USOO8945859B2

(12) United States Patent (10) Patent No.: US 8,945,859 B2 Donaldson et al. (45) Date of Patent: Feb. 3, 2015

(54) PRODUCTION OF BY A 50/10 (2013.01); Y02E 50/343 (2013.01): CI2N MCROORGANISM WITHENHANCED 9/88 (2013.01); CI2Y 202/01006 (2013.01); ACETOLACTATE SYNTHASE ACTIVITY CI2Y 102/04004 (2013.01); C12N 15/70 (2013.01); C12N 9/0008 (2013.01): CI2N (71) Applicant: Butamax(TM) Advanced Biofuels LLC, 15/52 (2013.01); C12N 15/74 (2013.01); CI2N Wilmington, DE (US) 9/0016 (2013.01) (72) Inventors: Gail K. Donaldson, Newark, DE (US); USPC ...... 435/7.4; 435/69.1; 435/157; 435/183; Andrew C. Eliot, Wilmington, DE (US); 435/252.3; 435/320.1; 536/23.2 Dennis Flint, Newark, DE (US); Lori (58) Field of Classification Search Ann Maggio-Hall, Wilmington, DE None (US); Vasantha Nagarajan, See application file for complete search history. Wilmington, DE (US) (56) References Cited (73) Assignee: Butamax Advanced Biofuels LLC, U.S. PATENT DOCUMENTS Wilmington, DE (US) 4.424,275 A 1/1984 Levy 4,568,643 A 2/1986 Levy (*) Notice: Subject to any disclaimer, the term of this 5,210,032 A 5/1993 Kashket patent is extended or adjusted under 35 5,210,296 A 5/1993 Cockrem et al. U.S.C. 154(b) by 0 days. 5,686,276 A 11/1997 Laffendet al. 6,013,494. A 1/2000 Nakamura et al. (21) Appl. No.: 13/839,246 6,177.264 B1 1/2001 Eggeling et al. 6,358,717 B1 3/2002 Blaschek et al. 6,579,330 B2 6/2003 Nakahama et al. (22) Filed: Mar 15, 2013 6,660,507 B2 12/2003 Cheng et al. 6,787,334 B1 9, 2004 Elischweski et al. (65) Prior Publication Data 7,632,663 B1 12/2009 Eggeling et al. 7.851,188 B2 * 12/2010 Donaldson et al...... 435,160 US 2014/OO3O794 A1 Jan. 30, 2014 7.993,889 B1 8/2011 Donaldson et al. 8,017,375 B2 9, 2011 Feldman et al. 8, 178,328 B2 5/2012 Donaldson et al. Related U.S. Application Data 8,273,558 B2 9/2012 Donaldson et al. 8,283,144 B2 * 10/2012 Donaldson et al...... 435,160 (63) Continuation of application No. 13/646,097, filed on 8,735,114 B2 5/2014 Donaldson et al. Oct. 5, 2012, which is a continuation of application 2002/00284.92 A1 3/2002 Lenke et al. No. 12/939,284, filed on Nov. 4, 2010, now Pat. No. 2004/0146996 A1 7/2004 Yocum et al. 8.283,144, which is a continuation of application No. 2004/O157301 A1 8, 2004 Chotani et al. 1 1/586,315, filed on Oct. 25, 2006, now Pat. No. 2009,0081746 A1 3/2009 Liao et al. 7,851,188. 2009, 0226991 A1 9, 2009 Feldman et al. (60) Provisional application No. 60/730,290, filed on Oct. (Continued) 26, 2005. FOREIGN PATENT DOCUMENTS (51) Int. Cl. AU 620802 B2 10, 1988 GOIN 33/573 (2006.01) CA 2O39.245 3, 1991 CI2P2/06 (2006.01) (Continued) CI2P 7/04 (2006.01) CI2N 9/00 (2006.01) OTHER PUBLICATIONS CI2N L/20 (2006.01) CI2N I/00 (2006.01) Wynn et al. J. Biol Chem. Jun. 25, 1992:267(18): 12400-3.* Bekkaoui. F., et al., “Isolation and structure of an acetolactate CI2N IS/00 (2006.01) Synthase gene from Schizosaccharomyces pombe and completion of C7H 2L/04 (2006.01) the ilv2 mutation in Saccharomyces cerevisiae, " Current Genetics CI2N 9/10 (2006.01) 24:544-547, Springer-Verlag, Germany 1993. CI2N 15/75 (2006.01) Card, J.C. and Farrell, L.M., “Separation of -Water Mixtures CI2N 9/04 (2006.01) Using Salts' in Technical Reports of Oak Ridge National Laboratory, CI2N 15/8 (2006.01) Chemical Technology Division, Contract No. W-7405-eng-26, 1982. CI2P 7/16 (2006.01) (Continued) CI2N 9/88 (2006.01) CI2N 15/70 (2006.01) CI2N 9/02 (2006.01) Primary Examiner — Christian Fronda CI2N 15/52 (2006.01) (57) ABSTRACT CI2N 15/74 (2006.01) Methods for the fermentative production of four carbon alco CI2N 9/06 (2006.01) hols is provided. Specifically, , preferably isobutanol (52) U.S. Cl. is produced by the fermentative growth of a recombinant CPC ...... CI2N 15/81 (2013.01); C12N 9/1096 bacterium expressing an isobutanol biosynthetic pathway. (2013.01); C12N 15/75 (2013.01); C12N 9/0006 (2013.01); CI2P 7/16 (2013.01); Y02E 17 Claims, 1 Drawing Sheet US 8,945,859 B2 Page 2

(56) References Cited Radmacher, E., et al., “Linking Central Metabolism with Increased Pathway Flux: L-Valine Accumulation by Corynebacterium U.S. PATENT DOCUMENTS glutamicum, "App Environ. Micro. 68:2246-2250, American Society for Microbiology, United States, 1993. 2009/0305363 A1 12/2009 Anthony et al. 2010.0081182 A1 4/2010 Paul et al. Renna, M.C., et al., “Regulation of the Bacillus subtilis als.S, alsD, 2010, 0120105 A1 5/2010 Anthony et al. and alsR Genes Involved in Post-Exponential-Phase Production of 2010/0129886 A1 5/2010 Anthony et al. Acetoin.” J. Bacteriology 175:3863-3875, American Society for 2010, O151545 A1 6, 2010 Roessler et al. Microbiology, United States, 1993. 2011/0053235 A1 3/2011 Festel et al. Rosenfield, E. and Beauvoit, B., “Role of the non-respiratory path 2011/011 1472 A1 5/2011 Donaldson et al. ways in the utilization of molecular oxygen by Saccharomyces 2011 0112334 A1 5/2011 Donaldson et al. cerevisiae," Yeast 20:1115-1144. John Wiley & Sons, Inc., United 2011 0160442 A1 6/2011 Pietarinen et al. 2011/0313206 A1 12/2011 Donaldson et al. States, 2003. 2013/0171706 A1 7/2013 Donaldson et al. Screen capture of http://enzyme...expasy.org/EC/2.2.1.6, the ExPASy. 2013,0183731 A1 7/2013 Donaldson et al. Bioformatics Resource Portal Nomenclature Database for 2014/0051151 A1 2/2014 Donaldson et al. EC No. 2.2.1.6. ExPASy Proteomics Server retrieved on Aug. 16. 2011. FOREIGN PATENT DOCUMENTS Screen capture of http://www.chem.qmul.ac.uk/iubmb? enzyme? EC2/2/1/6.html, the IUBMB Enzyme Nomenclature Database for EP O 112 459 A1 T 1984 EC No. 2.2.1.6, retrieved on Sep. 12, 2011. EP O 282474 A1 9, 1988 Smit, Ph.D. Thesis, Wageningen Universiteit (Wageningen, The EP O 315949 A2 5, 1989 EP 1 1499.18 A1 10, 2001 Netherlands), Formation of Amino Acid Derived Cheese Flavour JP 61-209594 9, 1986 Compounds, orally defended on Apr. 23, 2004, cataloged into the JP 63-017695 1, 1988 U.S.D.A. National Agricultural Library system on Oct. 3, 2004. JP 63-102687 5, 1988 Catalog Receipt from U.S.D. A. National Agricultural Library of JP 63-254986 10, 1988 Smit, Ph.D. Thesis, Wageningen Universiteit (Wageningen, The JP 2000-41655 A 2, 2000 Netherlands), Formation of Amino Acid Derived Cheese Flavour WO WO 90/02193 A1 3, 1990 Compounds, MARC Record View, 2 pages, indicating date cataloged WO WO 98.51813 A1 11, 1998 as 2004 1003 (i.e. Oct. 3, 2004) via MARC Code “005”. WO WOOOf 50624 A1 8, 2000 Re-examination Request Control No. 95/001.718, filed on Aug. 18. WO WOO1,21772 A2 3, 2001 2011. WO WO 2008/072920 A1 6, 2008 Re-examination Request Control No. 95/001.735, filed on Sep. 1, WO WO 2008/072921 A1 6, 2008 2011. OTHER PUBLICATIONS Complaint filed on Jan. 14, 2011 by Plaintiff ButamaxTM Advanced Biofuels LLC against Defendant Gevo, Inc. in the United States District Court for the District of Delaware, Case 1:1 1-cv-00054 Derrick, S. and Large, P., “Activities of the of the Ehrlich SRL-MPT. Pathway and formation of branched-chain in Sac Answer to Complaint filed on Mar. 25, 2011 by Defendant Gevo, Inc. charomyces cervisiae and Candida utilis grown in continous culuture in the United States District Court for District of Delaware, Case on valine or ammonium as sole nitrogen source. J. of General 1:11-cv-00054-SRL-MPT. Microbiology 139:2783-2792, Society for Chemical Microbiology, Amended Complaint filed on Aug. 11, 2011 by Plaintiff ButamaxTM Great Britain, 1993. against Defendant Gevo, Inc. in the United States District Court for Dickinson, J.R., et al., “An Investigation of the Metabolism of Valine the District of Delaware, Case 1:1 1-cv-00054-SRL-MPT. to Isobutyl Alcohol in Saccharomyces cerevisiae,” J. Biol. Chem. Answer to Amended Complaint filed on Sep. 13, 2011 by Defendant Gevo, Inc. in the United States District Court for the District of 273(40): 25751-25756, The American Society for Biochemistry and Delaware, Case 1:1 1-cv-00054-SRL-MPT. Molecular Biology, Inc., United States, 1998. Plaintiff's Opening Brief in Support of its Motion for a Preliminary Dickinson, J.R., et al., “The Catabolism of Amino Acids to Long Injunction (Reduced Version) filed on Sep. 30, 2011 in the United Chain and Complex Alcohols in Saccharomyces cerevisiae, "J. Biol. States District Court for the District of Delaware, Case 1:1 1-cv Chem. 278:8028-8034. The American Society for Biochemistry and OOO54-SRL-MPT. Molecular Biology, Inc., United States, 2003. Atsumi, S., et al., "Acetolactate synthase from Bacillus subtilis serves Hansen, J., et al., Topics in Current Genetics, Chapter, 5, vol. 2, J.H. as a 2-ketoisovalerate decarboxylase for isobutanol biosynthesis in de Winde (Ed.): Functional Genetics of Industrial Yeasts, Springer Escherichia coli, 'Appl. Environ. Microbiol. 75(19):6306-11, Ameri Verlag Berlin Heidelberg, Germany, pp. 143-170, 2003. can Society for Microbiology, United States (Oct. 2009): Epub: Aug. Ishige, T. et al., “Whole organism biocatalysis.” Current Opinion in 2009). Chemical Biology 9:174-180, Elesevier, The Netherlands, 2005. Seffernick, J.L., et al., “Melamine dearminase and atrazine Larroy, C., et al., "Characterization of the Saccharomyces cerevisiae chlorohydrolase: 98 percent identical but functionally different.” J. YMR318C (ADH6) gene product as a broad specificity NADPH Bacteriol. 183(8):2405-2410, American Society for Microbiology, dependentalcohol dehydrogenase: relevance in aldehyde reduction.” United States, Apr. 2001. Biochem J. 361: 163-172. Biochemical Society, Great Britain, 2002. Yoshimoto, H., et al., “Genetic and physiological analysis of Larroy, C., et al., “Properties and Functional Significance of Sac branched-chain alcohols and isoamyl acetate production in Sac charomyces cerevisiae ADHVL.” Chemico-Biological Interactions charomyces cervisiae," Appl. Microbiol. Biotechnol. 59(4-5):501-8, 143-144:229-238, Elesevier, The Netherlands, 2003. Springer International, Germany (Aug. 2002; Epub. Jun. 2002). Lehninger Principles of Biochemistry, 3rd ed., David L. Nelson and Peng, H.L., et al., “Cloning, sequencing and heterolgous expression Michael M. Cox, Eds. Worth Publishers, New York, NY. pp. 293 of a Klebisella penumoniae gene encoding an FAD-independent 294, 2000. acetolactate synthase.” Gene II 7(1): 125-130, Elesevier Science Matak-Vinkovic, D., et al., “Crystal Structure of Escherichia coli Publishers B.V., Netherlands, 1992. Ketopantoate Reductase at 1.7 A resolution and Insight into the De La Plaza, M., et al., “Biochemical and molecular characterization Enzyme Mechanism.” Biochemistry 40: 14493-14500, American of alpha-ketoisovalerate decarboxylase, an enzyme involved in the Chemical Society, United States, 2001. formation of aldehydes from amino acids by Lactococcus lactis,' Petersen, J.G.L., et al., “The JLV5 gene of Saccharomyces cerevisiae FEMS Microbiol. Lett. 238(2):367-74. Elsevier/North Holland on is highly expressed.” Nucl. Acids Res. 14:9631-9651, IRL Press Lim behalf of the Federation of European Microbiological Societies, ited, England, 1986. England, Sep. 2004. US 8,945,859 B2 Page 3

(56) References Cited Request for Reexamination of U.S. Patent No. 8,178,328, U.S. Con trol No. 95/001.998, Submitted May 25, 2012, including its Appen OTHER PUBLICATIONS dices and Exhibits. Memorandum Opinion of District Judge Robinson, in ButamaxTM Ullmann's Encyclopedia of Industrial Chemistry, 6' Edition, 5:716 Advanced Biofuels LLC vs Gevo, Inc., Case 1:11-cv-00054-SLR, 719, 2003. united States Court for the District of Delaware, dated Jun. 19, 2012; Carlini et al., “Guerbet Condensation of Method with N-Propanol to 26 pages. Isobutanol Alcohol Over Heterogenous Copper Chromite/Mg—Al Alasfour, F.N., “NO, Emission from a Spark Ignition Engine using Mixed Oxides Catalysts,” J. Mol. Catal. A. Chem. 220:215-220, 30% Iso-Butanol-Gasoline Blend; Part 1–Preheating Inlet Air.” 2004. Appl. Thermal Eng'g 18(5):245-56, Elsevier Science Ltd., England Garcia et al., “Fusel Alcohols Production in Beer Fermentation Pro (1998). cesses.” Process Biochemistry 29:303-309, 1994. Alasfour, F.N., “NO, Emission from a Spark Ignition Engine using Durre, “New Insights and Novel Developments in Clostridial 30% Iso-Butanol-Gasoline Blend; Part 2—Preheating Inlet Air.” Acetone/Butanol/Isopropanol Fermentation.” Applied Microbiology Appl. Thermal Eng'g 18(8):609-18, Elsevier Science Ltd., England and Biotechnology 49:639-648, 1998. (1998). Harris et al., “Characterization of Recombinant Strains of the Atsumi, S., et al., “Non-fermentative pathways for synthesis of Clostridium acetobutyllicum Butrate Kinase Inactivation Mutant: branched-chain higher alcohols as biofuels.” Nature 451 (7174):86 Need for New Phenomenological Models for Solventogenesis and 89, Nature Publishing Group, England (2008). Butanol Inhibition.” Biotechnology and Bioengineering 67: 1-11, Atsumi, S., et al., “Direct photosynthetic recycling of carbon dioxide 2000. to isobutyraldehyde.” Nat. Biotechnol. 27(12): 1177-80, Nature Pub International Search Report and Written Opinion of corresponding lishing Group, England (2009). PCT/US2006/041602, European Patent Office, Rijswijk, Nether Ayräpää, T., “Formation of Higher Alcohols From "C-Labelled lands, mailed Apr. 11, 2007. Valine and Leucine.” J. Inst. Brewing, 73:17-30, W. Heffer & Sons, International Preliminary Report on Patentability of corresponding Ltd. England (1967). PCT/US2006/041602, European Patent Office, Rijswijk, Nether Flint, D.H., et al., “The Inactivation of Dihydroxy-acid Dehydratase lands, mailed May 8, 2008. in Escherichia coli Treated with Hyperbaric Oxygen Occurs Because Chen. Thesis, McGill University (Montreal, Canada), “Formation of the Destruction of Its Fe—S Cluster, but the Enzyme Remains in and Analysis of Fusel Alcohols in Beer.” Submitted to the Faculty of the Cell in a Form That Can Be Reactivated,” J. Biol. Chem. Graduate Studies and Research, Department of Agricultural Chem 268(34):25547-25552. The American Society for Biochemistry and istry (1978). Molecular Biology, Inc., United States (1993). Oshita, K., et al., “Clarification of the relationship between fusel Glick, B.R., “Metabolic Load and Heterologous Gene Expression.” alcohol formation and amino acid assimilation by brewing yeast Biotechnol. Adv. 13:247-261, Elsevier Science, Ltd., England (1995). using "C-labeled amino acid.” Proc. Eur: Brewery Convention Jones, D.T. and Woods, D.R., "Acetone-Butanol Fermentation Revis Congr: 387-394 (1995). ited.” Microbiol. Rev. 50(4):484-524. American Society for Order Denying Request for Inter Partes Reexamination of U.S. Patent Microbiology, United States (1986). No. 7,851, 188, mailed Oct. 27, 2011, U.S. Control No. 95/001,718, Kispal, G., et al., “Mitochondrial and Cytosolic Branched-chain filed Aug. 18, 2011. Amino Acid Transaminases from Yeast, Homologs of the myc Petition Under 37 CFRSS 1927 and 1.181 for Supervisory Review of Oncogene-regulated Eca39 Protein.” J. Biol. Chem. 271 (40):24458 Refusal to Order Reexamination for Claims 1-3, 13-15, 17-24, and 24464. The American Society for Biochemistry and Molecular Biol 34-37, mailed Nov. 28, 2011, U.S. Control No.95/001,718, filed Aug. ogy, Inc., United States (1996). 18, 2011. Kohlhaw, G.B., "Leucine Biosynthesis in Fungi: Entering Metabo Second Request for Reexamination of U.S. Patent No. 7,851,188, lism through the Back Door.” Microbiol. Mol. Biol. Rev. 67: 1-15. U.S. Control No. 95/001,857, filed Dec. 19, 2011. American Society for Microbiology, United States (2003). Order Granting Request for Inter Partes Reexamination of U.S. Lagier, M.J., et al., “Mitochondrial-type iron-sulfur cluster Patent No. 7,851,188, mailed Mar. 5, 2012, U.S. Control No. biosynthesis genes (Ise S and Isel ) in the apicomplexan 95/001,857, filed Dec. 19, 2011. Cryptosporidium parvum, " Microbiology 149:3519-3530, SGM, Office Action in Inter Partes Reexamination of U.S. Patent No. 7.851,188 mailed Mar. 5, 2012, U.S. Control No. 95/001,857, filed England (2003). Dec. 19, 2011. Llopis, J., et al., “Measurement of cytosolic, mitochondrial, and Petition of Patent Owner Under 37 CFRSS 1.181 and/or 1.183 to Golgi pH in single lving cells with green flourescent proteins.” Proc. Vacate the Order Granting Second Reexamination Request, mailed Natl. Acad Sci. USA 95:6803-6808, The National Academy of Sci Mar. 19, 2012, U.S. Control No. 95/001,857, filed Dec. 19, 2011. ences, United States (1998). Opposition to Petition of Patent Owner Under 37 CFR SS 1.181 Marobbio, C.M.T. et al., “O-Isopropylmalate, a Leucine and/or 1.183 to Vacate the Order Granting Second Reexamination biosynthesis Intermediate in Yeast , is Transported by the Request, mailed Apr. 2, 2012, U.S. Control No. 95/001,857, filed Mitochondrial Oxalacetate Carrier.” J. Biol. Chem. 286(42):28445 Dec. 19, 2011. 28453. The American Society for Biochemistry and Molecular Biol Order Granting Request for Inter Partes Reexamination of U.S. ogy, Inc., United States (2008). Patent No. 7,993,889, mailed Nov. 25, 2011, U.S. Control No. Outten, C.E. and Culotta, V.C., “Alternative Start Sites in the Sac 95/001,735, filed Sep. 1, 2011. charomyces cerevisiae GLRI Gene Are Responsible for Mitchondrial Office Action in Inter Partes Reexamination of U.S. Patent No. and Cytosolic Isoforms of Glutahione Reductase.” J. Biol. Chem. 7.993,889 mailed Nov. 25, 2011, U.S. Control No. 95/001,735, filed 279(9):7785-7791, The American Society for Biochemistry and Sep. 1, 2011. Molecular Biology, Inc., United States (2004). Response filed Feb. 24, 2012 in Inter Partes Reexamination of U.S. Popuri, S.S.S. and Bata, R.M., “A Performance Study of Iso Patent No. 7.993,889, U.S. Control No. 95/001,735, filed Sep. 1, Butanol-, -, and -Gasoline Blends Using a Single 2011. Cylinder Engine.” Truck Alternative Fuels and Exhaust Gas Emis Response filed Feb. 27, 2012 in Inter Partes Reexamination of U.S. sion, SP-1001,932953, pp. 41-60. The Society of Automotive Engi Patent No. 7.993,889, U.S. Control No. 95/001,735, filed Sep. 1, neers, Inc., United States (1993). 2011. Ryan, E.D. and Kohlhaw, G.G., “Subcellular Localization of Third Party Requester Comments. After Non-Final Office Action, Isoleucine-Valine Biosynthetic Enzymes in Yeast.” J. Bacteriol. filed Mar. 26, 2012 in Inter Partes Reexamination of U.S. Patent No. 120(2):631-637. American Society for Microbiology, United States 7.993,889, U.S. Control No. 95/001,735, filed Sep. 1, 2011. (1974). US 8,945,859 B2 Page 4

(56) References Cited Reazin, G., et al., “Mechanism of Major Congener in Alcoholic Grain Fermentations.” J. Agr: Food Chem. 18(4):585-589, American OTHER PUBLICATIONS Chemical Society, United States (1970). Magee, P.T. and De Robichon-SZulmaster, H., “The Regulation of Sarthy, A.V., et al., “Expression of the Eshecrichia coli Xylose Isoleucine-Valine Biosynthesis in Saccharomyces cerevisiae," Euro Isomerase Gene in Saccharamyces cerevisiae,' Appl. Environ. pean J. Biochem. FEBS 3:507-511, Federation of European Bio Microbiol. 53(9): 1996-2000, American Society for Microbiology, chemical Societies, Germany (1968). United States (1987). Glassner, D.A., “Hydrocarbon Fuels from Plant Biomass' available Stephanopoulos, G.A. et al. In Metabolic Engineering Principles at http://www1.eere.energy.gov/biomass/pdfs/Biomass 2009 and Methodologies, pp. 1-15 and 26-37, Academic Press, United Adv. Biofuels H Glassner.pdf (2009). States (1998). Bayrock. D., “Fusel Oil Recycle—A Silent, Odorous Killer.” Ethanol Chin, M.. “UCLA researchers develop method for production of Producer Magazine, BBI International, United States, accessed at more efficient biofuels. UCLA Newsroom, Jan. 2, 2008, available at http://ethanolproducer.com/articles/8774/fusel-oil http://newsroom.ucla.edu/portal/ucla?ucla-engineering-researchers recycleundefineda-silent-odorous-killer, May 10, 2012. develop-42502.aspx, UC Regents, United States. Atsumi, S. and Liao, J.C., “Metabolic engineering for advanced Petition Denial, mailed Mar. 5, 2012, U.S. Control No. 95/001,718, biofuels production form Escherichia coli," Curr: Op. Biotechnol. filed Aug. 18, 2011. 19:414-419, Elsevier Ltd., England (2008). Decision on Petition Denied, Re-examination Request Terminated, Keasling, J.D. and Chou, H., “Metabolic engineering delivers next mailed May 23, 2012, U.S. Control No. 95/001,718, filed Aug. 18, generation biofuels.” Nature Biotechnology 26(3):298-299, Nature 2011. Publishing Group, England (2008). The Presidential Green Chemistry Challenge Awards Program: Sum Boulton, et al., 2001, Brewing Yeast & Fermentation, Chapters 3-4, mary of 2010 Award Entries and Recipients, United States Environ first ed., Blackwell Science Ltd, Oxford United Kingdom, pp. mental Protection Agency, 58 pages. 69-259. BRENDA Comprehensive Enzyme Information System entry for EC Response to Office Action filed Jun. 6, 2012 in Reexamination of U.S. 1.1.1.2 alcohol dehydrogenase (NADP+) in E. coli, accessed www. Patent No. 7,851, 188, U.S. Control No. 95/001,857, filed Dec. 19, brenda-enzymes.org, accessed on Jun. 1, 2012, 8 pages. 2011. Chen, E.C.-H... "Keto Acid Decarboxylase and Alcohol Declaration of Professor Alexander M. Klibanov, filed Jun. 5, 2012, Dehydrogenase Activities of Yeast in Relation to the Formation of in Re-examination of U.S. Patent 7,851, 188, U.S. Control No. Fusel Alcohols.” Can. Inst. Food Sci. Technol. J. 10:27-30, Canadian 95/001,857, filed December 19, 2011. Institute of Food Science and Technology, Canada (1977). Declaration of Larry C. Anthony, filed Jun. 5, 2012 in Reexamination Eden, A., et al., “Involvement of branched-chain amino acid of U.S. Patent 7,851,188, U.S. Control No. 95/001,857, filed Dec. 19, aminotransferases in the production of fusel alcohols during fermen 2011. tation in yeast.” Appl. Microbiol. Biotechnol. 55:296-300, Springer Requester's Opposition Petition to Return or Expunge Patent Own er's Petition, filed Jun. 20, 2012, in Reexamination of U.S. Patent Verlag, Germany (2001). 7.851,188, U.S. Control No. 95/001,857, filed Dec. 19, 2011. Hansen, J. and Kielland-Brandt, M.C., “Modification of biochemical Petition of Patent Owner to Seek Supervisory Review of Dismissal of pathways in industrial yeasts.” J. Biotechnol. 49:1-12, Elsevier Sci Petition to Vacate the Order Granting Third Party Requester's Second ence B.V., Netherlands (1996). Reexamination Request, filed Jun. 11, 2012, in Reexamination of Holmer, S. and Litske Petersen, J.G., “Regulation of isoleucine U.S. Patent 7,851,188, U.S. Control No. 95/001,857, filed Dec. 19, valine biosynthesis in Saccharomyces cerevisiae," Curr. Genet. 2011. 13:207-217. Springer-Verlag, Germany (1988). “Boosting Biomass-to . . . Butanol'?”. Green Car Congress, Jul. 20. Polaina, J., “Cloning of the ILV2, ILV3, and ILV5 Genes of Sac 2005, available athttp://www.greencarcongress.com/2005/07/boost charomyces cerevisiae," Carlsberg Res. Commun. 49:577-584. ing biomass.html. Springer-Verlag, Germany (1984). Bailey, J.E., “Toward a Science of Metabolic Engineering.” Science Rainbow, C., In The Yeasts, vol. 3, Rose, A.H. and Harrison, J.S., eds., 252: 1668-1675, American Association for the Advancements of Sci pp. 190-199, Academic Press, United States (1970). ence, United States (1991). Schulthess, D. and Ettlinger, L., “Influence of the Concentration of Lee et al., 1999, Metabolic Engineering, First Ed., Lee, S.Y. and Branched Chain Amino Acids on the Formation of Fusel Alcohols.” Papoutsakis E.T. Eds. Marcel Dekker, United States, p. 292-293. J. Inst. Brew: 84:240-243, W. Reffer & Sons, Ltd. England (1978). Walker, G.M., “Yeast Technology,” in Yeast Physiology and Van Maris, A.J.A., et al., “Directed Evolution of Pyruvate Biotechnology, John Wiley & Sons, Ltd, Chichester, England, pp. Decarboxylase-Negative Saccharomyces cerevisiae, Yielding a 265-320 (1998). C-Independent, Glucose-Tolerant, and Pyruvate-Hyperproducing Watanabe et al., “Mutants of bakers' yeasts producing a large amount Yeast.” Appl. Environ. Microbiol. 70(1): 159-166, American Society, of isobutyl alcohol or , flavour components ofbread.” for Microbiology, United States (2004). Applied Microbiology and Biotechnology 34:154-159, Springer Velasco, J.A., et al., “Cloning of the dihydroxyacid dehydratase Verlag, Germany (1990). encoding gene (ILV3) from Saccharomyces cerevisiae,' Gene Yoshizawa et al., “The Formation of Higher Alcohols in the Fermen 137: 179-185, Elsevier Sciense B.V., Netherlands (1993). tation of Amino Acids by Yeast. The Formation of Isobutanol and Webb, A.D. and Ingraham, J.L., “Fusel Oil” in Advances in Appl. Isoamyl Alcohol from Pyruvic Acid by Washed Yeats Cells.” Agri Microbiol., vol. 5, pp. 317-353, Academic Press Inc., England cultural and Biological Chemistry 29:672-677. Agricultural Chemi (1963). cal Society of Japan, Japan (1965). “Butamax Expands Early Adopters Group AS Two New Ethanol English language abstract for JP 63-017695, File 347. Accession No. Producers Join for Early Access to Biobutanol Production', available 2400795, Derwent WPI English language abstract for JP 63-017695, at http://www.butamax.com/ assets/pdf butamax',620announces published Jan. 25, 1988. %202%20new%20eag%20may%201%202012.pdf, May 1, 2012. English language abstract for JP 63-254986, File 347. Accession No. Stephanopoulos Preliminary Injunction Hearing Transcript, pp. 114 2638086, Derwent WPI English language abstract for JP 63-254986, 117. ButamaxTM Advanced Biofuels LLC v. Gevo, Inc., Case 11-054 published Oct. 21, 1988. SLR-MPT, U.S. District Court for the District of Delaware, Mar. 1, English language abstract for JP 63-102687. File 347. Accession No. 2012. 2485787, Derwent WPI English language abstract for JP 63-102678, Omura, F. “Targeting of mitochondrial Saccharomyces cerevisiae published May 7, 1988. ILv5p to the cytosol and its effect on vicinial diketone formation in English language abstract for JP 61-209594, File 347. Accession No. brewing.” Appl. Microbiol. Biotenchol. 78:503-513, Springer 1995494, Derwent WPI English language abstract for JP 61-209594, Verlag, Germany (2008). published Sep. 17, 1986. US 8,945,859 B2 Page 5

