sign in sign up
<<
Home , CREB, CREB1, FOSB

CREB-binding controls response to by acetylating histones at the fosB in the mouse

Amir A. Levine*†, Zhonghui Guan†‡, Angel Barco§, Shiqin Xu*, Eric R. Kandel*¶ʈ**††, and James H. Schwartz*ʈ

*Center for Neurobiology and Behavior, College of Physicians and Surgeons, Columbia University, New York State Psychiatric Institute, and ¶Howard Hughes Medical Institute, 1051 Riverside Drive, New York, NY 10032; ‡Department of Anesthesia and Critical Care, Massachusetts General Hospital, Harvard Medical School, 55 Fruit Street, Boston, MA 02114; §Instituto de Neurociencias (UMH-CSIC), Campus de San Juan. Apt. 18, San Juan de Alicante, Alicante 03550, Spain; and ʈDepartment of Physiology and Molecular Biophysics and **Center for Molecular Therapeutics and Department of Pharmacology, College of Physicians and Surgeons, Columbia University, 630 West 168th Street, New York, NY 10032

Contributed by Eric R. Kandel, November 10, 2005 Remodeling chromatin is essential for cAMP-regulated ex- FosB, an immediate early gene, also influences the response to pression, necessary not only for development but also for cocaine. Thus, manipulation of fosB and ⌬fosB expression in the storage and other enduring mental states. Histone acetylation and striatum of transgenic mice increases the behavioral response to deacetylation mediate long-lasting forms of in cocaine and to other drugs of abuse (15, 16). We now provide Aplysia as well as cognition in mice. Here, we show that histone evidence that fosB is induced by activating CREB and recruiting acetylation by the cAMP- binding protein (CREB)- CBP to the fosB promoter. CBP was first identified as a nuclear binding protein (CBP) mediates sensitivity to cocaine by regulating protein that binds specifically to phosphorylated CREB (8); expression of the fosB gene and its splice variant, ⌬fosB, a tran- later, it was found to be mutated in patients with Rubinstein– scription factor previously implicated in . Using the chro- Taybi syndrome, a disorder characterized by mental retardation, matin immunoprecipitation assay with antibodies against histone facial abnormalities, broad thumbs, and big toes (17). In addition H4 or CBP, we find that CBP is recruited to the fosB promoter to to phosphorylated CREB, CBP can form complexes with several acetylate histone H4 in response to acute exposure to cocaine. We other factors (c-Jun, c-Fos, and ATF2) and is show that mutant mice that lack one allele of the CBP gene and involved in cell growth, development, and oncogenesis (18). CBP have normal levels of fosB expression are less sensitive to chronic is also essential for activity-dependent in the (10-day) administration of cocaine than are wild-type mice. This hippocampus and cortex (19–21). Several CBP knockout or decreased sensitivity is correlated with decreased histone acety- dominant-negative mouse mutants have been generated, all of lation and results in decreased fosB expression and diminished which display normal short-term memory but are deficient in accumulation of ⌬fosB. Thus, CBP, which forms part of the pro- certain forms of long-term memory (22–24). moter complex with CREB, mediates sensitivity to cocaine by In this paper, we find that cocaine administration causes the acetylating histones. recruitment of CBP to the fosB promoter. CBP acetylates histone H4 and increases fosB expression. Compared with the addiction ͉ chromatin modulation ͉ memory storage ͉ wild type, in CBP haploinsufficient mice, less CBP is recruited Rubenstein–Tabi syndrome to the fosB promoter, resulting in decreased histone acetylation and fosB expression. Less expression of fosB results in decreased imilar molecular mechanisms underlie the formation of accumulating ⌬fosB, and decreased after cocaine Slong-term memory and cocaine addiction. In long-term challenge. Thus, we provide direct evidence that the recruitment facilitation of sensory-to-motor synapses underlying of CBP to the fosB promoter and the resulting histone acetyla- defensive reflexes in Aplysia, an established cellular model for tion are essential for inducing the gene expression that underlies long-term memory, the facilitatory cocaine addiction. (5-HT) activates the cAMP-dependent (PKA) (1) to phosphorylate cAMP-response element-binding protein Materials and Methods (CREB) (2). After recruiting CREB-binding protein (CBP) (3), Animals. Tanaka et al. (25) described the generation of CBP phospho-CREB leads to the induction of two immediate early haploinsufficient mice. We observed a progressively reduced , C͞EBP (4) and ubiquitin C-terminal hydrolase (5), as well transmission of the mutation with mice repeatedly backcrossed as several late effector genes including eEF1A and the RII with C57BL͞6J strain (after four backcrossings, many heterozy- subunit of PKA (6, 7). In addition to serving as a scaffold protein gous males did not transmit the silenced CBP allele). Those that in CREB promoter complexes, the recruited CBP also has did transmit this allele exhibited a rate lower than 50%). intrinsic histone acetyltransferase activity and can modify his- Therefore, we carried out our experiments in a genetic back- tones at promoters, resulting in the decondensation of DNA and ground similar to the one used by Tanaka et al. (25) and crossed thus enabling gene expression (3, 8). Recently, Kumar et al. (9) C57BL͞6J mutant males with BALB͞c females to generate the showed that histone acetylation is involved in the cellular and F1 hybrids. The wild-type mice used as controls were littermates molecular changes induced in by cocaine. They found of the mutants. Mice were maintained and bred under standard that histones at the promoter of cFos, a gene induced after acute conditions consistent with National Institutes of Health guide- cocaine administration, are acetylated acutely, and that chronic cocaine treatment involves acetylation at the promoters of BDNF and Cdk5, genes that are expressed in rodent models of Conflict of interest statement: No conflicts declared. cocaine addiction. Abbreviations: CREB, cAMP-response element-binding protein; CBP, CREB-binding protein; Activation of CREB also underlies cocaine addiction (for ChIP, chromatin immunoprecipitation; SAHA, suberoylanilide hydroxamic acid. review, see refs. 10–12); its overexpression in the striatum of †A.A.L. and Z.G. contributed equally to this work. mice decreases cocaine’s immediate rewarding effects; con- ††To whom correspondence should be addressed. E-mail: [email protected]. versely, its inhibition increases the effect of reward (13, 14). © 2005 by The National Academy of Sciences of the USA

