Oncogene (1999) 18, 1733 ± 1744 ã 1999 Stockton Press All rights reserved 0950 ± 9232/99 $12.00 http://www.stockton-press.co.uk/onc Attenuated expression of the serum responsive T1 gene in ras transformed ®broblasts due to the inhibition of c-fos gene activity

Reto Kessler1,2, Andrea Zacharova-Albinger1, Niels B. Laursen1,3, Markus Kalousek1,4 and Roman Klemenz*,1

1Division of Cancer Research, Department of Pathology, University Hospital, Schmelzbergstrasse 12, CH-8091 ZuÈrich, Switzerland

The T1 gene encodes a protein, which shares homology the G1 phase. This G0/G1 transition is characterized by with the IL-1 receptors. In ®broblasts, T1 is induced by the transient and precisely timed activation of a growth factors and in response to the onset of oncogene number of genes. The ®rst genes to be induced are expression. The c-fos gene is transiently activated in the immediate early genes. They are induced by these situations and was shown to be the major mediator preformed transcription factors which are activated in of T1 gene induction. In contrast, the sustained response to the proliferation promoting signal. Conse- expression of a ras oncogene in NIH3T3 cells resulted quently, the transcriptional stimulation of immediate in the downregulation of basal T1 gene activity and the early genes is independent of protein synthesis. Several attenuation of T1 gene induction in response to mitogenic of these immediate early genes encode transcription signals. Likewise, the immediate early genes encoding c- factors which become engaged in the activation of Fos, FosB, and Fra-2 are repressed in these cells. T1 delayed early genes (Herschman, 1991; Lau and gene repression could be overcome by the forced Nathans, 1991). The proteins of the Fos and Jun expression of c-fos in ras transformed ®broblasts. Thus, families are among the best studied immediate early the lack of c-fos gene expression is the likely cause for transcription factors and of relevance to this study. ras mediated T1 gene repression. Fra-1, in contrast to The four members of the Fos family (c-Fos, FosB, Fra- the other three members of the Fos family, is 1, and Fra-2) can heterodimerize with the three permanently synthesized in high amounts in ras members of the Jun family (c-Jun, JunB, and JunD) transformed NIH3T3 ®broblasts. We show that AP-1, to form a large array of di€erent AP-1 complexes which is abundant in these cells throughout the whole cell (Angel and Karin, 1991; Angel and Herrlich, 1994). cycle, consists predominantly of Fra-1/c-Jun and Fra1/ The stimulation of quiescent cells with growth JunD heterodimers. We provide evidence that Fra1/c- factors triggers the signal transduction cascade which Jun heterodimers are responsible for the repression of c- includes the Ras and Raf oncoproteins, MEK and the fos gene induction following serum stimulation. The two MAP kinases ERK-1 and ERK-2. Upon activa- introduction of a dominant negative version of c-Jun into tion, the latter translocate into the nucleus where they ras transformed ®broblasts was able to rescue c-fos gene catalyze the phosphorylation of several proteins induction in response to serum stimulation, further including the ternary complex factor Elk-1. This demonstrating that AP-1 is indeed involved in c-fos gene transcription factor binds in conjunction with serum repression. We conclude that oncogenic ras mediates the response factor (SRF) to the serum response element in activation of the fra-1 gene which results in elevated AP- the promoters of some immediate early genes such as 1 activity throughout the cell cycle. Fra-1 containing AP- the c-fos gene and thereby triggers their transcriptional 1 complexes repress the c-fos and possibly other activation (Karin, 1994; Marshall, 1995; Seger and immediate early genes thereby preventing the induction Krebs, 1995; Treisman, 1992). Oncogenic Ras is altered of certain delayed early genes such as the T1 gene in in such a way that it no longer needs an input signal in response to mitogenic stimulation. order to stimulate the ERK signal transduction cascade. Consequently, the expression of oncogenic Keywords: AP-1; fos; fra; T1; ras; transformation; Ras should result in the permanent activation of the c- serum induction fos gene unless inhibitory signals come into play which turns the signal o€. Elevated AP-1 activity has been found in ras transformed cells and taken as evidence for the constitutive activation of the c-fos gene. Introduction Likewise, the experimental induction of ras oncogene expression was shown to lead to c-fos gene activation When quiescent cells are stimulated to enter the cell (Bar and Feramisco, 1986; Feramisco et al., 1985; cycle they undergo a transition state before they enter Gutman et al., 1991; Schonthal et al., 1988; Stacey et al., 1987). In contrast, there are reports which describe *Correspondence: R Klemenz the silencing of the c-fos and other immediate early The ®rst two authors contributed equally to this work genes in oncogenically transformed cells (Chen and Current addresses: 2Neurosurgery, Laboratory of Tumor Biology and Faller, 1996; Suzuki et al., 1989; Yu et al., 1993; Zullo Genetics, BH 19-103, CHUV, CH-1011 Lausanne, Switzerland; 3Laboratory of Gene Expression, Department of Molecular and and Faller, 1988). Structural Biology, University of Aarhus, Gustav Wieds Vej 10, Previously, in a search for genes that are activated in DK-8000 Aarhus C, Denmark; 4Laves-Arzneimittel-GmbH, response to the induced expression of a Ha-ras Zweigniederlassung, SchoÈ tz, Lavesstrasse, CH-6247 SchoÈ tz, oncogene, we have isolated among others, cDNA Switzerland clones derived from the T1 gene (Klemenz et al., Received 24 April 1998; revised 5 October 1998; accepted 9 October 1998 1989; Werenskiold et al., 1989). T1 is a delayed early Attenuation of T1 gene expression in ras transformed cells R Kessler et al 1734 gene which is transiently activated in response to the control of the glucocorticoid hormone inducible stimulation of quiescent cells with serum, lysopho- promoter of the mouse mammary tumor virus sphatidic acid (LPA), the growth factors PDGF, (MMTV) (Jaggi et al., 1986). Peak levels of T1 aFGF, and bFGF, by TPA, and the proin¯ammatory mRNA are reached around 8 h following hormone cytokines TNFa and IL-1 (Kumar et al., 1997; Laursen addition. However, prolonged hormone treatment et al., 1998; Werenskiold et al., 1989; and unpublished resulted in the downregulation of T1 gene expression results). Its expression could also be induced through (Klemenz et al., 1989). Earlier, it has been observed by the conditional activation of a c-Fos-estrogen receptor several investigators that ligand activated glucocorti- hybrid protein (Kalousek et al., 1994). An enhancer coid receptor can interact with AP-1, and that this has been identi®ed 3.6 kb upstream of the transcription interaction mutually attenuates the transcriptional initiation site, which contains three essential E-boxes transactivation potential of both transcription factors