(56) References Cited Hammond, J.R.M.. “Brewer’s Yeasts.” in The Yeasts, vol. 5, 2n" Edition, Rose, A.H. and Harrison, J.S., eds., pp. 7-67, Academic OTHER PUBLICATIONS Press, United States (1993). Third Party Requester Comments. After Patent Owner Response to Third Party Requester Declaration of Dr. Stephanopoulos, filed Nov. Non-Final Office Action, filed Jul. 5, 2012, Inter Partes Reexamina 28, 2011, U.S. Control No. 95/001,718, filed Aug. 18, 2011. tion of U.S. Patent No. 7,851 188, U.S. Control No. 95/001,857, filed Patent Owner Declaration of Professor Klibanov, filed Feb. 24, 2012, Dec. 19, 2011. U.S. Control No. 95/001,735, filed Sep. 1, 2011. Third Party Requester Declaration of Dr. Stephanopoulos. After Non Third Party Declaration of Dr. Glassner, filed Jul. 5, 2012, U.S. Final Office Action, filed Mar. 26, 2012, U.S. Control No. Control. No. 95/001,857, filed Dec. 19, 2011. 95/001,735, filed Sep. 1, 2011. Chen, et al., “Increased isobutanol production in Saccharomyces Third Party Requester Declaration of Dr. Porter-Scheinman After cerevisiae by overexpression of genes in valine metabolism.” Non-Final Office Action, filed Mar. 26, 2012, U.S. Control No. Biotechol. Biofuels 4(21):1-12 BioMed Central Ltd., England 95/001,735, filed Sep. 1, 2011. (2011). Third Party Requester Declaration of Dr. Stephanopoulos, filed May Hammond, J.R.M., “Genetically-modified brewing yeasts for the 25, 2012, U.S. Control No. 95/001,998, filed May 25, 2012. 21st century. Progress to date.” Yeast II (16): 1613-27, John Wiley & Ayräpää, T., “The Formation of from "C-La Sons Ltd, United States (1995). belled Phenylalanine.” J. Inst. Brewing 71:341-347, W. Heffer & U.S. Appl. No. 60/900,477, Lino et al., filed Feb. 9, 2007. Sons, Ltd., England (1965). U.S. Appl. No. 60/900,546, Lino et al., filed Feb. 9, 2007. Ayräpää, T., “Formation of Higher Alcohols by Various Yeasts.” J. “Diet beer offers a slim hope.” http://www.independent.co.uk/news/ Inst. Brewing 74: 169-178, W. Heffer & Sons, Ltd, England (1968). diet-beer-offers-a-slim-hope-1305762.html. The IndependentNews Causton, H.C., et al., “Remodeling of Yeast Genome Expression in paper, Apr. 20, 1996. Response to Environmental Changes.” Mol. Biol. Cell 12:323-337. Herman, R.G., “Advances in catalytic synthesis and utilization of The American Society for Cell Biology, United States (2001). higher alcohols.” Catalysis Today 55(3):233-245, Elsevier B.V. Trinh, C.T. et al., “Redesigning Escherichia coli Metabolism for Netherlands (2000). Anaerobic Production of Isobutanol.” Appl. Env, Microbiol. 77:4894 Olson, E.S., et al., “Higher-alcohols biorefinery: Improvement of 904, American Society for Microbiology, United States (2011). catalyst for ethanol conversion.” Appl. Biochem. Biotechnol. 1 13 Kolkman, A., et al., “Comparative Proteome Analysis of Sac charomyces cerevisiae Grown in Chemostat Cultures Limited for I 16:913-932, Humana Press, United States (2004). Glucose or Ethanol. Mol. Cell. Proteom 4:1-11, The American Soci Sheldon-Coulson, “Production of Levulinic Acid in Urban ety for Biochemistry and Molecular Biology, Inc., United States Biorefineries.” M.S. Thesis. Sep. 12, 2011, 84 pp., Massachusetts (2005). Institute of Technology, United States. Boer, V.M., et al., “The Genome-wide Transcription Responses of Sequence Alignment SEQID No. 2 vs Peng's Accession No. P27696, Saccharomyces cerevisiae Grown on Glucose in Aerobic Chemostat provided with Third Party Requester Comments. After Patent Owner Cultures Limited for Carbon, Nitrogen, Phosphorus, or Sulfur.” J. Response to Non-Final Office Action, filed Jul. 5, 2012, Inter Partes Biol. Chem. 278:3265-3274. The American Society for Biochemistry Reexamination of U.S. Patent No. 7,851 188, U.S. Control No. and Molecular Biology, Inc., United States (2003). 95/001,857, filed Dec. 19, 2011. Frodyma, M.E. and Downs, D., "ApbA, the Ketopantoate Reductive Presecan, E., "The Bacillus subtilis genome from gerBC (311) to Enzyme Salmonella typhimurium is required for the Synthesis of licR (334).” Microbiology 143:3313-3328, SGM, England (1997). thiamine via the Alternative Pyrimidine Biosynthetic Pathway.” J. Bolotin, A., “The Complete Genome Sequence of the Lactic Acid Biol. Chem. 273:5572-76, The American Society for Biochemistry Bacterium Lactocuccus lactis ssp. lactis IL1403. Genome Res. and Molecular Biology, Inc., United States (1998). 1 I(5):731-753, Cold Spring Harbor Press, United States (2001). Inoue, T., “Mechanism of Higher Alcohol Formation During Wort Pretorius, I.S., et al., “Designer Yeasts for the Fermentation Industry Fermentation by Brewer's Yeast.” Rept. Res. Lab. Kirin Brewery Co. of the 21st Century.” Food Technol. Biotechnol 41(1):3-10, Journal of 18:13-16. The Research Laboratories of Kirin Brewery Co., Ltd., the Faculty of Food Technology and Biotechnology, Croatia (2003). Japan (1975). Alberts, et al., “Chapter 3, Macromolecules: Structure, Shape and Chen, E. C.-H... “The Relative contribution of Ehrlich and Information.” in Molecular Biology of the Cell, 3" Ed., pp. 134-135, Biosynthetic Pathways to the Formation of Fusel Alchols,” J. Amer: Garland Publishing, United States (1994). Soc. Brewing Chem. 36(1):39-43, American Society of Brewing Third Party Requester Declaration of Dr. Stephanopoulos, filed Jul. 5, Chemists, Inc., United States (1978). 2012, U.S. Control No. 95/001,857, filed Dec. 19, 2011. Norbeck, J. and Bloomberg, A., “Metabolic and regulatory changes “Gevo Announces Successful Startup of World's First Commercial associated with growth of Saccharomyces cerevisiae in 14MNaCl: Biobased Isobutanol Plant. Gevo Investor Relations News Release, Evidence for osmotic induction of gylcerol dissimilation via the May 24, 2012, 2 pages, accessed at http://irgevo.com/phoenix. dihydroxyacetone pathway.” J Biol Chem. 272(9):5544-54. The Zhtml?c=238618&p=irol-newsArticle&ID=1699401&highlight=. American Society for Biochemistry and Molecular Biology, Inc., United States (1997). De Kok, S., et al., “Energy coupling in Saccharomyces cerevisiae: Unverified English language translation of Japanese Patent Applica Selected opportunities for metabolic engineering.” Federation of tion No.JP 2000-041655A, publication date Feb. 15, 2000. European Microbiological Societies FEMS Yeast Re 12:387-397. Kotula, Land Curtis, P.J., “Evaluation of Foreign Gene Codon Opti Blackwell Publishing Ltd., England (2012). mization in Yeast: Expression of a Mouse IG Kappa Chain.” Nature "Agricultural Futures” in The Wall Street Journal Online, U.S. Edi Biotechnology 9. 1386-1389, Nature Publishing Group, England tion, Thursday, Jun. 28, 2012, 8 pages, accessed at http://online.wsj. (1991). com/mdc/public/page/2. 3023-fut agricultural-futures. Kassow, A., Metabolic effects of deleting the region encoding the html?mod=mdc c, Dow Jones & Company, Inc., United States. transit peptide in Saccharomyces cerevisiae ILV5. Thesis for the Zaworksi. F., ed., “US Oxo-alcohols sinking lower.” ICISpricing cand. Scient. degree at Institute of Genetics, Univeristy of Oxo-Alcohols, Jun. 22, 2012, 2 pages, Reed Business Information Copenhagen, Department of Yeast Genetics, 48 pages, Denmark Limited, England. (1992). Kwiatkowski, J.R., et al., “Modeling the process and costs of fuel U.S. Appl. No. 61/016.483, Feldman et al., filed Dec. 23, 2007. ethanol production by the corn dry-grind process.” Industrial Crops Blombach, B., et al., “Corynebacterium ghatamicum Tailored for and Products 23:288-296, Elsevier B.V., Netherlands (2006) Efficient Isobutanol Production.” Appl. Environ. Microbiol. Natural Gas Weekly Update for Week Ending Jun. 27, 2012, Release 77(10):3300-3310. The American Society for Microbiology, United Date Jun. 28, 2012, U.S. Energy Information Administration, 10 States (2011). pages, accessed at http://205.254.135.7/naturalgas/weekly. US 8,945,859 B2 Page 6

(56) References Cited butamax-early-adopters-group-surpasses-capacity-targets-with-ad diction-of-big-river-membership-represents-11-production-facili OTHER PUBLICATIONS ties-and-nearly-900-million-gallons-of-ethanol-capacity 150348995.html, . Bevill, K., et al., “Proposed Ethanol Plant List: 2008 United States & Brat, D., et al., “Cytosolic re-localization and optimization of valine Canada Part 1.” Ethanol Producer Magazine, EthanolProducer.com Synthesis and catabolism enables increased isobutanol production Apr. 1, 2008, 9 pages, accessed at http://www.ethanolproducer.com/ with the yeast Saccharomyces cerevisiae,” Biotechnology for articles/3851/proposed-ethanol-plant-list-2008-united-states-and Biofiules 5(65): 1-16, BioMed Central Ltd., England (2012). canada-part-l. Marquet, A., et al., “BioSynthesis of biotin and lipoic acid.” Vitam. “Who Shall Dare: Biobutanol and the intrepid ehtanol producer.” Biofuelsdigest.com, Jun. 22, 2012, Biofuels Digest, United States, 4 Horm. 6 1:51-101, Academic Press, United States (2001). pages, accessed at http://biofuelsdigest.com/bdigest/2012/06/22/ Ottenhoff, H.H., et al., “Organisation of the pantothenate (vitamin who-shall-dare-biobutanol-and-the-intrepid-ehtanol-producer?. B5) biosynthesis pathway in higher plants.” Plant J. 37:61-72, Eberhardt, I., et al., “Autoregulation of yeast pyruvate decarboxylase Blackwell Scientific Publishers, England (2004). gene expression requires the enzyme but not its catalystic activity.” Streit, W.R. and Entcheva, P. "Biotin in microbes, the genes involved Eur: J. Biochem 262(1):191-201, Federation of European Biochemi in its biosynthesis, its biochemical role and perspectives for cal Societies, England (1999). biotechnological production.” Appl. Microbiol. Biotechnol. 61:21 Hohmann, S. and Cedeberg, H., “Autoregulation may control the 31, Springer-Verlag, Germany (2003). expression of yeast pyruvate decarboxylase structural genes PDCI Magliano, P. et al., “Contributes of the peroxisome and B-oxidation and PDC5, "Eur: J. Biochem. 188(3):615-621, Federation of Euro cycle to biotin synthesis in fungi.” J. Biol. Chem. 286:42133-42140, pean Biochemical Societies, England (1990). American Society for Biochemistry and Molecular Biology, United Moller, K., et al., “Pyruvate decarboxylases from the petite-negative States (2011). yeast Saccharomyces kluyveri," Mol. Genet. Genomics 270(6):588 United States Court of Appeals for the Federal Circuit Decision, Case 568, Springer-Verlag, Germany (2004). No. 11-CV-0054-SLR; Appeal from United States District Court for Ter Schure, E.G., et al., “Pyruvate Decarboxylase Catalyzes the District of Delaware, Nov. 16, 2012. Decarboxylation of Branched-Chain 2-Oxo Acids But Is Not Essen Complaint, ButamaxTM Advanced Biofuels LLC v. Gevo, Inc., 1:12 tial for Fusel Alcohol Production by Saccharomyces cerevisiae,” cv-00602-SLR, U.S. District Court, District of Delaware, filed May Appl. Environ. Microbiol. 64(4): 1303-1307, American Society for Microbiology, United States (1998). 15, 2012. Vuralhan, Z. et al., “Physiological Characterization of the ARO 10 Answer to Complaint, ButamaxTM Advanced Biofuels LLC v. Gevo, Dependent, Broad-Substrate-Specificity 2-Oxo Acid Decarboxylase Inc., 1:12-cv-00602-SLR, U.S. District Court, District of Delaware, Activity of Saccharomyces cerevisiae," Appl. Envirion. Microbiol. filed Jun. 8, 2012. 71(6):3276-3284. American Society for Microbiology, United States "Getting Published in Nature: The Editorial Process,” accessed at (2005). http://www.nature.com/nature/authors/get published, accessed on Request for Ex Parte Reexamination of U.S. Patent No. 7.993,889 Dec. 19, 2012. with Exhibits, U.S. Control No. 90/012,503, filed Sep. 12, 2012. Dumas, R., et al., “Isolation and kinetic properties of acetohydroxy Declaration of Dr. Stephanolpoulos, filed Sep. 12, 2012, U.S. Control acid isomeroreductase from spinach (Spinacia oleracea) chlorplasts No. 90/012,503, filed Sep. 12, 2012. overexpressed in Escherichia coli,' Biochem. J. 288:865-874, Pub Office Action mailed Sep. 21, 2012, in Inter Partes Reexamination of lished by Portland Press, England (1992). U.S. Patent No. 8, 178,328, filed Jun. 21, 2012, U.S. Control No. Pang, S.S., et al., “The Crystal Structures of Klebsiella pneumoniae 95/001,998. Acetolactate Synthase with Enzyme-bound and with an Ordering Granting Request Inter Partes Reexamination of U.S. Unusual Intermediate.” J. Biol. Chem. 279(3):2242-2253, American Patent No. 8,178,328, filed Jun. 21, 2012, U.S. Control No. Society for Biochemistry and Molecular Biology, Inc., United States 95/001,998. (2004). Researchers Significantly Boost Yield of Isobutanol from Engineered Flint, D.H., et al., “The Role and Properties of the Iron-Sulfur Cluster Yeast Using New Synthesis Pathway Located in the Cytosol, pub in Escherichia coli Dihydroxy-acid Dehydratase.” J. Biol. CHem. lished Nov. 6, 2012, available at http://www.greencarcongress.com/ 268 (20): 14732-14742, American Society for Biochemistry and 2012/11/boles-20121106.html. Engineered Yeast Produces Ethanol and Butanol from C5 and C6 Molecular Biology, Inc., United States (1993). Sugars from Biomass Feedbacks, published Mar. 29, 2010, available Boonstra, B., et al., "Cofactor Regeneration by a Soluble Pyridine at http://www.greencarcongress.com/2010/03/weber-20100329. Transhydrogenase for Biological Production of html. Hydromorphone.” Applied and Environmental Microbiology Butalco to Begin Cellulosic Ethanol Production in Summer 2010 in 66(12):5161-5166, American Society for Microbiology, United Germany, published Feb. 24, 2010, available at http://www. States (2000). greencarcongress.com/2010/02/butalco-2010.0224.html. “Gevo Ramps Up Post-IPO: Executive Team Leads Next Round of First Yeast to Produce Biobutanol, published Sep. 7, 2009, available Renewables, Chemical Week Oct. 3/10, 2011, IHS, Inc., accessed at at http://www.pressebox.de/pressemitteilung?butalco-gmbh/First http://www.gevo.com/wp-content/uploads/2011/10/044 cwk Yeasts-to-Produce-Biobutanol boxid/286731. 101011 comp.pdf, accessed on Dec. 20, 2012. Savrasova, E.A., et al., “Use of the valine biosynthetic pathway to Repsonse to Inter Partes Reexamination Office Action filed Dec. 21. convert glucose into isobutanol.” J. Ind. Microbiol. Biotechnol. 2012 in Inter Partes Reexamination of U.S. Patent No. 8, 178.328, 38: 1287-1294, Springer, Germany (2011). filed Jun. 21, 2012, U.S. Control No. 95/001,998. Researchers Boost Isobutanol Production in Yeast, published Jul. 28, Declaration of Dr. Larry C. Anthony Accompanying Response to 2011, available at http://www.greencarcongress.com/2011/07/tud Inter Partes Reexamination Office Action, in Inter Partes Reexami 20110728.html. nation of U.S. Patent No. 8, 178,328, filed Jun. 21, 2012, U.S. Control Matsuda, F., et al., “Construction of an Artificial Pathway for No. 95/001,998. Isobutanol Biosynthesis in the Cytosol of Saccharomyces Declaration of Dr. Alexander M. Klibanov Accompanying Response cerevisiae." Biosci. Biotechnol. Biochem. 76(11):2139-2141, Japan to Inter Partes Reexamination Office Action, in Inter Partes Reex Society for Bioscience, Biotechnology, and Agrochemistry, Japan amination of U.S. Patent No. 8,178,328, filed Jun. 21, 2012, U.S. (2012). Control No. 95/001,998. Butamax Early Adopters Group surpasses capacity targets with addi Declaration of Dr. Janice Pero Accompanying Response to Inter tion of Big River, Membership represents II production facilities and Partes Reexamination Office Action, in Inter Partes Reexamination nearly 900 million gallons of ethanol capacity, published Jun. 26, of U.S. Patent No. 8,178,328, filed Jun. 21, 2012, U.S. Control No. 2012, available at http://www.prnewswire.com/news-releases/ 95/001,998. US 8,945,859 B2 Page 7

(56) References Cited ButamaxTM Technology & Intellectual Property FAO, accessed at http://butamaxpatents.com/FAQ.aspx on Nov. 18, 2013, ButamaxTM OTHER PUBLICATIONS Advanced Biofuels LLC. Butamax and Highwater Ethanol Break Ground on Biobutanol Ret Memorandum Opinion of District Judge Robinson, in ButamaxTM rofit Project Including Installation of Novel Corn Oil Separation Advanced Biofuels LLC vs. Gevo, Inc., Case 1:1 1-cv-00054-SLR, Technology, published Oct. 2, 2013, ButamaxTM Advanced Biofuels United States District Court for the District of Delaware, filed Mar. LLC. 19, 2013; 57 pages. Albertsen, L., et al., “Diversion of Flux toward Sequiterpene Produc Order of District Judge Robinson, in ButamaxTM Advanced Biofuels tion in Saccharomyces cerevisiae by Fusion of Host and LLC vs. Gevo, Inc., Case 1:1 1-cv-00054-SLR, United States District Heterologous Enzymes.” Applied and Enviro. Microbiol. Court for the District of Delaware, filed Mar. 19, 2013: 2 pages. 77(3):1033-1040, American Society for Microbiology, United States Final Judgement of District Judge Robinson, in ButamaxTM (2011). Advanced Biofuels LLC vs. Gevo, Inc., Case 1:1 1-cv-00054-SLR, Becker, J.V.W., et al., “Metabolic Engineering of Saccharomyces United States District Court for the District of Delaware, filed Apr. 5, cerevisiae for the synthesis of the wine-related antioxidant 2013; 2 pages. resveratrol. FEMS Yeast Res. 4:79-85, Elsevier B.V., Netherlands Pronk, J.T. et al., “Pyruvate Metabolism in Saccharomyces (2003). cerevisia,” YEAST 12:1607-1633, John Wiley Sons, Ltd., United Bricker, D.K., et al., “A Mitochondrial Pyruvate Carrier Required for States (1996). Pyrovate Uptake in Yeast, Drosophila, and Humans.” Science Stephanopolous Deposition Testimony Transcript, pp. 258-265, 337.96-100, American Association for the Advancement of Science, ButamaxTM Advanced Biofuels LLC v. Gevo, Inc., Case 11-054-SLR United States (2012). MPT, U.S. District Court for the District of Delaware, Nov. 19, 2012. Cordier, H., et al., “A metabolic and genomic study of engineered Avalos, J.L., et al., “Compartmentalization of metabolic pathways in Saccharomyces cerevisiae strains for high production.” yeast mitochondria improves the production of branched-chain Metabolic Engineering 9:364-378, Academic Press, United States alcohols.” Nature Biotechnology, Advance Online Publication: 1-9, (2007). Nature America, Inc., United States (2013). DeLoache, W.C. and Dueber, J.E., "Compartmentalizing metabolic Amended Final Judgment of District Judge Robinson, in pathways in organelles.” Nature Biotech. 3 1:320-321, Nature ButamaxTM Advanced Biofuels LLC vs. Gevo, Inc., Case 1:1 1-cv America, Inc., United States (2013). 00054-SLR, United States District Court for the District of Delaware, Divakaruni, A.S. and Murphy, A.N., "A Mitochondrial Mystery, filed Apr. 10, 2013; 2 pages. Solved.” Science 337:41-43, American Association for the Advance “Occurrence of higher alcohols,” in Aroma of Beer; Wine and Dis ment of Science, United States (2012). tilled Alcoholic Beverages, Nykanen, L., Ed., pp. 22-25, Akademie Enari, T.M.. “Genetic Modification of Food and Beverage Yeast.” Verlag, Berlin, Germany. Annals New York Acad. Sci, 646:181-192, New York Academy of Sciences, United States (1991). Jayaraj, R. and Smooker, P.M., “So you Need a Protein—A Guide to Geertmam, J-M.A., et al., “Physiological and genetic engineering of the Production of Recombinant Proteins.” The Open Veterinary Sci cytosolic metabolism in Saccharomyces cerevisiae for ence Journal 3:28-34, Bentham Open, England (2009). improved glycerol production.” Metabolic-Engineering 8:532-542, Third Party Requester Comments. After Non-Final Office Action, Elsevier Inc., United States (2006). filed Sep. 4, 2013 in Inter Partes Reexamination of U.S. Patent No. Giudici, P. et al., “A biometric study of higher alcohol production in 8, 178,328, filed Jun. 21, 2012, U.S. Control No. 95/001,998. Saccharomyces cerevisiae," Can. J. Microbiol. 3661-64. The Declaration of Gregory N. Stephanopoulos, Ph.D., Accompanying National Research Council of Canada, Canada (1990). Third Party Requester Comments to Patent Owner's Response to Hackel, B.J., et al., “Production of Soluble and Active Transferring Inter Partes Reexamination Office Action, in Inter Partes Reexami Receptor-Targeting Single-Chain Antibody Using Saccharomyces nation of U.S. Patent No. 8,178,328, filed Jun. 21, 2012, U.S. Control cerevisiae," Pharm. Res. 23:790-797, Springer Science + Business No. 95/001,998. Media, Inc., United States (2006). Memorandum Opinion of District Judge Robinson, in Gevo, Inc. vs. Herzig, S., et al., “Identification and Functional Expression of the ButamaxTM Advanced Biofuels LLC and E.I. Dupont De Nemours Mitochondrial Pyruvate Carrier.” Science 337:93-96, American and Company, Case 1:13-cv-00576-SLR, United States District Association for the Advancement of Science, United States (2012). Court for the District of Delaware, filed Jul. 26, 2013; 46 pages. Hutson, S.M. and Rannels, S.L., “Characterization of a Sánchez, A.M., et al., “Efficient Succinic Acid Production form Glu Mitochondrial Transport System for Branced Chain C-Keto Acids.” cose through Overexpression of Pyruvate Carboxylase in an J. Biol. Chem. 260(26): 14189-14193, American Society of Biologi Escherichia coli Alcohol Dehydrogenase and Lactate cal Chemists, Inc., United States (1985). Dehydrogenase Mutant.” Biotechnol. Prog. 21:358-365, American Ingraham, J.L., and Guymon, J.F., “The Formation of Higher Ali Chemical Society and American Institute of Chemical Engineers, phatic Alcohols by Mutant Strains of Saccharomyces cerevisiae.” United States (2005). Arch. Biochem. Biophy's. 88: 157-166, Academic Press, Inc., United Debourg, A., “Yeast in Action: From Wort to Beer.” Cerevisia States (1960). 27(3): 144-154, St. Martens-Latem Associations D Anciens Etudiants Kim, E-J. et al., “Expression of hepatitis B surface antigen S domain Des Ecole De Brasserie Belges, Belgium (2002). in recombinant Saccharomyces cerevisiae using GAL I promoter. J. Butomax expands Biobutanol Early Adopters Group with Four New Biotechnol. 141:155-159, Elsevier B.V., Netherlands (2009). Members. Brings Capacity to Halfa Billion Gallons, published Jun. Lee, W., et al., “Application of sequential integration for metabolic 18, 2012, ButamaxTM Advanced Biofuels LLC. engineering of 1,2-propanediol production in yeast.” Metabolic Villanueva, K.D., et al., "Subthreshold Vicinal Diketome Levels in Engineering 8:58-65. Elsevier, Inc., United States (2006). Lager Brewing Yeast Fermentations by Means of ILV5 Gene Ampli McCourt, J.A., et al., “Facile crystallization of Eshcerichia coli ketol fications.” ASBCA Journal 48:(3):111-114, American Society of acid reductoisomerase.” Acta Crystallographica D60: 1432-1434. Brewing Chemists, Inc., United States (1990). International Union of Crystallography by Munksgaard, United Villa, K.D. and Lee, S., "Control of Vicinal Diketone Production by States (2004). Brewer's Yeast. I. Effects of ILV5 and ILV3 Gene Amplification on Minahan, D.M., et al., “Synthesis of Fuel Alcohols and MTBE form Vicinal Diketone Production and ILV Enzyme Activity.” ASBCA Syngas. Using Spinel Oxide Based Catalysts.” Preprints Div. Fuel Journal 53(2):49-53, American Society of Brewing Chemists, Inc., Chem. ACS 42(2):715-719, American Chemical Society, United United States (1995). States (1997). Strive to Become a Company "Growing for Good, accessed at http:// Pirkov, I, et al., “Ethylene production by metabolic engineering of the www.suntory.com/president/index.html on Nov. 15, 2003, Suntory yeast Saccharomyces cerevisiae, "Metablic Engineering 10:276-280, Holdings Limited. Elsevier, Inc., United States (2008). US 8,945,859 B2 Page 8

(56) References Cited Sen, S., et al., “Developments in Directed Evolution for Improving Enzyme Functions.” Appl Biochem Biotechnol 143:212-223, OTHER PUBLICATIONS Humana Press Inc., United States (2007). ButamaxTM Advanced Biofuels LLC vs. Gevo, Inc. (Fed. Cir. 2014), Raab, A.M., et al., “Metabolic engineering of Saccharomyces dated Feb. 18, 2014 Appeal from the United States District Court for cerevisiae for the biotechonological production of Succinic acid.” the District of Delaware in No. 1 1-cv-00054, Judge Sue L. Metabolic Engineering 12:518-525, Elsevier Inc., United States Robinson. (2010). Action Closing Prosecution in Inter Partes Reexamination of U.S. Ro, D-K., et al., “Production of the antimalarial drug precursor Patent No. 8,178,328, mailed Mar. 19, 2014, U.S. Control No. artemisinic acid in engineered yeast.” Nature 440:940-943, Nature 95/001,998, filed Jun. 21, 2012. Publishing Group, England (2006). Bussey, H. and Umbarger, H.E., "Biosynthesis of Branched-Chain Sauer, M., et al., “Production of L-Ascorbic Acid by Metabolically Amino Acids in Yeast: Regulation of Synthesis of the Enzymes of Engineered Saccharomyces cerevisiae and Zygosaccharomyces Isoleucine and Valine Biosynthesis,” Journal of Bacteriol bailil," Applied and Environ. Microbiol. 70(10):6086-6091, Ameri ogy98(2):623-628, American Society for Microbiology, United can Society for Microbiology, United States (2004). States (1969). Swiegers, J.H., et al., “The development of yeast strains as tools for Lill, R. and Mühlenhoff, U. “Iron-sulfur-protein biogenesis in adjusting the flavor offermented beverages to market specifications.” eukaryotes.” Trends in Biochemical Sciences30(30:133-141k. Chapter 1, D. Havkin-Frenkel & F.C. Belanger (Eds.): Biotechnology Elsevier Ltd., England (2005). in Flavor Production, 1-55, Blackwell Publishing Ltd, Oxford, Byrne, K.L. and Meacock, P.A., “Thiamin auxotrophy in yeast United Kingdom (2008). through altered cofactor dependence of the enzyme Toivari, M.H., et al., “Enhancing the flux of D-Glucose to the pentose acetohydroxyacid synthase.” Microbiology 1 47:2389-2398, SGM, phosphate pathway in Saccharomyces cerevisiae for the production Great Britain (2001). of D- and ribitol.” Appl Microbiol Biotechnol 85:731-739, Gray, M. W., et al., “Mitoehondrial Evolution.” Science 283: 1476 Springer-Verlag, Germany (2010). 1481, American Association for the Advancement of Science, United Underwood, R.P. et al., “Development of Alternative Fuels from States (1999). Coal-Derived Syngas.” pp. 65-85, Air Products & Chemicals, Inc., Djaman, O., et al., “Repair of Oxidized Iron-Sulfur Clusters in United States (1991). Escherichia coli,” The Journal of Biological Chemistry Vai, M., et al., “Improved Secretion of Native Human Insulin-Like 279(43):44590-44599, American Society for Biochemistry and Growth Factor 1 from gas I Mutant Saccharomyces cerevisiae Cells.” Molecular Biology, United States (2004). Applied and Enviro Microbiol 66(12):5477-5479, American Society Strain, J., et al., “Suppressors of Superoxide Dismutase (SOD1) for Microbiology, United States (2000). Deficiency in Saccharomyces cerevisiae," The Journal of Biological Van Bergen, B., “Diacetyl: identification and characterisation of Chemistry 273(47):31138-31144. The American Society for Bio molecular mechanisms for reduction in yeeast and their application chemistry, and Molecular Biology, Inc., United States (1998). “Top Value Added Chemicals from Biomass: vol. I-Results of in a novel enzyme based assay for quantification in fermentation Screening for Potential Candidates from Sugars and Synthesis Gas.” systems.” Ph.D. Thesis, McGill University, Montreal, Canada U.S. Department of Energy Energy Efficiency and Renewable (2006). Energy, Eds. Werpy, T. and Petersen, G., 76 pages, National Renew Vellanki, R.N., et al., “Expression of hepatitis B surface antigen in able Energy Laboratory, United States (2004). Saccharomyces cerevisiae utilizing glyceraldeyhyde-3-phosphate Causey, T.B., et al., “Engineering the metabolism of Escherichia coli dehydrogenase promoter of Pichia pastoris." Biotechnol. Lett. W3110 for the conversion of Sugar to redox-neutral and oxidized 29:313-318, Springer Science+Business Media B.V., United States products: Homoacetate production.” PNAS 100(3):825-832, (2007). National Academy of Sciences, United States (2003). Xu, G., et al., “Reconstruction of cytosolic fumaric acid biosynthesis “Homegrown for the Homeland: Ethanol industry Outlook 2005. 20 pathways in Saccharomyces cerevisiae," Microbiol Cell Factories pages, Renewable Fuels Association, Washington, DC, United States | 1:24, pp. 1-10, BioMed Central Ltd, England (2012). (2005). Yoshimoto, H., et al., “Pyruvate Decarboxylase Encoded by the “DuPont Receives U.S. EPA's Presidential Green Chemistry: Award PDCI Gene Contributes, at Least partially, to the Decarboxylation of for New Innovation.” Jun. 24, 2003, 2 pages, accessed at http:// O-Ketoisocaporate for Isoamyl Alcohol Formation in Saccharomyces www2/dupont.com/Media Center?en US/news releases/2003/ cerevisiae, "J Biosci. Bioengineering 92:(1):83-85, Elsevier, Japan nr06 24 03a.htm 1 on May 13, 2014. (2001). Rai, M. and Padh, H., “Expression systems for production of Zelle, R.M., et al., “Malic Acid Production by Saccharomyces heterologous proteins.” Current Science30(9): 1121-1128, Academy cerevisiae: Engineering of Pyruvate Carboxylation, Oxaloacetate of Sciences, United States (2001). Reduction, and Malate Export.” Applied Envirion. Micriobiol. Schreier, H.J., et al., “Heterologous expression in the Archaea: tran 74(9):2766-2777. American Society for Microbiology, United States Scription from Pyrococcus firiosus gah and mlr Apromoters in (2009). Haloferax volcanii," Extremophiles3:11-19, Springer-Verlag, Ger Zhang, B., et al., “Engineering the Monomer Composition of many (1999). Polyhyroxyalkanoates Synthesized in Saccharomyces cerevisiae,” Martin, V.J.J., et al., “Engineering a mevalonate pathway in Applied Environ. Microbiol. 72(1):536-543, American Society for Escherichia coli for production ofterpenoids.” Nature Biotechnology Microbiology, United States (2006). 21(7):796-802, Nature Publishing Group, England (2003). Information on EC 1.1.1.86 ketol-acid reductoisomerase, accessed Christen, P. et al. “Ethanol Extraction by Supported Liquid Mem at http://www.brenda-enzymes.org/php/result flat.php4?ecno=1.1. brane During Fermentation.” Biotechnology and Bioengineering 1.86, accessed on Dec. 16, 2013, 42 pages. 36:116-123, John Wiley & Sons, Inc., United States (1990). Information on EC 2.2.1.6-acetolactate synthase, accessed at http:// Bryan, T., "Adsorbing it All.” Biodiesel Magazine, Mar. 1, 2005, 3 www.brenda-enzymes.org/php/result flat.php4?ecno=2.2.1.6. Pages, accessed at http://www.biodieselmagazine.com/articles/239/ accessed on Dec. 16, 2013, 126 pages. adsorbing-it-all on May 17, 2014. Information on EC 4.2.1.9-dihydroxy-acid dehydratase, accessed Palomares, L.A., et al., “Production of Recombinant Proteins: Chal at http://www.brenda-enzymes.org/php/result flat.php4?ecno 4.2. lenges and Solutions.” Methods in Molecular Biology 267: 15-52, 1.9, accessed on Dec. 16, 2013, 24 pages. Humana Press Inc., United Staes (2004). Chica, R.A., et al., “Semi-rational approaches to engineering enzyme Chase, R., “DuPont, BPjoin to makebutanol; they say it outperforms activity: combining the benefits to directed evolution and rational ethanol as a fuel additive.” USA Today, Jun. 23, 2006, 2 pages, design.” Current Opinion in Biotechnology 16:378-384. Elsevier accessed at http://usatoday30.usatoday.com/money/industries/en Ltd., England (2005). ergy/2006-06-20-butanol x.htm on May 14, 2014. US 8,945,859 B2 Page 9