19186–19191 ͉ PNAS ͉ December 27, 2005 ͉ vol. 102 ͉ no. 52 www.pnas.org͞cgi͞doi͞10.1073͞pnas.0509735102 Downloaded by guest on September 24, 2021 Fig. 1. Cocaine induces fosB expression through CBP recruitment and histone acetylation at the fosB promoter. (A) Real-time RT-PCR shows that fosB is induced in C57BL͞6J mouse striata 2 h after injecting 30 mg͞kg cocaine i.p. (n ϭ 3 in each group; actin set at 1; cocaine, 7.88 Ϯ 0.15; P Ͻ 0.001). (B) ChIP assays show increased CBP recruitment to the fosB promoter 20 min after injecting 30 mg͞kg cocaine i.p. [n ϭ 7 in each group; control set at 1; cocaine, 2.45 Ϯ 0.65; P Ͻ 0.05, input (nonimmunoprecipitated DNA) was used as control]. (C) The acetylation of histone H4 at the fosB promoter was increased 20 min after injecting 30 mg͞kg cocaine i.p. (n ϭ 6 mice pairs; control set at 1; cocaine, 1.41 Ϯ 0.14; P Ͻ 0.05). Normalized reporter (Rn) represents the fluorescence detected. Data are expressed as mean Ϯ SEM, P values were measured by Student’s t test. Representative data from real-time PCR experiments are shown to the right of each bar chart. The quantifying of fosB cDNA (A), and CBP and acetylated histone H4 antibody pulldown (B and C) was done by normalizing Ct values (Ct value is the number of cycles at which the fluorescence crosses a threshold indicated by the arrow at the abscissa) of cDNA and immunoprecipitated DNA (saline control vs. cocaine) to Ct values of actin and input DNA. Acetylated histone H4 at the actin promoter and levels of actin cDNA were unaffected by cocaine.