and a TRE, the binding sites of helix-loop-helix (Diamond et al., 1990; Kerppola et al., 1993). Such a transcription factors and AP-1, respectively (Kessler mechanism could be the cause for the transient nature et al., 1997; TruÈ b et al., 1994). of T1 mRNA accumulation since AP-1 is involved in In ®broblasts, the T1 gene is transcribed into a ras mediated T1 gene induction. Alternatively, the 2.7 kb mRNA which encodes a secreted protein with downregulation of the T1 gene could be due to signi®cant similarity to the extracellular domain of the prolonged Ha-ras oncogene expression. To distinguish interleukin-1 receptors (Kalousek et al., 1994; Tomi- between these two possibilities we have produced the naga, 1989). In proliferating ®broblasts there is very NIH3T3 derived cell line TAR, containing a Ha-ras little T1 mRNA and its level is even more decreased (EJ) oncogene construct which is regulated by a b- upon entry of the cells into the quiescent state. Reentry estradiol-activatable transactivator (Scheier et al., of these cells into the cell cycle is followed by a manuscript in preparation). Since NIH3T3 cells are dramatic transient accumulation of T1 mRNA which devoid of estrogen receptors, b-estradiol treatment does reaches its maximal level after 6 h and rapidly not in¯uence endogenous gene expression or cellular disappears thereafter (Kalousek et al., 1994). In mast metabolism. b-estradiol stimulation of TAR cells cells the T1 gene is transcribed from a di€erent resulted in the rapid synthesis of Ha-ras mRNA promoter which lies 10.5 kb proximal to the one used (Figure 1a) and their morphological transformation in ®broblasts (GaÈ chter et al., 1996). Mast cell speci®c within 2 days. Ha-ras oncogene expression initially T1 gene expression is regulated by GATA transcription resulted in the accumulation of T1 mRNA. However, factors but not AP-1. A 5 kb T1 mRNA accumulates upon prolonged b-estradiol treatment T1 mRNA levels which encodes a protein resembling the type I IL-1 receptor. Its ectodomain is identical with the T1 protein produced in ®broblasts (Yanagisawa et al., 1992). Using a recently generated T1 speci®c mono- clonal antibody (Moritz et al., 1998b) we could detect the membrane anchored form of T1 exclusively in mast cells (Moritz et al., 1998a). While we originally found strong T1 gene induction following the conditional expression of the Ha-ras (EJ) and v-mos oncogenes (Klemenz et al., 1989) we later observed and report here that under conditions of sustained oncogene expression the T1 gene is no longer transcribed and even rendered unresponsive to growth factor and serum mediated stimulation. We report here that the sustained Ha-ras oncogene expression in NIH3T3 cells leads to the accumulation of Fra-1 and postulate that the high level of AP-1, consisting mainly of Fra-1/c-Jun heterodimers in ras transformed ®broblasts results in the silencing of the c-fos gene. The lack of c-fos gene expression in ras transformed cells is the likely cause for attenuated T1 gene expression. We conclude that the downregulation of c-fos in ras transformed NIH3T3 cells results in the loss of basal T1 gene transcription and unresponsive- ness of the T1 gene to mitogenic stimulation. Figure 1 T1 gene regulation by induced and constitutive expression of Ha-ras.(a) TAR cells are stable transfected NIH3T3 cells harboring a b-estradiol-inducible Ha-ras onco- gene. These cells were treated with b-estradiol for the indicated Results time periods (h). RNA was collected and 5 mg of total RNA was subjected to Northern blot analysis. The Northern blot was Induced but not sustained expression of the Ha-ras hybridized in succession with T1 and ras speci®c DNA probes oncogene results in T1 gene expression without stripping the hybridized probe in between. (b) Ha-ras transformed NFR-2 and parental NIH3T3 cells were either Previously, we have demonstrated that the induction of growth arrested in 0.5% FCS for 24 h or left untreated (g, exponentially growing). Starved cells were serum stimulated with Ha-ras oncogene expression resulted in the activation DMEM containing 10% FCS for the indicated time periods (h). of the T1 gene. In these experiments we have used a The same Northern blots were hybridized with a T1 probe cell line which contains a Ha-ras oncogene under the followed by a proliferin probe Attenuation of T1 gene expression in ras transformed cells R Kessler et al 1735 dropped despite sustained expression of the Ha-ras and transiently increased after serum stimulation, it oncogene (Figure 1a). Thus, the transient nature of T1 was permanently high in NFR-2 cells irrespective of gene expression in response to ras oncogene induction the proliferative state of these cells (Figure 3a, b). To is a consequence of biochemical changes triggered by directly demonstrate that the observed DNA-protein the Ras oncoprotein and not an artifact of the complexes consisted of Fos and Jun proteins, we conditional expression system. performed antibody interference experiments. The The T1 gene is also induced in response to the addition of polyclonal antisera speci®cally recognizing stimulation of quiescent cells with serum (Kalousek et either Fos or Jun family member proteins prevented al., 1994). However, in the NIH3T3 derived cell line the formation of the DNA-protein complexes with NFR-2, which constitutively expresses the Ha-ras nuclear extracts from both cell lines (Figure 3c). This oncogene, serum mediated T1 gene expression is abrogated. In contrast, proliferin, which is also an AP-1 responsive gene, is permanently expressed in NFR-2 cells and superinduced in response to mitogenic stimulation with serum (Figure 1b). The same phenomenon was observed with TAR cells which were treated for several days with b-estradiol (data not shown). Many transformed cell lines secrete growth factors which act in an autocrine fashion to support proliferation even in the absence of exogenously supplied mitogens. Consequently these cells cannot be rendered quiescent by serum deprivation, and serum addition does not induce a G0/G1 transition. We investigated whether the inability to induce cell cycle arrest upon serum starvation was the cause for the lack of T1 gene expression in NFR-2 cells. The serum concentration in the medium was reduced from 10 to 0.5% and cell numbers were determined during the following 4 days. We observed that serum starvation induced complete cell cycle arrest in NIH3T3 and NFR-2 cells alike and that the subsequent serum stimulation resulted in the same rapid onset of proliferation in both cell lines (Figure 2a). Moreover, we demonstrated that the extent of cell cycle entry, as measured by the number of cells in the S-phase, was proportional to the serum concentration over the range of 0.5 ± 6% and that this concentration dependency is indistinguishable for NIH3T3 and NFR-2 cells (Figure 2b). Thus the lack of T1 gene expression in NFR-2 cells cannot be explained by the inability of these cells to arrest proliferation upon serum starvation.