(56) References Cited Gevo Investor Relations FAQs, Gevo, accessed at http://irgevo.com/ phoenix.Zhtml?c=23861.8&p=irol-faq on May 7, 2014. OTHER PUBLICATIONS Amendment No. 4 to Form S-1 Registration Statement, United States “50 Disruptive Companies: Company Profile: Joule Unlimited.” Securities and Exchange Commission, Registration No. 333-168792, Review (2013), 2 pages, accessed at http://www2.technologyreview. filed Jan. 19, 2011, 303 pages. com/triš0/jouleunlimited on May 14, 2014. Burtis, P.R., et at, "California's Cleantech Industry: Annual Venture Schwartz, D'AIM Interview: Sapphire Energy's Tim Zenk, 'Algae Capital Investment Update 2006. Environmental Entrepreneurs and Industry Magazine (2010), 11 pages, accessed at http://www. algaeindustrymagazine.com/tim-Zenk? on May 15, 2014. Cleantech Venture Network LLC, 15 pages. Singer, E., "A Better Biothel: A California biotech company is engi Day, R., “Methanotech and Turtle Island Recycling.” Cleantech neering microbes to produce cheap biofuels that could outcompete Investing: Greentech Media, Aug. 30, 2005, accessed at http://www. ethanol.” MIT Technology Review, Apr. 3, 2007, 2 pages, accessed at greentechmedia.com/cleantech-investing/post/methanotech-and http://www.technologyreview.com/news/407629/a-better-biofuel/ turtle-island-recycling-151 on May 7, 2014. on May 19, 2014. ButamaxTM Advanced Biofuels LLC v. Gevo, Inc., No. 13-1342, Joint Dijkhuizen, L., et al., “Methanol, a potential feedstock for Appendix vol. II of III, A10447-A10495, ECF No. 49, (2014). biotechnological processes.” Trends in Biotechnology3(10):262-267. Meinhold. R. et al." Direct Conversion of Ethane to Ethanol by Elsevier Science Publishers, B.V., Netherlands (1985). Engineered Cytochrome P450 BM3.” ChemBioChem 6:1765-1768, Wiley-VCH Verlag GmbH & Co. KGaA, Germany (2005). * cited by examiner U.S. Patent Feb. 3, 2015 US 8,945,859 B2 US 8,945,859 B2 1. 2 PRODUCTION OF ISOBUTANOL BY A increases the yield of isobutanol, as described by Dickinsonet MICROORGANISM WITHENHANCED al., supra, wherein it is reported that a yield of isobutanol of 3 ACETOLACTATE SYNTHASE ACTIVITY g/L is obtained by providing L-valine at a concentration of 20 g/L in the fermentation. However, the use of valine as a CROSS-REFERENCE TO RELATED 5 feed-stock would be cost prohibitive for industrial scale APPLICATION isobutanol production. The biosynthesis of isobutanol directly from sugars would be economically viable and would This application is a continuation of U.S. application Ser. represent an advance in the art. There have been no reports of No. 13/646,097, filed Oct. 5, 2012, now U.S. Pat. No. 8,735, a recombinant microorganism designed to produce isobu 114, issued May 27, 2014, which is a continuation of U.S. tanol. application Ser. No. 12/939,284, filed Nov. 4, 2010, now U.S. There is a need, therefore, for an environmentally respon Pat. No. 8,283,144, issued Oct. 9, 2012, which is a continu sible, cost-effective process for the production of isobutanol ation of U.S. application Ser. No. 1 1/586,315, filed Oct. 25, as a single product. The present invention addresses this need 2006, now U.S. Pat. No. 7,851,188, issued Dec. 14, 2010, by providing a recombinant microbial production host that which claims priority under 35 U.S.C. S 119 from U.S. Pro- 15 expresses an isobutanol biosynthetic pathway. visional Application Ser. No. 60/730,290, filed Oct. 26, 2005, each of which are incorporated by reference in their entirety. SUMMARY OF THE INVENTION REFERENCE TO ASEQUENCE LISTING The invention provides a recombinant microorganism hav SUBMITTED ELECTRONICALLY VIA EFS-WEB 2O ing an engineered isobutanol biosynthetic pathway. The engi neered microorganism may be used for the commercial pro The content of the electronically submitted sequence list duction of isobutanol. Accordingly, in one embodiment the ing (Name: CL3243 Seq Listing Conv.ST25.txt, Size: 368 invention provides a recombinant microbial host cell com kilobytes; and Date of Creation: Jun. 26, 2012) is herein prising at least one DNA molecule encoding a polypeptide incorporated by reference in its entirety. 25 that catalyzes a Substrate to product conversion selected from the group consisting of FIELD OF THE INVENTION i) pyruvate to acetolactate (pathway step a) ii) acetolactate to 2,3-dihydroxyisovalerate (pathway step The invention relates to the field of industrial microbiology b) and the production of alcohols. More specifically, isobutanol 30 iii) 2.3-dihydroxyisovalerate to C.-ketoisovalerate (path is produced via industrial fermentation of a recombinant way step c) microorganism. iv) C.-ketoisovalerate to isobutyraldehyde, (pathway step d), and BACKGROUND OF THE INVENTION V) isobutyraldehyde to isobutanol: (pathway stepe) 35 wherein the at least one DNA molecule is heterologous to said Butanol is an important industrial chemical, useful as a fuel microbial host cell and wherein said microbial host cell pro additive, as a feedstock chemical in the plastics industry, and duces isobutanol. as a foodgrade extractant in the food and flavor industry. Each In another embodiment, the invention provides a recombi year 10 to 12 billion pounds of butanol are produced by nant microbial host cell comprising at least one DNA mol petrochemical means and the need for this commodity chemi- 40 ecule encoding a polypeptide that catalyzes a Substrate to cal will likely increase. product conversion selected from the group consisting of: Methods for the chemical synthesis of isobutanol are i) pyruvate to acetolactate, (pathway step a) known, such as oXo synthesis, catalytic hydrogenation of ii) acetolactate to 2,3-dihydroxyisovalerate, (pathway step carbon monoxide (Ullmann's Encyclopedia of Industrial b) Chemistry, 6' edition, 2003, Wiley-VCHVerlag GmbH and 45 iii) 2.3-dihydroxyisovalerate to C.-ketoisovalerate, (path Co., Weinheim, Germany, Vol. 5, pp. 716–719) and Guerbet way step c) condensation of methanol with n-propanol (Carlini et al., J. iv) O-ketoisovalerate to isobutyryl-CoA, (pathway step f) Mol. Catal. A. Chem. 220:215-220 (2004)). These processes V) isobutyryl-CoA to isobutyraldehyde, (pathway step g), use starting materials derived from petrochemicals and are and generally expensive and are not environmentally friendly. 50 vi) isobutyraldehyde to isobutanol: (pathway step e) The production of isobutanol from plant-derived raw materi wherein the at least one DNA molecule is heterologous to said als would minimize green house gas emissions and would microbial host cell and wherein said microbial host cell pro represent an advance in the art. duces isobutanol. Isobutanol is produced biologically as a by-product of In another embodiment, the invention provides a recombi yeastfermentation. It is a component of “fusel oil that forms 55 nant microbial host cell comprising at least one DNA mol as a result of incomplete metabolism of amino acids by this ecule encoding a polypeptide that catalyzes a Substrate to group of fungi. Isobutanol is specifically produced from product conversion selected from the group consisting of: catabolism of L-valine. After the amine group of L-valine is i) pyruvate to acetolactate, (pathway step a) harvested as a nitrogen source, the resulting O-keto acid is ii) acetolactate to 2,3-dihydroxyisovalerate, (pathway step decarboxylated and reduced to isobutanol by enzymes of the 60 b) so-called Ehrlich pathway (Dickinson et al., J. Biol. Chem. iii) 2.3-dihydroxyisovalerate to C.-ketoisovalerate, (path 273(40):25752-25756 (1998)). Yields of fusel oil and/or its way step c) components achieved during beverage fermentation are typi iv) O-ketoisovalerate to valine, (pathway Steph) cally low. For example, the concentration of isobutanol pro V) valine to isobutylamine, (pathway step i) duced in beer fermentation is reported to be less than 16 parts 65 vi) isobutylamine to isobutyraldehyde, (pathway step), per million (Garcia et al., Process Biochemistry 29:303-309 and (1994)). Addition of exogenous L-valine to the fermentation vii) isobutyraldehyde to isobutanol: (pathway step e) US 8,945,859 B2 3 4 wherein the at least one DNA molecule is heterologous to said BRIEF DESCRIPTION OF THE FIGURES AND microbial host cell and wherein said microbial host cell pro SEQUENCE DESCRIPTIONS duces isobutanol. In another embodiment, the invention provides a method The invention can be more fully understood from the fol for the production of isobutanol comprising: 5 lowing detailed description, FIGURE, and the accompanying 1) providing a recombinant microbial host cell comprising sequence descriptions, which form a part of this application. at least one DNA molecule encoding a polypeptide that FIG. 1 shows four different isobutanol biosynthetic path catalyzes a Substrate to product conversion selected ways. The steps labeled “a”, “b”, “c”, “d”, “e”, “f”, “g”, “h”, from the group consisting of “i’,” and “k” represent the substrate to product conversions i) pyruvate to acetolactate (pathway step a) 10 described below. ii) acetolactate to 2,3-dihydroxyisovalerate (pathway step The following sequences conform with 37 C.F.R.S 1.821 b) 1.825 (“Requirements for Patent Applications Containing iii) 2.3-dihydroxyisovalerate to C.-ketoisovalerate (path Nucleotide Sequences and/or Amino Acid Sequence Disclo way step c) 15 sures—the Sequence Rules') and are consistent with World iv) O-ketoisovalerate to isobutyraldehyde, (pathway step Intellectual Property Organization (WIPO) Standard ST.25 d), and (2009) and the sequence listing requirements of the EPO and V) isobutyraldehyde to isobutanol: (pathway stepe) PCT (Rules 5.2 and 49.5(a-bis), and Section 208 and Annex C wherein the at least one DNA molecule is heterologous to said of the Administrative Instructions). The symbols and format microbial host cell; and used for nucleotide and amino acid sequence data comply 2) contacting the host cell of (i) with a fermentable carbon with the rules set forth in 37 C.F.R.S 1.822. Substrate in a fermentation medium under conditions whereby isobutanol is produced. TABLE 1 In another embodiment, the invention provides a method Summary of Gene and Protein SEQID Numbers for the production of isobutanol comprising: 25 1) providing a recombinant microbial host cell comprising SEQID at least one DNA molecule encoding a polypeptide that NO: SEQ ID catalyzes a Substrate to product conversion selected Nucleic NO: from the group consisting of Description acid Peptide i) pyruvate to acetolactate, (pathway step a) 30 Klebsiella pneumoniae budB 1 2 ii) acetolactate to 2,3-dihydroxyisovalerate, (pathway step (acetolactate synthase) Bacilius subtiis alss 78 78 b) (acetolactate synthase) iii) 2.3-dihydroxyisovalerate to C.-ketoisovalerate, (path Lactococci is lactis als 179 8O way step c) (acetolactate synthase) iv) O-ketoisovalerate to isobutyryl-CoA, (pathway step f) 35 E. coli ilvC (acetohydroxy acid 3 4 reductoisomerase) V) isobutyryl-CoA to isobutyraldehyde, (pathway step g), S. cerevisiae ILVS 8O 81 and (acetohydroxy acid vi) isobutyraldehyde to isobutanol: (pathway step e) reductoisomerase) wherein the at least one DNA molecule is heterologous to said M. maripaludis ilvC 182 83 40 (Ketol-acid reductoisomerase) microbial host cell; and B. subtiis ilvC 184 85 2) contacting the host cell of (i) with a fermentable carbon (acetohydroxy acid Substrate in a fermentation medium under conditions reductoisomerase) E. coli ilvD (acetohydroxy acid 5 6 whereby isobutanol is produced. dehydratase) In another embodiment, the invention provides a method S. cerevisiae ILV3 83 186 for the production of isobutanol comprising: 45 (Dihydroxyacid dehydratase) 1) providing a recombinant microbial host cell comprising M. maripaludis ilvD 187 188 at least one DNA molecule encoding a polypeptide that (Dihydroxy-acid dehydratase) B. subtiis ilv) 189 190 catalyzes a Substrate to product conversion selected (dihydroxy-acid dehydratase) from the group consisting of Lactococcus lactis kiv D (branched- 7 8 i) pyruvate to acetolactate, (pathway step a) 50 chain C-keto acid decarboxylase), ii) acetolactate to 2,3-dihydroxyisovalerate, (pathway step codon optimized Lactococcus lactis kiv D (branched- 191 8 b) chain C-keto acid decarboxylase), iii) 2.3-dihydroxyisovalerate to C.-ketoisovalerate, (path Lactococci is lactis kdcA 192 193 way step c) (branched-chain alpha-ketoacid iv) O-ketoisovalerate to Valine, (pathway Steph) 55 decarboxylase) Salmonella typhimurium 194 195 V) valine to isobutylamine, (pathway step i) (indolepyruvate decarboxylase) vi) isobutylamine to isobutyraldehyde, (pathway step), Clostridium acetobutyllicum pdc 196 197 and (Pyruvate decarboxylase) E. coliyah) (branched-chain alcohol 9 10 vii) isobutyraldehyde to isobutanol: (pathway step e) dehydrogenase) wherein the at least one DNA molecule is heterologous to said 60 S. cerevisite YPR1 198 199 microbial host cell; and (2-methylbutyraldehyde reductase) 2) contacting the host cell of (i) with a fermentable carbon S. cerevisiae ADH6 200 2O1 Substrate in a fermentation medium under conditions (NADPH-dependent dehydrogenase) whereby isobutanol is produced. Clostridium acetobutyllicum bdha 2O2 2O3 In an alternate embodiment the invention provides an 65 (NADH-dependent butanol isobutanol constainingfermentation medium produced by the dehydrogenase A) methods of the invention. US 8,945,859 B2 5 6 TABLE 1-continued TABLE 1-continued Summary of Gene and Protein SEQ ID Numbers Summary of Gene and Protein SEQ ID Numbers SEQID SEQID NO: SEQ ID NO: SEQ ID Nucleic NO: Nucleic NO: Description acid Peptide Description acid Peptide Clostridium acetobutyllicum bdhB 158 204 S. avermitiis icmB 26S 266 Butanol dehydrogenase (isobutyrl-CoA mutase) B. subtiis bkoAA 205 2O6 10 (branched-chain keto acid ehydrogenase E1 subunit) SEQID NOs: 11-38, 40-69, 72-75, 85-138, 144, 145, 147 B. subtiis bkoAB 2O7 208 (branched-chain alpha-keto acid 157, 159-176 are the nucleotide sequences of oligonucleotide ehydrogenase E1 subunit) cloning, Screening or sequencing primers used in the B. subtiis bkoB 209 210 15 Examples described herein. (branched-chain alpha-keto acid ehydrogenase E2 subunit) SEQ ID NO:39 is the nucleotide sequence of the cscBKA B. subtilis lpdV 211 212 gene cluster described in Example 16. (branched-chain alpha-keto acid SEQID NO:70 is the nucleotide sequence of the glucose ehydrogenase E3 subunit) isomerase promoter 1.6GI described in Example 13. Pputida bkdA1 213 214 (keto acid dehydrogenase E1-alpha SEQ ID NO:71 is the nucleotide sequence of the 1.5GI Subunit) promoter described in Example 13. Pputida bkdA2 215 216 SEQ ID NO:76 is the nucleotide sequence of the GPD (keto acid dehydrogenase E1-beta Subunit) promoter described in Example 17. Pputida bkdB 217 218 SEQ ID NO:77 is the nucleotide sequence of the CYC1 (transacylase E2) 25 terminator described in Example 17. Pputida 1pdV 219 220 (lipoamide dehydrogenase) SEQ ID NO:79 is the nucleotide sequence of the FBA C. beijerinckii ald 221 222 promoter described in Example 17. (coenzyme A acylating aldehyde SEQ ID NO:81 is the nucleotide sequence of ADH1 pro ehydrogenase) moter described in Example 17. C. acetobutyllicum adhel 223 224 30 (aldehyde dehydrogenase) SEQID NO:82 is the nucleotide sequence of ADH1 termi C. acetobutylicum adhe 225 226 nator described in Example 17. (alcohol-aldehyde dehydrogenase) SEQ ID NO:84 is the nucleotide sequence of GPM pro Pputida nahC) 227 228 moter described in Example 17. (acetaldehyde dehydrogenase) T. thermophilus 229 230 SEQ ID NO:139 is the amino acid sequence of sucrose (acetaldehyde dehydrogenase) 35 hydrolase (CscA). E. coi avt.A 231 232 SEQID NO:140 is the amino acid sequence of D-fructoki (valine-pyruvate transaminase) nase (CScK). B. licheniformis avta 233 234 (valine-pyruvate transaminase) SEQ ID NO:141 is the amino acid sequence of sucrose E. coi ilw 235 236 permease (CscEB). (branched chain amino acid 40 SEQ ID NO:142 is the nucleotide sequence of plasmid aminotransferase) pFP988DssPspac described in Example 20. S. cerevisiae BAT2 237 238 SEQ ID NO:143 is the nucleotide sequence of plasmid (branched chain amino acid aminotransferase) pFP988DssPgroE described in Example 20. M. thermoautotrophicum 239 240 SEQ ID NO:146 is the nucleotide sequence of the (branched chain amino acid 45 pFP988Dss vector fragment described in Example 20. aminotransferase) S. coelicoior 241 242 SEQID NO:177 is the nucleotide sequence of the pFP988 (valine dehydrogenase) integration vector described in Example 21. B. subtiis bcd 243 244 SEQ ID NO:267 is the nucleotide sequence of plasmid (leucine dehydrogenase) pC194 described in Example 21. S. viridifaciens 245 246 50 (valine decarboxyase) DETAILED DESCRIPTION OF THE INVENTION A. denitrificans aptA 247 248 (omega-amino acid:pyruvate transaminase) The present invention relates to methods for the production R. eutropha 249 250 of isobutanol using recombinant microorganisms. The (alanine-pyruvate transaminase) 55 S. Oneidensis 251 252 present invention meets a number of commercial and indus (beta alanine-pyruvate transaminase) trial needs. Butanol is an important industrial commodity Pputida 253 254 chemical with a variety of applications, where its potential as (beta alanine-pyruvate transaminase) a fuel or fuel additive is particularly significant. Although S. cinnamonensis icm 255 256 (isobutyrl-CoA mutase) only a four-carbon alcohol, butanol has an energy content S. cinnamonensis icmB 257 258 60 similar to that of gasoline and can be blended with any fossil (isobutyrl-CoA mutase) fuel. Butanol is favored as a fuel or fuel additive as it yields S. Coeicolor SCO5415 259 260 only CO and little or no SO, or NO, when burned in the (isobutyrl-CoA mutase) S. Coeicolor SCO4800 261 262 standard internal combustion engine. Additionally butanol is (isobutyrl-CoA mutase) less corrosive than ethanol, the most preferred fuel additive to S. avermitiis icmA 263 264 65 date. (isobutyrl-CoA mutase) In addition to its utility as a biofuel or fuel additive, butanol has the potential of impacting hydrogen distribution prob US 8,945,859 B2 7 8 lems in the emerging fuel cell industry. Fuel cells today are NO:192); CAG34226 (SEQ ID NO:8), AJ746364 (SEQ ID plagued by safety concerns associated with hydrogen trans NO:191), Salmonella typhimurium (GenBank Nos: port and distribution. Butanol can be easily reformed for its NP 46.1346 (SEQ ID NO:195), NC 003.197 (SEQ ID hydrogen content and can be distributed through existing gas NO:194)), and Clostridium acetobutyllicum (GenBank Nos: stations in the purity required for either fuel cells or vehicles. NP 149189 (SEQ ID NO:197), NC 001988 (SEQ ID Finally the present invention produces isobutanol from NO:196)). plant derived carbon sources, avoiding the negative environ The term “branched-chain alcohol dehydrogenase' refers mental impact associated with standard petrochemical pro to an enzyme that catalyzes the conversion of isobutyralde cesses for butanol production. hyde to isobutanol. Preferred branched-chain alcohol dehy The following definitions and abbreviations are to be used 10 drogenases are known by the EC number 1.1.1.265, but may for the interpretation of the claims and the specification. also be classified under other alcohol dehydrogenases (spe The term “invention” or “present invention” as used herein cifically, EC 1.1.1.1 or 1.1.1.2). These enzymes utilize is a non-limiting term and is not intended to refer to any single NADH (reduced nicotinamide adenine dinucleotide) and/or embodiment of the particular invention but encompasses all NADPH as electron donorand are available from a number of possible embodiments as described in the specification and 15 Sources, including, but not limited to, S. cerevisiae (GenBank the claims. Nos: NP 010656 (SEQID NO:199), NC 001136 (SEQID The term "isobutanol biosynthetic pathway” refers to an NO:198); NP 014051 (SEQ ID NO:201) NC 001145 enzyme pathways to produce isobutanol. (SEQ ID NO:200)), E. coli (GenBank Nos: NP 417484 The terms “acetolactate synthase' and “acetolactate syn (SEQ ID NO:10), NC 000913 (SEQ ID NO:9)), and C. thetase' are used interchangeably hereinto refer to an enzyme acetobutylicum (GenBank Nos: NP 349892 (SEQ ID that catalyzes the conversion of pyruvate to acetolactate and NO:203), NC 003030 (SEQ ID NO:202): NP 3498.91 CO. Preferred acetolactate synthases are known by the EC (SEQ ID NO:204), NC 003030 (SEQID NO:158)). number 2.2.1.6 (Enzyme Nomenclature 1992, Academic The term “branched-chain ketoacid dehydrogenase' refers Press, San Diego). These enzymes are available from a num to an enzyme that catalyzes the conversion of O-ketoisoval ber of sources, including, but not limited to, Bacillus subtilis 25 erate to isobutyryl-CoA (isobutyryl-coenzyme A), using (GenBank Nos: CAB15618 (SEQ ID NO:178), Z99122 NAD" (nicotinamide adenine dinucleotide) as electron (SEQID NO:78), NCBI (National Center for Biotechnology acceptor. Preferred branched-chain keto acid dehydrogenases Information) amino acid sequence, NCBI nucleotide are known by the EC number 1.2.4.4. These branched-chain sequence, respectively), Klebsiella pneumoniae (GenBank keto acid dehydrogenases are comprised of four subunits and Nos: AAA25079 (SEQID NO:2), M73842 (SEQID NO:1)), 30 sequences from all Subunits are available from a vast array of and Lactococcus lactis (GenBank Nos: AAA25161 (SEQID microorganisms, including, but not limited to, B. subtilis NO:180), L16975 (SEQ ID NO:179)). (GenBank Nos: CAB14336 (SEQ ID NO:206), Z991 16 The terms “acetohydroxy acid isomeroreductase' and (SEQ ID NO:205); CAB14335 (SEQ ID NO:208), Z991 16 “acetohydroxy acid reductoisomerase are used interchange (SEQ ID NO:207); CAB14334 (SEQ ID NO:210), Z991 16 ably hereinto refer to an enzyme that catalyzes the conversion 35 (SEQ ID NO:209); and CAB14337 (SEQ ID NO:212), of acetolactate to 2,3-dihydroxyisovalerate using NADPH Z991 16 (SEQID NO:211)) and Pseudomonas putida (Gen (reduced nicotinamide adenine dinucleotide phosphate) as an Bank Nos: AAA65614 (SEQID NO:214), M57613 (SEQID electron donor. Preferred acetohydroxy acid isomeroreduc NO:213); AAA65615 (SEQ ID NO:216), M57613 (SEQ ID tases are known by the EC number 1.1.1.86 and sequences are NO:215); AAA65617 (SEQ ID NO:218), M57613 (SEQ ID available from a vast array of microorganisms, including, but 40 NO:217); and AAA65618 (SEQID NO:220), M57613 (SEQ not limited to, Escherichia coli (GenBank Nos: NP 418222 ID NO:219)). (SEQ ID NO:4), NC 000913 (SEQ ID NO:3)), Saccharo The term “acylating aldehyde dehydrogenase” refers to an myces cerevisiae (GenBank Nos: NP 013459 (SEQ ID enzyme that catalyzes the conversion of isobutyryl-CoA to NO:181), NC 001144 (SEQ ID NO:80)), Methanococcus isobutyraldehyde, using either NADH or NADPH as electron maripaludis (GenBank Nos: CAF30210 (SEQID NO:183), 45 donor. Preferred acylating aldehyde dehydrogenases are BX957220 (SEQ ID NO:182)), and Bacillus. subtilis (Gen known by the EC numbers 1.2.1.10 and 1.2.1.57. These Bank Nos: CAB 14789 (SEQID NO:185), Z991 18 (SEQ ID enzymes are available from multiple sources, including, but NO:184)). not limited to, Clostridium beijerinckii (GenBank Nos: The term “acetohydroxy acid dehydratase' refers to an AAD31841 (SEQ ID NO:222), AF157306 (SEQ ID enzyme that catalyzes the conversion of 2,3-dihydroxyisov 50 NO:221)), C. acetobutylicum (GenBank Nos: NP 149325 alerate to C.-ketoisovalerate. Preferred acetohydroxy acid (SEQ ID NO:224), NC 001988 (SEQ ID NO:223): dehydratases are known by the EC number 4.2.1.9. These NP 1491.99 (SEQ ID NO:226), NC 001988 (SEQ ID enzymes are available from a vast array of microorganisms, NO:225)), P. putida (GenBank Nos: AAA89106 (SEQ ID including, but not limited to, E. coli (GenBank Nos: NO:228), U13232 (SEQID NO:227)), and Thermus thermo YP 026248 (SEQIDNO:6), NC 000913 (SEQID NO:5)), 55 philus (GenBank Nos: YP 145486 (SEQ ID NO:230), S. cerevisiae (GenBank Nos: NP 012550 (SEQID NO:186), NC 006461 (SEQID NO:229)). NC 001142 (SEQ ID NO:83)), M. maripaludis (GenBank The term “transaminase' refers to an enzyme that catalyzes Nos: CAF29874 (SEQ ID NO:188), BX957219 (SEQ ID the conversion of C.-ketoisovalerate to L-valine, using either NO:187)), and B. subtilis (GenBank Nos: CAB 14105 (SEQ alanine or glutamate as amine donor. Preferred transaminases ID NO:190), Z99115 (SEQID NO:189)). 60 are known by the EC numbers 2.6.1.42 and 2.6.1.66. These The term “branched-chain C-keto acid decarboxylase' enzymes are available from a number of sources. Examples of refers to an enzyme that catalyzes the conversion of O-ketois Sources for alanine-dependent enzymes include, but are not ovalerate to isobutyraldehyde and CO. Preferred branched limited to, E. coli (GenBank Nos: YP 026231 (SEQ ID chain C-keto acid decarboxylases are known by the EC num NO:232), NC 000913 (SEQ ID NO:231)) and Bacillus ber 4.1.1.72 and are available from a number of sources, 65 licheniformis (GenBank Nos: YP 093743 (SEQ ID including, but not limited to, Lactococcus lactis (GenBank NO:234), NC 006322 (SEQ ID NO:233)). Examples of Nos: AAS49166 (SEQ ID NO.193), AY548760 (SEQ ID Sources for glutamate-dependent enzymes include, but are US 8,945,859 B2 9 10 not limited to, E. coli (GenBank Nos:YP 026247 (SEQ ID latory and coding sequences that are not found together in NO:236), NC 000913 (SEQ ID NO:235)), S. cerevisiae nature. Accordingly, a chimeric gene may comprise regula (GenBank Nos: NP 012682 (SEQ ID NO:238), tory sequences and coding sequences that are derived from NC 001142 (SEQ ID NO:237)) and Methanobacterium different sources, or regulatory sequences and coding thermoautotrophicum (GenBank Nos: NP 276546 (SEQID sequences derived from the same source, but arranged in a NO:240), NC 000916 (SEQID NO:239)). manner different than that found in nature. “Endogenous The term “valine dehydrogenase' refers to an enzyme that gene' refers to a native gene in its natural location in the catalyzes the conversion of O-ketoisovalerate to L-valine, genome of an organism. A “foreign gene' or "heterologous using NAD(P)H as electron donor and ammonia as amine gene' refers to a gene not normally found in the host organ donor. Preferred valine dehydrogenases are known by the EC 10 ism, but that is introduced into the host organism by gene numbers 1.4.1.8 and 1.4.1.9 and are available from a number transfer. Foreign genes can comprise native genes inserted of sources, including, but not limited to, Streptomyces coeli into a non-native organism, or chimeric genes. A “transgene’ color (GenBank Nos: NP 628270 (SEQ ID NO:242), is a gene that has been introduced into the genome by a NC 003888 (SEQ ID NO:241)) and B. subtilis (GenBank transformation procedure. Nos: CAB14339 (SEQ ID NO:244), Z991 16 (SEQ ID 15 As used herein the term “coding sequence” refers to a DNA NO:243)). sequence that codes for a specific amino acid sequence. "Suit The term “valine decarboxylase' refers to an enzyme that able regulatory sequences’ refer to nucleotide sequences catalyzes the conversion of L-valine to isobutylamine and located upstream (5' non-coding sequences), within, or down CO. Preferred valine decarboxylases are known by the EC stream (3' non-coding sequences) of a coding sequence, and number 4.1.1.14. These enzymes are found in Strepto which influence the transcription, RNA processing or stabil mycetes, such as for example, Streptomyces viridifaciens ity, or translation of the associated coding sequence. Regula (GenBank Nos: AAN10242 (SEQ ID NO:246), AY116644 tory sequences may include promoters, translation leader (SEQ ID NO:245)). sequences, introns, polyadenylation recognition sequences, The term “omega transaminase' refers to an enzyme that RNA processing site, effector binding site and stem-loop catalyzes the conversion of isobutylamine to isobutyralde 25 Structure. hyde using a suitable amino acid as amine donor. Preferred The term “promoter” refers to a DNA sequence capable of omega transaminases are known by the EC number 2.6.1.18 controlling the expression of a coding sequence or functional and are available from a number of sources, including, but not RNA. In general, a coding sequence is located 3' to a promoter limited to, Alcaligenes denitrificans (AAP92672 (SEQ ID sequence. Promoters may be derived in their entirety from a NO:248), AY330220 (SEQID NO:247)), Ralstonia eutropha 30 native gene, or be composed of different elements derived (GenBank Nos: YP 294474 (SEQ ID NO:250), from different promoters found in nature, or even comprise NC 007347 (SEQ ID NO:249)), Shewanella oneidensis synthetic DNA segments. It is understood by those skilled in (GenBank Nos: NP 719046 (SEQ ID NO:252), the art that different promoters may direct the expression of a NC 004347 (SEQ ID NO:251)), and P. putida (GenBank gene in different tissues or cell types, or at different stages of Nos: AAN66223 (SEQ ID NO:254), AE016776 (SEQ ID 35 development, or in response to different environmental or NO:253)). physiological conditions. Promoters which cause a gene to be The term "isobutyryl-CoA mutase' refers to an enzyme expressed in most cell types at most times are commonly that catalyzes the conversion of butyryl-CoA to isobutyryl referred to as “constitutive promoters”. It is further recog CoA. This enzyme uses coenzyme B as cofactor. Preferred nized that since in most cases the exact boundaries of regu isobutyryl-CoA mutases are known by the EC number 40 latory sequences have not been completely defined, DNA 5.4.99.13. These enzymes are found in a number of Strepto fragments of different lengths may have identical promoter mycetes, including, but not limited to, Streptomyces cinna activity. monensis (GenBank Nos: AAC08713 (SEQ ID NO:256), The term “operably linked’ refers to the association of U67612 (SEQ ID NO:255): CAB59633 (SEQ ID NO:258), nucleic acid sequences on a single nucleic acid fragment So AJ24.6005 (SEQID NO:257)), S. coelicolor (GenBank Nos: 45 that the function of one is affected by the other. For example, CAB70645 (SEQ ID NO:260), AL939123 (SEQ ID a promoter is operably linked with a coding sequence when it NO:259); CAB92663 (SEQ ID NO:262), AL939121 (SEQ is capable of effecting the expression of that coding sequence ID NO:261)), and Streptomyces avermitilis (GenBank Nos: (i.e., that the coding sequence is under the transcriptional NP 824008 (SEQ ID NO:264), NC 003 155 (SEQ ID control of the promoter). Coding sequences can be operably NO:263): NP 824637 (SEQ ID NO:266), NC 003 155 50 linked to regulatory sequences in sense or antisense orienta (SEQ ID NO:265)). tion. The term “a facultative anaerobe' refers to a microorgan The term “expression', as used herein, refers to the tran ism that can grow in both aerobic and anaerobic environ Scription and stable accumulation of sense (mRNA) or anti mentS. sense RNA derived from the nucleic acid fragment of the The term “carbon substrate' or "fermentable carbon Sub 55 invention. Expression may also refer to translation of mRNA strate” refers to a carbon source capable of being metabolized into a polypeptide. by host organisms of the present invention and particularly As used herein the term “transformation” refers to the carbon Sources selected from the group consisting of transfer of a nucleic acid fragment into a host organism, monosaccharides, oligosaccharides, polysaccharides, and resulting in genetically stable inheritance. Host organisms one-carbon substrates or mixtures thereof. 60 containing the transformed nucleic acid fragments are The term “gene' refers to a nucleic acid fragment that is referred to as “transgenic’’ or “recombinant’ or “trans capable of being expressed as a specific protein, optionally formed organisms. including regulatory sequences preceding (5' non-coding The terms “plasmid, “vector' and “cassette' refer to an sequences) and following (3' non-coding sequences) the cod extra chromosomal element often carrying genes which are ing sequence. “Native gene’ refers to a gene as found in 65 not part of the central metabolism of the cell, and usually in nature with its own regulatory sequences. “Chimeric gene’ the form of circular double-stranded DNA fragments. Such refers to any gene that is not a native gene, comprising regu elements may be autonomously replicating sequences, US 8,945,859 B2 11 12 genome integrating sequences, phage or nucleotide isobutanol via a series of enzymatic steps. The preferred sequences, linear or circular, of a single- or double-stranded isobutanol pathway (FIG. 1, steps a to e), comprises the DNA or RNA, derived from any source, in which a number of following Substrate to product conversions: nucleotide sequences have been joined or recombined into a a) pyruvate to acetolactate, as catalyzed for example by unique construction which is capable of introducing a pro 5 acetolactate synthase, moter fragment and DNA sequence for a selected gene prod b) acetolactate to 2,3-dihydroxyisovalerate, as catalyzed uct along with appropriate 3' untranslated sequence into a for example by acetohydroxy acid isomeroreductase, cell. “Transformation cassette' refers to a specific vector c) 2.3-dihydroxyisovalerate to C.-ketoisovalerate, as cata containing a foreign gene and having elements in addition to lyzed for example by acetohydroxy acid dehydratase, the foreign gene that facilitates transformation of a particular 10 d) O-ketoisovalerate to isobutyraldehyde, as catalyzed for host cell. “Expression cassette' refers to a specific vector example by a branched-chain keto acid decarboxylase, containing a foreign gene and having elements in addition to and the foreign gene that allow for enhanced expression of that e) isobutyraldehyde to isobutanol, as catalyzed for gene in a foreign host. example by, a branched-chain alcohol dehydrogenase. As used herein the term "codon degeneracy” refers to the 15 This pathway combines enzymes known to be involved in nature in the genetic code permitting variation of the nucle well-characterized pathways for valine biosynthesis (pyru otide sequence without effecting the amino acid sequence of vate to O-ketoisovalerate) and valine catabolism (O-ketoisov an encoded polypeptide. The skilled artisan is well aware of alerate to isobutanol). Since many valine biosynthetic the “codon-bias' exhibited by a specific host cell in usage of enzymes also catalyze analogous reactions in the isoleucine nucleotide codons to specify a given amino acid. Therefore, biosynthetic pathway, Substrate specificity is a major consid when synthesizing a gene for improved expression in a host eration in selecting the gene Sources. For this reason, the cell, it is desirable to design the gene Such that its frequency primary genes of interest for the acetolactate synthase of codon usage approaches the frequency of preferred codon enzyme are those from Bacillus (alsS) and Klebsiella (budB). usage of the host cell. These particular acetolactate synthases are known to partici The term "codon-optimized as it refers to genes or coding 25 pate in butanediol fermentation in these organisms and show regions of nucleic acid molecules for transformation of Vari increased affinity for pyruvate over ketobutyrate (Gollop et ous hosts, refers to the alteration of codons in the gene or al., J. Bacteriol. 172(6):3444-3449 (1990); Holtzclaw et al., J. coding regions of the nucleic acid molecules to reflect the Bacteriol. 121(3):917-922 (1975)). The second and third typical codon usage of the host organism without altering the pathway steps are catalyzed by acetohydroxy acid reductoi polypeptide encoded by the DNA. 30 Somerase and dehydratase, respectively. These enzymes have Standard recombinant DNA and molecular cloning tech been characterized from a number of Sources, such as for niques used herein are well known in the art and are described example, E. coli (Chunduru et al., Biochemistry 28(2):486 by Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular 493 (1989); Flint et al., J. Biol. Chem. 268(29): 14732-14742 Cloning: A Laboratory Manual, Second Edition, Cold Spring (1993)). The final two steps of the preferred isobutanol path Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) 35 way are known to occur in yeast, which can use valine as a (hereinafter “Maniatis”); and by Silhavy, T.J., Bennan, M. L. nitrogen Source and, in the process, secrete isobutanol. C.-Ke and Enquist, L. W., Experiments with Gene Fusions, Cold toisovalerate can be converted to isobutyraldehyde by a num Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. ber of keto acid decarboxylase enzymes, such as for example (1984); and by Ausubel, F. M. et al., Current Protocols in pyruvate decarboxylase. To prevent misdirection of pyruvate Molecular Biology, published by Greene Publishing Assoc. 40 away from isobutanol production, a decarboxylase with and Wiley-Interscience (1987). decreased affinity for pyruvate is desired. So far, there are two Isobutanol Biosynthetic Pathways Such enzymes known in the art (Smit et al., Appl. Environ. Carbohydrate utilizing microorganisms employ the Emb Microbiol. 71 (1):303-311 (2005); de la Plaza et al., FEMS den-Meyerhof-Parnas (EMP) pathway, the Entner-Doudoroff Microbiol. Lett. 238(2):367-374 (2004)). Both enzymes are pathway and the pentose phosphate cycle as the central, meta 45 from strains of Lactococcus lactis and have a 50-200-fold bolic routes to provide energy and cellular precursors for preference for ketoisovalerate over pyruvate. Finally, a num growth and maintenance. These pathways have in common ber of aldehyde reductases have been identified in yeast, the intermediate glyceraldehyde-3-phosphate and, ulti many with overlapping Substrate specificity. Those known to mately, pyruvate is formed directly or in combination with the prefer branched-chain substrates over acetaldehyde include, EMP pathway. Subsequently, pyruvate is transformed to 50 but are not limited to, alcohol dehydrogenase VI (ADH6) and acetyl-coenzyme A (acetyl-CoA) via a variety of means. Ypr1p (Larroy et al., Biochem. J. 361 (Pt 1):163–172 (2002); Acetyl-CoA serves as a key intermediate, for example, in Ford et al., Yeast 19(12):1087-1096 (2002)), both of which generating fatty acids, amino acids and secondary metabo use NADPH as electron donor. An NADPH-dependent reduc lites. The combined reactions of Sugar conversion to pyruvate tase, Yohl), active with branched-chain substrates has also produce energy (e.g. adenosine-5'-triphosphate, ATP) and 55 been recently identified in E. coli (Sulzenbacher et al., J. Mol. reducing equivalents (e.g. reduced nicotinamide adenine Biol. 342(2):489-502 (2004)). dinucleotide, NADH, and reduced nicotinamide adenine Another pathway for converting pyruvate to isobutanol dinucleotide phosphate, NADPH). NADH and NADPH must comprises the following Substrate to product conversions be recycled to their oxidized forms (NAD" and NADP", (FIG. 1, steps a, b, c, f, g, e): respectively). In the presence of inorganic electron acceptors 60 a) pyruvate to acetolactate, as catalyzed for example by (e.g. O., NO, and SO), the reducing equivalents may be acetolactate synthase, used to augment the energy pool; alternatively, a reduced b) acetolactate to 2,3-dihydroxyisovalerate, as catalyzed carbon by-product may be formed. for example by acetohydroxy acid isomeroreductase, The invention enables the production of isobutanol from c) 2.3-dihydroxyisovalerate to C.-ketoisovalerate, as cata carbohydrate sources with recombinant microorganisms by 65 lyzed for example by acetohydroxy acid dehydratase, providing four complete reaction pathways, as shown in FIG. f) O-ketoisovalerate to isobutyryl-CoA, as catalyzed for 1. Three of the pathways comprise conversion of pyruvate to example by a branched-chain keto acid dehydrogenase, US 8,945,859 B2 13 14 g) isobutyryl-CoA to isobutyraldehyde, as catalyzed for cloned and has some activity with butylamine (Yun et al., example by an acylating aldehyde dehydrogenase, and Appl. Environ. Microbiol. 70(4):2529-2534 (2004)). In this e) isobutyraldehyde to isobutanol, as catalyzed for direction, these enzymes use pyruvate as the amino acceptor, example by, a branched-chain alcohol dehydrogenase. yielding alanine. As mentioned above, adverse affects on the The first three steps in this pathway (a,b,c) are the same as 5 pyruvate pool may be offset by using a pyruvate-producing those described above. The O-ketoisovalerate is converted to transaminase earlier in the pathway. The isobutyraldehyde is isobutyryl-CoA by the action of a branched-chain keto acid then converted to isobutanol by a branched-chain alcohol dehydrogenase. While yeast can only use valine as a nitrogen dehydrogenase, as described above for the first pathway. Source, many other organisms (both eukaryotes and prokary The fourth isobutanol biosynthetic pathway comprises the otes) can use valine as the carbon source as well. These 10 organisms have branched-chain keto acid dehydrogenase Substrate to product conversions shown as steps k, g, e in FIG. (Sokatch et al. J. Bacteriol. 148(2):647-652 (1981)), which 1. A number of organisms are known to produce butyrate generates isobutyryl-CoA. Isobutyryl-CoA may be converted and/or butanol via a butyryl-CoA intermediate (Dirre et al., to isobutyraldehyde by an acylating aldehyde dehydrogenase. FEMS Microbiol. Rev. 17(3):251-262 (1995); Abbad-Andal Dehydrogenases active with the branched-chain substrate 15 oussi et al., Microbiology 142(5):1149-1158 (1996)). Isobu have been described, but not cloned, in Leuconostoc and tanol production may be engineered in these organisms by Propionibacterium (Kazahaya et al., J. Gen. Appl. Microbiol. addition of a mutase able to convert butyryl-CoA to isobu 18:43-55 (1972); Hosoi et al., J. Ferment. Technol. 57:418 tyryl-CoA (FIG. 1, step k). Genes for both subunits of isobu 427 (1979)). However, it is also possible that acylating alde tyryl-CoA mutase, a coenzyme B12-dependent enzyme, have hyde dehydrogenases known to function with Straight-chain 20 been cloned from a Streptomycete (Ratnatilleke et al., J. Biol. acyl-CoAS (i.e. butyryl-CoA), may also work with isobu Chem. 274(44):31679-31685 (1999)). The isobutyryl-CoA is tyryl-CoA. The isobutyraldehyde is then converted to isobu converted to isobutyraldehyde (step g in FIG. 1), which is tanol by a branched-chain alcohol dehydrogenase, as converted to isobutanol (step e in FIG. 1). described above for the first pathway. Thus, in providing multiple recombinant pathways from Another pathway for converting pyruvate to isobutanol 25 pyruvate to isobutanol, there exist a number of choices to comprises the following Substrate to product conversions fulfill the individual conversion steps, and the person of skill (FIG. 1, Steps a, b, c, h, i, j, e): in the art will be able to utilize publicly available sequences to a) pyruvate to acetolactate, as catalyzed for example by construct the relevant pathways. A listing of a representative acetolactate synthase, number of genes known in the art and useful in the construc b) acetolactate to 2,3-dihydroxyisovalerate, as catalyzed 30 tion of isobutanol biosynthetic pathways are listed below in for example by acetohydroxy acid isomeroreductase, Table 2. c) 2.3-dihydroxyisovalerate to O-ketoisovalerate, as cata lyzed for example by acetohydroxy acid dehydratase, TABLE 2 h) O-ketoisovalerate to Valine, as catalyzed for example by Valine dehydrogenase or transaminase, 35 Sources of Isobutanol Biosynthetic Pathway Genes i) valine to isobutylamine, as catalyzed for example by Valine decarboxylase, Gene GenBank Citation j) isobutylamine to isobutyraldehyde, as catalyzed for acetolactate Z99122, Bacilius subtilis complete genome (section 19 synthase of 21): from 3608981 to 3809670 example by omega transaminase, and gi3246883Olemb|Z99122.2BSUB001932468830) e) isobutyraldehyde to isobutanol, as catalyzed for 40 M73842, Klebsiella pneumoniae acetolactate synthase example by, a branched-chain alcohol dehydrogenase. (illuk) gene, complete cols The first three steps in this pathway (a,b,c) are the same as gil 149210gb|M73842.1 KPNILUK149210 L16975, Lactococcus lactis alpha-acetolactate synthase those described above. This pathway requires the addition of (als) gene, complete cols a valine dehydrogenase or a Suitable transaminase. Valine gi473900gb|L16975.1|LACALS473900 (and or leucine) dehydrogenase catalyzes reductive amina- 45 acetO- NC 000913, Escherichia coli K12, complete genome tion and uses ammonia; K values for ammonia are in the hydroxy gi49175990 refNC 000913.249175990) acid millimolar range (Priestly et al., Biochem J. 26.1(3):853-861 isomero (1989); Vancura et al., J. Gen. Microbiol. 134(12):32.13–3219 reductase (1988) Zinket al., Arch. Biochem. Biophys. 99:72-77 (1962); NC 001144, Saccharomyces cerevisiae chromosome Sekimoto et al. J. Biochem (Japan) 116(1):176-182 (1994)). 50 XII, complete chromosome sequence gi42742286 refNC 001144.3||42742286 Transaminases typically use either glutamate or alanine as BX957220, Methanococcus maripaludis S2 complete amino donors and have been characterized from a number of genome; segment 2.5 organisms (Lee-Peng et al., J. Bacteriol. 139(2): 339-345 gi44920669 |emb|BX957220.1144920669) (1979); Berg et al., J. Bacteriol. 155(3):1009-1014 (1983)). Z991 18, Bacilius subtilis complete genome (section 15 Analanine-specific enzyme may be desirable, since the gen- 55 of 21): from 28.12801 to 3013507 gi324688O2 emb|Z991 18.2BSUBOO1532468802 eration of pyruvate from this step could be coupled to the acetO- NC 000913, Escherichia coli K12, complete genome consumption of pyruvate later in the pathway when the amine hydroxy gi49175990 refNC 000913.249175990) group is removed (see below). The next step is decarboxyla acid tion of valine, a reaction that occurs in Valanimycin biosyn dehydratase NC 001142, Saccharomyces cerevisiae chromosome thesis in Streptomyces (Garg et al., Mol. Microbiol. 46(2): 60 X, complete chromosome sequence 505-517 (2002)). The resulting isobutylamine may be gi42742252|refNC 001142.542742252) converted to isobutyraldehyde in a pyridoxal 5'-phosphate BX957219, Methanococcus maripaludis S2 complete genome; segment 1.5 dependent reaction by, for example, an enzyme of the omega gi45047123|emb|BX957219.1||45047123) aminotransferase family. Such an enzyme from Vibrio fluvia Z991 15, Bacilius subtilis complete genome (section 12 lis has demonstrated activity with isobutylamine (Shin et al., 65 of 21): from 2207806 to 2409180 Biotechnol. Bioeng. 65(2):206-211 (1999)). Another omega gi32468778 emb|Z99115.2BSUBOO1232468778) aminotransferase from Alcaligenes denitrificans has been US 8,945,859 B2 15 16 TABLE 2-continued TABLE 2-continued Sources of Isobutanol Biosynthetic Pathway Genes Sources of Isobutanol BioSynthetic Pathway Genes