lines and approved by the Institutional Animal Care and Use and transcription. Real-time PCR was performed with the Gene- Committees. Amp 5700 Sequence Detection System (PE Corporation, Norwalk CT). Amounts of specific histone modifications at the fosB pro- Chromatin Immunoprecipitation (ChIP). The ChIP assay was per- moter were determined by measuring the amount of acetylated formed as described in ref. 3 with some modifications. The striatum histone-associated DNA using quantitative real-time PCR with was dissected from mice anesthetized with 100 mg͞kg ketamine and actin as control. No differences were seen between animals injected perfused with 4% paraformaldehyde for 30 min, washed in 0.125 M with saline and animals killed that had not been injected. Input and glycine and PBS, each for 12 min at 4°C, and homogenized. After immunoprecipitated DNA amplification reactions were run in NEUROSCIENCE sonication, the average size of DNA fragments was Ϸ600 bp. triplicate in the presence of SYBR-Green (Applied Biosystems). Chromatin was used for immunoprecipitation with specific anti- Normalized reporter (Rn) values [fluorescence detected during bodies, anti-acetylated histone H4 (Upstate Biotechnology, Lake PCR (GeneAmp 5700 Sequence Detection System manual, PE Placid, NY) and anti CBP (Santa Cruz Biotechnology). The pres- Corporation) from each sample] were obtained by using SEQUENCE ence of the fosB promoter was analyzed by real-time PCR with the DETECTOR 1.1 software (see Fig. 1). Relative quantification of promoter-specific primer pair GGTCCCGGAGGCATAAATTC template was done as described by the manufacturer (Applied (forward) and TCACGCCTCCAAGAAGAAGAA (reverse) us- Biosystems). Values (mean Ϯ SEM) were analyzed by two-tailed ing actin sequences to control for specificity of histone acetylation paired t tests (adjusted for multiple comparisons) for statistical

Levine et al. PNAS ͉ December 27, 2005 ͉ vol. 102 ͉ no. 52 ͉ 19187 Downloaded by guest on September 24, 2021 significance (P Ͻ 0.05). PCRs were run in triplicate for each brain sample, and at least three independent sample pairs were used for each statistical analysis.

Measuring mRNA by Real-Time PCR. RNA from the striata of mice injected with 30 mg͞kg cocaine was extracted by using Trizol reagent (Invitrogen) and precipitated with isopropanol. mRNA was reverse transcribed by using a SuperScript III First-Strand Synthesis kit (Invitrogen). The amount of cDNA was quantified by using real-time PCR. The primers used to amplify specific cDNA regions of the transcripts of interest were: fosB 5Ј- ACAGATCGACTTCAGGCGGA-3Ј and 5Ј-GTTTGTGG- GCCACCAGGAC-3Ј; as internal control for normalization actin, 5Ј-ATGGTGGGAATGGGTCAGAAG-3Ј and 5Ј- TCTCCATGTCGTCCCAGTTG-3Ј. Fold differences of mRNA over control values were calculated by using the Rn method as described by the manufacturer (Applied Biosystems).