NFR-2 cells constitutively express elevated AP-1 binding activity We have previously shown that the T1 gene contains an essential AP-1 binding site (TRE) within its enhancer sequence (Kessler et al., 1997; TruÈ b et al., 1994) and that experimentally induced expression of the c-fos or the fosB genes is sucient for T1 gene activation (Kalousek et al., 1994). Constitutively elevated AP-1 activity and enhanced expression of several AP-1 responsive genes such as those encoding Figure 2 Equal serum dependence for proliferation of NIH3T3 stromelysin, interstitial collagenase, proliferin, and and NFR2 cells. (a) Growth curves for NIH3T3 and NFR-2 cells. One day after seeding the cells in 10% FCS, the serum VEGF is a widespread phenomenon among several concentration was reduced to 0.5% (solid arrows, solid squares transformed cell lines and tumors. Based on these and circles) or left at 10% (open squares). After 24 h, the FCS observations one would expect elevated AP-1 activity concentration of some cultures was increased to 10% (open in the ras transformed NFR-2 cells and consequently arrows, solid squares) whereas other cultures were further incubated in 0.5% FCS (circles). The values are the average of increased rather than attenuated T1 gene expression. two experiments and the error bars give standard deviations. (b) We performed electrophoretic mobility shift assays NIH3T3 (circles) and NFR-2 cells (squares) were growth arrested (EMSA) with nuclear extracts derived from serum by incubation in medium containing 0.5% FCS for 2 days. deprived and from serum stimulated NIH3T3 and Di€erent concentrations of serum as indicated on the abscissa NFR-2 cells and an oligonucleotide with the TRE were added and the fraction of cells passing through the S-phase was determined by measuring the incorporation of BrdU. The sequence of the T1 gene enhancer. While the AP-1 highest value was taken as 100% and corresponds to 60 ± 80% of binding activity was low in non cycling NIH3T3 cells BrdU positive cells Attenuation of T1 gene expression in ras transformed cells R Kessler et al 1736 result con®rms the involvement of Fos and Jun is downregulated in ras transformed cells despite proteins in the DNA-protein complex formation. increased AP-1 activity. To evaluate this possibility we analysed the expression pattern of all jun and fos genes in serum starved and serum stimulated NIH3T3 and Altered expression of the fos and jun family members in NFR-2 cells (Figure 4a). The most striking observation Ha-ras transformed cells is the complete lack of c-fos mRNA in starved and AP-1 complexes are composed of proteins belonging to serum stimulated NFR-2 cells (Figure 4a). The the Jun and Fos family which consist of three and four expression of three other genes, fosB, fra-2, and junB members, respectively. Thus, many di€erent AP-1 was strongly reduced in NFR-2 cells. In contrast, fra-1 complexes can form depending on the expression of mRNA was present in these cells at all times while it the various fos and jun genes. The presence of di€erent accumulated only transiently in NIH3T3 ®broblasts AP-1 complexes in serum stimulated NIH3T3 cells and during the entry of serum starved cells into the cell cycle in ras transformed NFR-2 cells could explain our (Figure 4a and b). To demonstrate that the accumula- paradox observation that the AP-1 responsive T1 gene tion of fra-1 mRNA in NFR-2 cells under normal growth conditions is indeed a consequence of ras oncogene expression we performed experiments with two cell lines harboring an inducible ras oncogene (Figure 4c). Induction of the ras oncogene by treatment of TAR cells with b-estradiol resulted in the slow accumulation of fra-1 mRNA which remained abun- dant as long as b-estradiol treatment was continued. The HLE cell line is a derivative of NIH3T3 cells carrying the Ha-ras (EJ) oncogene under the control of the glucocorticoid inducible promoter of mouse mammary tumor virus (MMTV) (Jaggi et al., 1986). Treatment of these cells with the synthetic glucocorti- coid hormone dexamethasone (Dex) resulted in the accumulation of fra-1 mRNA. Hormone withdrawal is followed by the disappearance of fra-1 mRNA. The treatment of the parental NIH3T3 cells with b-estradiol and Dex did not stimulate fra-1 mRNA accumulation (data not shown). The mRNA of the two jun family members c-jun and junD were expressed at similar levels in NIH3T3 and NFR-2 cells. Based on these results we expected to ®nd in NFR-2 cells AP-1 complexes that are mainly composed of Fra- 1 and c-Jun or JunD. EMSA experiments were performed with nuclear extracts from serum stimu- lated NIH3T3 and NFR-2 cells and the TRE element from the T1 enhancer. An antibody against c-Fos partly interfered with DNA binding of AP-1 in protein extracts derived from NIH3T3 but not from NFR-2 cells. In contrast, anti-Fra-1 antibodies substantially reduced AP-1-TRE complex formation in extracts from NIH3T3 and NFR-2 cells (Figure 4d). These results are consistent with our gene expression data (Figure 4A). Fra-1 predominates in the AP-1 complexes derived from NFR-2 cells while both, c-Fos and Fra-1 are found in AP-1 complexes in serum stimulated NIH3T3 cells. Antibodies directed against c-Jun and JunD inter- fered with DNA binding of NFR-2 derived AP-1 Figure 3 AP-1 DNA binding activity in NIH3T3 and NFR2 complexes. Thus, both proteins appear to participate in cells. (a) Nuclear extracts were prepared from NIH3T3 and NFR- complex formation with the TRE in the T1 gene 2 cells maintained in medium containing 0.5% FCS for 24 h and subsequently stimulated with 10% FCS for the indicated time enhancer. periods (h) or left untreated. 4 mg of nuclear protein extracts were These results indicate that the predominant form of incubated with 10 fmol of 32P-labeled T1-TRE oligonucleotide. AP-1 in NFR-2 cells which can bind in vitro to the T1 (b) The experiment shown in Figure 3a was performed three times TRE consist of Fra-1 and c-Jun/JunD. and the results quanti®ed by densitometric scanning of the autoradiograms, standard deviations are given by the error bars. The highest value (3 h serum stimulation) was taken as 100%. (c) A T1 promoter construct does not respond to enhanced Proteins in nuclear extracts from NIH3T3 and NFR-2 cells, which were serum stimulated for 3 h, were allowed to form AP-1 activity in NFR-2 cells complexes with the labeled T1-TRE for 10 min. Antibodies that Elevated AP-1 activity in ras transformed cells is recognize all family members of Fos and Jun proteins were added as indicated. After incubation for 30 min the samples were thought to be the cause for the enhanced expression of subjected to gel electrophoresis several AP-1 responsive genes. We assume that the AP- Attenuation of T1 gene expression in ras transformed cells R Kessler et al 1737