Gene GenBank Citation Gene GenBank Citation branched AY548760, Lactococcus lactis branched-chain alpha valine AY116644, Streptomyces viridifaciens amino acid decar aminotransferase gene, partial cols; ketol-acid chain ketoacid decarboxylase (kdcA) gene, complete cols boxylase C-keto acid gi|44921616 Igb|AY548760.1144921616) reductoisomerase, acetolactate synthetase Small decar Subunit, acetolactate synthetase large subunit, complete boxylase cols; azoxy antibiotic valanimycin gene cluster, complete 10 sequence; and putative transferase, and putative AJ746364, Lactococcus lactis Subsp. lactis kivd gene Secreted protein genes, complete cols for alpha-ketoisovalerate decarboxylase, strain IFPL730 gi27777548gb|AY116644.1127777548 gi|51870501 emb|AJ746364.1||51870501) Omega AY330220, Achromobacter denitrificans Omega-amino NC 003197, Salmonella typhimurium LT2, complete trans- acid:pyruvate transaminase (aptA) gene, complete cols genome aminase gi 33086797 Igb|AY330220.1133086797) gil 16763390 refNC 003197.1||16763390) 15 NC 007347, Ralstonia eutropha JMP134 chromosome NC 001988, Clostridium acetobutyllicum ATCC 824 1, complete sequence plasmid pSOL1, complete sequence gi73539706 |refNC 007347.1||73539706) gil 15004705 refNC 001988.215004705 NC 004347, Shewanella Oneidensis MR-1, complete branched NC 001136, Saccharomyces cerevisiae chromosome genome chain IV, complete chromosome sequence gi24371600|refNC 004347.1||24371600 alcohol gi50593.138 |refNC 001136.650593.138) NZ AAAGO2000002, Rhodospirillum rubrum Rrub02 2, dehy whole genome shotgun sequence drogenase gi48764549 reflNZ AAAGO2000002.1148764549) AEO16776, Pseudomonasputida KT2440 section 3 of NC 001145, Saccharomyces cerevisiae chromosome 21 of the complete genome XIII, complete chromosome sequence gi26557019.gb|AEO16776.1||26557019 gi|44829554|refNC 001145.2||44829554) isobutyryl- U67612, Streptomyces cinnamonensis coenzyme B12 NC 000913, Escherichia coli K12, complete genome 25 CoA dependent isobutyrylCoA mutase (icm) gene, complete gi49175990 refNC 000913.249175990) mutase CCS NC 003030, Clostridium acetobutyllicum ATCC 824, gi3002491gb|U67612.1|SCU676123.002491) complete genome AJ246005, Streptomyces cinnamonensis icmB gene for gil 15893298 |refNC 003030.1||15893298) isobutyryl-CoA mutase, Small subunit branched Z99116, Bacilius subtilis complete genome (section 13 gi|6137076 emb|AJ24.6005.1 ISCI246.0056137076) chain of 21): from 2409151 to 2613687 30 AL939123, Streptomyces coelicolor A3(2) complete keto acid gi|32468787 emb|Z991 16.2|BSUBOO1332468787) genome; segment 2029 dehy gi24430032 emb|AL939123.1|SCO93912324430032) drogenase AL9939121, Streptomyces coelicolor A3(2) complete M57613, Pseudomonas putida branched-chain keto genome; segment 1829 acid dehydrogenase operon (bkdA1, bkdA1 and bkdA2), gi24429533emb|AL939121.1|SCO93912124429533) transacylase E2 (bkdB), bkdR and lipoamide 35 NC 003155, Streptomyces avermitilis MA-4680, dehydrogenase (lpdV) genes, complete cols complete genome gi790512gb|M57613.1|PSEBKDPPG2790512 gi57833846 refNC 003155.357833846) acylating AF157306, Clostridium beijerinckii strain NRRL B593 aldehyde hypothetical protein, coenzyme A acylating aldehyde Microbial Hosts for Isobutanol Production dehy dehydrogenase (ald), acetoacetate:butyratefacetate drogenase coenzyme A transferase (ctfA), 40 Microbial hosts for isobutanol production may be selected acetoacetate:butyratefacetate coenzyme A transferase from bacteria, cyanobacteria, filamentous fungi and yeasts. (ctfB), and acetoacetate decarboxylase (adc) genes, The microbial host used for isobutanol production is prefer complete cols gi|4742298Ogb|AF157306.2||4742.2980) ably tolerant to isobutanol so that the yield is not limited by NC 001988, Clostridium acetobutyllicum ATCC 824 butanol toxicity. Microbes that are metabolically active at plasmid pSOL1, complete sequence 45 high titer levels of isobutanol are not well known in the art. gil 15004705 refNC 001988.215004705 Although butanol-tolerant mutants have been isolated from U13232, Pseudomonas putida NCIB9816 acetaldehyde Solventogenic Clostridia, little information is available con dehydrogenase (nahO) and 4-hydroxy-2-oxovalerate cerning the butanol tolerance of other potentially useful bac aldolase (nahM) genes, complete cols, and 4 Oxalocrotonate decarboxylase (nahK) and 2-oxopent-4- terial strains. Most of the studies on the comparison of alcohol enoate hydratase (nahL) genes, partial cols 50 tolerance in bacteria Suggest that butanol is more toxic than gi595671gb|U13232.1|PPU13232595671) ethanol (de Cavalho et al., Microsc. Res. Tech. 64:215-22 trans NC 000913, Escherichia coli K12, complete genome (2004) and Kabelitz et al., FEMS Microbiol. Lett. 220:223 aminase gi49175990 refNC 000913.249175990 227 (2003)). Tomas et al. (J. Bacteriol. 186:2006-2018 NC OO6322, Bacilius licheniformis ATCC 14580, (2004)) report that the yield of 1-butanol during fermentation complete genome 55 gi52783855 refNC O06322.1152783855 in Clostridium acetobutyllicum may be limited by 1-butanol NC 001142, Saccharomyces cerevisiae chromosome toxicity. The primary effect of 1-butanol on Clostridium X, complete chromosome sequence acetobutylicum is disruption of membrane functions (Her gi|42742252|refNC 001142.5||42742252 mann et al., Appl. Environ. Microbiol. 50: 1238-1243 (1985)). NC 000916, Methanothermobacter thermautotrophicus The microbial hosts selected for the production of isobu str. Delta H, complete genome 60 tanol are preferably tolerant to isobutanol and should be able gil 15678031 refNC 000916.1||15678031 valine NC 003888, Streptomyces coelicolor A3(2), complete to convert carbohydrates to isobutanol. The criteria for selec dehy genome tion of suitable microbial hosts include the following: intrin drogenase gi|32141095 refNC 003888.3 ||32141095 sic tolerance to isobutanol, high rate of glucose utilization, Z99116, Bacilius subtilis complete genome (section 13 availability of genetic tools for gene manipulation, and the of 21): from 2409151 to 2613687 65 ability to generate stable chromosomal alterations. gi|32468787 emb|Z991 16.2|BSUBOO1332468787) Suitable host strains with a tolerance for isobutanol may be identified by screening based on the intrinsic tolerance of the US 8,945,859 B2 17 18 strain. The intrinsic tolerance of microbes to isobutanol may reaction (U.S. Pat. No. 4,683.202) to obtain amounts of DNA be measured by determining the concentration of isobutanol Suitable for transformation using appropriate vectors. Tools that is responsible for 50% inhibition of the growth rate for codon optimization for expression in a heterologous host (IC50) when grown in a minimal medium. The IC50 values are readily available. Some tools for codon optimization are may be determined using methods known in the art. For 5 available based on the GC content of the host organism. The example, the microbes of interest may be grown in the pres GC content of some exemplary microbial hosts is given Table ence of various amounts of isobutanol and the growth rate 3. monitored by measuring the optical density at 600 nanom eters. The doubling time may be calculated from the logarith TABLE 3 mic part of the growth curve and used as a measure of the 10 growth rate. The concentration of isobutanol that produces GC Content of Microbial Hosts 50% inhibition of growth may be determined from a graph of the percent inhibition of growth versus the isobutanol con Strain % GC centration. Preferably, the host strain should have an IC50 for B. iicheniformis 46 isobutanol of greater than about 0.5%. 15 B. subtiis 42 C. acetobutyllicum 37 The microbial host for isobutanol production should also E. coi 50 utilize glucose at a high rate. Most microbes are capable of Pputida 61 utilizing carbohydrates. However, certain environmental A. eutrophus 61 microbes cannot utilize carbohydrates to high efficiency, and Paenibacilius macerans 51 therefore would not be suitable hosts. Rhodococcus erythropolis 62 The ability to genetically modify the host is essential for Brevibacilius 50 the production of any recombinant microorganism. The mode Paenibacilius polymyxa 50 of gene transfer technology may be by electroporation, con jugation, transduction or natural transformation. A broad Once the relevant pathway genes are identified and isolated range of host conjugative plasmids and drug resistance mark 25 they may be transformed into suitable expression hosts by ers are available. The cloning vectors are tailored to the host means well known in the art. Vectors or cassettes useful for organisms based on the nature of antibiotic resistance mark the transformation of a variety of host cells are common and ers that can function in that host. commercially available from companies such as EPICEN The microbial host also has to be manipulated in order to TRER (Madison, Wis.), Invitrogen Corp. (Carlsbad, Calif.), inactivate competing pathways for carbon flow by deleting 30 Stratagene (La Jolla, Calif.), and New England Biolabs, Inc. various genes. This requires the availability of either trans (Beverly, Mass.). Typically the vector or cassette contains posons to direct inactivation or chromosomal integration vec sequences directing transcription and translation of the rel tors. Additionally, the production host should be amenable to evant gene, a selectable marker, and sequences allowing chemical mutagenesis so that mutations to improve intrinsic autonomous replication or chromosomal integration. Suit isobutanol tolerance may be obtained. 35 able vectors comprise a region 5' of the gene which harbors Based on the criteria described above, suitable microbial transcriptional initiation controls and a region 3' of the DNA hosts for the production of isobutanol include, but are not fragment which controls transcriptional termination. Both limited to, members of the genera Clostridium, Zymomonas, control regions may be derived from genes homologous to the Escherichia, Salmonella, Rhodococcus, Pseudomonas, transformed host cell, although it is to be understood that such Bacillus, Lactobacillus, Enterococcus, Alcaligenes, Kleb 40 control regions may also be derived from genes that are not siella, Paenibacillus, Arthrobacter, Corynebacterium, Brevi native to the specific species chosen as a production host. bacterium, Pichia, Candida, Hansenula and Saccharomyces. Initiation control regions or promoters, which are useful to Preferred hosts include: Escherichia coli, Alcaligenes eutro drive expression of the relevant pathway coding regions in the phus, Bacillus licheniformis, Paenibacillus macerans, desired host cell are numerous and familiar to those skilled in Rhodococcus erythropolis, Pseudomonasputida, Lactobacil 45 the art. Virtually any promoter capable of driving these lus plantarum, Enterococcus faecium, Enterococcus galli genetic elements is suitable for the present invention includ narium, Enterococcus faecalis, Bacillus subtilis and Saccha ing, but not limited to, CYC1, HIS3, GAL1, GAL10, ADH1, romyces cerevisiae. PGK, PHO5, GAPDH, ADC1, TRP1, URA3, LEU2, ENO, Construction of Production Host TPI, CUP1, FBA, GPD, and GPM (useful for expression in Recombinant organisms containing the necessary genes 50 Saccharomyces); AOX1 (useful for expression in Pichia); and that will encode the enzymatic pathway for the conversion of lac, ara, tet, trp, IP, IPT7, tac, and trc (useful for expression a fermentable carbon substrate to isobutanol may be con in Escherichia coli, Alcaligenes, and Pseudomonas); the amy, structed using techniques well known in the art. In the present apr, npr promoters and various phage promoters useful for invention, genes encoding the enzymes of one of the isobu expression in Bacillus subtilis, Bacillus licheniformis, and tanol biosynthetic pathways of the invention, for example, 55 Paenibacillus macerans; niSA (useful for expression Gram acetolactate synthase, acetohydroxy acid isomeroreductase, positive bacteria, Eichenbaum et al. Appl. Environ. Micro acetohydroxy acid dehydratase, branched-chain C-keto acid biol. 64(8):2763-2769 (1998)); and the synthetic P11 pro decarboxylase, and branched-chain alcohol dehydrogenase, moter (useful for expression in Lactobacillus plantarum, Rud may be isolated from various sources, as described above. et al., Microbiology 152:1011-1019 (2006)). Methods of obtaining desired genes from a bacterial 60 Termination control regions may also be derived from vari genome are common and well known in the art of molecular ous genes native to the preferred hosts. Optionally, a termi biology. For example, if the sequence of the gene is known, nation site may be unnecessary, however, it is most preferred Suitable genomic libraries may be created by restriction endo if included. nuclease digestion and may be screened with probes comple Certain vectors are capable of replicating in a broad range mentary to the desired gene sequence. Once the sequence is 65 of host bacteria and can be transferred by conjugation. The isolated, the DNA may be amplified using standard primer complete and annotated sequence of pRK404 and three directed amplification methods such as polymerase chain related vectors-pRK437, pRK442, and pRK442(H) are avail US 8,945,859 B2 19 20 able. These derivatives have proven to be valuable tools for Expression of an Isobutanol Biosynthetic Pathway in B. genetic manipulation in Gram-negative bacteria (Scott et al., licheniformis Plasmid 50(1):74-79 (2003)). Several plasmid derivatives of Most of the plasmids and shuttle vectors that replicate in B. broad-host-range Inc P4 plasmid RSF 1010 are also available subtilis may be used to transform B. licheniformis by either with promoters that can function in a range of Gram-negative 5 protoplast transformation or electroporation. The genes bacteria. Plasmid pAYC36 and pAYC37, have active promot required for the production of isobutanol may be cloned in ers along with multiple cloning sites to allow for the heter plasmids pBE20 orphBE60 derivatives (Nagarajan et al., Gene ologous gene expression in Gram-negative bacteria. 114:121-126 (1992)). Methods to transform B. licheniformis Chromosomal gene replacement tools are also widely are known in the art (for example see Fleming et al. Appl. 10 Environ. Microbiol. 61 (11):3775-3780 (1995)). The plas available. For example, a thermosensitive variant of the mids constructed for expression in B. subtilis may be trans broad-host-range replicon pWV 101 has been modified to formed into B. licheniformis to produce a recombinant micro construct a plasmid pVE6002 which can be used to effect bial host that produces isobutanol. gene replacement in a range of Gram-positive bacteria Expression of an Isobutanol Biosynthetic Pathway in (Maguin et al., J. Bacteriol. 174(17):5633-5638 (1992)). 15 Paenibacillus macerans Additionally, in vitro transposomes are available to create Plasmids may be constructed as described above for random mutations in a variety of genomes from commercial expression in B. subtilis and used to transform Paenibacillus Sources Such as EPICENTRE(R). macerans by protoplast transformation to produce a recom The expression of an isobutanol biosynthetic pathway in binant microbial host that produces isobutanol. various preferred microbial hosts is described in more detail Expression of the Isobutanol Biosynthetic Pathway in below. Alcaligenes (Ralstonia) eutrophus Expression of an Isobutanol Biosynthetic Pathway in E. Methods for gene expression and creation of mutations in Coli Alcaligenes eutrophus are known in the art (see for example Vectors or cassettes useful for the transformation of E. coli Taghavi et al., Appl. Environ. Microbiol., 60(10):3585-3591 are common and commercially available from the companies 25 (1994)). The genes for an isobutanol biosynthetic pathway listed above. For example, the genes of an isobutanol biosyn may be cloned in any of the broad host range vectors thetic pathway may be isolated from various sources, cloned described above, and electroporated to generate recombi into a modified puC19 vector and transformed into E. coli nants that produce isobutanol. The poly(hydroxybutyrate) NM522, as described in Examples 6 and 7. pathway in Alcaligenes has been described in detail, a variety Expression of an Isobutanol Biosynthetic Pathway in 30 of genetic techniques to modify the Alcaligenes eutrophus Rhodococcus erythropolis genome is known, and those tools can be applied for engi A series of E. coli-Rhodococcus shuttle vectors are avail neering an isobutanol biosynthetic pathway. able for expression in R. erythropolis, including, but not lim Expression of an Isobutanol Biosynthetic Pathway in ited to, pRhBR17 and pl)A71 (Kostichka et al., Appl. Micro Pseudomonas putida biol. Biotechnol. 62:61-68 (2003)). Additionally, a series of 35 Methods for gene expression in Pseudomonas putida are promoters are available for heterologous gene expression in known in the art (see for example Ben-Bassat et al., U.S. Pat. R. erythropolis (see for example Nakashima et al., Appl. No. 6,586.229, which is incorporated herein by reference). Environ. Microbiol. 70:5557-5568 (2004), and Tao et al., The butanol pathway genes may be inserted into pPCU18 and Appl. Microbiol. Biotechnol. 2005, DOI 10.1007/s00253 this ligated DNA may be electroporated into electrocompe 005-0064). Targeted gene disruption of chromosomal genes 40 tent Pseudomonas putida DOT-T1 C5aAR1 cells to generate in R. erythropolis may be created using the method described recombinants that produce isobutanol. by Tao et al., supra, and Brans etal. (Appl. Environ. Microbiol. Expression of an Isobutanol Biosynthetic Pathway in Sac 66: 2029-2036 (2000)). charomyces cerevisiae The heterologous genes required for the production of Methods for gene expression in Saccharomyces cerevisiae isobutanol, as described above, may be cloned initially in 45 are known in the art (see for example Methods in Enzymology, pDA71 or pRhBR71 and transformed into E. coli. The vectors Volume 194, Guide to Yeast Genetics and Molecular and Cell may then be transformed into R. erythropolis by electropora Biology (Part A, 2004, Christine Guthrie and Gerald R. Fink tion, as described by Kostichka et al., supra. The recombi (Eds.), Elsevier Academic Press, San Diego, Calif.). Expres nants may be grown in Synthetic medium containing glucose sion of genes in yeast typically requires a promoter, followed and the production of isobutanol can be followed using meth 50 by the gene of interest, and a transcriptional terminator. A ods known in the art. number of yeast promoters can be used in constructing Expression of an Isobutanol Biosynthetic Pathway in B. expression cassettes for genes encoding an isobutanol bio Subtilis synthetic pathway, including, but not limited to constitutive Methods for gene expression and creation of mutations in promoters FBA, GPD, ADH1, and GPM, and the inducible B. subtilis are also well known in the art. For example, the 55 promoters GAL1, GAL10, and CUP1. Suitable transcrip genes of an isobutanol biosynthetic pathway may be isolated tional terminators include, but are not limited to FBAt, GPDt, from various sources, cloned into a modified puC19 vector GPMt, ERG10t, GAL1t, CYC1, and ADH1. For example, and transformed into Bacillus subtilis BE 1010, as described Suitable promoters, transcriptional terminators, and the genes in Example 8. Additionally, the five genes of an isobutanol of an isobutanol biosynthetic pathway may be cloned into E. biosynthetic pathway can be split into two operons for expres 60 coli-yeast shuttle vectors as described in Example 17. sion, as described in Example 20. The three genes of the Expression of an Isobutanol Biosynthetic Pathway in Lac pathway (bubE, ilvD, and kiv)) were integrated into the tobacillus plantarum chromosome of Bacillus subtilis BE 1010 (Payne and Jack The Lactobacillus genus belongs to the Lactobacillales son, J. Bacteriol. 173:2278-2282 (1991)). The remaining two family and many plasmids and vectors used in the transfor genes (ilvC and bdhB) were cloned into an expression vector 65 mation of Bacillus subtilis and Streptococcus may be used for and transformed into the Bacillus strain carrying the inte lactobacillus. Non-limiting examples of Suitable vectors grated isobutanol genes include pAMR1 and derivatives thereof (Renault et al., Gene US 8,945,859 B2 21 22 183:175-182 (1996); and O'Sullivan et al., Gene 137:227 Although it is contemplated that all of the above mentioned 231 (1993)); pMBB1 and pHW800, a derivative of pMBB1 carbon substrates and mixtures thereof are suitable in the (Wyckoff et al. Appl. Environ. Microbiol. 62: 1481-1486 present invention, preferred carbon Substrates are glucose, (1996)); pMG1, a conjugative plasmid (Tanimoto et al., J. fructose, and Sucrose. Bacteriol. 184:5800-5804 (2002)); pNZ9520 (Kleerebezem In addition to an appropriate carbon Source, fermentation et al., Appl. Environ. Microbiol. 63:4581-4584 (1997)); media must contain Suitable minerals, salts, cofactors, buffers pAM401 (Fujimoto et al., Appl. Environ. Microbiol. 67: 1262 and other components, known to those skilled in the art, 1267 (2001)); and pAT392 (Arthur et al., Antimicrob. Agents suitable for the growth of the cultures and promotion of the Chemother: 38:1899-1903 (1994)). Several plasmids from enzymatic pathway necessary for isobutanol production. 10 Culture Conditions Lactobacillus plantarum have also been reported (e.g., van Typically cells are grown at a temperature in the range of Kranenburg R, Golic N. Bongers R. Leer RJ, de Vos W M. about 25° C. to about 40° C. in an appropriate medium. Siezen RJ, Kleerebezem M. Appl. Environ. Microbiol. 2005 Suitable growth media in the present invention are common March; 71 (3): 1223-1230). For example, expression of an commercially prepared media Such as Luria Bertani (LB) isobutanol biosynthetic pathway in Lactobacillus plantarum 15 broth, Sabouraud Dextrose (SD) brothorYeast medium (YM) is described in Example 21. broth. Other defined or synthetic growth media may also be Expression of an Isobutanol Biosynthetic Pathway in used, and the appropriate medium for growth of the particular Enterococcus faecium, Enterococcus gallinarium, and microorganism will be known by one skilled in the art of Enterococcus faecalis microbiology or fermentation Science. The use of agents The Enterococcus genus belongs to the Lactobacillales known to modulate catabolite repression directly or indi family and many plasmids and vectors used in the transfor rectly, e.g., cyclic adenosine 2:3'-monophosphate, may also mation of Lactobacillus, Bacillus subtilis, and Streptococcus be incorporated into the fermentation medium. may be used for Enterococcus. Non-limiting examples of Suitable pH ranges for the fermentation are between pH 5.0 suitable vectors include pAMR1 and derivatives thereof to pH 9.0, where pH 6.0 to pH 8.0 is preferred as the initial (Renault et al., Gene 183:175-182 (1996); and O'Sullivan et 25 condition. al., Gene 137:227-231 (1993)); pMBB1 and pHW800, a Fermentations may be performed under aerobic or anaero derivative of pMBB1 (Wyckoff et al. Appl. Environ. Micro bic conditions, where anaerobic or microaerobic conditions biol. 62: 1481-1486 (1996)); pMG1, a conjugative plasmid are preferred. (Tanimoto et al., J. Bacteriol. 184:5800-5804 (2002)); The amount of isobutanol produced in the fermentation pNZ9520 (Kleerebezem et al., Appl. Environ. Microbiol. 30 medium can be determined using a number of methods 63:4581-4584 (1997)); p.AM401 (Fujimoto et al., Appl. Envi known in the art, for example, high performance liquid chro ron. Microbiol. 67: 1262-1267 (2001)); and pAT392 (Arthur matography (HPLC) or gas chromatography (GC). et al., Antimicrob. Agents Chemother: 38:1899-1903 (1994)). Industrial Batch and Continuous Fermentations Expression vectors for E. faecalis using the niSA gene from The present process employs a batch method of fermenta Lactococcus may also be used (Eichenbaum et al., Appl. 35 tion. A classical batch fermentation is a closed system where Environ. Microbiol. 64:2763-2769 (1998). Additionally, vec the composition of the medium is set at the beginning of the tors for gene replacement in the E. faecium chromosome may fermentation and not subject to artificial alterations during the be used (Nallaapareddy et al., Appl. Environ. Microbiol. fermentation. Thus, at the beginning of the fermentation the 72:334-345 (2006)). For example, expression of an isobu medium is inoculated with the desired organism or organ tanol biosynthetic pathway in Enterococcus faecalis is 40 isms, and fermentation is permitted to occur without adding described in Example 22. anything to the system. Typically, however, a “batch” fermen Fermentation Media tation is batch with respect to the addition of carbon source Fermentation media in the present invention must contain and attempts are often made at controlling factors such as pH suitable carbon substrates. Suitable substrates may include, and oxygen concentration. In batch systems the metabolite but are not limited to, monosaccharides such as glucose and 45 and biomass compositions of the system change constantly fructose, oligosaccharides Such as lactose or Sucrose, up to the time the fermentation is stopped. Within batch polysaccharides Such as starch or cellulose or mixtures cultures cells moderate through a static lag phase to a high thereof and unpurified mixtures from renewable feedstocks growth log phase and finally to a stationary phase where Such as cheese whey permeate, cornsteep liquor, Sugar beet growth rate is diminished or halted. Ifuntreated, cells in the molasses, and barley malt. Additionally the carbon Substrate 50 stationary phase will eventually die. Cells in log phase gen may also be one-carbon Substrates Such as carbon dioxide, or erally are responsible for the bulk of production of end prod methanol for which metabolic conversion into key biochemi uct or intermediate. cal intermediates has been demonstrated. In addition to one A variation on the standard batch system is the Fed-Batch and two carbon Substrates methylotrophic organisms are also system. Fed-Batch fermentation processes are also Suitable in known to utilize a number of other carbon containing com 55 the present invention and comprise a typical batch system pounds such as methylamine, glucosamine and a variety of with the exception that the substrate is added in increments as amino acids for metabolic activity. For example, methy the fermentation progresses. Fed-Batch systems are useful lotrophic yeast are known to utilize the carbon from methy when catabolite repression is apt to inhibit the metabolism of lamine to form trehalose or glycerol (Bellion et al., Microb. the cells and where it is desirable to have limited amounts of Growth C1-Compa. Int. Symp.), 7th (1993), 415-32. 60 substrate in the media. Measurement of the actual substrate Editor(s): Murrell, J. Collin; Kelly, Don P. Publisher: Inter concentration in Fed-Batch systems is difficult and is there cept, Andover, UK). Similarly, various species of Candida fore estimated on the basis of the changes of measurable will metabolize alanine or oleic acid (Sulter et al., Arch. factors such as pH, dissolved oxygen and the partial pressure Microbiol. 153:485-489 (1990)). Hence it is contemplated of waste gases such as CO. Batch and Fed-Batch fermenta that the source of carbon utilized in the present invention may 65 tions are common and well known in the art and examples encompassa wide variety of carbon containing Substrates and may be found in Thomas D. Brock in Biotechnology: A Text will only be limited by the choice of organism. book of Industrial Microbiology, Second Edition (1989) US 8,945,859 B2 23 24 Sinauer Associates, Inc., Sunderland, Mass., or Deshpande, Suitable solvent. The isobutanol-containing organic phase is Mukund V., Appl. Biochem. Biotechnol., 36:227. (1992), then distilled to separate the isobutanol from the solvent. herein incorporated by reference. Distillation in combination with adsorption may also be Although the present invention is performed in batch mode used to isolate isobutanol from the fermentation medium. In it is contemplated that the method would be adaptable to this method, the fermentation broth containing the isobutanol continuous fermentation methods. Continuous fermentation is distilled to near the azeotropic composition and then the is an open system where a defined fermentation medium is remaining water is removed by use of an adsorbent, such as added continuously to a bioreactor and an equal amount of molecular sieves (Aden et al. Lignocellulosic Biomass to conditioned media is removed simultaneously for processing. Ethanol Process Design and Economics Utilizing Co-Cur Continuous fermentation generally maintains the cultures at a 10 rent Dilute Acid Prehydrolysis and Enzymatic for constant high density where cells are primarily in log phase growth. Corn Stover, Report NREL/TP-510-32438, National Renew Continuous fermentation allows for the modulation of one able Energy Laboratory, June 2002). factor or any number of factors that affect cell growth or end Additionally, distillation in combination with pervapora product concentration. For example, one method will main 15 tion may be used to isolate and purify the isobutanol from the tain a limiting nutrient Such as the carbon Source or nitrogen fermentation medium. In this method, the fermentation broth level at a fixed rate and allow all other parameters to moder containing the isobutanol is distilled to near the azeotropic ate. In other systems a number of factors affecting growth can composition, and then the remaining water is removed by be altered continuously while the cell concentration, mea pervaporation through a hydrophilic membrane (Guo et al., J. Sured by media turbidity, is kept constant. Continuous sys Membr. Sci. 245, 199-210 (2004)). tems strive to maintain steady state growth conditions and thus the cell loss due to the medium being drawn off must be balanced against the cell growth rate in the fermentation. EXAMPLES Methods of modulating nutrients and growth factors for con tinuous fermentation processes as well as techniques for The present invention is further defined in the following maximizing the rate of product formation are well known in 25 Examples. It should be understood that these Examples, the art of industrial microbiology and a variety of methods are while indicating preferred embodiments of the invention, are detailed by Brock, supra. given by way of illustration only. From the above discussion It is contemplated that the present invention may be prac and these Examples, one skilled in the art can ascertain the ticed using either batch, fed-batch or continuous processes essential characteristics of this invention, and without depart and that any known mode offermentation would be suitable. 30 Additionally, it is contemplated that cells may be immobi ing from the spirit and scope thereof, can make various lized on a substrate as whole cell catalysts and subjected to changes and modifications of the invention to adapt it to fermentation conditions for isobutanol production. various uses and conditions. Methods for Isobutanol Isolation from the Fermentation General Methods Medium 35 Standard recombinant DNA and molecular cloning tech The bioproduced isobutanol may be isolated from the fer niques used in the Examples are well known in the art and are mentation medium using methods known in the art. For example, Solids may be removed from the fermentation described by Sambrook, J., Fritsch, E. F. and Maniatis, T. medium by centrifugation, filtration, decantation, or the like. Molecular Cloning: A Laboratory Manual: Cold Spring Har Then, the isobutanol may be isolated from the fermentation bor Laboratory Press: Cold Spring Harbor, N.Y. (1989) (Ma medium, which has been treated to remove solids as 40 niatis) and by T. J. Silhavy, M. L. Bennan, and L. W. Enquist, described above, using methods such as distillation, liquid Experiments with Gene Fusions, Cold Spring Harbor Labo liquid extraction, or membrane-based separation. Because ratory Press, Cold Spring Harbor, N.Y. (1984) and by isobutanol forms a low boiling point, azeotropic mixture with Ausubel, F. M. et al., Current Protocols in Molecular Biol water, distillation can only be used to separate the mixture up ogy, pub. by Greene Publishing Assoc. and Wiley-Inter to its azeotropic composition. Distillation may be used in 45 science (1987). combination with another separation method to obtain sepa Materials and methods suitable for the maintenance and ration around the azeotrope. Methods that may be used in growth of bacterial cultures are well known in the art. Tech combination with distillation to isolate and purify isobutanol niques suitable for use in the following Examples may be include, but are not limited to, decantation, liquid-liquid found as set out in Manual of Methods for General Bacteri extraction, adsorption, and membrane-based techniques. 50 ology (Philipp Gerhardt, R. G. E. Murray, Ralph N. Costilow, Additionally, isobutanol may be isolated using azeotropic Eugene W. Nester, Willis A. Wood, Noel R. Krieg and G. distillation using an entrainer (see for example Doherty and Briggs Phillips, eds), American Society for Microbiology, Malone, Conceptual Design of Distillation Systems, McGraw Washington, D.C. (1994)) or by Thomas D. Brock in Biotech Hill, New York, 2001). nology: A Textbook of Industrial Microbiology, Second Edi The isobutanol-water mixture forms a heterogeneous azeo 55 tion, Sinauer Associates, Inc., Sunderland, Mass. (1989). All trope so that distillation may be used in combination with reagents, restriction enzymes and materials used for the decantation to isolate and purify the isobutanol. In this growth and maintenance ofbacterial cells were obtained from method, the isobutanol containing fermentation broth is dis Aldrich Chemicals (Milwaukee, Wis.), BD Diagnostic Sys tilled to near the azeotropic composition. Then, the azeotro tems (Sparks, Md.), Life Technologies (Rockville, Md.), or pic mixture is condensed, and the isobutanol is separated Sigma Chemical Company (St. Louis, Mo.) unless otherwise from the fermentation medium by decantation. The decanted 60 specified. aqueous phase may be returned to the first distillation column as reflux. The isobutanol-rich decanted organic phase may be Microbial strains were obtained from The American Type further purified by distillation in a second distillation column. Culture Collection (ATCC), Manassas, Va., unless otherwise The isobutanol may also be isolated from the fermentation noted. medium using liquid-liquid extraction in combination with 65 The oligonucleotide primers to use in the following distillation. In this method, the isobutanol is extracted from Examples are given in Table 4. All the oligonucleotide prim the fermentation broth using liquid-liquid extraction with a ers are synthesized by Sigma-Genosys (Woodlands, Tex.). US 8,945,859 B2 25 26 TABLE 4 Oligonucleotide Clonind, Screenind, and Sequencinct Primers