Antibodies and Immunoblotting. Mice were injected with 30 mg͞kg cocaine i.p. for 10 days and killed 24 h later. Striata were dissected in PBS on ice and homogenized in 0.25% Triton X-100, 0.5% Nonidet P-40, 10 mM EDTA, 0.5 mM EGTA, 10 mM Tris⅐HCl (pH 8.0), and 1 mM PMSF. Protein was measured by a Lowry-based assay (Bio-Rad); 30 ␮g of protein was used for detection of ⌬fosB and separated by SDS͞10% PAGE. After electrophoresis, gels were transferred to nitrocellulose mem- branes (Protran, Schleicher & Schuell) and probed with fosB antibody (H-75) (Santa Cruz Biotechnology), overnight at 4°C. Blots were incubated with an anti-rabbit IgG-HRP as secondary antibody (1:1,000) (Sigma) for1hatroom temperature and quantified by using ECL (Amersham Pharmacia). Some blots were later stripped with 0.2 M glycine (pH 2.8) and 0.5 M NaCl for 25 min at room temperature and reprobed as indicated. To verify the accuracy of sample loading, selected blots were reprobed with a monoclonal antibody to ␤-tubulin (1:20,000; Sigma). A single band was observed at 55 kDa, and the intensity of the signal was similar in all lanes. Relative optical density readings for the ⌬fosB and ␤-tubulin bands were determined by using a computer-assisted densitometry program (NIH IMAGE 1.63 software) from three independent sample pairs. The optical density of components corresponding to the 35- to 37-kDa ⌬fosB protein was normalized with the optical density of ␤-tubulin- specific bands for each sample by dividing the optical density Fig. 2. Basal recruitment of CBP and histone H4 acetylation at the fosB obtained from ⌬fosB-specific bands by the optical density ob- promoter in CBP haploinsufficient and in wild-type mice. (A) The basal ex- tained from ␤-tubulin-specific bands for each animal. pression of fosB in the mutant and wild-type were equivalent (n ϭ 3 pairs; wild type set at 1; mutant, 1.061 Ϯ 0.041; P Ͼ 0.05). Note that the values are set Behavior. For all tasks, we used adult male mutant mice and relative to those of the wild-type. The fosB expression was 4- to 8-fold less than that observed after treatment with cocaine (also see Fig. 1A). (B) CBP recruit- control littermates. Statistical analyses by ANOVAs and ϭ Ϯ ment was less in the mutant (n 5 in each group, wild type set at 1; mutant, means SEM are presented in Fig. 5. Experimenters were blind 0.68 Ϯ 0.06; P Ͻ 0.01; input DNA was used as control). (C) Basal histone H4 to the genotype in all studies. Motor activity in an open field was acetylation at the fosB promoter in the mutant also was less than that in the quantified in four Plexiglas open field boxes 43 ϫ 43 cm2 (MED wild type (n ϭ 5 in each group; wild type set at1; mutant, 0.63 Ϯ 0.17; P Ͻ 0.05; Associates, Georgia, VT). Two sets of 16 pulse-modulated input DNA was used as control). infrared photobeams were placed on opposite walls 2.5 cm apart to record ambulatory movements. Activity chambers were com- puter interfaced for data sampling at 100-ms resolution. The of the mice received saline injections and were placed in the test computer-defined grid lines that divided each open field into chambers, and their locomotor activity was measured for 1 h. center and surround regions, with each of four lines being 11 cm Results from each wall. Overall motor activity was quantified as the total distance traveled (m) over the test session. In a behavioral Cocaine Induces fosB, Recruits CBP, and Causes Histone Acetylation. sensitization paradigm, mice were divided into four groups (two FosB is induced in the rodent striatum by cocaine administration groups of wild-type and two of mutants), and their activities were (26, 27). We confirmed this observation by using real-time measured for1haftercocaine or saline injection. For the first RT-PCR and found that,2hafterinjecting 30 mg͞kg cocaine, 3 days, mice (ϩ͞ϩ, n ϭ 14; ϩ͞Ϫ, n ϭ 13) were placed in the the fosB gene was induced Ϸ8-fold in the striatum of wild-type chambers immediately after saline injections. From the fourth to C57BL͞6J mice (Fig. 1A). ninth day, mice were given either saline or cocaine and were Does cocaine cause chromatin remodeling at the promoters of placed in the chambers [cocaine: 30 mg͞kg: ϩ͞ϩ, n ϭ 7; ϩ͞Ϫ, genes that have been implicated in addiction? To address this n ϭ 7; vehicle (saline): ϩ͞ϩ, n ϭ 7; ϩ͞Ϫ, n ϭ 6]. On day 16, all question, we adapted the ChIP assay to mouse brain (see ref. 3).

19188 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0509735102 Levine et al. Downloaded by guest on September 24, 2021 Fig. 4. Expression of fosB in the striatum of mice treated with a inhibitor is enhanced after cocaine treatment. Real-time PCR shows a 3-fold increase in fosB expression after cocaine injection in mice that were pretreated with SAHA. Treatment with SAHA without cocaine admin- istration did not change fosB expression. C57BL͞6J were injected with SAHA (25 mg͞kg) or vehicle (DMSO) 2 h before receiving cocaine (20 mg͞kg). Mice were killed 2 h after the injection of cocaine. n ϭ 18; control set at 1; DMSO and cocaine, 1.25 Ϯ 0.001; SAHA plus cocaine, 3 Ϯ 0.002; *, P Ͻ 0.05.

(Fig. 1 B and C). The increase in acetylation was selective: both the acetylation at actin’s promoter and transcription of the actin gene were unaffected by cocaine (Fig. 1 A and C). We next examined CBP haploinsufficient mice. This mutant carries only one functional cbp allele. The expression of fosB is similar in mutant and wild type at baseline, even though the recruitment of CBP to the fosB promoter and histone acetylation are decreased in the mutant (Fig. 2). We next asked how cocaine affects the recruitment of CBP, histone acetylation, and fosB expression. After a cocaine challenge, CBP and histone H4 acetylation were reduced at the fosB promoter of the mutant mouse compared to that in the wild type. This reduction of CBP recruitment and histone acetylation correlates with the reduc- tion in fosB expression in the mutant (Fig. 3).