Figure 4 Gene expression of fos and jun family members in NIH3T3 and NFR-2 cells after serum stimulation. (a) Serum starved NIH3T3 and NFR-2 cells were stimulated with 10% FCS for 30 min, 1, 2 or 4 h. RNA was collected and subjected to Northern blot analysis. Seven identical Northern blots were prepared and hybridized with the probes indicated. Representative ethidium bromide stained gels are depicted below the autoradiograms. (b) Serum starved NIH3T3 and NFR-2 cells were stimulated with 10% FCS for the indicated times in hours. 5 mg of total RNA were subjected to Northern blot analysis using a fra-1 speci®c DNA probe. g, growing. (c) TAR cells, carrying the b-estradiol inducible Ha-ras oncogene were treated with b-estradiol for 0, 2, 4, 6 h, 1 and 7 days. HLE cells which harbor an MMTV-LTR driven Ha-ras oncogene were left untreated or were treated with 1 mM dexamethasone (Dex) for 24 h. RNA was collected and analysed on a Northern blot for fra-1 mRNA accumulation. (d) EMSA experiments were performed with nuclear extracts derived from NFR-2 and NIH3T3 cells which were serum stimulated for 3 h. Following incubation of nuclear extracts with the T1-TRE probe for 10 min antibodies were added that recognize speci®c family members of Fos and Jun proteins as indicated. The samples were subjected to gel electrophoresis after a further incubation for 30 min. The degree of inhibition of AP-1 DNA binding activity was determined by phosphoimager scanning of the intensity of the residual complex after addition of indicated antibody to the binding reaction. The indicated values are the means of three experiments using independently prepared nuclear extracts and standard deviations are given by the error bars. The values obtained without the inclusion of an antibody were taken as 100% Attenuation of T1 gene expression in ras transformed cells R Kessler et al 1738 1 complex, which predominates in these cells, can Fos and the ligand binding domain of the estrogen activate some AP-1 responsive genes but not others, receptor. In the absence of b-estradiol the c-Fos- including T1. To test this hypothesis we introduced estrogen receptor hybrid protein (c-Fos hER) is CAT reporter gene constructs driven by two di€erent inactive but becomes active upon hormone binding. AP-1 responsive promoters into NIH3T3 and NFR-2 A NIH3T3 cell line, which constitutively express the c- cells. A reporter gene containing a minimal promoter Fos hER transgene (Schuermann et al., 1993), was and ®ve TREs from the interstitial collagenase gene transfected with the Ha-ras (EJ) oncogene and T1 gene was approximately 16-fold more active in NFR-2 than expression was analysed in ®ve transformed clones in NIH3T3 cells (Figure 5). This most likely re¯ects which express the Ha-ras oncogene as revealed by elevated AP-1 activity in NFR-2 cells and indicates Northern blot analysis (Figure 6b). There was no T1 that these TREs in the context of this reporter gene expression in response to serum stimulation in all construct are recognized by the AP-1 complexes in of them, consistent with the results obtained with NFR-2 cells. In contrast, a reporter gene under the NFR-2 cells (Figure 6a). However, treatment of these control of the T1 promoter, including the enhancer cell lines with b-estradiol led to the accumulation of element, is less actively expressed in NFR-2 cell than in similar amounts of T1 mRNA as in serum stimulated NIH3T3 cells despite strongly enhanced AP-1 activity NIH3T3 cells or in the parental NIH/c-Fos hER cells in the former cell line. We take this ®nding as an (Figure 6a). We conclude that the absence of T1 gene indication that the T1 gene is not activated by the Fra- expression in ras transformed ®broblasts is due to 1/c-Jun complexes, which predominate in NFR-2 cells. attenuated c-fos gene expression and not due to an inhibitory component which blocks the T1 gene and which accumulates in these cells. Ectopic expression of c-fos in ras transformed ®broblasts renders T1 serum inducible We have previously demonstrated that the T1 gene responds strongly to c-Fos. Here we have shown that the c-fos gene is not expressed in NFR-2 cells. We assume that the absence of c-Fos is the reason why there is no T1 gene expression in ras transformed cells. To test this hypothesis we generated cell lines which express the activated Ha-ras oncogene and synthesize an activatable c-Fos protein. This protein consists of c-

Figure 5 T1 promoter reporter gene expression in NIH3T3 and NFR-2 cells. NIH3T3 and NFR-2 cells were transiently transfected with promoter reporter gene constructs and pRSV- LacZ. SH4.9 contains 4.9 kb of the T1 promoter including the enhancer at the position 73.6 kb, the ®rst exon and intron as well as part of the second exon up to but excluding the ATG Figure 6 c-Fos can rescue T1 gene expression in ras transformed initiation codon. 56TRE contains an arti®cial promoter ®broblasts. (a) NIH/c-FoshER cells, Ha-ras transformed deriva- consisting of ®ve concatamerized copies of the collagenase gene tives thereof (clones 3, 6, 7. 10, 11), and NIH3T3 cells were serum TRE in front of the thymidin kinase minimal promoter in the starved for 24 h and thereafter stimulated with serum or treated plasmid pBLCAT2. Protein extracts were prepared 48 h after with b-estradiol for 6 h. RNA was prepared and subjected to transfection and CAT assays were performed with lysates Northern blot analysis using a T1 speci®c probe. Only the normalized for b-galactosidase activity. The values are the relevant region of the blots showing the 2.7 kb T1 transcript are average of three independent experiments and the standard shown. (b) Northern blot demonstrating Ha-ras oncogene deviations are given by the error bars expression in the transfected but not the parental cell line Attenuation of T1 gene expression in ras transformed cells R Kessler et al 1739 inhibitory e€ect on c-fos promoter activity. This Ectopic expression of AP-1 complexes consisting of experiment demonstrates that the AP-1 complexes, Fra-1 and c-Jun strongly suppressed c-fos promoter activity in NIH3T3 cells which are abundant in NFR-2 cells (c-Jun/Fra-1 and possibly c-Jun homodimers), have a strong potential to Having shown that blocked c-fos gene expression in ras suppress c-fos promoter activity. transformed ®broblasts is the cause for the absence of serum mediated T1 gene induction we asked why the c- Expression of dominant negative c-Jun releases c-fos fos gene is silent in these cells. It has been shown promoter suppression in ras transformed cells earlier that the c-fos gene is repressed by AP-1 (Lin et al., 1988; Mechta et al., 1997; Nose et al., 1989; To unambiguously demonstrate that the elevated AP-1 Okimoto et al., 1996; Suzuki et al., 1989; Zullo & activity in NFR-2 cells is the cause for c-fos gene Faller, 1988). Thus, the likely cause for c-fos gene repression, we introduced a dominant negative mutant repression in NFR-2 cells is the elevated AP-1 activity form of c-Jun (D9Jun) into NFR-2 cells and in these cells. Since the predominant form of AP-1 investigated its e€ect on c-fos promoter activity. consists of Fra-1 and c-Jun we were particularly D9Jun has been shown to act as an inhibitor of AP-1 interested in analysing whether forced overexpression activity (Lloyd et al., 1991). Expression of mutant c- of these genes leads to c-fos gene repression. A c-fos Jun in NFR-2 cells increases c-fos promoter activity in promoter CAT reporter construct (FosWtCAT) (Osei- a dose dependent manner, probably by heterodimeriz- Frimpong et al., 1994) was transiently transfected in ing with Fra-1 and thereby titrating out active AP-1 the presence or absence of expression plasmids (Figure 8a). This result indicates that AP-1 activity is encoding fos and jun members into NIH3T3 cells. As indeed a repressor of the c-fos promoter in NFR-2 expected, expression of Fra-1 and c-Jun led to cells. signi®cant c-fos promoter repression (Figure 7). If To investigate whether our ®ndings in NFR-2 cells combined, these two proteins caused very strong also apply to other systems, we used Ki-ras suppression. Transfection of an expression plasmid transformed NIH3T3 cells (DT) and a morphologic encoding JunD activated the c-fos promoter. However, revertant (DTR1) thereof, which emerged following the in combination with Fra-1, JunD had a slightly stable introduction of D9Jun (Lloyd et al., 1991). DT repressive e€ect. Expression of c-fos, fosB, fra-2 or cells behaved like NFR-2 cells in that they did not junB, which are either poorly or not expressed in NFR- induce the c-fos gene in response to serum stimulation 2 cells (Figure 4), had no or a less pronounced (Figure 8b). In contrast, the revertant cell line DTR1 exhibited restored c-fos inducibility. We conclude from these results, that AP-1 activity is involved in c-fos gene repression in ras transformed cells.