SEO ID Name Sequence Description NO:

CACCATGGACAAACAGTATCCGG louds forward 1. TACGCC

N81 CGAAGGGCGATAGCTTTACCAAT ould reverse 2 CC

CACCATGGCTAACTACTTCAATA ilwC forward 3 CACTGA

CCAGGAGAAGGCCTTGAGTGTTT ilwC reverse 4. TCTCC

CACCATGCCTAAGTACCGTTCCG ilvD forward 5 CCACCA

CGCAGCACTGCTCTTAAATATTC ilvD reverse 6 GGC

CACCATGAACAACTTTAATCTGC ychD forward 7 ACACCC

GCTTAGCGGGCGGCTTCGTATAT ychD reverse 8 ACGGC

GCATGCCTTAAGAAAGGAGGGG louds forward 9 GGTCACATGGACAAACAGTATCC

ATGCATTTAATTAATTACAGAATC ould reverse 2O TGACTCAGATGCAGC

GTCGACGCTAGCAAAGGAGGGA ilwC forward 21 ATCACCATGGCTAACTACTTCAA

TCTAGATTAACCCGCAACAGCAA ilwC reverse 22 TACGTTTC

TCTAGAAAAGGAGGAATAAAGTA ilvD forward 23 TGCCTAAGTACCGTTC

GGATCCTTATTAACCCCCCAGTT ilvD reverse 24 TCGATTTA

GGATCCAAAGGAGGCTAGACATA kivD forward 25 TGTATACTGTGGGGGA

GAGCTCTTAGCTTTTATTTTGCTC kivD reverse 26 CGCAAAC

GAGCTCAAAGGAGGAGCAAGTA ychD forward 27 ATGAACAACTTTAATCT

GAATTCACTAGTCCTAGGTTAGC ychD reverse 28 GGGCGGCTTCGTATATACGG

BenNF CAACATTAGCGATTTTCTTTTCTC Npr forward 29 T

BenASR CATGAAGCTTACTAGTGGGCTTA Npr reverse 3O AGTTTTGAAAATAATGAAAACT

N11 O2 GAGCTCACTAGTCAATTGTAAGT louds forward 31 AAGTAAAAGGAGGTGGGTCACAT GGACAAACAGTATCC

N111.2 GGATCCGATCGACTTAAGCCTCA ould reverse 32 GCTTACAGAATCTGACTCAGATG CAGC

N112.2 GAGCTCCTTAAGAAGGAGGTAAT ilwC forward 33 CACCATGGCTAACTACTTCAA

N113.2 GGATCCGATCGAGCTAGCGCGG ilwC reverse 34 CCGCTTAACCCGCAACAGCAATA CGTTTC US 8,945,859 B2 27 28 TABLE 4 - continued Oligonucleotide Clonind, Screenind, and Sequencinct Primers

SEO ID Name Sequence Description NO:

GAGCTCGCTAGCAAGGAGGTAT ilvD forward 35 AAAGTATGCCTAAGTACCGTTC

GGATCCGATCGATTAATTAACCT ilvD reverse 36 AAGGTTATTAACCCCCCAGTTTC GATTTA

GAGCTCTTAATTAAAAGGAGGTT kivD forward 37 AGACATATGTATACTGTGGGGGA

GGATCCAGATCTCCTAGGACATG kivD reverse 38 TTTAGCTTTTATTTTGCTCCGCAA AC

N13 OSeq 1. TGTTCCAACCTGATCACCG sequencing 4 O primer

N13 OSeq 2 GGAAAACAGCAAGGCGCT sequencing 41 primer

N13 OSeq 3 CAGCTGAACCAGTTTGCC sequencing 42 primer

N13 OSeq 4. AAAATACCAGCGCCTGTCC sequencing 43 primer

N13 OSeq TGAATGGCCACCATGTTG sequencing 44 primer

N13 OSeq GAGGATCTCCGCCGCCTG sequencing 45 primer

N13 OSeq AGGCCGAGCAGGAAGATC sequencing 46 primer

N13 OSeq TGATCAGGTTGGAACAGCC sequencing 47 primer

AAGAACTGATCCCACAGGC sequencing 48 primer

ATCCTGTGCGGTATGTTGC sequencing 49 primer

ATTGCGATGGTGAAAGCG sequencing SO primer

ATGGTGTTGGCAATCAGCG sequencing 51 primer

GTGCTTCGGTGATGGTTT sequencing 52 primer

TTGAAACCGTGCGAGTAGC sequencing 53 primer

N132 Seq TATTCACTGCCATCTCGCG sequencing 54 primer

N132 Seq CCGTAAGCAGCTGTTCCT sequencing 55 primer

N132 Seq GCTGGAACAATACGACGTTA sequencing 56 primer

N132 Seq TGCTCTACCCAACCAGCTTC sequencing st primer

N132 Seq ATGGAAAGACCAGAGGTGCC sequencing 58 primer

N132 Seq TGCCTGTGTGGTACGAAT sequencing 59 primer US 8,945,859 B2 29 30 TABLE 4 - continued Oligonucleotide Clonind, Screenind, and Sequencinct Primers

SEO ID Name Sequence Description NO:

N132 SeqR3 TATTACGCGGCAGTGCACT sequencing 60 primer

N132 SeqR4 GGTGATTTTGTCGCAGTTAGAG sequencing 61 primer

TCGAAATTGTTGGGTCGC sequencing 62 primer

GGTCACGCAGTTCATTTCTAAG sequencing 63 primer

TGTGGCAAGCCGTAGAAA sequencing 64 primer

AGGATCGCGTGGTGAGTAA sequencing 65 primer

GTAGCCGTCGTTATTGATGA sequencing 66 primer

GCAGCGAACTAATCAGAGATTC sequencing 67 primer

TGGTCCGATGTATTGGAGG sequencing 68 primer

TCTGCCATATAGCTCGCGT sequencing 69 primer

Scr1 CCTTTCTTTGTGAATCGG sequencing 72 primer

Scr2 AGAAACAGGGTGTGATCC sequencing 73 primer

Scr3 AGTGATCATCACCTGTTGCC sequencing 74 primer

Scra AGCACGGCGAGAGTCGACGG sequencing primer

T-louds AGATAGATGGATCCGGAGGTGG loud B 44 (BamHI) GTCACATGGACAAACAGT forward

B-kivD CTCTAGAGGATCCAGACTCCTAG kivD reverse 45 (BamHI) GACATG

T-groE (XhoI) AGATAGATCTCGAGAGCTATTGT PgroE 47 AACATAATCGGTACGGGGGTG forward

B-groEL (SpeI, ATTATGTCAGGATCCACTAGTTT PgroE 48 BamH1) CCTCCTTTAATTGGGAATTGTTAT rewerse CCGC

T-groEL AGCTATTGTAACATAATCGGTAC PgroE 49 GGGGGTG forward

T-ilvCB. S. ACATTGATGGATCCCATAACAAG ilwC forward SO (BamHI) GGAGAGATTGAAATGGTAAAAG

B-ilvCB. S. TAGACAACGGATCCACTAGTTTA ilwC reverse 51 (SpeIBamHI) ATTTTGCGCAACGGAGACCACCG C

T-BD64 TTACCGTGGACT CACCGAGTGG pBD64 52 (Dra.II) GTAACTAGCCTCGCCGGAAAGA forward GCG

B-BD64 TCACAGTTAAGACACCTGGTGCC pBD64 53 (Dra.II) GT'TAATGCGCCATGACAGCCATG rewerse AT US 8,945,859 B2 31 32 TABLE 4 - continued Oligonucleotide Clonind, Screenind, and Sequencinct Primers

SEO ID Name Sequence Description NO: T-laclo (DraIII) ACAGATAGAT CACCAGGTGCAAG laclq 54 CTAATTCCGGTGGAAACGAGGTC forward ATC

B-laclid ACAGTACGATACACGGGGTGTCA, laclq 55 (Dra.II) CTGCCCGCTTTCCAGTCGGGAAA rewerse CC

T-groE (DraIII) TCGGATTACGCACCCCGTGAGCT PgroE 56 ATTGTAACATAATCGGTACGGGG forward GTG

B-B. S. ilvC CTGCTGATCTCACACCGTGTGTT ilwC reverse st (Dra.II) AATTTTGCGCAACGGAGACCACC GC

T-chB TCGATAGCATACACACGGTGGTT lodh forward 59 (Dra.II) AACAAAGGAGGGGTTAAAATGGT TGATTTCG

B-loch ATCTACGCACTCGGTGATAAAAC lodh reverse 60 (rrnBT1Dra) GAAAGGCCCAGTCTTTCGACTGA GCCTTTCGTTTTATCTTACACAGA TTTTTTGAATATTTGTAGGAC

LDH EcoRW F GACGTCATGACCACCCGCCGATCCC chL forward 61 TTTT

LDH AatR GATATCCAACACCAGCGACCGACGT lichL reverse 62 ATTAC

Cm F ATTTAAATCTCGAGTAGAGGATCCCA. Cm forward 63 ACAAACGAAAATTGGATAAAG

Cm R ACGCGTTATTATAAAAGCCAGTCATT Cm rever Se 64 AGG

P11 F-Stu CCTAGCGCTATAGTTGTTGACAG P11 promoter 65 AATGGACATACTATGATATATTGT forward TGCTATAGCGA

P11 R-SpeI CTAGTCGCTATAGCAACAATATA P11 promoter 66 TCATAGTATGTCCATTCTGTCAAC rewerse AACTATAGCGCTAGG