Suberoylanilide Hydroxamic Acid (SAHA), a Histone Deacetylase In- hibitor, Enhances fosB Expression in C57BL͞6J Mice Striatum After Cocaine Treatment. To examine whether histone acetylation plays Fig. 3. Cocaine-induced CBP recruitment and histone H4 acetylation are a role in the induction of gene expression by cocaine, we used a decreased at the fosB promoter, resulting in decreased fosB expression in CBP potent and specific histone deacetylase inhibitor, SAHA, that we haploinsufficient mice. (A) Cocaine was less effective in inducing fosB in the and others have found to pass the blood brain barrier and to exert mutant mice. Values were from the mice 2 h after injection of 30 mg͞kg ϭ Ϯ Ͻ its effect on the brain (29). We find that SAHA caused a 2-fold cocaine i.p. (n 3 mice pairs, control, 1; cocaine, 0.448 0.033; P 0.01). (B increase in the expression of fosB after cocaine treatment. and C) ChIP assays show that, 20 min after 30 mg͞kg cocaine injection, there is a decrease in CBP recruitment to the fosB promoter in mutant mouse SAHA administration did not affect the expression of fosB in the striatum compared to wild type (n ϭ 3 in each group, wild type set at 1, mutant absence of cocaine, suggesting that histone acetylation plays an 0.31; P Ͻ 0.05, input DNA as control) (B) and a decrease in acetylated histone important role in the gene expression induced by cocaine. Thus, H4 at the fosB promoter (n ϭ 3 in each group; wild type set at 1; mutant 0.67; by inhibiting the deacetylating process, which counteracts the P ϭ 0.014, input DNA as control) (C). Data are expressed as mean Ϯ SEM. CBP’s histone acetyltransferase activity, SAHA causes an in- crease in fosB expression (Fig. 4).

Our working hypothesis was that chromatin remodeling, which Mutant Mice Accumulate Less ⌬fosB After Chronic Cocaine Adminis- underlies memory storage in Aplysia, is likely to be important also tration. Drug addiction is thought to depend on the buildup of for the formation of stable addictive behaviors. The fosB gene was ⌬fosB protein that takes place during chronic administration of examined because the expression of its truncated splice variant ⌬

cocaine (15). Before we injected the drug, the amount of fosB NEUROSCIENCE ⌬fosB has a robust effect on sensitivity to cocaine (15). Activation protein was undetectable in both CBP haploinsufficient and of the fosB promoter depends on the cAMP-dependent PKA wild-type mice. After six daily injections, we also failed to detect phosphorylation of CREB (28). CREB in turn recruits CBP to any ⌬fosB. By 10 days, however, ⌬fosB immunoblotting revealed induce immediate early genes. CBP is a histone acetyltransferase that the mutants have relative optical density (ROD) of 0.72 Ϯ (HAT) that activates transcription by acetylating specific lysine 0.059, and wild-type ROD was 1.476 Ϯ 0.069 (n ϭ 3 pairs; P Ͻ residues in histones of nucleosomes, thereby opening up repressive 0.05 Student t test). chromatin structures (8, 23). Using the ChIP assay, we found an increase in the recruitment of CBP to the fosB promoter and The Response to Cocaine Is Reduced in CBP Haploinsufficient Mice. We increased acetylation of histone H4 20 min after injecting cocaine next examined the response to cocaine in a behavioral sensiti-

