceae). . Nw York : New . Systematic complex American Pellaea .

Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Fri, 21 Oct 2011 20:35:25 Copyright (c) American Society for Plant Taxonomists. All rights reserved. Tyn R M ad . . ro 93. Gorpy soe, n evolutionary and spores, Geography, 1973. Tryon . F. A. and M. R. Tryon, Tyn R M ad . . ro 92. 1982. Tryon . F. A. and M. R. Tryon, Tyn A F ad . . rto 98. Cttxnmc tde o te fern the on studies Cytotaxonomic 1958. Britton. M. D. and F. A. Tryon, PAUP* 2002. L. D. Swofford, Tyn R M ad . . tle . 18 trdpya f eu Pr I. 13. II. Part Peru. of Pteridophyta 1989. Stolze. G. R. and M. R. Tryon, Tyn R M, . . ro , n K U Kae 90. Peiaee. p 404 Pp. Pteridaceae. 1990. Kramer . U. K. and Tryon , F. A. M., R. Tryon, Tyn R M. 15 rvso o te mrcn pce o of species American the of revision A 1956. M. R. Tryon, pterido- the in parthenogenesis and apospory Apogamy, 1951. N. W. Steil, Wnhm M D. 19 1993. D. M. Windham, Arizona. Mountain, Elden of phylogeny . ferns fern The to 1983. relation D. M. in Windham, spores of Structure 1974. H. W. Wagner, Shetez E, . cnie , . ue , . . ida , n K M Pryer . M. K. and Windham , D. M. Huiet, L. Schneider , H. E., Schuettpelz, Plastid 2006. Pryer . M. K. and Korall, P. lep- E., 400 from Schuettpelz, inferred phylogeny Fern 2007. Pryer . M. K. and E. Schuettpelz, 2007. Inc. Institute genus SAS the in studies Pryer . M. Spore K. and Gastony , J. 1983. G. Grusz , L. Britton. A. Windham , D. M. M. J., C. D. Rothfels, and M. K. Pryer, Wnhm M D. 18 1987. D. M. Windham, Zik, . 06. 2006. J. D. Zwickl, Flavonoid 1993. Favre-Bonvin . J. and Waton , H. Doerr , M. E., Wollenweber, - Pteridaceae of exudates Lipophilic 2000. chemosys- Schneider . H. their and and E. Wollenweber, ferns in flavonoids Exudate 1989. E. Wollenweber, chemotaxo- as ferns Mexican of flavonoids Exudate 1984. E. Wollenweber, 6 SSEAI OAY [Volume 36 SYSTEMATIC BOTANY cheilanthoid American some of distribution the on Notes 1967. R. T. Pray, 564 ingroup taxaare provided in Table 1 . for outgroup taxa;nomenclaturalauthorities andvoucherinformationof available. Nomenclatural authoritiesandvoucherinformation are given are notgivenfortaxarepresented byonly onespecimen.NA =datanot GenBank accession; Beck, J. Rothfels, C. Grusz , L. A. Schuettpelz, E. Huiet, L. D., M. Windham, chei- of studies Chromosome 2003. Yatskievych . G. and D. M. Windham, ( database.shtml ); average spore length( Lab FernDNA Databasenumber(see http://www.pryerlab.net/DNA_ μ m) (numberofspores persporangia); Appendix relations inthecheilanthoidferns . Pp. 45 – 153 in Nw ok: Aaei Press . Academic York : New classification offerns genus other methods),v. 4.0beta10 . Sunderland : Sinauer Associates . Pteridaceae –15.Dennstaedtiaceae . in ence totropical America Contributionsfrom theGrayHerbariumofHarvardUniversity phytes II . Gymnosperms. AnnalsoftheMissouriBotanicalGarden 897–906. eea. genera . ing overallrelationships andtheaffinities ofpreviously unsampled 2007 . A molecularphylogenyofthefernfamilyPteridaceae:assess- vide improved supportfordeeprelationships amongferns . tosporangiate speciesandthree plastidgenes. Inc. Institute 712–724. 57: patterns ofevolutionaryconvergence inxeric-adaptedferns . 2008 . Towards amonophyletic Gymnocarpium vl 2, 2, vol. Fern Journal American FernJournal nivea aglycones andadihydrostilbene from thefrond exudateof 751–777. 28: chemistry andchemotaxonomy . tematic implication . nomic markers . en ferns . dtra Cmite. Nw ok: Ofr Uiest Press . University Oxford York : New Committee. Editorial . asivc , n K M Pyr . 20 sn patd n nuclear and plastid Using 2009. complexes incheilanthoidferns . Pryer . M. DNA K. sequencestoredraw genericboundariesanddemystifyspecies and Yatskievych , G. United StatesandMexico . lanthoid ferns(Pteridaceae:Cheilanthoideae)from thewestern likelihood criterion logenetic analysisoflarge biological sequencedatasetsunderthemaximum The familiesandgeneraofvascularplants . Phytochemistry American FernJournal Pellaea Pteridophytes andGymnosperms 1 . Sample information. Taxon specimen number:Pryer Molecular PhylogeneticsandEvolution Botanical Review 3 85–93. 73: . GARLI, vers.0.951.Geneticalgorithmapproaches forthephy- d. K U Kae ad . . re eln: Springer . Berlin: Green . S. P. and Kramer U. K. eds. Evolution . Canadian JournalofBotany Revista LatinoamericanadeQuímica trnG-trnR . Ph.D.dissertation. Austin : The University ofTexas . Argyrochosma Argyrochosma, . d. A C Jry J A Cab , n B A Thomas. A. B. and Crabbe, A. J. Jermy , C. A. eds. . 3 611 –612. 33: Biochemical SystematicsandEcology 7 37–41. 77: JMP user’s guide . Nw ok: Springer . York : New . 2 137–145. 12:

Phylogenetic analysisusingparsimony(*and 7 90–104. 17: : GenBankaccession.Specimen numbers American JournalofBotany 7 52–58. 57: Ferns andalliedplantswithspecialrefer- P. 11–15 i in 171–175 Pp. . anewgenusofcheilanthoidferns American FernJournal Notholaena Biochemical SystematicsandEcology Fieldiana μ atpA 1 332–353. 61: m) ±onestandard deviation , ed. Flora ofNorth America . Cary, NorthCarolina : SAS 1 377–388. 61: : GenBankaccession; , vl 1, 1, vol. , (Pteridaceae):resolving 4 1172 –1185 . 44: : 1–128. : Taxon Flora ofNorthAmerica 5 3–11 . 15: The phylogenyand 6 1037–1050. 56: Pteridophytes and 0 1788–1800. 90: atpA 9 128–132. 99: 7 141–144. 17: 179: 1 – 106 . 1–106. 179: Notholaena datapro- Notholaena Notholaena American Taxon Taxon rbcL 55:

. , . :

U674 E280; EU26871. EU268808; EU268764; HQ846481. eri HQ846497. Argyrochosma pallens tenera 1.79 (64);HQ846395;HQ846444;HQ846483. Argyrochosma nivea tenera var. 76.00 ±3.67(32);HQ846379;HQ846428;HQ846479. ± 4.25(32);NA;NA. 4.61 (32);NA;NA. HQ846449; HQ846495. Argyrochosma nivea nivea 02-35 Paragymnopterismarantae Yatskievych 04-90 Paragymnopterisdelavayi ± 2.49(32);HQ846388;HQ846437;Q846489. HQ846432; HQ846480. ± 3.08(32);HQ846376;HQ846425;HQ846478. HQ846460. tanea 67.15 ±2.66(32);HQ846368;HQ846417;HQ846466. Argyrochosma limitanea itanea HQ846407; HQ846456;HQ846461. EU268771; HQ846472. ebeliana 74.95 ±4.35(32);HQ846389;HQ846438; HQ846485. HQ846378; HQ846427;HQ846482. HQ846451; HQ846503. HQ846410; HQ846458;HQ846463. HQ846435; HQ846488. Argyrochosma nivea var. 4 3.53 (32);HQ846399;HQ846448;HQ846500. 38.3 ±1.87(64);NA;NA. Argyrochosma limitanea itanea HQ846381; HQ846430;HQ846487. HQ846442; HQ846492. Argyrochosma nivea flava 2.75 (64);HQ846394;HQ846443;HQ846506. HQ846423; HQ846476. HQ846498. chosma microphylla DB4974; 46.83±1.44(64);HQ846375;HQ846424;HQ846475. 3.65 (32);HQ846380;HQ846429;HQ846474. DB6232; 40.85±1.25(64);NA;NA. 2.66 (64);HQ846387;HQ846436;HQ846486. HQ846403; HQ846452;HQ846502. HQ846507. HQ846471. Argyrochosma formosa Argyrochosma peninsularis insularis 43.01 ±2.50(64);HQ846391;HQ846440;HQ846490. NA; HQ846464. Argyrochosma fendleri Argyrochosma fendleri Argyrochosma fendleri fendleri 41.15 ±2.06(64);HQ846371;HQ846420;HQ846469. HQ846372; HQ846421;HQ846468. HQ846459; NA. Argyrochosma limitanea limitanea DB7201; 52.07±3.24(64);NA;NA. 49.61 ±1.94(64);HQ846405;HQ846454;NA. (64); HQ846365;EU268772;HQ846473. HQ846414; HQ846496. : DB6241; NA;HQ846401;HQ846450;HQ846504. D.C.Eaton Argyrochosma chilensis flava tenera (MO)):DB3736;NA;EU268763; EF452161;EU268711. 1 2 subsp. 6 4 5 3 : DB5856;54.72±2.30(32);HQ846384;HQ846433;HQ846477. 1 : DB6236;67.48±2.97(32);HQ846396;HQ846445;HQ846493. : DB6237;58.08 ±1.99(64);HQ846397;HQ846446;HQ846494. : DB6226;66.67 ±5.61(32);HQ846392;HQ846441;HQ846491. 2 : DB6245;58.72±3.70(32);HQ846404;HQ846453;HQ846501. : DB6329;62.31±2.00(32);HQ846406;HQ846455;HQ846462. 2 5 : DB3776;48.31±2.28(64);HQ846363; HQ846413;FN565504. 1 : DB6154;69.25±2.78(32);HQ846390;HQ846439;HQ846484. : DB6331;41.77±2.10(64);HQ846408;HQ846457;HQ846465. 2 : DB6149; 60.43±3.53(32);HQ846385;HQ846434;HQ846499.