PldhI F- AAGCTTGTCGACAAACCAACATT ldhL forward 67 HindIII ATGACGTGTCTGGGC

Pldh R- GGATCCTCATCCTCTCGTAGTGA ldhL reverse 68 BamHI AAATT

F-odh-Avr TTCCTAGGAAGGAGGTGGTTAAA lodh forward 69 ATGGTTGATTTCG

R-lodh - TTGGATCCTTACACAGATTTTTTG lodh reverse 70 BamHI AATAT

F-ilwC (B.S.) - AACTTAAGAAGGAGGTGATTGAA ilwC forward 71. AfIII ATGGTAAAAGTATATT

R-ilwC (B.S.) - AAGCGGCCGCTTAATTTTGCGCA ilwC reverse 72 Not ACGGAGACC

R- TTAAGCTTGACATACTTGAATGACCT nis A promoter 73 PnisA (HindIII) AGTC forward R-Pnis.A (SpeI TTGGATCCAAACTAGTATAATTTATT nis A promoter 74 BamHI) TTGTAGTTCCTTC rewerse

Methods for Determining Isobutanol Concentration in Cul example, a specific high performance liquid chromatography ture Media s (HPLC) method utilized a Shodex SH-1011 column with a The concentration of isobutanol in the culture media can be Shodex SH-G guard column, both purchased from Waters determined by a number of methods known in the art. For Corporation (Milford, Mass.), with refractive index (RI) US 8,945,859 B2 33 34 detection. Chromatographic separation was achieved using TOPObudB. The pENTR construct was transformed into E. 0.01 MHSO as the mobile phase with a flow rate of 0.5 coli Top 10 (Invitrogen) cells and plated according to manu mL/min and a column temperature of 50°C. Isobutanol had a facturer's recommendations. Transformants were grown retention time of 46.6 min under the conditions used. Alter overnight and plasmid DNA was prepared using the QIAprep natively, gas chromatography (GC) methods are available. Spin Miniprep kit (Qiagen, Valencia, Calif.; catalog no. For example, a specific GC method utilized an HP-INNOWax 27106) according to manufacturer's recommendations. column (30 mx0.53 mm id, 1 um film thickness, Agilent Clones were sequenced to confirm that the genes inserted in Technologies, Wilmington, Del.), with a flame ionization the correct orientation and to confirm the sequence. The detector (FID). The carrier gas was helium at a flow rate of 4.5 nucleotide sequence of the open reading frame (ORF) for this mL/min, measured at 150° C. with constant head pressure; 10 gene and the predicted amino acid sequence of the enzyme are injector split was 1:25 at 200° C.; oven temperature was 45° given as SEQID NO:1 and SEQID NO:2, respectively. C. for 1 min, 45 to 220° C. at 10°C/min, and 220° C. for 5 To create an expression clone, the budB gene was trans min; and FID detection was employed at 240° C. with 26 ferred to the ploEST 14 vector by recombination to generate mL/min helium makeup gas. The retention time of isobutanol pDEST14 budB. The pDEST14budB vector was transformed was 4.5 min. 15 into E. coli BL21-AI cells (Invitrogen). Transformants were The meaning of abbreviations is as follows: “s' means inoculated into Luria Bertani (LB) medium supplemented second(s), “min' means minute(s), “h” means hour(s), “psi' with 50 ug/mL of amplicillin and grown overnight. An aliquot means pounds per square inch, "nm’ means nanometers, “d of the overnight culture was used to inoculate 50 mL of LB means day(s), "LL means microliter(s), “mL means milli supplemented with 50 lug/mL of amplicillin. The culture was liter(s), “L” means liter(s), “mm” means millimeter(s), “nm' incubated at 37° C. with shaking until the ODoo reached means nanometers, “mM” means millimolar, “uM” means 0.6-0.8. The culture was split into two 25-mL cultures and micromolar, “M” means molar, “mmol” means millimole(s), arabinose was added to one of the flasks to a final concentra "umol” means micromole(s)', 'g' means gram(s), “ug” tion of 0.2% w/v. The negative control flask was not induced means microgram(s) and “ng” means nanogram(s), "PCR with arabinose. The flasks were incubated for 4 h at 37° C. means polymerase chain reaction, “OD' means optical den 25 with shaking. Cells were harvested by centrifugation and the sity, “ODoo” means the optical density measured at a wave cell pellets were resuspended in 50 mMMOPS, pH 7.0 buffer. length of 600 nm, “kDa” means kilodaltons, 'g' means the The cells were disrupted either by Sonication or by passage gravitation constant, “bp” means base pair(s), "kbp” means through a French Pressure Cell. The whole cell lysate was kilobase pair(s), “96 w/v’ means weight/volume percent, % centrifuged yielding the Supernatant or cell free extract and V/v’ means volume/volume percent, “IPTG' means isopro 30 the pellet or the insoluble fraction. An aliquot of each fraction pyl-B-D-thiogalactopyranoiside, “RBS’ means ribosome (whole cell lysate, cell free extract and insoluble fraction) was binding site, “HPLC’ means high performance liquid chro resuspended in SDS (MES) loading buffer (Invitrogen), matography, and “GC’ means gas chromatography. The term heated to 85° C. for 10 min and subjected to SDS-PAGE “molar selectivity” is the number of moles of product pro analysis (NuPAGE 4-12% Bis-Tris Gel, catalog no. duced per mole of Sugar Substrate consumed and is reported 35 NP0322Box, Invitrogen). A protein of the expected molecu as a percent. lar weight of about 60 kDa, as deduced from the nucleic acid sequence, was present in the induced culture but not in the Example 1 uninduced control. Acetolactate synthase activity in the cell free extracts is Cloning and Expression of Acetolactate Synthase 40 measured using the method described by Bauerle et al. (Bio chim. Biophys. Acta 92(1): 142-149 (1964)). The purpose of this Example was to clone the budB gene from Klebsiella pneumoniae and express it in E. coli BL21 Example 2 AI. The budB gene was amplified from Klebsiella pneumo niae strain ATCC 25955 genomic DNA using PCR, resulting 45 Prophetic in a 1.8 kbp product. Genomic DNA was prepared using the Gentra Puregene kit Cloning and Expression of Acetohydroxy Acid (Gentra Systems, Inc., Minneapolis, Minn.; catalog number Reductoisomerase D-5000A). The budB gene was amplified from Klebsiella pneumoniae genomic DNA by PCR using primers N80 and 50 The purpose of this prophetic Example is to describe how N81 (see Table 2), given as SEQID NOs: 11 and 12, respec to clone the ilvC gene from E. coli K12 and express it in E. tively. Other PCR amplification reagents were supplied in coli BL21-AI. The ilvC gene is amplified from E. coli manufacturers' kits, for example, Finnzymes PhusionTM genomic DNA using PCR. High-Fidelity PCR Master Mix (New England Biolabs Inc., The ilvC gene is cloned and expressed in the same manner Beverly, Mass.: catalog no. F-531) and used according to the 55 as the budB gene described in Example 1. Genomic DNA manufacturer's protocol. Amplification was carried out in a from E. coli is prepared using the Gentra Puregene kit (Gentra DNA. Thermocycler GeneAmp 9700 (PE Applied Biosys Systems, Inc., Minneapolis, Minn.; catalog number tems, Foster city, CA). D-5000A). The ilvC gene is amplified by PCR using primers For expression studies the Gateway cloning technology N100 and N101 (see Table 2), given as SEQID NOS:13 and (Invitrogen Corp., Carlsbad, Calif.) was used. The entry vec 60 14, respectively, creating a 1.5 kbp product. The forward torpENTRSDD-TOPO allowed directional cloning and pro primer incorporates four bases (CCAC) immediately adja vided a Shine-Dalgarno sequence for the gene of interest. The cent to the translational start codon to allow directional clon destination vector poEST14 used a T7 promoter for expres ing into pENTR/SD/D-TOPO (Invitrogen) to generate the sion of the gene with no tag. The forward primer incorporated plasmid pENTRSDD-TOPOilvC. Clones are sequenced to four bases (CACC) immediately adjacent to the translational 65 confirm that the genes are inserted in the correct orientation start codon to allow directional cloning into pENTRSDD and to confirm the sequence. The nucleotide sequence of the TOPO (Invitrogen) to generate the plasmid pENTRSDD open reading frame (ORF) for this gene and the predicted US 8,945,859 B2 35 36 amino acid sequence of the enzyme are given as SEQ ID cloned into puC57, to form puC57-kiv.D. The codon-opti NO:3 and SEQID NO:4, respectively. mized nucleotide sequence of the open reading frame (ORF) To create an expression clone, the ilvC gene is transferred for this gene and the predicted amino acid sequence of the to the pDEST 14 (Invitrogen) vector by recombination to enzyme are given as SEQID NO:7 and SEQIDNO:8, respec generate pDEST14ilvC. The pDEST14ilvC vector is trans tively. formed into E. coli BL21-AI cells and expression from the T7 To create an expression clone Ndel and BamHI restriction promoter is induced by addition of arabinose. A protein of the sites are utilized to clone the 1.7 kbp kiv D fragment from expected molecular weight of about 54 kDa, as deduced from pUC57-kiv.D into vector pBT-3a (Novagen, Madison, Wis.). the nucleic acid sequence, is present in the induced culture, This creates the expression clone pET-3a-kiv.D. The pET-3a but not in the uninduced control. 10 kivD vector is transformed into E. coli BL21-AI cells and Acetohydroxy acid reductoisomerase activity in the cell expression from the T7 promoter is induced by addition of free extracts is measured using the method described by Arfin arabinose. A protein of the expected molecular weight of and Umbarger (J. Biol. Chem. 244(5):1118-1127 (1969)). about 61 kDa, as deduced from the nucleic acid sequence, is present in the induced culture, but not in the uninduced con Example 3 15 trol. Branched-chain keto acid decarboxylase activity in the cell Prophetic free extracts is measured using the method described by Smit et al. (Appl. Microbiol. Biotechnol. 64:396–402 (2003)). Cloning and Expression of Acetohydroxy Acid Dehydratase Example 5 The purpose of this prophetic Example is to describe how Prophetic to clone the ilvD gene from E. coli K12 and express it in E. coli BL21-AI. The ilvD gene is amplified from E. coli Cloning and Expression of Branched-Chain Alcohol genomic DNA using PCR. 25 Dehydrogenase The ilvD gene is cloned and expressed in the same manner as the budB gene described in Example 1. Genomic DNA The purpose of this prophetic Example is to describe how from E. coli is prepared using the Gentra Puregene kit (Gentra to clone theychD gene from E. coli K12 and express it in E. Systems, Inc., Minneapolis, Minn.; catalog number coli BL21-AI. The yohD gene is amplified from E. coli D-5000A). The ilvD gene is amplified by PCR using primers 30 genomic DNA using PCR. N102 and N103 (see Table 2), given as SEQID NOS:15 and TheyqhD gene is cloned and expressed in the same manner 16, respectively, creating a 1.9 kbp product. The forward as the budB gene described in Example 1. Genomic DNA primer incorporates four bases (CCAC) immediately adja from E. coli is prepared using the Gentra Puregene kit (Gentra cent to the translational start codon to allow directional clon Systems, Inc., Minneapolis, Minn.; catalog number ing into pENTR/SD/D-TOPO (Invitrogen) to generate the 35 D-5000A). TheychD gene is amplified by PCR using primers plasmid pENTRSDD-TOPOilvD. Clones are submitted for N104 and N105 (see Table 2), given as SEQID NOS:17 and sequencing to confirm that the genes are inserted in the cor 18, respectively, creating a 1.2 kbp product. The forward rect orientation and to confirm the sequence. The nucleotide primer incorporates four bases (CCAC) immediately adja sequence of the open reading frame (ORF) for this gene and cent to the translational start codon to allow directional clon the predicted amino acid sequence of the enzyme are given as 40 ing into pENTR/SD/D-TOPO (Invitrogen) to generate the SEQ ID NO:5 and SEQID NO:6, respectively. plasmid pENTRSDD-TOPOyghlD. Clones are submitted for To create an expression clone, the ilvD gene is transferred sequencing to confirm that the genes are inserted in the cor to the pDEST 14 (Invitrogen) vector by recombination to rectorientation and to confirm the sequence. The nucleotide generate pDEST14ilvD. The pDEST14ilvD vector is trans sequence of the open reading frame (ORF) for this gene and formed into E. coli BL21-AI cells and expression from the T7 45 the predicted amino acid sequence of the enzyme are given as promoter is induced by addition of arabinose. A protein of the SEQ ID NO 9 and SEQID NO:10, respectively. expected molecular weight of about 66 kDa, as deduced from To create an expression clone, theyqhD gene is transferred the nucleic acid sequence, is present in the induced culture, to the pDEST 14 (Invitrogen) vector by recombination to but not in the uninduced control. generate ploEST14ychl). The ploEST14ilvD vector is trans Acetohydroxy acid dehydratase activity in the cell free 50 formed into E. coli BL21-AI cells and expression from the T7 extracts is measured using the method described by Flintet al. promoter is induced by addition of arabinose. A protein of the (J. Biol. Chem. 268(20): 14732-14742 (1993)). expected molecular weight of about 42 kDa, as deduced from the nucleic acid sequence, is present in the induced culture, Example 4 but not in the uninduced control. 55 Branched-chain alcohol dehydrogenase activity in the cell Prophetic free extracts is measured using the method described by Sulzenbacher et al. (J. Mol. Biol. 342(2):489-502 (2004)). Cloning and Expression of Branched-Chain Keto Acid Decarboxylase Example 6 60 The purpose of this prophetic example is to describe how to Prophetic clone the kiv) gene from Lactococcus lactis and express it in E. coli BL21-AI. Construction of a Transformation Vector for the A DNA sequence encoding the branched-chain keto acid Genes in an Isobutanol Biosynthetic Pathway decarboxylase (kiv.D) from L. lactis is obtained from Gen 65 Script (Piscataway, N.J.). The sequence obtained is codon The purpose of this prophetic Example is to describe how optimized for expression in both E. coli and B. subtilis and is to construct a transformation vector comprising the genes US 8,945,859 B2 37 38 encoding the five steps in an isobutanol biosynthetic pathway. EcoRI, releasing a 1.2 kbp fragment. This is ligated with All genes are placed in a single operon under the control of a pUC19dHS, which has previously been digested with SacI single promoter. The individual genes are amplified by PCR and EcoRI. The resulting clone, puC19dHS-ychD, is con with primers that incorporate restriction sites for later cloning firmed by restriction digest. Next, the ilvC gene is excised and the forward primers contain an optimized E. coli ribo from pCR4 Blunt-TOPO-ilvC with SalI and Xbal, releasing a some binding site (AAAGGAGG). PCR products are TOPO 1.5 kbp fragment. This is ligated with puC19dHS-ychD, cloned into the pCR 4Blunt-TOPO vector and transformed which has previously been digested with SalI and Xbal. The into E. coli Top 10 cells (Invitrogen). Plasmid DNA is pre resulting clone, puC19dHS-ilvC-yqhD, is confirmed by pared from the TOPO clones and the sequence of the genes is restriction digest. The budB gene is then excised from pCR4 verified. Restriction enzymes and T4 DNA ligase (New 10 Blunt-TOPO-budB with SphI and Nsil, releasing a 1.8 kbp England Biolabs, Beverly, Mass.) are used according to fragment. pUC19dHS-ilvC-ychl) is digested with SphI and manufacturer's recommendations. For cloning experiments, PstI and ligated with the SphI/NsiI budB fragment (NsiI and restriction fragments are gel-purified using QIAquick Gel PstI generate compatible ends), forming puC19dHS-budB Extraction kit (Qiagen). After confirmation of the sequence, ilvC-ychD. A 1.9 kbp fragment containing the ilvD gene is the genes are subcloned into a modified puC19 vector as a 15 excised from pCR4 Blunt-TOPO-ilvD with Xbaland BamHI cloning platform. The puC19 vector is modified by HindIII/ and ligated with puC19dHS-budB-ilvC-yqhD, which is Sap digestion, creating puC19dHS. The digest removes the digested with these same enzymes, forming puC19dHS lac promoter adjacent to the MCS (multiple cloning site), budB-ilvC-ilvD-ychD. Finally, kiv) is excised from pCR4 preventing transcription of the operons in the vector. Blunt-TOPO-kivD with BamHI and SacI, releasing a 1.7 kbp The budB gene is amplified from K. pneumoniae ATCC fragment. This fragment is ligated with puC19dHS-budB 25955 genomic DNA by PCR using primer pair N110 and ilvC-ilvD-yqhD, which has previously been digested with N111 (see Table 2), given as SEQID NOS:19 and 20, respec BamHI and SacI, forming puC19dHS-budB-ilvC-ilvD tively, creating a 1.8 kbp product. The forward primer incor kivD-yqh). porates SphI and AflII restriction sites and a ribosome binding The puC19d HS-budB-ilvC-ilvD-kivD-yghlD vector is site (RBS). The reverse primer incorporates PacI and NsiI 25 digested with AflII and Spel to release a 8.2 kbp operon restriction sites. The PCR product is cloned into pCR4 Blunt fragment that is cloned into pBen AS, an E. coli-B. subtilis TOPO creating pCR4 Blunt-TOPO-budB. Plasmid DNA is shuttle vector. Plasmid pBenAS is created by modification of prepared from the TOPO clones and the sequence of the gene the pBE93 vector, which is described by Nagarajan, (WO is verified. 93/24.631. Example 4). To make pBenAS the Bacillus amy The ilvC gene is amplified from E. coli K12 genomic DNA 30 loliquefaciens neutral protease promoter (NPR), signal by PCR using primer pair N112 and N113 (see Table 2) given sequence, and the phoA gene are removed with a NcoI/Hin as SEQID NOS:21 and 22, respectively, creating a 1.5 kbp dIII digest of pBE93. The NPR promoter is PCR amplified product. The forward primer incorporates SalI and NheI from pBE93 by primers BenNF and Ben ASR, given as SEQ restriction sites and a RBS. The reverse primer incorporates a ID NOS:29 and 30, respectively. Primer Ben ASR incorpo Xbal restriction site. The PCR product is cloned into pCR4 35 rates AflII, Spel, and HindIII sites downstream of the pro Blunt-TOPO creating pCR4 Blunt-TOPO-ilvC. Plasmid moter. The PCR product is digested with Ncol and HindIII DNA is prepared from the TOPO clones and the sequence of and the fragment is cloned into the corresponding sites in the the gene is verified. vector creating pBen AS. The operon fragment is subcloned The ilvD gene is amplified from E. coli K12 genomic DNA into the AflII and Spel sites in pRen AS creating pBen-budB by PCR using primer pair N114 and N115 (see Table 2) given 40 ilvC-ilvD-kivD-yqh). as SEQ ID NOS:23 and 24, respectively, creating a 1.9 kbp product. The forward primer incorporates a Xbal restriction Example 7 site and a RBS. The reverse primer incorporates a BamHI restriction site. The PCR product is cloned into pCR4 Blunt Prophetic TOPO creating pCR4 Blunt-TOPO-ilvD. Plasmid DNA is 45 prepared from the TOPO clones and the sequence of the gene Expression of the Isobutanol Biosynthetic Pathway is verified. in E. coli The kiv) gene is amplified from puC57-kivD (described in Example 4) by PCR using primer pair N116 and N117 (see The purpose of this prophetic Example is to describe how Table 2), given as SEQ ID NOS:25 and 26, respectively, 50 to express an isobutanol biosynthetic pathway in E. coli. creating a 1.7 bp product. The forward primer incorporates a The plasmid p3en-budB-ilvC-ilvD-kivD-yqh D, con BamHI restriction site and a RBS. The reverse primer incor structed as described in Example 6, is transformed into E. coli porates a SacI restriction site. The PCR product is cloned into NM522 (ATCC No. 47000) to give E. coli strain NM522/ pCR4 Blunt-TOPO creating pCR4 Blunt-TOPO-kiv.D. Plas pBen-budB-ilvC-ilvD-kivD-ychD and expression of the mid DNA is prepared from the TOPO clones and the sequence 55 genes in the operon is monitored by SDS-PAGE analysis, of the gene is verified. enzyme assay and Western blot analysis. For Western blots, The ydhD gene is amplified from E. coli K12 genomic antibodies are raised to synthetic peptides by Sigma-Genosys DNA by PCR using primer pair N118 and N119(see Table 2) (The Woodlands, Tex.). given as SEQID NOS:27 and 28, respectively, creating a 1.2 E. coli strain NM522/pBen-budB-ilvC-ilvD-kivD-yghl) is kbp product. The forward primer incorporates a SacI restric 60 inoculated into a 250 mL shake flask containing 50 mL of tion site. The reverse primer incorporates Spel and EcoRI medium and shaken at 250 rpm and 35° C. The medium is restriction sites. The PCR product is cloned into pCR4 Blunt composed of glucose (5 g/L), MOPS (0.05 M), ammonium TOPO creating pCR4 Blunt-TOPO-yghD. Plasmid DNA is sulfate (0.01 M), potassium phosphate, monobasic (0.005 prepared from the TOPO clones and the sequence of the gene M), S10 metal mix (1% (v/v)) yeast extract (0.1% (w/v)), is verified. 65 casamino acids (0.1% (w/v)), thiamine (0.1 mg/L), proline To construct the isobutanol pathway operon, theyqhD gene (0.05 mg/L), and biotin (0.002 mg/L), and is titrated to pH 7.0 is excised from pCR4 Blunt-TOPO-ychD with SacI and with KOH. S10 metal mix contains: MgCl2 (200 mM), CaCl US 8,945,859 B2 39 40 (70 mM), MnO1 (5 mM), FeC1 (0.1 mM), ZnCl (0.1 mM), Acetolactate synthase activity in the cell free extracts was thiamine hydrochloride (0.2 mM), CuSO (172 uM), CoCl measured as described in Example 1. Three hours after induc (253 uM), and NaMoC (242 uM). After 18 h, isobutanol is tion with IPTG, an acetolactate synthase activity of 8 units/ detected by HPLC or GC analysis, using methods that are mg was detected. The control strain carrying only the well known in the art, for example, as described in the General pTrc99A plasmid exhibited 0.03 units/mg of acetolactate Methods section above. synthase activity. Example 8 Example 10

Prophetic 10 Cloning and Expression of Acetohydroxy Acid Reductoisomerase Expression of the Isobutanol Biosynthetic Pathway in Bacillus subtilis The purpose of this Example was to clone the ilvC gene from E. coli K12 and express it in E. coli TOP10. The ilvC The purpose of this prophetic Example is to describe how 15 gene was amplified from E. coli K12 strain FM5 (ATCC to express an isobutanol biosynthetic pathway in Bacillus 53911) genomic DNA using PCR. subtilis. The same approach as described in Example 7 is The ilvC gene was cloned and expressed in a similar man used. ner as described for the cloning and expression of ilvC in The plasmid p3en-budB-ilvC-ilvD-kivD-yqhD, con Example 2 above. PCR was used to amplify ilvC from the E. structed as described in Example 6, is used. This plasmid is coli FM5 genome using primers N112.2 and N113.2 (SEQID transformed into Bacillus subtilis BE1010 (J. Bacteriol. 173: NOs:33 and 34, respectively). The primers created SacI and 2278-2282 (1991)) to give B. subtilis strain BE1010/pben AMU sites and an optimal RBS at the 5' end and NotI, Nhel budB-ilvC-ilvD-kivD-ychl) and expression of the genes in and BamHI sites at the 3' end of ilvC. The 1.5 kbp PCR each operon is monitored as described in Example 7. product was cloned into pCR4 Blunt TOPO according to the B. subtilis strain BE1010/p3en-budB-ilvC-ilvD-kivD 25 manufacturer's protocol (Invitrogen) generating pCR4 Blunt ychl) is inoculated into a 250 mL shake flask containing 50 TOPO::ilvC. The sequence of the PCR product was con mL of medium and shaken at 250 rpm and 35°C. for 18 h. The firmed using sequencing primers (N131 Seqf 1-F3, and medium is composed of dextrose (5 g/L), MOPS (0.05 M), N131SeqR1-R3, given as SEQID NOs:48-53, respectively). glutamic acid (0.02 M), ammonium sulfate (0.01 M), potas To create an expression clone, the ilvC gene was excised from sium phosphate, monobasic buffer (0.005 M), S10 metal mix 30 pCR4 Blunt TOPO::ilvC using SacI and BamHI and cloned (as described in Example 11, 1% (v/v)), yeast extract (0.1% into pTrc99A. The pTrc99A::ilvC vector was transformed (w/v)), casamino acids (0.1% (w/v)), tryptophan (50 mg/L). into E. coli TOP10 cells and expression from the Trc promoter methionine (50 mg/L), and lysine (50 mg/L), and is titrated to was induced by addition of IPTG, as described in Example 9. pH 7.0 with KOH. After 18 h, isobutanol is detected by HPLC Cell-free extracts were prepared as described in Example 1. or GC analysis using methods that are well known in the art, 35 Acetohydroxy acid reductoisomerase activity in the cell for example, as described in the General Methods section free extracts was measured as described in Example 2. Three above. hours after induction with IPTG, an acetohydroxy acid reduc toisomerase activity of 0.026 units/mg was detected. The Example 9 control strain carrying only the pTrc99A plasmid exhibited 40 less than 0.001 units/mg of acetohydroxy acid reductoi Cloning and Expression of Acetolactate Synthase Somerase activity. To create another acetolactate synthase expression clone, Example 11 the budB gene was cloned into the vectorpTrc99A. The budB gene was first amplified from pENTRSDD-TOPObudB (de 45 Cloning and Expression of Acetohydroxy Acid scribed in Example 1) using primers (N110.2 and N111.2, Dehydratase given as SEQ ID NOS:31 and 32, respectively) that intro duced SacI, Spel and Mfe sites at the 5' end and BbvCI, The purpose of this Example was to clone the ilvD gene AFIII, and BamHI sites at the 3' end. The resulting 1.75 kbp from E. coli K12 and express it in E. coli Top 10. The ilvD PCR product was cloned into pCR4-Blunt TOPO (Invitro 50 gene was amplified from E. coli K12 strain FM5 (ATCC gen) and the DNA sequence was confirmed (using N130Seq 53911) genomic DNA using PCR. sequencing primers F1-F4 and R1-R4, given as SEQID NOs: The ilvD gene was cloned and expressed in a similar man 40-47, respectively). The budB gene was then excised from ner as the ilvC gene described in Example 10. PCR was used this vector using SacI and BamHI and cloned into pTrc99A to amplify ilvD from the E. coli FM5 genome using primers (Amann et al. Gene 69(2):301-315 (1988)), generating 55 N114.2 and N115.2 (SEQ ID NOS:35 and 36, respectively). pTrc99A: budB. ThepTrc99A::budB vector was transformed The primers created SacI and Nhe sites and an optimal RBS into E. coli TOP10 cells and the transformants were inocu at the 5' end and Bsu36I, PacI and BamHI sites at the 3' end of lated into LB medium supplemented with 50 lug/mL of ampi ilvD. The 1.9 kbp PCR product was cloned into pCR4 Blunt cillin and grown overnight at 37°C. An aliquot of the over TOPO according to the manufacturer's protocol (Invitrogen) night culture was used to inoculate 50 mL of LB medium 60 generating pCR4 Blunt TOPO::ilvD. The sequence of the supplemented with 50 lug/mL of ampicillin. The culture was PCR product was confirmed (sequencing primers incubated at 37°C. with shaking until the ODoo reached 0.6 N132SeqF1-F4 and N132SeqR1-R4, given as SEQID NOs: to 0.8. Expression of budB from the Trc promoter was then 54-61, respectively). To create an expression clone, the ilvD induced by the addition of 0.4 mM IPTG. Negative control gene was excised from plasmid pCR4 Blunt TOPO::ilvD flasks were also prepared that were not induced with IPTG. 65 using SacI and BamHI, and cloned into pTrc99A. The The flasks were incubated for 4 h at 37° C. with shaking. pTrc99A::ilvD vector was transformed into E. coli TOP10 Cell-free extracts were prepared as described in Example 1. cells and expression from the Trc promoter was induced by US 8,945,859 B2 41 42 addition of IPTG, as described in Example 9. Cell-free NADPH-dependent isobutyraldehyde reductase activity extracts were prepared as described in Example 1. when the cell extracts were assayed by following the decrease Acetohydroxy acid dehydratase activity in the cell free in absorbance at 340 nm at pH 7.5 and 35° C. extracts was measured as described in Example 3. Three To generate a second expression strain containing 1.5GI hours after induction with IPTG, an acetohydroxy acid dehy yghD:Cm, a P1 lysate was prepared from MG 1655 1.5GI dratase activity of 46 units/mg was measured. The control ychD::Cm and the cassette was transferred to BL21 (DE3) strain carrying only the pTrc99A plasmid exhibited no detect (Invitrogen) by transduction, creating BL21 (DE3) 1.5GI able acetohydroxy acid dehydratase activity. ychD::Cm.