Discussion

This study was performed to investigate the reason for the lack of T1 gene induction in ras transformed ®broblasts. T1 was originally identi®ed as a gene which is strongly induced during the onset of Ha-ras and v- mos oncogene expression. Promoter analyses have revealed the presence of an essential TRE in the enhancer element and the ectopic expression of c-fos and fosB was sucient to induce T1 gene expression eciently (Kalousek et al., 1994). Therefore, it came as a surprise to ®nd that the T1 gene was inactive in ras transformed cells that contain highly elevated levels of AP-1 activity. An explanation was o€ered by the ®nding that the composition of the AP-1 complexes di€ered in normal and in ras transformed ®broblasts. Expression of c-fos and fosB was strongly reduced in mitogen stimulated ras transformed cells while fra-1 expression was high and constitutive. A similar ®nding was recently reported by Mechta et al., (1997). We Figure 7 Response of a c-fos promoter reporter construct to the could show that the forced expression of c-fos was expression of fos and jun family members in NIH3T3 cells. sucient to reactivate the T1 gene in ras transformed NIH3T3 cells were transiently transfected with the c-fos promoter cells, indicating that attenuated c-fos expression rather CAT reporter construct fosWtCAT and pRSV-LacZ in the absence or presence of expression plasmids encoding di€erent than the accumulation of an inhibitor, which blocks fos and jun family members as indicated below the bars. Protein the T1 gene, is the cause for T1 gene repression. These extracts were prepared 24 h after transfection. CAT activity was results indicate that only a subset of AP-1 complexes determined with lysates normalized for b-galactosidase activity. can induce the T1 gene. We assume that AP-1, The values are the average of three independent experiments and the error bars give the standard deviations. The value obtained in consisting of c-Fos and c-Jun that predominates at the absence of cotransfected expression constructs was taken as early times of mitogenic stimulation of quiescent 100% ®broblasts and shortly after the onset of oncogene Attenuation of T1 gene expression in ras transformed cells R Kessler et al 1740 in these cells. Proliferin is an angiogenic factor and might be involved in the neovascularization of tumors. Other AP-1 responsive genes encoding proteins involved in tumorigenesis such as the proteases stromelysin and interstitial collagenase as well the angiogenic growth factor VEGF are constitutively expressed at high levels in many transformed cell lines and in tumors where their activation might be controlled by elevated levels of Fra-1 containing AP- 1 (Battista et al., 1998; Vallone et al., 1997). How the fra-1 gene is activated in ras transformed cells remains to be investigated. It was reported that c- Fos stimulates fra-1 gene expression (Bergers et al., 1995; Braselmann et al., 1992, 1993; Brusselbach et al., 1995; Miao and Curran, 1994; Schuermann et al., 1993). While this might be the mechanism operating in mitogenically stimulated normal ®broblasts it is unlikely to account for the permanent fra-1 gene activity in ras transformed cells since these cells do not express c-fos. Ras communicates with several signal transduction cascades. In addition to the stimulation of the Raf-MEK-ERK pathway it also causes the permanent activation of the JNK pathway resulting in constitutively phosphorylated, active c-Jun (Binetruy et al., 1991; Hibi et al., 1993; Smeal et al., 1991). Since fra-1 gene expression was reported to be stimulated by AP-1 (Bergers et al., 1995), the AP-1 complexes, which predominate in ras transformed cells, possibly maintain fra-1 gene expression. In neoplastically transformed thyroid cells fra-1 has been described as one of the target genes of the high mobility group I C (HMGI-C) protein which is upregulated in these cells and which is essential for the transformed phenotype (Vallone et al., 1997). Recently evidence has been provided that Fra-1 is involved in the establishment of the transformed Figure 8 Response of the c-fos promoter to the expression of phenotype. Vallone and coworkers (1997) have dominant negative c-Jun in ras transformed cells. (a) NFR-2 cells observed that the fra-1 gene is induced in neoplasti- were transiently transfected with fosWtCAT and pRSV-LacZ in cally transformed rat thyroid cells and that interference the absence or presence of increasing amounts of an expression with its expression leads to a partial reversion of the plasmid pSLD9Jun encoding a dominant negative c-Jun protein. transformed phenotype. However, overexpression of Protein extracts were prepared 24 h after transfection. CAT assays were performed with lysates normalized for b-galactosidase fra-1 alone was not sucient to trigger cell transforma- activity. The values are the average of three independent tion. Likewise, Mechta et al., (1997) have found that experiments and the standard deviations are given by the error ectopic expression of fra-1 in NIH3T3 cells led to bars. (b) The Ki-ras transformed cell line DT and the revertant slightly enhanced cell growth in soft agar whereas the cell line DTR1 were serum starved (0) and stimulated with 10% FCS for 30 min. RNA was collected and subjected to Northern forced coexpression of fra-1 and c-jun augmented soft blot analysis using a c-fos speci®c probe. The ethidium bromide agar growth almost to the same extent as ras oncogene stained gel is depicted below the autoradiogram mediated transformation. Strongly increased anchorage independent growth of fra-1 overexpressing rat ®broblasts and tumor formation of such cells in expression triggers T1 gene activation. In contrast, Fra- athymic mice was shown by Bergers et al. (1995). 1 containing AP-1 complexes, which predominate in These observations suggest that Fra-1 contributes to ras transformed cells, cannot activate the T1 gene. The neoplastic transformation. Consistent with this view is repression of T1 gene activity, presumably as a the ®nding that fra-1 is upregulated in rat renal consequence of fra-1 overexpression, is reminiscent of carcinoma cells (Hino et al., 1995; Urakami et al., the downregulation of human papillomavirus type 16 1997) and tumorigenic keratinocytes (Li et al., 1998). transcription in response to antioxidant treatment. Whether fra-1 expression is involved in human tumor Human keratinocytes respond to antioxidants by an formation remains to be shown. increase of AP-1 consisting primarily of Fra-1/JunB Fra-1 might participate in neoplastic transformation which represses rather than activates the AP-1 through its involvement in the induction of genes dependent viral genes (Rosl et al., 1997). Other AP-1 whose protein products catalyze such important responsive genes behave di€erently. The