Argyrochosma palmeri Argyrochosma incana Argyrochosma incana Argyrochosma pallens Argyrochosma limitanea : DB3179;58.50±1.24(32);EU268722;EF452139;EU268668. Argyrochosma microphylla : DB5855;71.29±2.26(32)&51.592.53(64);HQ846383; mexicana (U.S. A., Utah, (MO)):DB4565;NA;HQ846373;HQ846422; HQ846467. Argyrochosma palmeri Argyrochosma dealbata 1 var. var. var. var. 1 : DB4557;50.11 ±2.34(64);HQ846367;HQ846416; Argyrochosma incana 3 2 2 Argyrochosma pilifera Argyrochosma nivea Argyrochosma nivea : DB4560;66.49±2.84(32);HQ846370;HQ846419; Argyrochosma nivea 4 Argyrochosma nivea : DB4556;40.77±2.11 (64);HQ846366;HQ846415; Argyrochosma microphylla Argyrochosma jonesii : DB4559;60.56±1.77(32);HQ846369;HQ846418; : DB6238;NA;HQ846398;HQ846447;HQ846505. : DB5854;NA;HQ846382;HQ846431;HQ846470. Argyrochosma nivea subsp. subsp. subsp. : DB7202;49.45±2.91(64);NA;NA. nivea flava flava tenera (L.)K.H.Shing (Baker)K.H.Shing : DB6385;51.46±1.81(64);HQ846411; Argyrochosma nivea 3 Argyrochosma jonesii : DB6242;41.21±3.06(64);HQ846402; 6 2 3 5 mexicana 2 1 : DB6150;72.64±6.40(32);HQ846386; : DB6227;60.57±3.00(32);HQ846393; limitanea limitanea Argyrochosma incana : DB6240;66.02±3.52(32);HQ846400; Windham 3447 2 1 Argyrochosma peninsularis : DB6231;66.12±1.99(32);&49.13 Argyrochosma stuebeliana : DB3198;40.46±3.78(64);HQ846362; : DB3194;NA;HQ846361;HQ846412; Argyrochosma limitanea Argyrochosma limitanea : DB5054;NA;HQ846377;HQ846426; : DB6383;39.62±3.34(64);HQ846409; subsp. Argyrochosma delicatula Argyrochosma jonesii Argyrochosma incana Argyrochosma limitanea 2 2 1 : DB4562;49.76±2.23(64); Argyrochosma nivea 4 2 : DB6384;41.53±1.89(64); (CHINA, Yunnan, var. var. : DB4583;NA;HQ846374; var. : DB4558;82.69±2.78(16)& var. mexicana 3 vr var. : DB6330;60.30±1.62(32); : DB5411; 62.26±4.47(32); 1 Argyrochosma lumholtzii : DB6243;39.25±2.43(64); 2 Argyrochosma nivea Argyrochosma nivea : DB5055;42.25 ± 1.79(64); Argyrochosma nivea Argyrochosma incana Argyrochosma nivea Argyrochosma jonesii (DUKE)):DB3930;NA; nivea flava : DB3844;49.09±3.04 var. tenera nivea nivea 1 Argyrochosma nivea 3 Argyrochosma nivea : DB3839;HQ846364; (HN, Yunnan, (CHINA, Argyrochosma limi- Argyrochosma pen- Argyrochosma stu- 3 3 : DB6228;48.81± 4 4 tenera 1 3 : DB5390;63.92± 5 : DB6239;60.43± : DB7026;76.50± : DB6151;46.93± : DB4975;61.44 : B12 57.58 DB6152; : : B07 63.02 DB7027; : Argyrochosma Pellaeabrew- subsp. subsp. 1 3 1 6 1 Yatskievych : DB4561; : : DB5335; : var. : DB6328; : : DB6153; : : DB7203; : : DB6225; : Argyro- subsp. flava var. var. var. var. lim- lim- 5 4 : : :