Example 12 10 Example 14 Cloning and Expression of Branched-Chain Keto Construction of a Transformation Vector for the First Acid Decarboxylase Four Genes in an Isobutanol Biosynthetic Pathway The purpose of this Example was to clone the kiv) gene 15 The purpose of this Example was to construct a transfor from Lactococcus lactis and express it in E. coli TOP10. mation vector comprising the first four genes (i.e., budB. The kiv) gene was cloned and expressed in a similar ilvC, ilvD and kiv)) in an isobutanol biosynthetic pathway. manner as that described for ilvC in Example 10 above. PCR To construct the transformation vector, first, the ilvC gene was used to amplify kiv D from the plasmid puC57-kivD (see was obtained from pTrc99A::ilvC (described in Example 10) Example 4, above) using primers N116.2 and N117.2 (SEQ by digestion with AflII and BamHI and cloned into pTrc99A:: ID NOS:37 and 38, respectively). The primers created SacI budB (described in Example 9), which was digested with and PacI sites and an optimal RBS at the 5' end and PciI, Avril, AflII and BamHI to produce plasmid pTrc99A:: budB-ilvC. BglII and BamHI sites at the 3' end of kiv.D. The 1.7 kbp PCR Next, the ilvD and kiv) genes were obtained from pTrc99A:: product was cloned into pCR4 Blunt TOPO according to the ilvD (described in Example 11) and pTrc99A::kivD (de manufacturer's protocol (Invitrogen) generating pCR4 Blunt 25 scribed in Example 12), respectively, by digestion with NheI TOPO::kiv.D. The sequence of the PCR product was con and PacI (ilvD) and PacI and BamHI (kivD). These genes firmed using primers N133SeqF1-F4 and N133SeqR1-R4 were introduced into pTrc99A::budB-ilvC, which was first (given as SEQ ID NOS:62-69, respectively). To create an digested with Nhe and BamHI, by three-way ligation. The expression clone, the kiv) gene was excised from plasmid presence of all four genes in the final plasmid, pTrc99A:: pCR4 Blunt TOPO::kivD using SacI and BamHI, and cloned 30 budB-ilvC-ilvD-kiv.D, was confirmed by PCR screening and into pTrc99A. The pTrc99A::kivD vector was transformed restriction digestion. into E. coli TOP10 cells and expression from the Trc promoter was induced by addition of IPTG, as described in Example 9. Example 15 Cell-free extracts were prepared as described in Example 1. Branched-chain keto acid decarboxylase activity in the cell 35 Expression of an Isobutanol Biosynthetic Pathway in free extracts was measured as described in Example 4, except E. coli Grown on Glucose that PurpaldR) reagent (Aldrich, Catalog No. 162892) was used to detect and quantify the aldehyde reaction products. To create E. coli isobutanol production strains, pTrc99A:: Three hours after induction with IPTG, a branched-chain keto budB-ilvC-ilvD-kivD (described in Example 14) was trans acid decarboxylase activity of greater than 3.7 units/mg was 40 formed into E. coli MG1655 1.5GI ydhD:Cm and E. coli detected. The control strain carrying only the pTrc99A plas BL21 (DE3) 1.5GI ychD:Cm (described in Example 13). mid exhibited no detectable branched-chain keto acid decar Transformants were initially grown in LB medium containing boxylase activity. 50 ug/mL, kanamycin and 100 g/mL carbenicillin. The cells from these cultures were used to inoculate shake flasks (ap Example 13 45 proximately 175 mL total volume) containing 50 or 170 mL of TM3a/glucose medium (with appropriate antibiotics) to Expression of Branched-Chain Alcohol represent high and low oxygen conditions, respectively. Dehydrogenase TM3a/glucose medium contained (per liter): glucose (10g), KHPO (13.6 g), citric acid monohydrate (2.0 g), (NH), E. coli contains a native gene (ychD) that was identified as 50 SO(3.0 g), MgSO4.7H2O (2.0 g), CaCl2.H2O (0.2g), ferric a 1,3-propanediol dehydrogenase (U.S. Pat. No. 6,514,733). ammonium citrate (0.33 g), thiamine.HCl (1.0 mg), yeast The YchD protein has 40% identity to AdhB (encoded by extract (0.50g), and 10 mL of trace elements solution. The pH adhB) from Clostridium, a putative NADH-dependent was adjusted to 6.8 with NH-OH. The trace elements solution butanol dehydrogenase. TheyqhD gene was placed under the contained: citric acid.HO (4.0 g/L), MnSOHO (3.0 g/L), constitutive expression of a variant of the glucose isomerase 55 NaCl (1.0 g/L), FeSO.7HO (0.10 g/L), CoC1.6HO (0.10 promoter 1.6GI (SEQ ID NO. 70) in E. coli strain MG 1655 g/L), ZnSO.7HO (0.10 g/L), CuSO4.5H2O (0.010 g/L), 1.6ydhD:Cm (WO 2004/033646) using Red technology HBO, (0.010 g/L), and Na MoO 2HO (0.010 g/L). (Datsenko and Wanner, Proc. Natl. Acad. Sci. U.S.A. 97:6640 The flasks were inoculated at a starting ODoo of s().01 (2000)). MG1655 1.6ydhD:Cm contains a FRT-CmR-FRT units and incubated at 34°C. with shaking at 300 rpm. The cassette so that the antibiotic marker can be removed. Simi 60 flasks containing 50 mL of medium were closed with 0.2 um larly, the native promoter was replaced by the 1.5GI promoter filter caps; the flasks containing 150 mL of medium were (WO 2003/089621) (SEQ ID NO. 71), creating strain closed with sealed caps. IPTG was added to a final concen MG 1655 1.5GI-ychl):Cm, thus, replacing the 1.6GI pro tration of 0.04 mM when the cells reached an ODoo of >0.4 moter of MG16551.6ydhD:Cm with the 1.5GI promoter. units. Approximately 18 h after induction, an aliquot of the Strain MG 1655 1.5GI-yqhD:Cm was grown in LB 65 broth was analyzed by HPLC (Shodex Sugar SH 1011 column medium to mid-log phase and cell free extracts were prepared (Showa Denko America, Inc. NY) with refractive index (RI) as described in Example 1. This strain was found to have detection) and GC (Varian CP-WAX 58(FFAP) CB, 0.25 US 8,945,859 B2 43 44 mmx0.2 umx25 m (Varian, Inc., Palo Alto, Calif.) with flame ilvD-kivD and E. coli MG1655 1.5yghD/pTrc99A::budB ionization detection (FID)) for isobutanol content, as ilvC-ilvD-kivD (described in Example 15) by electropora described in the General Methods section. No isobutanol was tion. Transformants were first selected on LB medium detected in control strains carrying only the pTrc99A vector containing 100 ug/mL amplicillin and 50 ug/mL, kanamycin (results not shown). Molar selectivities and titers of isobu 5 and then screened on MacConkey sucrose (1%) plates to tanol produced by strains carrying pTrc99A::budB-ilvC confirm functional expression of the Sucrose operon. For ilvD-kivD are shown in Table 5. Significantly higher titers of production of isobutanol, strains were grown in TM3a mini mal defined medium (described in Example 15) containing isobutanol were obtained in the cultures grown under low 1% Sucrose instead of glucose, and the culture medium was oxygen conditions. analyzed for the amount of isobutanol produced, as described 10 in Example 15, except that samples were taken 14 h after TABLE 5 induction. Again, no isobutanol was detected in control strains carrying only the pTrc99A vector (results not shown). Production of Isobutanol by E. coli Strains Grown on Glucose Molar selectivities and titers of isobutanol produced by Molar MG1655 1.5yghlD carrying pTrc99A: budB-ilvC-ilvD-kivD O2 Isobutanol Selectivity 15 are shown in Table 6. Similar results were obtained with the Strain Conditions M (%) analogous BL21 (DE3) strain. MG1655 1.5GIyghlD/ High 0.4 4.2 pTrc99A:budB-ilvC-ilvD-kivD TABLE 6 MG1655 1.5GIyghlD/ Low 9.9 39 pTrc99A:budB-ilvC-ilvD-kivD Production of Isobutanol by E. coli strain BL21 (DE3) 1.5GIyghD/ High O.3 3.9 MG1655 1.5ydhD?pTrc99A:budB-ilvC-ilvD pTrc99A:budB-ilvC-ilvD-kivD kivDipBHR1::cscBKA Grown on Sucrose BL21 (DE3) 1.5GIyghD/ Low 1.2 12 pTrc99A:budB-ilvC-ilvD-kivD O2 IPTG, Isobutanol, Molar Conditions mM M Selectivity, 9% *Determined by HPLC. 25 High O.04 O.17 2 High 0.4 1.59 21 Example 16 Low O.04 4.03 26 Low 0.4 3.95 29 Expression of an Isobutanol Biosynthetic Pathway in *Determined by HPLC. E. coli Grown on Sucrose 30 Since the strains described in Example 15 were not capable Example 17 of growth on Sucrose, an additional plasmid was constructed to allow utilization of sucrose for isobutanol production. A Expression of Isobutanol Pathway Genes in sucrose utilization gene cluster cscEBKA, given as SEQ ID 35 Saccharomyces Cerevisiae NO:39, was isolated from genomic DNA of a sucrose-utiliz ing E. coli strain derived from ATCC strain 13281. The To express isobutanol pathway genes in Saccharomyces Sucrose utilization genes (cscA, cScK, and cscB) encode a cerevisiae, a number of E. coli-yeast shuttle vectors were sucrose hydrolase (CscA), given as SEQID NO:139, D-fruc constructed. A PCR approach (Yu, et al. Fungal Genet. Biol. tokinase (CscK), given as SEQID NO:140, and sucrose per 41:973-981 (2004)) was used to fuse genes with yeast pro mease (CscB), given as SEQ ID NO:141. The sucrose-spe 40 moters and terminators. Specifically, the GPD promoter cific repressor gene cscR was not included so that the three (SEQ ID NO:76) and CYC1 terminator (SEQ ID NO:77) genes cscEBKA were expressed constitutively from their were fused to the alsS gene from Bacillus subtilis (SEQ ID native promoters in E. coli. NO:78), the FBA promoter (SEQ ID NO:79) and CYC1 Genomic DNA from the sucrose-utilizing E. coli strain was terminator were fused to the ILV5 gene from S. cerevisiae digested to completion with BamHI and EcoRI. Fragments 45 (SEQ ID NO:80), the ADH1 promoter (SEQID NO:81) and having an average size of about 4 kbp were isolated from an ADH1 terminator (SEQ ID NO:82) were fused to the ILV3 agarose gel and were ligated to plasmid pLitmus28 (New gene from S. cerevisiae (SEQ ID NO:83), and the GPM England Biolabs), digested with BamHI and EcoRI and trans promoter (SEQID NO:84) and ADH1 terminator were fused formed into ultracompetent E. coli TOP10F" cells (Invitro to the kiv) gene from Lactococcus lactis (SEQ ID NO:7). gen). The transformants were streaked onto MacConkey agar 50 The primers, given in Table 7, were designed to include plates containing 1% Sucrose and amplicillin (100 g/mL)and restriction sites for cloning promoter/gene/terminator prod screened for the appearance of purple colonies. Plasmid DNA ucts into E. coli-yeast shuttle vectors from the pRS400 series was isolated from the purple transformants, and sequenced (Christianson et al. Gene 110:119-122 (1992)) and for with M13 Forward and Reverse primers (Invitrogen), and exchanging promoters between constructs. Primers for the 5' Scr1-4 (given as SEQID NOs:72-75, respectively). The plas ends of ILV5 and ILV3 (N138 and N155, respectively, given mid containing cscB, cScK, and cscA (cScPKA) genes was 55 as SEQID NOs: 95 and 107, respectively) generated new start designated pScrl. codons to eliminate mitochondrial targeting of these To create a Sucrose utilization plasmid that was compatible enzymes. with the isobutanol pathway plasmid (Example 14), the All fused PCR products were first cloned into pCR4-Blunt operon from pScrl was subcloned into pBHR1 (MoBiTec, by TOPO cloning reaction (Invitrogen) and the sequences Goettingen, Germany). The cscEBKA genes were isolated by 60 were confirmed (using M13 forward and reverse primers digestion of pScrl with XhoI (followed by incubation with (Invitrogen) and the sequencing primers provided in Table 7. Klenow enzyme to generate bluntends) and then by digestion Two additional promoters (CUP1 and GAL1) were cloned by with AgeI. The resulting 4.2 kbp fragment was ligated into TOPO reaction into pCR4-Blunt and confirmed by sequenc pBHR1 that had been digested with Nael and AgeI, resulting ing; primer sequences are indicated in Table 7. The plasmids in the 9.3 kbp plasmid pBHR1::cscBKA. 65 that were constructed are described in Table 8. The plasmids The sucrose plasmid p3HR1::cscBKA was transformed were transformed into either Saccharomyces cerevisiae into E. coli BL21 (DE3) 1.5 yahD/pTrc99A: budB-ilvC BY4743 (ATCC 201390) or YJR148w (ATCC 4036939) to US 8.9 45,859 B2 45 46 assess enzyme specific activities using the enzyme assays with buffer, centrifuged again, and frozen at -80°C. The cells described in Examples 1-4 and Examples 9-12. For the deter were thawed, resuspended in 20 mM Tris-HCl, pH 8.0 to a mination of enzyme activities, cultures were grown to an ODoo of 1.0 in synthetic complete medium (Methods in Yeast final Volume of 2 mL, and then disrupted using a bead beater Genetics, 2005, Cold Spring Harbor Laboratory Press, Cold with 1.2 g of glass beads (0.5 mm size). Each sample was Spring Harbor, N.Y., pp. 201-202) lacking any metabolite(s) 5 processed on high speed for 3 minutes total (with incubation necessary for selection of the expression plasmid(s), har on ice after each minute of beating). Extracts were cleared of vested by centrifugation (2600xg for 8 min at 4°C.), washed cell debris by centrifugation (20,000xg for 10 min at 4°C.). TABLE F Primer Sequences for Cloning and Sequencing of S. cerevisiae Expression Vectors SEQ ID Name Sequence Description NO :

CGTGTTAGTCACATCAGGA B. subtilis alsS 85 C sequencing primer

GGCCATAGCAAAAATCCAA B. subtilis alsS 86 ACAGC sequencing primer

CCACGATCAATCATATCGA B. subtilis alsS 87 ACACG sequencing primer

GGTTTCTGTCTCTGGTGAC B. subtilis alsS 88 G sequencing primer

GTCTGGTGATTCTACGCGC B. subtilis alsS 89 AAG sequencing primer

CATCGACTGCATTACGCAA B. subtilis alsS 9 O CTC sequencing primer

CGATCGTCAGAACAACATC B. subtilis alsS 91 TGC sequencing primer

CCTTCAGTGTTCGCTGTCA B. subtilis alsS 92 G sequencing primer

N136 CCGCGGATAGATCTGAAAT FBA promoter 93 GAATAACAATACTGACA forward primer with SacII/BglII sites

N137 TACCACCGAAGTTGATTTG FBA promoter 94 CTTCAACATCCTCAGCTCT reverse primer AGATTTGAATATGTATTACT with BowCI site TGGTTAT and ILW5 - annealing region

N138 ATGTTGAAGCAAATCAACT ILW5 forward 95 TCGGTGGTA primer (creates alternate start codon)

N139 TTATTGGTTTTCTGGTCTCA ILVs reverse 96 AC primer

N14 O AAGTTGAGACCAGAAAACC CYC terminator 97 AATAATTAATTAATCATGTA forward primer ATTAGTTATGTCACGCTT With PacI site and ILV5 - annealing region

N141 GCGGCCGCCCGCAAATTA CYC terminator 98 AAGCCTTCGAGC reverse primer With Not site

N142 GGATCCGCATGCTTGCATT GPM promoter 99 TAGTCGTGC forward primer With BamHI site

N143 CAGGTAATCCCCCACAGTA GPM promoter 1OO TACATCCTCAGCTATTGTA reverse primer ATATGTGTGTTTGTTTGG With BbvCI site and kiv annealing region US 8,945,859 B2 47 48 TABLE 7 - continued Primer Sequences for Cloning and Sequencing of S. cerevisiae Expression Vectors SEQ ID Name Sequence Description NO:

N144 ATGTATACTGTGGGGGATT kivD forward 1 O1 ACC primer

N145 TTAGCTTTTATTTTGCTCCG kivD reverse 1 O2 CA primer

N146 TTTGCGGAGCAAAATAAAA ADH terminator 103 GCTAATTAATTAAGAGTAA forward primer GCGAATTTCTTATGATTTA With PacI site and kivD- annealing region

N147 ACTAGTACCACAGGTGTTG ADH terminator 104 TCCTCTGAG reverse primer with SpeI site

N151 CTAGAGAGCTTTCGTTTTC alsS reverse 105 ATG primer

N152 CTCATGAAAACGAAAGCTC CYC terminator 106 TCTAGTTAATTAATCATGTA forward primer ATTAGTTATGTCACGCTT With PacI site and als S-annealing region

N155 ATGGCAAAGAAGCTCAACA ILV3 forward 1. Of AGTACT primer (alternate start codon)

N156 TCAAGCATCTAAAACACAA I W3 reverse 108 CCG P rimer

N157 AACGGTTGTGTTTTAGATG ADH terminator 109 CTTGATTAATTAAGAGTAA forward primer GCGAATTTCTTATGATTTA With PacI site and ILV3 - annealing region

N158 GGATCCTTTTCTGGCAACC DH promoter 11O AAACCCATA orward primer With BamHI site

N159 CGAGTACTTGTTGAGCTTC ADH promoter 111 TTTGCCATCCTCAGCGAGA reverse primer TAGTTGATTGTATGCTTG With BbvCI site and ILV3 - annealing region

1. GAAAACGTGGCATCCTCTC FBA: i: ILW5 : : CYC sequencing primer

2 GCTGACTGGCCAAGAGAA FBA: i: ILW5 : : CYC A. sequencing primer

3 TGTACTTCTCCCACGGTTT FBA: i: ILW5 : : CYC C sequencing primer

4. AGCTACCCAATCTCTATAC FBA: i: ILW5 : : CYC CCA sequencing primer

5 CCTGAAGTCTAGGTCCCTA FBA: i: ILW5 : : CYC TTT sequencing primer

GCGTGAATGTAAGCGTGA FBA: i: ILW5 : : CYC C sequencing primer

CGTCGTATTGAGCCAAGAA FBA: i: ILW5 : : CYC C sequencing primer

GCATCGGACAACAAGTTCA FBA: i: ILW5 : : CYC T sequencing primer

TCGTTCTTGAAGTAGTCCA FBA: i: ILW5 : : CYC ACA sequencing primer US 8,945,859 B2 49 50 TABLE F - Continued Primer Sequences for Cloning and Sequencing of S. cerevisiae Expression Vectors SEQ ID Name Sequence Description NO:

N160 Seq TGAGCCCGAAAGAGAGGA FBA: : : CYC 21 T sequencing primer

Seq ACGGTATACGGCCTTCCTT ADH: : W3: :ADH 22 sequencing primer

Seq GGGTTTGAAAGCTATGCAG ADH: : W3 : : A. D 23 T sequencing imer

Seq GGTGGTATGTATACTGCCA ADH: : W3 : : D 24 ACA sequencing imer

Seq GGTGGTACCCAATCTGTGA ADH: : W3 : : 25 TTA sequencing imer

Seq CGGTTTGGGTAAAGATGTT ADH: : W3 : : D 26 G sequencing imer

Seq AAACGAAAATTCTTATTCTT ADH: : W3 : : A. D 2 7 GA sequencing imer

Seq TCGTTTTAAAACCTAAGAG ADH: : W3 : : A. D 28 TCA sequencing imer

Seq CCAAACCGTAACCCATCAG ADH: : W3 : : sequencing imer

Seq CACAGATTGGGTACCACCA ADH: : W3 : : D sequencing imer

Seq ACCACAAGAACCAGGACCT ADH: : W3 : : A. D 3 1. G sequencing imer

Seq CATAGCTTTCAAACCCGCT ADH: : W3: :ADH 32 sequencing primer

Seq CGTATACCGTTGCTCATTA ADH: : W3: :ADH 33 GAG sequencing primer

ATGTTGACAAAAGCAACAA alsS forward 34 AAGA primer

ATCCGCGGATAGATCTAGT GPD forward 35 TCGAGTTTATCATTATCAA primer with SacII/Bgll I sites

TTCTTTTGTTGCTTTTGTCA GPD promoter 36 ACATCCTCAGCGTTTATGT reverse primer GTGTTTATTCGAAA With BbvCI site and alsS annealing region

N176 ATCCGCGGATAGATCTATT GAL1 promoter 137 AGAAGCCGCCGAGCGGGC forward primer G with SacII/BglII sites

N177 ATCC. TCAGCTTTTCTCCTT GAL1 promoter 138 GACGTTAAAGTA reverse with BbvCI site

N191 ATCCGCGGATAGATCTCCC CUP1 promoter 17s ATTACCGACATTTGGGCGC forward primer with SacII/BglII sites

N192 ATCCTCAGCGATGATTGAT CUP1 promoter 176 TGATTGATTGTA reverse with BbvCI site US 8,945,859 B2 51 52 TABLE 8 to poor transcription of the leu2-dallele (Erhart and Hollen berg, J. Bacteriol. 156:625-635 (1983)). Aerobic cultures E. Coli-Yeast Shuttle Vectors Carrying Isobutanol Pathway Genes were grown in 175 mL capacity flasks containing 50 mL of Plasmid Name Construction medium in an Innova4000 incubator (New Brunswick Scien tific, Edison, N.J.) at 30° C. and 200 rpm. Low oxygen cul pRS426 ATCC No. 77107), – ORA3 selection tures were prepared by adding 45 mL of medium to 60 mL pRS426:GPD:alsS:CYC GPD:alsS:CYC PCR product digested with serum vials that were sealed with crimped caps after inocu SacII/NotI cloned into pRS426 digested lation and kept at 30° C. Sterile syringes were used for sam with same pling and addition of inducer, as needed. Approximately 24h pRS426:FBA::ILV5:CYC FBA::ILV5:CYC PCR product digested with 10 SacII/NotI cloned into pRS426 digested after inoculation, the inducer CuSO was added to a final with same concentration of 0.03 mM. Control cultures for each strain pRS425 ATCC No. 77106), – without CuSO addition were also prepared. Culture super LEU2 selection pRS425:ADH::ILV3::ADH ADH::ILV3::ADH PCR product digested natants were analyzed 18 or 19 h and 35 h after CuSO with BamHISpeI cloned into pRS425 addition by both GC and HPLC for isobutanol content, as digested with same 15 described above in Example 15. The results for S. cerevisiae pRS425:GPM:kivD:ADH GPM:kivD::ADH PCR product digested YJR148w?pRS423:CUP1-alsS+FBA-ILV3/pHR81::FBA with BamHISpeI cloned into pRS425 digested with same ILV5+GPM-kivD grown on glucose are presented in Table 9. bRS426::CUP1::alsS 7.7 kbp SacII/BbvCI fragment from For the results given in Table 9, the samples from the aerobic pRS426:GPD:alsS:CYC ligated cultures were taken at 35 h and the samples from the low with SacII/BbvCI CUP1 fragment oxygen cultures were taken at 19 hand measured by HPLC. RS426::GAL1::ILVS 7 kbp SacII/BbvCI fragment from pRS426:FBA::ILV5:CYC ligated The results for S. cerevisiae YJR148w?pRS423:CUP1 with SacII/BbvCIGAL1 fragment alsS+FBA-ILV3/pHR81:FBA-ILV5+GPM-kivD grown on RS42S::FEBA::ILV3 8.9 kbp BamHIBbvCI fragment from sucrose are presented in Table 10. The results in this table pRS425:ADH::ILV3::ADH ligated with were obtained with samples taken at 18 h and measured by 0.65 kbp BglII/BbvCI FBA fragment from 25 HPLC. RS426::FEBA::ILVS::CYC pRS425:CUP1-alss+FBA- 2.4 kbp SacII/NotI fragment from LV3 bRS426::CUP1::alsS cloned into TABLE 9 bRS425::FBA::ILV3 cut with SacII Not pRS426:FBA-ILV5+GPM- 2.7 kbp BamHI/SpeI fragment from Production of Isobutanol by S. cerevisiae YJR148w?pRS423::CUP1

kiv) bRS425::GPM::kivD::ADH cloned into 30 alss+FBA-ILV3/pHR81:FBA-ILV5+GPM-kivD Grown on Glucose RS426::FEBA::ILVS::CYC cut with BamHI/SpeI pRS426:GAL1-FBA+GPM-8.5 kbp SacII/NotI fragment from kiv) pRS426: FBA-ILV5+GPM-kivD ligated with 1.8 kbp SacII/NotI fragment from RS426::GAL1::ILVS 35 pRS423 (ATCC No. 77104), – HIS3 Selection pRS423:CUP1-alss+FBA- 5.2 kbp SacI/SalI fragment from LV3 pRS425:CUP1-alsS+FBA-ILV3 ligated into pRS423 cut with SacI/SalI pHR81 ATCC No. 87541), – ORA3 and leu2-d selection 40 HR81::FBA-ILVS-GPM 4.7 kbp SacIBamHI fragment from kiv) pRS426:FBA-ILV5+GPM-kivD ligated into pHR81 cut with SacI/BamHI