Levine et al. PNAS ͉ December 27, 2005 ͉ vol. 102 ͉ no. 52 ͉ 19189 Downloaded by guest on September 24, 2021 ⌬fosB (15), and fosB knockout mice (16)]. In these two strains, expression of fosB and ⌬fosB was altered before cocaine ad- ministration. One strain had increased ⌬fosB protein before cocaine administration and the other had diminished fosB expression at baseline. Both strains showed increased sensitivity to cocaine. These results appear to be paradoxical because, on the one hand, the mutant that overexpressed ⌬fosB was sensitive to cocaine, and on the other, the knockout mutant with no fosB expression and no ⌬fosB protein was also more sensitive. With CBP mutant mice, we confirmed that, when starting with normal fosB expression levels before cocaine was administered, a de- crease in fosB expression in response to cocaine (influenced by the lack of CBP) correlates with decreased sensitivity to cocaine. However, it remains unclear why fosB mutant mice exhibit increased sensitization in the absence of fosB expression. Fig. 5. CBP haploinsufficient mice show decreased sensitivity to cocaine. Alarcon et al. (23) studied deficits in long-term memory in Sensitivity assessed by locomotor activity: total (ϮSEM) distance traveled (in CBP haploinsufficient mice. These mice phenocopy a well meters) of wild-type and CBP haploinsufficient mice during six consecutive ͞ ϩ͞ϩ ϭ ϩ͞Ϫ ϭ described syndrome in humans: the Rubinstein–Taybi syndrome. days of cocaine injection [cocaine: 30 mg kg: , n 7; , n 7; vehicle Long-term memory and long-term potentiation, both of which (saline): ϩ͞ϩ, n ϭ 7; ϩ͞Ϫ, n ϭ 6]. There was no difference in activity between mutant and wild-type groups that were injected with saline. Activity was are impaired in these mutants, can be significantly improved by greater in wild-type than in cocaine-injected CBP haploinsufficient mice (P Ͻ pharmacological compensation for the lack of CBP with histone 0.05 for all days), whereas there was no difference between the wild-type and deacetylase (HDAC) inhibitors. This finding suggests that these mutant controls. deficits are due to the requirement of CBP throughout life and not to the consequences of altered brain development leading to permanent anatomical abnormalities. It is possible that the zation paradigm, which is a widely used index of addictive altered sensitization that we observed in mutant mice may also behavior in rodents (30–32). For the first 3 days, all mice be pharmacologically reversed as with the memory deficits (23). received saline i.p., and no differences between wild-type and The increase in ⌬fosB expression induced by the cAMP- mutants were observed (P Ͻ 0.05). Next, mice were divided into dependent phosphorylation of CREB and the recruitment of four groups and injected with either saline or cocaine each day CBP is a common pathway in the formation of several different for 6 days. We found that the response to cocaine was reduced addictive behaviors caused by many drugs and situations (36). in mutant mice. In contrast, wild-type littermates showed a Although CREB-mediated gene expression has been examined typical pattern of enhanced sensitization to cocaine with the in higher animals (37, 38), in Aplysia the connection between expected increase in locomotor activity (Fig. 5). molecular events and behavior are clearer. In Aplysia, treatment with serotonin (5-HT) results in the recruitment of CREB1 and Discussion CBP to the C͞EBP promoter and acetylation of histones induc- Many drugs of abuse act by increasing in the striatum ing downstream effector genes needed for producing long-term (33, 34). Dopamine then stimulates the synthesis of cAMP facilitation (3). The facilitation is blocked by the inhibitory through D1 receptors, and the cAMP activates PKA. The kinase FMRFamide, which acts through p38 mitogen- phosphorylates CREB, a constitutive . activated protein kinase phosphorylation of the inhibitory tran- CREB is resident at CRE-containing promoter sites. Upon scription factor CREB2 (39). CREB2 displaces CREB1 and phosphorylation, CREB recruits CBP to form the active pro- recruits HDAC5 to the C͞EBP promoter, blocking the expres- moter complex, and the fosB gene is induced. Using ChIP assays, sion of effector genes and leading to long-term depression. Two we show directly that cocaine administration leads to the induc- avenues of pharmacological intervention seem promising: agents tion of the fosB gene by recruiting CBP. The binding protein that result in blocking the recruitment of CBP (as, for example, then acetylates histones, modifying chromatin and resulting in FMRFamide in Aplysia) and drugs that cause deacetylation of the decondensation of DNA. The accumulation of a splice the fosB gene. These agents may not only prevent the formation variant, ⌬fosB, has been shown to be important for the formation of new behaviors, but may also reverse downstream synaptic of in rodents (14). We found that the CBP changes that are induced by previously learned behavior. It is not haploinsufficient mutants, in response to cocaine, accumulate clear why agents that are expected to act at many sites of gene less ⌬fosB protein in the striatum than do wild-type mice. This induction might target the fosB gene specifically. Nevertheless, difference correlates with the decrease in CBP recruitment and recent clinical trials with chromatin modifying drugs have pro- histone acetylation at the fosB promoter. duced specific therapeutic affects despite their ability to influ- The accumulation of ⌬fosB has been shown to be important ence many areas of the genome (40, 41). in the formation of addictive behaviors in rodents (35). Because levels of fosB and ⌬fosB expression are the same in both We thank Rene Hen, Stephanie Dulawa, Lee Zuckerman, Jinmin Liu, Alejandro I. Hernandez, and Jason Wolk for help with this paper. This wild-type and CBP haploinsufficient mice before a cocaine work was supported by National Institute of Mental Health Grants challenge, the mutant is better suited for studying the effect of MH15174 (to J.H.S.) and MH60387 (to J.H.S.), and National Institute the fosB gene on the response to cocaine than the two other mice of Neurological Disorders and Stroke Grants MH048850 and NS29255 mutant strains that were used in the past [mice that overexpress (to J.H.S.).