proliferin gene reaction as loosening of cell-cell contacts or triggering was shown to be activated by Fra-1 (Groskopf and of tumor neovascularization. However, sustained fra-1 Linzer, 1994) and we assume that it is the high amount expression seems to result also in the silencing of genes. of Fra-1 in NFR-2 cells which accounts for the We have demonstrated that the expression of a elevated level of proliferin mRNA that we observed dominant negative form of c-Jun in ras transformed Attenuation of T1 gene expression in ras transformed cells R Kessler et al 1741 ®broblasts can rescue c-fos gene expression, indicating restricted expression pattern. Tumor associated T1 that c-fos gene repression is an AP-1 mediated e€ect. gene expression does not seem to be a widespread Furthermore, we have shown that AP-1 consisting of phenomenon albeit slightly elevated T1 gene expression Fra-1 and c-Jun represses c-fos gene expression more has been observed in experimentally induced murine strongly than other forms of AP-1. While this work mammary carcinomas (Rossler et al., 1993). This is was in progress Mechta et al. (1997) have also provided consistent with our observation that T1 gene expres- strong evidence for c-fos gene repression by Fra-1 sion is not stimulated by those AP-1 proteins which containing AP-1. Likewise, silencing of the c-fos gene prevail in ras transformed cells. Thus, AP-1 respon- in response to NGF and EGF has been observed in siveness of a gene does not necessarily imply that it is Fra-1 overproducing PC-12 cells (Ito et al., 1990). Fra- overexpressed in oncogenically transformed cells with 1 overexpression was also found to be inhibitory for elevated AP-1 activity. egr-1 gene expression (Gius et al., 1990). egr-1 is an ras oncogene expression results in the establishment immediate early gene which is strongly activated in of a new equilibrium of gene expression which includes serum stimulated ®broblasts. We have also observed gene activation as well as gene repression. The that egr-1 is no longer induced in ras transformed transition state, which precedes this new equilibrium,

NFR-2 cells during the G0/G1 transition (unpublished can be mimicked in conditional oncogene expression results). c-fos is very rapidly induced upon serum and systems. However, using such systems one has to keep growth factor stimulation of quiescent cells while fra-1 in mind that the molecular e€ects that result from mRNA and protein appear later (Lallemand et al., transient and sustained oncogene expression might be 1997). The kinetics of the appearance of fra-1 and the of quite di€erent nature. Based on studies with an disappearance of c-fos mRNA are compatible with the inducible oncogene cell system we have initially ®nding that Fra-1 is involved in c-fos gene suppression. described T1 as a ras and mos oncogene responsive The repression of c-fos and other immediate early gene. Here we have demonstrated that in a more transcription factor has been observed in several physiological situation, namely under conditions of laboratories. Yu et al., (1993) have described the lack sustained ras oncogene expression as it occurs in many of c-fos,c-jun, junB and egr-1 expression in serum tumors, basal T1 gene expression is not elevated and its stimulated ras and src transformed rodent cell lines. induction upon mitogenic stimulation is even repressed. Likewise, the absence of c-fos gene expression in ras transformed cells in response to TPA, PDGF, Ca2+ ionophore, serum, and cAMP has been described by several authors (Lin et al., 1988; Mechta et al., 1997; Materials and methods Nose et al., 1989; Okimoto et al., 1996; Suzuki et al., 1989; Zullo and Faller, 1988) and NGF and bFGF Cell cultures mediated c-fos gene induction was found to be NIH3T3 and NFR-2 cells were grown in Dulbecco's attenuated in N-ras transformed PC-12 cells (Thom- modi®ed Eagle's medium (DMEM) supplemented with son et al., 1990). In ras transformed Jurkat cells Ca2+ 10% fetal calf serum (FCS), penicillin at 100 units/ml, in¯ux mediated c-fos and egr-1 gene expression is and streptomycin at 100 mg/ml. The cell lines carrying b- abolished (Chen et al., 1996). Most interestingly, c-fos, estradiol inducible genes were grown in DMEM without c-jun,andegr-1 are downregulated in over 70% of phenol-red supplemented with 10% newborn calf serum human non-small cell lung carcinomas (Levin et al., (NCS). The b-estradiol analog diethylstilbestrol (Sigma, 1995) and c-fos is one of the most strongly down- Buchs, Switzerland) was added to a ®nal concentration of 1078 M. Proliferation arrest was achieved by incubating regulated genes in human colon cancer (Zhang et al., subcon¯uent cultures in DMEM containing 0.5% FCS 1997). The repression of c-fos in neoplastically (NIH3T3andNFR-2cells)or1%NCS,for1or2daysas transformed cells and in tumors might be a function- speci®ed in the ®gure legends. The stable integration of the ally insigni®cant by-product of fra-1 upregulation. But activated Ha-ras gene in the plasmid p cHa-ras (A) into the it might as well be important for tumorigenicity. cell line 5/1 (the kind gift of M Schuermann) (Schuermann Evidence for the latter has been provided: MHC class et al., 1993), to which we refer in this article as NIH/cFos I downregulation in lung carcinoma and melanoma hER, gave rise to clones 3, 6, 7, 10, 11. Transfected cells cells correlates with c-fos repression and the forced were selected in 0.5 mg/ml G418 and 1 mg/ml hygromycin. expression of c-fos and c-jun led to MHC class I The TAR cell line was generated by cotransfecting plasmid reexpression and a signi®cant reduction in tumorigenic pGC/ras(A) containing an inducible Ha-ras (EJ) oncogene and plasmid pGal-ER-VP16 encoding a b-estradiol and metastatic properties (Yamit Hezi et al., 1994). c- activable transactivator gene (Braselmann et al., 1993) fos is often involved in cell di€erentiation and its into NIH3T3 cells. Plasmid pGC/ras(A) was constructed absence might maintain cells in the proliferative, by inserting a 4.8 kb BamHI fragment of the plasmid undi€erentiated state. Fra-1 mediated c-fos down- pcHa-ras(A) (Santos et al., 1984) into the plasmid pGC regulation in PC-12 cells prevented NGF mediated (Braselmann et al., 1993). Cell clones were selected in G418 di€erentiation and resulted in an increased prolifera- and isolated cell lines were monitored for morphological tion rate (Ito et al., 1990). transformation in response to b-estradiol treatment. Some of the known AP-1 responsive genes, which are overexpressed in tumors, encode proteins that Plasmids contribute to the tumorigenic phenotype. They do so Plasmids encoding fra-1 and fra-2 were kindly provided by either as proteases which mediate cell motility and R Bravo. The cDNAs were cloned as EcoRI fragments into entry into the vasculature (stromelysin, interstitial