1. Kandel, E. R. & Schwartz, J. H. (1982) Science 218, 433–443. 5. Hegde, A. N., Inokuchi, K., Pei, W., Casadio, A., Ghirardi, M., Chain, D. G., 2. Bartsch, D., Casadio, A., Karl, K. A., Serodio, P. & Kandel, E. R. (1998) Cell Martin, K. C., Kandel, E. R. & Schwartz, J. H. (1997) Cell 89, 115–126. 95, 211–223. 6. Giustetto, M., Hegde, A. N., Si, K., Casadio, A., Inokuchi, K., Pei, W., Kandel, 3. Guan, Z., Giustetto, M., Lomvardas, S., Kim, J. H., Miniaci, M. C., Schwartz, E. R. & Schwartz, J. H. (2003) Proc. Natl. Acad. Sci. USA 100, 13680–13685. J. H., Thanos, D. & Kandel, E. R. (2002) Cell 111, 483–493. 7. Liu, J. & Schwartz, J. H. (2003) Brain Res 959, 68–76. 4. Alberini, C. M., Ghirardi, M., Metz, R. & Kandel, E. R. (1994) Cell 76, 8. Chrivia, J. C., Kwok, R. P., Lamb, N., Hagiwara, M., Montminy, M. R. & 1099–1114. Goodman, R. H. (1993) Nature 365, 855–859.