the EcoRI site of the expression plasmid pCI (Promega, collagenase) or as mediators of tumor neovasculariza- Madison, WI, USA). The fosB cDNA was excised from tion (proliferin, VEGF). T1 is a soluble IL-1 receptor- pTZfosB (a generous gift of M Schuermann) with EcoRI like protein of unknown function but with a very and SalI and inserted into the corresponding sites of the Attenuation of T1 gene expression in ras transformed cells R Kessler et al 1742 expression plasmid pSVK3 (Pharmacia). The T1 reporter washed twice with ice cold PBS, scraped o€ the plates and plasmid SH4.9 has been described previously (TruÈ b et al., sedimented by centrifugation. The pellet was suspended in 1994). The pBLCAT2 plasmid containing the tk-minimal ice cold bu€er A (10 mM HEPES (pH 7.9), 10 mM KCl, promoter was described elsewhere (Luckow and SchuÈ tz, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM dithiothreitol) 1987). containing a cocktail of protease inhibitors (Hagenbuchle and Wellauer, 1992) and immediately centrifuged. 5 ml of bu€er A were added to the pellet and after an incubation Transfections and CAT assay period of 15 min on ice, the suspension was passed three Cells were transfected using the calcium-phosphate times with a syringe through a 24-gauge needle to break coprecipitation method (Wigler et al., 1979). 24 h before the swollen cells. Nuclei were pelleted by centrifugation transfection, 106 cells were plated per 10-cm tissue culture and suspended in an equal volume of 40 mM HEPES dish. 6 h after the addition of the DNA precipitate, the (pH 7.9), 800 mM NaCl, 2 mM EDTA, 2 mM EGTA, 2 mM cells were washed twice with phosphate bu€ered saline dithiothreitol containing a cocktail of protease inhibitors (PBS) containing 1 mM EDTA and maintained in DMEM (Hagenbuchle and Wellauer, 1992). After vigorous shaking supplemented with 10% FCS for the indicated time for 15 min at 48C, nuclear debris was removed by periods. centrifugation. Protein concentrations of the nuclear NIH3T3 and NFR-2 cells were cotransfected with 10 mg extracts were determined (Bradford, 1976). Aliquots were reporter plasmid, 5 mg pRSV-LacZ (Bonnerot et al., 1987) frozen in liquid nitrogen and stored at 7808C. and the indicated amounts of expression plasmids. Titration of the various expression plasmids (0.1 ± 10 mg) revealed that 2.5 mg DNA led to maximal stimulation of the reporter Electrophoretic mobility shift assay (EMSA) constructs. The total amount of DNA used in the The probe for the EMSA were produced by annealing of transfection experiments was kept constant by the addition complementary oligonucleotides centered around the TRE of pBSKS+. 24 or 48 h after transfection, cells were rinsed oftheT1enhancer[thesequenceoftheT1TREis:5' twice with cold PBS and scraped into 1 ml cold PBS. Cells CTAGAATGTCTTAGTCACTTTAG 3' (upper oligonu- were pelleted and resuspended in cold 40 mM Tris-HCl cleotide), 5' TTACAGAATCAGTGAAATCCTAG 3' pH 7.5, 1 mM EDTA, 150 mM NaCl. The suspension was (lower oligonucleotide)] and ®lling in of the recessive ends sonicated six times at 50 W with a cell disruptor (Heat with Klenow enzyme in the presence of a-32P-dCTP Systems-Ultrasonics, Inc.). Cell debris was removed by (3000 Ci/mmol, Amersham, Amersham Pharmacia Bio- centrifugation. An aliquot of the supernatant was used to tech, Uppsala, Sweden). Unincorporated deoxynucleoside measure b-galactosidase activity according to Miller (1972). triphosphates were removed on Sephadex G-50 Nick Chloramphenicolacetyltransferase (CAT) assays were per- columns (Pharmacia, Amersham Pharmacia Biotech, formed with cell extracts normalized for b-galactosidase Uppsala, Sweden). 20 000 c.p.m. (Cerenkow) probe activity and quantitated by the phase extraction method (approximately 5 ± 10 fmol DNA) were incubated with (Seed and Sheen, 1988). The butyrylated reaction products 4 mg of nuclear extract in 15 ml20mM HEPES, pH 7.9, were extracted with a mixture of tetramethylpentadecane and 60 mM NaCl, 1 mM EDTA, 0.25 mg bovine serum xylene (2 : 1) and the radioactivity was determined in a albumin, 1 mg poly (dI-dC) (Pharmacia) and 4% Ficoll scintillation counter (Canberra Packard 1900 TR). for 15 min at room temperature. For antibody interference experiments, antisera directed RNA preparation and Northern blot analysis against the Fos and Jun family members (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) were added to Total RNA was isolated according to Chomczynsky and the nuclear extracts 10 min after the addition of the Sacchi (1987), denatured by glyoxylation (McMaster and radioactive probe. After an additional incubation period of Carmichael, 1977), fractioned on 1% agarose gels (5 mg/ 30 min samples were subjected to electrophoresis on a 5% lane) and transferred onto nylon membranes (Genescreen non-denaturing polyacrylamide gel in 22 mM Tris-borate, plus, Du Pont). After UV cross-linking of the RNA (1200 0.25 mM EDTA, pH 7.9, for 1.5 h at 200 V. Gels were MeJ), the membranes were hybridized at 428Cwith exposed to Fuji X-Ray ®lms. To quantify results of gel random primed, a-32P-dCTP labeled DNA fragments retardation assays, autoradiographs were analysed by (Feinberg and Vogelstein, 1983, 1984). The following quantitative scanning densitometry. probes were used: T1: two EcoRI-fragments (1.0 and 1.6 kb) from the plasmid pT1.11, spanning the entire T1 cDNA (Klemenz et al., 1989) (available from ATCC); fos: 1kbPstI fragment from the plasmid pfos-1, containing the cDNA of the FBJ-MuLU v-fos (Curran et al., 1982); fosB: 0.87 kb HindIII/HindII fragment from the plasmid pTZfosB; fra-1: 1.5 kb EcoRI fragment from the plasmid fra-1; fra-2: 2.3 kb EcoRI fragment from the plasmid fra2/ Acknowledgements 5; c-jun:1.5kbHindIII/EcoRI fragment from the plasmid The authors would like to thank B Wasylyk for the pTZjun (gift from M Schuermann); junB: 470 bp BamHI/ plasmid SLD9Jun and the cell lines DT and DTR1; P SacI fragment from the plasmid pSG-junB; junD:1.5kb Angel for the plasmid 773/65CAT, pSVc-fos, and pRSVc- EcoRI fragment from the plasmid pSG-junD; Ha-ras: jun; R Bravo for pfra-2/5 and pfra-1; M Schuermann for 2.9 kb SacI fragment from the plasmid pcHa-ras(A) pTZjun and pTZfosB and the cell line 5/1 (NIH3T3/cFos (Santos et al., 1984). hER); R Jaggi for pSG-JunD and pSG-JunB; M Busslinger for pGal-ER-VP16 and pGC; and RM Lebovitz for pFoswtCAT. We also thank D Moritz for the critical Preparation of nuclear extracts reading of this manuscript. This work was supported by Nuclear extracts were prepared according to Schreiber et Swiss National Science Foundation Grant 3100-052650.97 al. (1989) with minor modi®cations. NIH3T3 cells were (to RK) and the Swiss Cancer League. Attenuation of T1 gene expression in ras transformed cells R Kessler et al 1743 References

Angel P and Karin M. (1991). Biochim. Biophys. Acta., 1072, Klemenz R, Ho€mann S and WerenskioÈ ld AK. (1989). Proc. 129 ± 157. Natl. Acad. Sci. USA, 86, 5708 ± 5712. Angel PE and Herrlich PA (eds). (1994). The FOS and JUN Kumar S, McDonnell PC, Gum RJ, Hand AT, Lee JC and families of transcription factors. CRC Press Inc: Boca Young PR. (1997). Biochem. Biophys. Res. Commun., 235, Raton, FL, USA. 533 ± 538. Bar SD and Feramisco JR. (1986). Science, 233, 1061 ± 1068. Lallemand D, Spyrou G, Yaniv M and Pfarr CM. (1997). Battista S, deNigris F, Fedele M, Chiappetta G, Scala S, Oncogene, 14, 819 ± 830. Vallone D, Pierantoni GM, Megar T, Santoro M, Lau LF and Nathans D. (1991). In: The hormonal control of Viglietto G, Verde P and Fusco A. (1998). Oncogene, 17, gene transcription. Cohen, P. & Foulkes, J.G. (eds). 377 ± 385. Amersham, The Netherlands: Elsevier. pp. 257 ± 293. Bergers G, Graninger P, Braselmann S, Wrighton C and Laursen NB, Kessler R, Frohli E and Klemenz R. (1998). Busslinger M. (1995). Mol. Cell. Biol., 15, 3748 ± 3758. Oncogene, 16, 575 ± 586. Binetruy B, Smeal T and Karin M. (1991). Nature, 351, 122 ± Levin WJ, Press MF, Gaynor RB, Sukhatme VP, Boone TC, 127. Reissmann PT, Figlin RA, Holmes EC, Souza LM and Bonnerot C, Rocancourt D, Briand P, Grimber G and Slamon DJ. (1995). Oncogene, 11, 1261 ± 1269. Nicolas JF. (1987). Proc. Natl. Acad. Sci. USA, 84, 6795 ± Li JJ, Rhim JS, Schlegel R, Vousden KH and Colburn NH. 6799. (1998). Oncogene, 16, 2711 ± 2721. Bradford MM. (1976). Anal. Biochem., 72, 248 ± 254. Lin AH, Groppi VE and Gorman RR. (1988). Mol. Cell. Braselmann S, Bergers G, Wrighton C, Graninger P, Superti Biol., 8, 5052 ± 5055. FG and Busslinger M. (1992). J. Cell. Sci. Suppl., 16, 97 ± Lloyd A, Yancheva N and Wasylyk B. (1991). Nature, 352, 109. 635 ± 638. Braselmann S, Graninger P and Busslinger M. (1993). Proc. Luckow B and SchuÈ tz G. (1987). Nucleic. Acids. Res., 15, Natl. Acad. Sci. USA, 90, 1657 ± 1661. 5490. Brusselbach S, Mohle SU, Wang ZQ, Schreiber M, Lucibello Marshall MS. (1995). FASEB. J., 9, 1311 ± 1318. FC, Muller R and Wagner EF. (1995). Oncogene, 10, 79 ± McMaster GK and Carmichael GG. (1977). Proc. Natl. 86. Acad.Sci.USA,74, 4835 ± 4838. Chen CY and Faller DV. (1996). J. Biol. Chem., 271, 2376 ± Mechta F, Lallemand D, Pfarr CM and Yaniv M. (1997). 2379. Oncogene, 14, 837 ± 847. Chen CY, Froman LW and Faller DV. (1996). Mol. Cell. Miao GG and Curran T. (1994). Mol. Cell. Biol., 14, 4295 ± Biol., 16, 6582 ± 6592. 4310. Chomczynski P and Sacchi N. (1987). Anal. Biochem., 162, Miller JH. (1972). Experiments in Molecular Genetics. Cold 156 ± 159. Spring Harbor, NY, USA: Cold Spring Harbor Labora- CurranT,PetersG,VanBC,TeichNMandVermaIM. tory. (1982). J. Virol., 44, 674 ± 682. Moritz D, GaÈ chter T, Geyshelinck J and Klemenz R. Diamond MI, Miner JN, Yoshinaga SK and Yamamoto KR. (1998a). J. Immunol., in press. (1990). Science, 249, 1266 ± 1272. Moritz DR, Geyshelinck J and Klemenz R. (1998b). Feinberg AP and Vogelstein B. (1983). Anal. Biochem., 132, Hybridoma, 17, 107 ± 116. 6±13. NoseK,ItamiM,SatakeM,ItoYandKurokiT.(1989). Feinberg AP and Vogelstein B. (1984). Anal. Biochem., 137, Mol. Carcinog., 2, 208 ± 216. 266 ± 267. Okimoto T, Kohno K, Kuwano M, Gopas J, Kung HF and Feramisco JR, Clark R, Wong G, Arnheim N, Milley R and Ono M. (1996). Oncogene, 12, 1625 ± 1633. McCormick F. (1985). Nature, 314, 639 ± 642. Osei-Frimpong J, Sepulveda J, Rangdaeng S and Lebovitz GaÈ chter T, WerenskioÈ ld AK and Klemenz R. (1996). J. Biol. RM. (1994). Mol. Carcinog., 10, 72 ± 81. Chem., 271, 124 ± 129. Rosl F, Das BC, Lengert M, Geletneky K and zur Hausen H. Gius D, Cao XM, Rauscher FD, Cohen DR, Curran T and (1997). J. Virol., 71, 362 ± 370. Sukhatme VP. (1990). Mol. Cell. Biol., 10, 4243 ± 4255. Rossler U, Andres AC, Reichmann E, Schmahl W and Groskopf JC and Linzer DI. (1994). Mol. Cell. Biol., 14, WerenskioÈ ld AK. (1993). Oncogene, 8, 609 ± 617. 6013 ± 6020. Santos E, Pulciani S and Barbacid M. (1984). Fed. Proc., 43, Gutman A, Wasylyk C and Wasylyk B. (1991). Mol. Cell. 2280 ± 2286. Biol., 11, 5381 ± 5387. Schonthal A, Herrlich P, Rahmsdorf HJ and Ponta H. Hagenbuchle O and Wellauer PK. (1992). Nucleic. Acids. (1988). Cell, 54, 325 ± 334. Res., 20, 3555 ± 3559. Schreiber E, Matthias P, MuÈ ller MM and Scha€ner W. Herschman HR. (1991). Annu.Rev.Biochem.,60, 281 ± 319. (1989). Nucleic. Acids. Res., 17, 6419. Hibi M, Lin A, Smeal T, Minden A and Karin M. (1993). Schuermann M, Hennig G and Muller R. (1993). Oncogene, Genes. Dev., 7, 2135 ± 2148. 8, 2781 ± 2790. Hino O, Kobayashi E, Nishizawa M, Kubo Y, Kobayashi T, Seed B and Sheen JY. (1988). Gene, 67, 271 ± 277. HirayamaY,TakaiS,KikuchiY,TsuchiyaH,Orimoto Seger R and Krebs EG. (1995). FASEB. J., 9, 726 ± 735. K, Kajino K, Takahara T and Mitani H. (1995). J. Cancer. Smeal T, Binetruy B, Mercola DA, Birrer M and Karin M. Res. Clin. Oncol., 121, 602 ± 605. (1991). Nature, 354, 494 ± 496. Ito E, Sweterlitsch LA, Tran PB, Rauscher FD and Stacey DW, Watson T, Kung HF and Curran T. (1987). Mol. Narayanan R. (1990). Oncogene, 5, 1755 ± 1760. Cell. Biol., 7, 523 ± 527. Jaggi R, Salmons B, Muellener D and Groner B. (1986). SuzukiH,FujitaH,OgisoY,OdaA,KuzumakiNand EMBO J., 5, 2609 ± 2616. Uchino J. (1989). Exp. Cell. Res., 184, 524 ± 528. Kalousek MB, TruÈ bT,SchuÈ rmann M and Klemenz R. Thomson TM, Green SH, Trotta RJ, Burstein DE and (1994). J. Biol. Chem., 269, 6866 ± 6873. Pellicer A. (1990). Mol. Cell. Biol., 10, 1556 ± 1563. Karin M. (1994). Curr. Opin. Cell. Biol., 6, 415 ± 424. Tominaga S. (1989). FEBS. Lett., 258, 301 ± 304. KerppolaTK,LukDandCurranT.(1993).Mol. Cell. Biol., Treisman R. (1992). Trends. Biochem. Sci., 17, 423 ± 426. 13, 3782 ± 3791. TruÈ bT,KalousekMB,FroÈ hli E and Klemenz R. (1994). Kessler R, Laursen NB, Trub T, Kalousek MB and Klemenz Proc. Natl. Acad. Sci. USA, 91, 3896 ± 3900. R. (1997). Biol. Chem., 378, 657 ± 667. Attenuation of T1 gene expression in ras transformed cells R Kessler et al 1744 Urakami S, Tsuchiya H, Orimoto K, Kobayashi T, Igawa M Yamit Hezi A, Plaksin D and Eisenbach L. (1994). Oncogene, and Hino O. (1997). Biochem. Biophys. Res. Commun., 9, 1065 ± 1079. 241, 24 ± 30. Yanagisawa K, Tsukamoto T, Takagi T and Tominaga S. Vallone D, Battista S, Pierantoni GM, Fedele M, Casalino L, (1992). FEBS. Lett., 302, 51 ± 53. Santoro M, Viglietto G, Fusco A and Verde P. (1997). Yu CL, Prochownik EV, Imperiale MJ and Jove R. (1993). EMBO J., 16, 5310 ± 5321. Mol. Cell. Biol., 13, 2011 ± 2019. WerenskioÈ ld AK, Ho€mann S and Klemenz R. (1989). Mol. Zhang L, Zhou W, Velculescu VE, Kern SE, Hruban RH, Cell. Biol., 9, 5207 ± 5214. Hamilton SR, Vogelstein B and Kinzler KW. (1997). Wigler M, Sweet R, Sim GK, Wold B, Pellicer A, Lacy E, Science, 276, 1268 ± 1272. Maniatis T, Silverstein S and Axel R. (1979). Cell, 16, Zullo JN and Faller DV. (1988). Mol. Cell. Biol., 8, 5080 ± 777 ± 785. 5085.