19190 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0509735102 Levine et al. Downloaded by guest on September 24, 2021 9. Kumar, A., Choi, K. H., Renthal, W., Tsankova, N. M., Theobald, D. E., 25. Tanaka, Y., Naruse, I., Maekawa, T., Masuya, H., Shiroishi, T. & Ishii, S. (1997) Truong, H. T., Russo, S. J., Laplant, Q., Sasaki, T. S., Whistler, K., et al. (2005) Proc. Natl. Acad. Sci. USA 94, 10215–10220. Neuron 48, 303–314. 26. Hope, B., Kosofsky, B., Hyman, S. E. & Nestler, E. J. (1992) Proc. Natl. Acad. 10. Nestler, E. J. (2004) Trends Pharmacol. Sci. 25, 210–218. Sci. USA 89, 5764–5768. 11. Terwilliger, R. Z., Beitner-Johnson, D., Sevarino, K. A., Crain, S. M. & Nestler, 27. Zhang, D., Zhang, L., Lou, D. W., Nakabeppu, Y., Zhang, J. & Xu, M. (2002) E. J. (1991) Brain Res. 548, 100–110. J. Neurochem. 82, 1453–1464. 12. Kano, T., Suzuki, Y., Shibuya, M., Kiuchi, K. & Hagiwara, M. (1995) 28. Inoue, D., Kido, S. & Matsumoto, T. (2004) J. Biol. Chem. 279, 49795– NeuroReport 6, 2197–2200. 49803. 13. Carlezon, W. A., Jr., Thome, J., Olson, V. G., Lane-Ladd, S. B., Brodkin, E. S., 29. Hockly, E., Richon, V. M., Woodman, B., Smith, D. L., Zhou, X., Rosa, E., Hiroi, N., Duman, R. S., Neve, R. L. & Nestler, E. J. (1998) Science 282, 2272–2275. Sathasivam, K., Ghazi-Noori, S., Mahal, A., Lowden, P. A., et al. (2003) Proc. 14. Walters, C. L. & Blendy, J. A. (2001) J. Neurosci. 21, 9438–9444. Natl. Acad. Sci. USA 100, 2041–2046. 15. Kelz, M. B., Chen, J., Carlezon, W. A., Jr., Whisler, K., Gilden, L., Beckmann, 30. Robinson, T. E. & Berridge, K. C. (1993) Brain Res. Brain Res. Rev. 18, 247–291. A. M., Steffen, C., Zhang, Y. J., Marotti, L., Self, D. W., et al. (1999) Nature 31. Izenwasse, S., French, D., Carroll, F. I. & Kunko, P. M. (1999) Behav. Brain Res. 401, 272–276. 99, 201–208. 16. Hiroi, N., Brown, J. R., Haile, C. N., Ye, H., Greenberg, M. E. & Nestler, E. J. 32. Kalivas, P. W. & Duffy, P. (1993) J. Neurosci. 13, 266–275. (1997) Proc. Natl. Acad. Sci. USA 94, 10397–10402. 33. Hyman, S. E. & Malenka, R. C. (2001) Nat. Rev. Neurosci. 2, 695–703. 17. Petrij, F., Giles, R. H., Dauwerse, H. G., Saris, J. J., Hennekam, R. C., Masuno, 34. Kalivas, P. W. & Volkow, N. D. (2005) Am. J. Psychiatry 162, 1403–1413. M., Tommerup, N., van Ommen, G. J., Goodman, R. H., Peters, D. J., et al. 35. Chao, J. & Nestler, E. J. (2004) Annu. Rev. Med. 55, 113–132. (1995) Nature 376, 348–351. 36. Impey, S., Smith, D. M., Obrietan, K. Donahue, R., Wade, C. & Storm, D. R. 18. Goodman, R. H. & Smolik, S. (2000) Genes Dev. 14, 1553–1577. (1998) Nat. Neurosci. 1, 595–601. 19. Hardingham, G. E., Chawla, S., Cruzalegui, F. H. & Bading, H. (1999) Neuron 37. Barrot, M., Olivier, J. D., Perrotti, L. I., DiLeone, R. J., Berton, O., Eisch, A. J., 22, 789–798. Impey, S., Storm, D. R., Neve, R. L., Yin, J. C., et. al. (2002) Proc. Natl. Acad. 20. Hu, S. C., Chrivia, J. & Ghosh, A. (1999) Neuron 22, 799–808. Sci. USA 99, 11435–11440. 21. Impey, S., Fong, A. L., Wang, Y., Cardinaux. J. R., Fass, D. M., Obrietan, K., 38. Nestler, E. J., Barrot, M., DiLeone, R. J., Eisch, A. J., Gold, S. J. & Monteggia, Wayman, G. A., Storm, D. R., Soderling, T. R. & Goodman, R. H. (2002) L. M. (2002) Neuron 34, 13–25. Neuron 34, 235–244. 39. Guan, Z., Kim, J. H., Lomvardas, S., Holick, K., Xu, S., Kandel, E. R. & 22. Oike, Y., Hata, A., Mamiya, T., Kaname, T., Noda, Y., Suzuki, M., Yasue, H., Schwartz, J. H. (2003) J. Neurosci. 23, 7317–7325. Nabeshima, T., Araki, K. & Yamamura, K. (1999) Hum. Mol. Genet. 8, 387–396. 40. Kelly, W. K. & Marks, P. A. (2005) Nat. Clin. Pract. Oncol. 2, 150–157. 23. Alarcon, J. M., Malleret, G., Touzani, K., Vronskaya, S., Ishii, S., Kandel, E. R. 41. Lehrman, G., Hogue, I. B., Palmer, S., Jennings, C., Spina, C. A., Wiegand, A., & Barco, A. (2004) Neuron 42, 947–959. Landay, A. L., Coombs, R. W., Richman, D. D., Mellors, J. W., et. al. (2005) 24. Korzus, E., Rosenfeld, M. G. & Mayford, M. (2004) Neuron 42, 961–972. Lancet 366, 549–555. NEUROSCIENCE

Levine et al. PNAS ͉ December 27, 2005 ͉ vol. 102 ͉ no. 52 ͉ 19191 Downloaded by guest on September 24, 2021