45 Example 18 Production of Isobutanol by Recombinant Saccharomyces Cerevisiae 50 Plasmids pRS423:CUP1-alsS+FBA-ILV3 and pHR81: FBA-ILV5+GPM-kivD (described in Example 17) were Production of Isobutanol by S. cerevisiae YJR148w?pRS423::CUP1 transformed into Saccharomyces cerevisiae YJR 148w to pro alss+FBA-ILV3/pHR81:FBA-ILV5+GPM-kivD Grown on Sucrose duce strain YJR148w?pRS423:CUP1-alsS+FBA-ILV3/ pHR81::FBA-ILV5+GPM-kivD. A control strain was pre 55 pared by transforming vectors pRS423 and pHR81 (described in Example 17) into Saccharomyces cerevisiae YJR148w (strain YJR148w?pRS423/pHR81). Strains were maintained on standard S. cerevisiae synthetic complete medium (Methods in Yeast Genetics, 2005, Cold Spring Har 60 bor Laboratory Press, Cold Spring Harbor, N.Y., pp. 201-202) containing either 2% glucose or Sucrose but lacking uracil and histidine to ensure maintenance of plasmids. For isobutanol production, cells were transferred to syn thetic complete medium lacking uracil, histidine and leucine. 65 Removal of leucine from the medium was intended to trigger an increase in copy number of the pHR81-based plasmid due US 8,945,859 B2 53 54 TABLE 10-continued TABLE 11-continued Production of Isobutanol by S. cerevisiae YJR148w?pRS423::CUP1 Production of Isobutanol by S. cerevisiae YJR148w?pRS425::CUP1 alss+FBA-ILV3/pHR81:FBA-ILV5+GPM-kivD Grown on Sucrose alsS+FBA-ILV3/pRS426:GAL1-ILV5+GPM-kivD Grown on Galactose and Raffinose Iso- Molar O2 butanol Selectivity, mMIso Strain Level mM % Iso- butanol CuSO4, butanol per YJR148w?pRS423:CUP1-alsS+FBA- Low O.30 1.1 Strain O. level mM mM OD unit ILV3/pHR81:FBA-ILV5+ GPM-kivD b YJR148w?pRS423:CUP1-alsS+FBA- Low O.21 O.8 10 YJR148wipRS425::CUP1-alSS- Aerobic 0.03 O.82 O.09 FBA-ILV3/pRS426:GAL1-ILV5+ GPM-kiv Ob Strain suffixes “a”, “b', and “c” indicate separate isolates. YJR148wipRS425::CUP1-alSS- Aerobic 0.1 O.81 O.09 FBA-ILV3/pRS426:GAL1-ILV5+ The results indicate that, when grown on glucose or GPM-kiv) c YJR148wipRS425::CUP1-alSS- Aerobic 0.5 O16 O.04 Sucrose under both aerobic and low oxygen conditions, strain 15 FBA-ILV3/pRS426:GAL1-ILV5+ YJR 148w?pRS423:CUP1-alsS+FBA-ILV3/pHR81::FBA GPM-kiv) d ILV5+GPM-kivD produced consistently higher levels of YJR148wipRS425::CUP1-alSS- Aerobic 0.5 O.18 O.O1 isobutanol than the control strain. FBA-ILV3/pRS426:GAL1-ILV5+ GPM-kiv) e YJR148w?pRS425/pRS426 LOW O.1 O.042 O.OO7 Example 19 (control) YJR148w?pRS425/pRS426 LOW O.S O.O23 O.OO6 (control) Production of Isobutanol by Recombinant YJR148wipRS425::CUP1-alSS- LOW O O.1 O.04 Saccharomyces Cerevisiae FBA-ILV3/pRS426:GAL1-ILV5+ GPM-kiv) a 25 YJR148wipRS425::CUP1-alSS- LOW O.O3 O.O24 O.O2 Plasmids pRS425::CUP1-alsS+FBA-ILV3 and pRS426:: FBA-ILV3/pRS426:GAL1-ILV5+ GAL1-ILV5+GPM-kivD (described in Example 17) were GPM-kiv Ob transformed into Saccharomyces cerevisiae YJR 148w to pro YJR148wipRS425::CUP1-alSS- LOW O.1 O.O3O O.04 duce strain YJR148w?pRS425:CUP1-alsS+FBA-ILV3/ FBA-ILV3/pRS426:GAL1-ILV5+ pRS426::GAL1-ILV5+GPM-kiv.D. A control strain was pre GPM-kiv) c 30 YJR148wipRS425::CUP1-alSS- LOW O.S O.OO8 O.O2 pared by transforming vectors pRS425 and pRS426 FBA-ILV3/pRS426:GAL1-ILV5+ (described in Example 17) into Saccharomyces cerevisiae GPM-kiv) d YJR148w (strain YJR148w?pRS425/pRS426). Strains were YJR148wipRS425::CUP1-alSS- LOW O.S O.OO8 O.OO)4 maintained on synthetic complete medium, as described in FBA-ILV3/pRS426:GAL1-ILV5+ Example 18. GPM-kiv) e 35 For isobutanol production, cells were transferred to syn Strain suffixes “a”, “b”, “c”, “d” and “e” indicate separate isolates. thetic complete medium containing 2% galactose and 1% raffinose, and lacking uracil and leucine. Aerobic and low The results indicate that in general, higher levels of isobu oxygen cultures were prepared as described in Example 18. tanol per optical density unit were produced by theYJR 148w/ Approximately 12 hafter inoculation, the inducer CuSO was pRS425:CUP1-alsS+FBA-ILV3/pRS426::GAL1-ILV5+ added up to a final concentration of 0.5 mM. Control cultures 40 GPM-kivD strain compared to the control strain under both for each strain without CuSO addition were also prepared. aerobic and low oxygen conditions. Culture supernatants were sampled 23h after CuSO addition for determination of isobutanol by HPLC, as described in Example 20 Example 18. The results are presented in Table 11. Due to the widely different final optical densities observed and associ 45 Expression of an Isobutanol Biosynthetic Pathway in ated with quantifying the residual carbon source, the concen Bacillus subtilis tration of isobutanol per ODoo unit (instead of molar selec tivities) is provided in the table to allow comparison of strains The purpose of this Example was to express an isobutanol containing the isobutanol biosynthetic pathway genes with biosynthetic pathway in Bacillus subtilis. The five genes of 50 the isobutanol pathway (pathway steps (a) through (e) in FIG. the controls. 1) were split into two operons for expression. The three genes budB, ilvD, and kiv), encoding acetolactate synthase, aceto TABLE 11 hydroxy acid dehydratase, and branched-chain keto acid Production of Isobutanol by S. cerevisiae YJR148w?pRS425::CUP1 decarboxylase, respectively, were integrated into the chromo alsS+FBA-ILV3/pRS426:GAL1-ILV5+GPM-kivD 55 some of B. subtilis BE1010 (Payne and Jackson, J. Bacteriol. Grown on Galactose and Raffinose 173:2278-2282 (1991)). The two genes ilvC and bdhB, mMIso encoding acetohydroxy acid isomeroreductase and butanol Iso- butanol dehydrogenase, respectively, were cloned into an expression CuSO4, butanol per vector and transformed into the Bacillus strain carrying the Strain O. level mM mM OD unit 60 integrated isobutanol genes. YJR148w?pRS425/pRS426 Aerobic 0.1 O.12 O.O1 Integration of the Three Genes, budB, ilvD and kiv D into (control) the Chromosome of B. Subtilis BE1010. YJR148w?pRS425/pRS426 Aerobic 0.5 O.13 O.O1 Bacillus integration vectors pFP988DssPspac and (control) YJR148w?pRS425:CUP1-alsS+ Aerobic O O.2O O.O3 pFP988DssPgroE were used for the chromosomal integration 65 of the three genes, budB (SEQ ID NO:1), ilvD (SEQ ID NO:5), and kiv.D (SEQ ID NO:7). Both plasmids contain an E. coli replicon from pBR322, an ampicillin antibiotic marker US 8,945,859 B2 55 56 for selection in E. coli and two sections of homology to the control of the spac promoter (Pspac). To improve expression sacB gene in the Bacillus chromosome that direct integration of functional enzymes, the Pspac promoter was replaced by a of the vector and intervening sequence by homologous PgroE promoter from plasmid pHTO1 (MoBitec, Goettingen, recombination. Between the sacB homology regions is a spac Germany). promoter (PgroE) on pFP988DssPspac or a groEL promoter 5 A 6,039 bp pFP988Dss vector fragment, given as SEQ ID (PgroE) on pFP988DssPgroE, and a selectable marker for NO:146, was excised from an unrelated plasmid by restric Bacillus, erythromycin. The promoter region also contains tion digestion with XhoI and BamHI, and was gel-purified. the lacO sequence for regulation of expression by a lacI The PgroE promoter was PCR-amplified from plasmid repressor protein. The sequences of pFP988DssPspac (6,341 pHT01 with primers T-groECXhoI) (SEQ ID NO:147) and bp) and pFP988DssPgroE (6.221 bp) are given as SEQ ID 10 B-groEL(Spel, BamH1) (SEQIDNO:148). The PCR product NO:142 and SEQID NO:143 respectively. was digested with XhoI and BamHI, ligated with the 6,039 bp The cassette with three genes budB-ilvD-kivD was con pFP988Dss vector fragment, and transformed into DH5C. structed by deleting the ilvC gene from plasmid pTrc99a competent cells. Transformants were screened by PCR budB-ilvC-ilvD-kiv.D. The construction of the plasmid amplification with primers T-groECXhoI) and B-groEL(Spel, pTrc99A: budB-ilvC-ilvD-kivD is described in Example 14. 15 BamH1). Positive clones showed the expected 174bp PgroE Plasmid pTrc99A::budB-ilvC-ilvD-kivD was digested with PCR product and were named pFP988DssPgroE. The plas AflII and NheI, treated with the Klenow fragment of DNA midpFP988DssPgroE was also confirmed by DNA sequence. polymerase to make blunt ends, and the resulting 9.4 kbp Plasmid pFP988DssPspac-budB-ilvD-kivD was digested fragment containing pTrc99a vector, budB, ilvD, and kiv) with Spel and PmeI and the resulting 5.313 bp budB-ilvD was gel-purified. The 9.4 kbp vector fragment was self-li- 20 kiv.D fragment was gel-purified. The budB-ilvD-kiv.D frag gated to create pTrc99A:: budB-ilvD-kiv.D, and transformed ment was ligated into Spel and Pme sites of into DH5O. competent cells (Invitrogen). A clone of pTrc99a pFP988DssPgroE and transformed into DH5O. competent budB-ilvD-kivD was confirmed for the ilvC gene deletion by cells. Positive clones were screened for a 1,690 bp PCR restriction mapping. The resulting plasmid pTrc99A:: budB product by PCR amplification with primers T-groEL (SEQID ilvD-kivD was digested with SacI and treated with the Kle- 25 NO:149) and N111 (SEQID NO:20). The positive clone was now fragment of DNA polymerase to make blunt ends. The named pFP988DssPgroE-budB-ilvD-kivD. plasmid was then digested with BamHI and the resulting Plasmid pFP988DssPgroE-budB-ilvD-kivD was prepared 5,297 bp budB-ilvD-kiv.D fragment was gel-purified. The from the E. coli transformant, and transformed into Bacillus 5,297 bp budB-ilvD-kivD fragment was ligated into the SmaI subtilis BE 1010 competent cells as described above. Trans and BamHI sites of the integration vector pFP988DssPspac. 30 formants were screened by PCR amplification with primers The ligation mixture was transformed into DH5O. competent N130SeqF1 (SEQ ID NO:40) and N130SeqR1 (SEQ ID cells. Transformants were screened by PCR amplification of NO:44) for budB, and N133SeqF1 (SEQ ID NO:62) and the 5.3 kbp budB-ilvD-kivD fragment with primers T-budB N133SeqR1 (SEQ ID NO:66) for kiv). Positive integrants (BamHI) (SEQ ID NO:144) and B-kivD(BamHI) (SEQ ID showed the expected 1.7 kbp budB and 1.7 kbp kivD PCR NO:145). The correct clone was named pFP988DssPspac- 35 products. Two positive integrants were isolated and named B. budB-ilv)-kivD. subtilis BE1010 AsacB::PgroE-budB-ilvD-kivD #1-7 and B. Plasmid pFP988DssPspac-budB-ilvD-kivD was prepared subtilis BE1010 AsacB::PgroE-budB-ilvD-kivD #8-16. from the E. coli transformant, and transformed into B. subtilis Plasmid Expression of ilvC and bdhB Genes. BE1010 competent cells, which had been prepared as Two remaining isobutanol genes, ilvC and bdhB, were described by Doyle et al. (J. Bacteriol. 144:957 (1980)). 40 expressed from a plasmid. Plasmid pHTO1 (MoBitec), a Competent cells were harvested by centrifugation and the cell Bacillus-E. coli shuttle vector, was used to fuse an ilvC gene pellets were resuspended in a small Volume of the Superna from B. subtilis to a PgroE promoter so that the ilvC gene was tant. To one volume of competent cells, two volumes of expressed from the PgroE promoter containing a lacO SPII-EGTA medium (Methods for General and Molecular sequence. The ilvC gene, given as SEQ ID NO:186, was Bacteriology, P. Gerhardt et al., Ed., American Society for 45 PCR-amplified from B. subtilis BR151 (ATCC 33677) Microbiology, Washington, D.C. (1994)) was added. Ali genomic DNA with primers T-ilvCB.S.(BamHI) (SEQ ID quots (0.3 mL) of cells were dispensed into test tubes and then NO:150) and B-ilvCB.s.(Spel BamHI) (SEQ ID NO:151). 2 to 3 ug of plasmid pFP988DssPspac-budB-ilvD-kivD was The 1,067 bp ilvC PCR product was digested with BamHI added to the tubes. The tubes were incubated for 30 minat37° and ligated into the BamHI site of pHTO1. The ligation mix C. with shaking, after which 0.1 mL of 10% yeast extract was 50 ture was transformed into DH5O. competent cells. Positive added to each tube and they were further incubated for 60 clones were screened for a 1,188 bp PCR product by PCR min. Transformants were grown for selection on LB plates amplification with primers T-groEL and B-ilvB.S.(Spel containing erythromycin (1.0 g/mL) using the double agar BamHI). The positive clone was named pHTO1-ilvC(B.S). overlay method (Methods for General and Molecular Bacte Plasmid pHTO1-ilvC(B.s) was used as a template for PCR riology, supra). Transformants were screened by PCR ampli- 55 amplification of the PgroE-ilvC fused fragment. fication with primers N130SeqF1 (SEQ ID NO:40) and Plasmid pBD64 (Minton et al., Nucleic Acids Res. 18:1651 N130SeqR1 (SEQ ID NO:44) for budB, and N133SeqF1 (1990)) is a fairly stable vector for expression of foreign (SEQID NO:62) and N133SeqR1 (SEQID NO:66) forkiv D. genes in B. subtilis and contains a repB gene and chloram Positive integrants showed the expected 1.7 kbp budB and 1.7 phenicol and kanamycin resistance genes for selection in B. kbp kiv) PCR products. Two positive integrants were iden- 60 subtilis. This plasmid was used for expression of ilvC and tified and named B. subtilis BE1010 AsacB::Pspac-budB bdhBunder the control of a PgroE promoter. To clone PgroE ilvD-kivD #2-3-2 and B. subtilis BE1010 AsacB::Pspac ilvC, bdhB and a lacI repressor gene into plasmid pPD64, a budB-ilv)-kivD H6-12-7. one-step assembly method was used (Tsuge et al., Nucleic Assay of the enzyme activities in integrants B. subtilis Acids Res. 31:e133 (2003)). A 3.588 bp pBD64 fragment BE1010 AsacB::Pspac-budB-ilvD-kivD #2-3-2 and B. subti- 65 containing a repB gene, which included the replication func lis BE1010 AsacB::Pspac-budB-ilvD-kivD #6-12-7 indicated tion, and the kanamycin antibiotic marker was PCR-ampli that the activities of BudB, Ilv) and Kiv) were low under the fied from pBD64 with primers T-BD64(DraIII) (SEQ ID US 8,945,859 B2 57 58 NO:152), which introduced a DraIII sequence (CAC cells were induced with 1.0 mM isopropyl-B-D-thiogalacto CGAGTG), and B-BD64(DraIII) (SEQID NO:153), which pyranoiside (IPTG) at early-log phase (ODoo of approxi introduced a DraIII sequence (CACCTGGTG). A 1,327 bp mately 0.2). At 24 h after inoculation, an aliquot of the broth lacI repressor gene was PCR-amplified from pMUTIN4 was analyzed by HPLC (Shodex Sugar SH 1011 column) with (Vagner et al., Microbiol. 144:3097-3104 (1998)) with T-la refractive index (R1) detection for isobutanol content, as cId(DraIII) (SEQ ID NO:154), which introduced a DmIII described in the General Methods section. The HPLC results sequence (CACCAGGTG) and B-lacIq(DraIII) (SEQ ID are shown in Table 12. NO:155), which introduced a DmIII sequence (CAC GGGGTG). A 1,224 bp PgroE-ilvC fused cassette was PCR TABLE 12 amplified from pHT01-ilvC(B.s) with T-groE(DraIII) (SEQ 10 ID NO:156), which introduced a DmIII sequence (CAC Production of Isobutanol from Glucose by B. subtilis BE1010 CCCGTG), and B-B.S.ilvC(DraIII) (SEQID NO:157), which AsacB::PgroE-budB-ilw)-kiv ObBDPgroE-ilwC(B.S.)-bdhB Strains introduced a DmIII sequence (CACCGTGTG). A 1.2 kbp isobutanol, molar selectivity, bdhB gene (SEQ ID NO:158) was PCR-amplified from Strain O Level mM % 15 Clostridium acetobutylicum (ATCC824) genomic DNA with B. subtiis a high 1.OO 1.8 primers T-bdhB(DraIII) (SEQID NO:159), which introduced (induced) a DmIII sequence (CACACGGTG), and B-bdhB B. subtiis b high O.87 1.6 (rrnBT1DraIII) (SEQID NO:160), which introduced a DmIII (induced) B. subtiis a low O.O6 O.1 sequence (CACTCGGTG). The three underlined letters in the (induced) variable region of the DmIII recognition sequences were B. subtiis b low O.14 O.3 designed for specific base-pairing to assemble the four frag (induced) ments with an order of p3D64-lacI-PgroEilvC-bdhB. Each PCR product with DraIII sites at both ends was digested B. subtiis a is B. subtiis BE1010 AsacB::PgroE-budB-ilvD-kivD #1-7pBDPgroE-ilvC SPEAR is B. subtilis BE1010 AsacB::PgroE-budB-ilvD-kivD #8-16/pBDPgroE-ilvC separately with DmIII, and the resulting DmIII fragments, (B.S.)-bdhB 3.588 bp pBD64, lacI, PgroEilvC, and bdhB were gel-puri 25 fied using a QIAGEN gel extraction kit (QIAGEN). A mixture The isolate of B. subtilis BE1010 AsacB::PgroE-budB containing an equimolar concentration of each fragment with ilvD-kivD #1-7/pBDPgroE-ilvC(B.S.)-bdhB was also exam a total DNA concentration of 30 to 50 ug/100 uL was prepared ined for isobutanol production from Sucrose, essentially as for ligation. The ligation solution was then incubated at 16°C. described above. The recombinant strain was inoculated in 25 overnight. The ligation generated high molecular weight tan 30 mL or 75 mL of Sucrose medium containing kanamycin (10 dem repeat DNA. The ligated long, linear DNA mixture was ug/mL) in 125 mL flasks to simulate high and medium oxy directly transformed into competent B. subtilis BE1010, pre gen levels, and grown at 37°C. with shaking at 200 rpm. The pared as described above. B. subtilis preferentially takes up Sucrose medium was identical to the glucose medium except long repeated linear DNA forms, rather than circular DNA to that glucose (10 g/L) was replaced with 10 g/L of sucrose. The establish a plasmid. After transformation the culture was 35 cells were uninduced, or induced with 1.0 mM isopropyl-3- spread onto an LB plate containing 10 g/mL of kanamycin D-thiogalactopyranoiside (IPTG) at early-log phase (ODoo for selection. Positive recombinant plasmids were screened of approximately 0.2). At 24 h after inoculation, an aliquot of by Dral digestion, giving four fragments with an expected the broth was analyzed by HPLC (Shodex Sugar SH1011 size of 3,588 bp (pBD64), 1,327 bp (lacI), 1,224 bp (PgorE column) with refractive index (R1) detection for isobutanol ilvC), and 1,194 bp (bdhB). The positive plasmid was named 40 content, as described in the General Methods section. The pBDPgroE-ilvC(B.S.)-bdhB. HPLC results are given in Table 13. Demonstration of Isobutanol Production from Glucose or Sucrose by B. subtilis BE1010 AsacB::PdroE-budB-ilvD TABLE 13 kivD/pBDPgroE-ilvC(B.S.)-bdhB. Production of Isobutanol from Sucrose by B. subtilis Strain BE1010 To construct the recombinant B. subtilis expressing the five 45 AsacB::PgroE-budB-ilw)-kivDipBDPgroE-ilwC(B.S.)-bdhB genes of the isobutanol biosynthetic pathway, competent cells of the two integrants B. subtilis BE 1010 AsacB-PgroE-budB Strain O Level isobutanol, mM molar selectivity, % ilvD-kivD #1-7 and B. subtilis BE1010 AsacB::PgroE-budB B. subtiis a high Not detected Not detected ilvD-kivD #8-16 were prepared as described above, and (uninduced) transformed with plasmid pBDPgroE-ilvC(B.S.)-bdhB, 50 B. subtiis a high 0.44 4.9 yielding B. subtilis BE1010 AsacB::PgroE-budB-ilvD-kivD (induced) #1-7/pBDPgroE-ilvC(B.S.)-bdhB and B. subtilis BE1010 B. subtiis a medium O.83 8.6 AsacB::PgroE-budB-ilvD-kivD #8-16/pBDPgroE-ilvC (induced) (B.S.)-bdhB. B. subtiis a is B. subtiis BE1010 AsacB::PgroE-budB-ilvD-kivD #1-7pBDPgroE-ilvC The two recombinant strains were inoculated in either 25 55 (B.S.)-bdhB mL or 100 mL of glucose medium containing kanamycin (10 ug/mL) in 125 mL flasks to simulate high and low oxygen Example 21 conditions, respectively, and aerobically grown at 37°C. with shaking at 200 rpm. The medium consisted of 10 mM (NH) Prophetic SO, 5 mM potassium phosphate buffer (pH 7.0), 100 mM 60 MOPS/KOH buffer (pH 7.0), 20 mM glutamic acid/KOH (pH Expression of an Isobutanol Biosynthetic Pathway in 7.0), 2% S10 metal mix, 1% glucose, 0.01% yeast extract, Lactobacillus plantarum 0.01% casamino acids, and 50 ug/mL each of L-tryptophan, L-methionine, and L-lysine. The S10 metal mix consisted of The purpose of this prophetic Example is to describe how 200 mMMgCl2, 70 mM CaCl, 5 mMMnCl, 0.1 mM FeCls, 65 to express an isobutanol biosynthetic pathway in Lactobacil 0.1 mM ZnCl, 0.2 mM thiamine hydrochloride, 0.172 mM lus plantarum. The five genes of the isobutanol pathway, CuSO, 0.253 mM CoCl2, and 0.242 mM NaMoO. The encoding five enzyme activities, are divided into two operons US 8,945,859 B2 59 60 for expression. The budB, ilvD and kiv) genes, encoding the purified. pFP988-DldhL::Cm is digested with HpaI and enzymes acetolactate synthase, acetohydroxy acid dehy BamHI and the 5.5 kbp vector fragment isolated. The budB dratase, and branched-chain C-keto acid decarboxylase, ilvD-kivD operon is ligated with the integration vector respectively, are integrated into the chromosome of Lactoba pFP988-DldhL:Cm to create pFP988-DldhL-P11-budB cillus plantarum by homologous recombination using the ilv)-kivD::Cm. method described by Hols et al. (Appl. Environ. Microbiol. Integration of pFP988-DldhL-P11-budB-ilvD-kivD::Cm 60:1401-1413 (1994)). The remaining two genes (ilvC and into L. plantarum BAA-793 to form L. plantarum AldhL1:: bdhB, encoding the enzymes acetohydroxy acid reductoi budB-ilvD-kivD::Cm Comprising Exogenous budB, ilvD. Somerase and butanol dehydrogenase, respectively) are and kiv) Genes. cloned into an expression plasmid and transformed into the 10 Electrocompetent cells of L. plantarum are prepared as Lactobacillus strain carrying the integrated isobutanol genes. described by Aukrust, T. W., et al. (In: Electroporation Pro Lactobacillus plantarum is grown in MRS medium (Difco tocols for Microorganisms; Nickoloff, J. A., Ed.; Methods in Laboratories, Detroit, Mich.) at 37° C., and chromosomal Molecular Biology, Vol. 47; Humana Press, Inc., Totowa, DNA is isolated as described by Moreira et al. (BMC Micro N.J., 1995, pp 201-208). After electroporation, cells are out biol. 5:15 (2005)). 15 grown in MRSSM medium (MRS medium supplemented Integration. with 0.5 M Sucrose and 0.1 M MgCl) as described by Auk The budB-ilvD-kivD cassette under the control of the syn rust et al. Supra for 2 h at 37°C. without shaking. Electropo thetic P11 promoter (Rudet al., Microbiology 152:1011-1019 rated cells are plated for selection on MRS plates containing (2006)) is integrated into the chromosome of Lactobacillus chloramphenicol (10 ug/mL) and incubated at 37°C. Trans plantarum ATCC BAA-793 (NCIMB 8826) at the ldhL1 formants are initially screened by colony PCR amplification locus by homologous recombination. To build the ldhL inte to confirm integration, and initial positive clones are then gration targeting vector, a DNA fragment from Lactobacillus more rigorously screened by PCR amplification with a bat plantarum (Genbank NC 004567) with homology toldhL is tery of primers. PCR amplified with primers LDH EcoRV F (SEQ ID Plasmid Expression of ilvC and bdhB Genes. NO:161) and LDH Aati IR (SEQ ID NO:162). The 1986 bp 25 The remaining two isobutanol genes are expressed from PCR fragment is cloned into pCR4 Blunt-TOPO and plasmid pTRKH3 (O'Sullivan DJ and Klaenhammer T R. sequenced. The pCR4 Blunt-TOPO-ldhL1 clone is digested Gene 137:227-231 (1993)) under the control of the L. plan with EcoRV and Aati I releasing a 1982 bp lodh L1 fragment tarum lahL promoter (Ferain et al., J. Bacteriol. 176:596-601 that is gel-purified. The integration vector pFP988, given as (1994)). The ldhL promoter is PCR amplified from the SEQ ID NO:177, is digested with HindIII and treated with 30 genome of L. plantarum ATCC BAA-793 using primers Klenow DNA polymerase to blunt the ends. The linearized PldhL F-HindIII (SEQ ID NO:167) and PldhL R-BamHI plasmid is then digested with Aati I and the 2931 bp vector (SEQID NO:168). The 411 bp PCR product is cloned into fragment is gel purified. The EcoRV/Aat|IldhL1 fragment is pCR4 Blunt-TOPO and sequenced. The resulting plasmid, ligated with the pFP988 vector fragment and transformed into pCR4 Blunt-TOPO-PldhL is digested with HindIII and E. coli Top 10 cells. Transformants are selected on LB agar 35 BamHI releasing the PldhL fragment. plates containing amplicillin (100 ug/mL) and are screened by Plasmid pTRKH3 is digested with HindIII and SphI and colony PCR to confirm construction of pFP988-ldhL. the gel-purified vector fragment is ligated with the PldhL To add a selectable marker to the integrating DNA, the Cm fragment and the gel-purified 2.4 kbp BamHI/SphI fragment gene with its promoter is PCR amplified from pC194 (Gen containing ilvC(B.S.)-bdhB from the Bacillus expression Bank NC 002013, SEQ ID NO:267) with primers Cm F 40 plasmid plBDPgroE-ilvC(B.S.)-bdhB (Example 20) in a (SEQ ID NO:163) and Cm R (SEQID NO:164), amplifying three-way ligation. The ligation mixture is transformed into a836 bp PCR product. This PCR product is cloned into pCR4 E. coli Top 10 cells and transformants are grown on Brain Blunt-TOPO and transformed into E. coli Top 10 cells, creat Heart Infusion (BHI, Difco Laboratories, Detroit, Mich.) ing pCR4 Blunt-TOPO-Cm. After sequencing to confirm that plates containing erythromycin (150 mg/L). Transformants no errors are introduced by PCR, the Cm cassette is digested 45 are screened by PCR to confirm construction. The resulting from pCR4 Blunt-TOPO-Cm as an 828 bp Mlul/Swal frag expression plasmid, pTRKH3-ilvC(B.S.)-bdhB is trans ment and is gel purified. TheldhL-homology containing inte formed into L. plantarum AldhL1::budB-ilvD-kivD::Cm by gration vector pFP988-ldhL is digested with Mlul and Swal electroporation, as described above. and the 4740 bp vector fragment is gel purified. The Cm L. plantarum Aldh1: budB-ilvD-kivD:Cm containing cassette fragment is ligated with the pFP988-ldhL vector 50 pTRKH3-ilvC(B.S.)-bdhB is inoculated into a 250 mL shake creating pFP988-DldhL:Cm. flask containing 50 mL of MRS medium plus erythromycin Finally the budB-ilvD-kivD CaSSette from (10 ug/mL) and grown at 37° C. for 18 to 24 h without pFP988DssPspac-budB-ilvD-kiv.D, described in Example shaking, after which isobutanol is detected by HPLC or GC 20, is modified to replace the amylase promoter with the analysis, as described in the General Methods section. synthetic P11 promoter. Then, the whole operon is moved 55 into pFP988-DldhL:Cm. The P11 promoter is built by oli Example 22 gonucleotide annealing with primer P11 F-StuI (SEQ ID NO:165) and P11 R-Spel (SEQ ID NO:166). The annealed Prophetic oligonucleotide is gel-purified on a 6% Ultra PAGE gel (Embi Tec, San Diego, Calif.). The plasmid pFP988DssPspac 60 Expression of an Isobutanol Biosynthetic Pathway in budB-ilvD-kiv.D, containing the amylase promoter, is Enterococcus faecalis digested with StuI and Spel and the resulting 10.9 kbp vector fragment is gel-purified. The isolated P11 fragment is ligated The purpose of this prophetic Example is to describe how with the digested pFP988DssPspac-budB-ilvD-kivD to cre to express an isobutanol biosynthetic pathway in Enterococ ate pFP988-P11-budB-ilvD-kivD. Plasmid pFP988-P11 65 cus faecalis. The complete genome sequence of Enterococ budB-ilvD-kivD is then digested with Stu and BamHI and cus faecalis strain V583, which is used as the host strain for the resulting 5.4 kbp P11-budB-ilvD-kiv.D fragment is gel the expression of the isobutanol biosynthetic pathway in this US 8,945,859 B2 61 62 Example, has been published (Paulsen et al., Science 299: To provide a promoter for the E. coli Gram-positive shuttle 2071-2074 (2003)). An E. coli/Gram-positive shuttle vector, vector pTRKH3, the nis A promoter (Chandrapati et al., Mol. Plasmid pTRKH3 (O'Sullivan DJ and Klaenhammer T R, Microbiol. 46(2):467-477 (2002)) is PCR-amplified from Gene 137:227-231 (1993)), is used for expression of the five Lactococcus lactis genomic DNA with primers F-Pnis A(Hin dIII) (SEQID NO:173) and R-PnisA(SpeI BamHI) (SEQID genes (budB, ilvC, ilvD, kiv), bdhB) of the isobutanol path NO:174) and then TOPO cloned. After sequencing, the 213 way in one operon. pTRKH3 contains an E. coli plasmid bp nis A promoter fragment is isolated by digestion with Hin p15A replication origin, the pAMB1 replicon, and two anti dIII and BamHI followed by gel purification. Plasmid biotic resistance selection markers for tetracycline and eryth pTRKH3 is digested with HindIII and BamHI and the vector romycin. Tetracycline resistance is only expressed in E. coli, fragment is gel-purified. The linearized pTRKH3 is ligated and erythromycin resistance is expressed in both E. coli and 10 with the Pnis.A fragment and transformed into E. coli Top 10 Gram-positive bacteria. Plasmid paMB 1 derivatives can rep cells by electroporation. Transformants are selected follow licate in E. faecalis (Poyart et al., FEMS Microbiol. Lett. ing overnight growth at 37° C. on LB agar plates containing 156:193-198 (1997)). The inducible nis.A promoter (PnisA), erythromycin (25 ug/mL). The transformants are then screened by colony PCR to confirm the correct clone of which has been used for efficient control of gene expression 15 pTRKH3-PnisA. by nisin in a variety of Gram-positive bacteria including Plasmid pTRKH3-Pnis A is digested with Spel and Enterococcus faecalis (Eichenbaum et al., Appl. Environ. BamHI, and the vector is gel-purified. Plasmid pTrc99A:: Microbiol. 64:2763-2769 (1998)), is used to control expres budB-ilvC(B.S)-ilvD-kivD-bdhB, described above, is sion of the five desired genes encoding the enzymes of the digested with Spel and BamHI, and the 7.5 kbp fragment is isobutanol biosynthetic pathway. gel-purified. The 7.5 kbp budB-ilvC(B.s)-ilvD-kivD-bdhB The plasmid pTrc99A::budB-ilvC-ilvD-kivD (described fragment is ligated into the pTRKH3-Pnis.A vector at the Spel in Example 14), which contains the isobutanol pathway and BamHI sites. The ligation mixture is transformed into E. operon, is modified to replace the E. coli ilvC gene (SEQID coli Top 10 cells by electroporation and transformants are selected following overnight growth on LB agar plates con NO:3) with the B. subtilis ilvC gene (SEQ ID NO:184). taining erythromycin (25ug/mL) at 37°C. The transformants Additionally, the bdhB gene (SEQ ID NO:158) from 25 are then screened by colony PCR. The resulting plasmid is Clostridium acetobutylicum is added to the end of the operon. named pTRKH3-PnisA-budB-ilvC(B.S)-ilvD-kivD-bdhB. First, the bdhB gene from pBDPgroE-ilvC(B.S.)-bdhB (de This plasmid is prepared from the E. coli transformants and scribed in Example 20) is amplified using primers F-bdhB transformed into electrocompetent E. faecalis V583 cells by Avril (SEQ ID NO:169) and R-bdhB-BamHI (SEQ ID electroporation using methods known in the art (Aukrust, T. NO: 170), and then TOPO cloned and sequenced. The 1194 bp 30 W., et al. In: Electroporation Protocols for Microorganisms; bdhB fragment is isolated by digestion with Avril and Nickoloff, J. A., Ed.; Methods in Molecular Biology, Vol. 47: BamHI, followed by gel purification. This bdhB fragment is Humana Press, Inc., Totowa, N.J., 1995, pp 217-226), result ligated with pTrc99A::budB-ilvC-ilvD-kiv.D that has previ ing in E. faecalis V583/pTRKH3-PnisA-budB-ilvC(B.s)- ously been digested with Avril and BamHI and the resulting ilv)-kivD-bdhB. fragment is gel purified. The ligation mixture is transformed 35 The second plasmid containing nis A regulatory genes, into E. coli Top 10 cells by electroporation and transformants nisk and nisk, the add9 spectinomycin resistance gene, and are selected following overnight growth at 37°C. on LB agar the pSH71 origin of replication is transformed into E. faecalis plates containing amplicillin (100 g/mL). The transformants V583/pTRKH3-Pnis A-budB-ilvC(B.S)-ilvD-kivD-bdhB by are then screened by colony PCR to confirm the correct clone electroporation. The plasmid containing pSH71 origin of rep containing pTrc99A::budB-ilvC-ilvD-kivD-bdhB. 40 lication is compatible with pAME31 derivatives in E. faecalis Next, ilvC(B.S.) is amplified from p3DPgroE-ilvC(B.S.)- (Eichenbaum et al., Supra). Double drug resistant transfor bdhB (described in Example 20) using primers F-ilvC(B.S.)- mants are selected on LBagar plates containing erythromycin AflII (SEQ ID NO:171) and R-ilvC(B.S.)-NotI (SEQ ID (25 ug/mL) and spectinomycin (100 ug/mL), grown at 37°C. NO:172). The PCR product is TOPO cloned and sequenced. The resulting E. faecalis strain V5838 harboring two plas The 1051 bp ilvC(B.S.) fragment is isolated by digestion with 45 mids, i.e., an expression plasmid (pTRKH3-Pnis A-budB AflII and NotI followed by gel purification. This fragment is ilvC(B.S)-ilvD-kivD-bdhB) and a regulatory plasmid ligated with pTrc99A: budB-ilvC-ilvD-kivD-bdhB that has (pSH71-niskK), is inoculated into a 250 mL shake flask been cut with AflII and NotI to release the E. coli ilvC (the containing 50 mL of Todd-Hewitt broth supplemented with 10.7 kbp vector band is gel purified prior to ligation with yeast extract (0.2%) (Fischetti et al., J. Exp. Med. 161: 1384 ilvC(B.S.)). The ligation mixture is transformed into E. coli 50 1401 (1985)), nisin (20 ug/mL) (Eichenbaum et al., supra), Top 10 cells by electroporation and transformants are selected erythromycin (25 ug/mL), and spectinomycin (100 g/mL). following overnight growth at 37° C. on LB agar plates con The flask is incubated without shaking at 37° C. for 18-24 h. taining amplicillin (100 g/mL). The transformants are then after which time, isobutanol production is measured by screened by colony PCR to confirm the correct clone contain HPLC or GCanalysis, as described in the General Methods ing pTrc99A: budB-ilvC(B.S.)-ilvD-kivD-bdhB. section.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 267

<21 Os SEQ ID NO 1 &211s LENGTH: 168O &212s. TYPE: DNA <213> ORGANISM: K. pneumoniae

<4 OOs SEQUENCE: 1

US 8,945,859 B2 65 66 - Continued

Ser Gly Pro Gly Cys Ser Asn Luell Ile Thir Gly Met Ala Thir Ala Asn 85 90 95

Ser Glu Gly Asp Pro Wall Wall Ala Luell Gly Gly Ala Wall Lys Arg Ala 105 11 O

Asp Ala Glin Wall His Glin Ser Met Asp Thir Wall Ala Met Phe 115 12 O 125

Ser Pro Wall Thir Ala Ile Glu Wall Thir Ala Pro Asp Ala Luell 13 O 135 14 O

Ala Glu Wall Wall Ser Asn Ala Phe Arg Ala Ala Glu Glin Gly Arg Pro 145 150 155 160

Gly Ser Ala Phe Wall Ser Lell Pro Glin Asp Wall Wall Asp Gly Pro Wall 1.65 17O 17s

Ser Gly Wall Lell Pro Ala Ser Gly Ala Pro Glin Met Gly Ala Ala 18O 185 19 O

Pro Asp Asp Ala Ile Asp Glin Wall Ala Luell Ile Ala Glin Ala 195

Asn Pro Ile Phe Lell Lell Gly Luell Met Ala Ser Glin Pro Glu Asn Ser 21 O 215 22O

Lys Ala Luell Arg Arg Lell Lell Glu Thir Ser His Ile Pro Wall Thir Ser 225 23 O 235 24 O

Thir Glin Ala Ala Gly Ala Wall Asn Glin Asp Asn Phe Ser Arg Phe 245 250 255

Ala Gly Arg Wall Gly Lell Phe Asn Asn Glin Ala Gly Asp Arg Luell Luell 26 O 265 27 O

Glin Luell Ala Asp Lell Wall Ile Cys Ile Gly Tyr Ser Pro Wall Glu Tyr 285

Glu Pro Ala Met Trp Asn Ser Gly Asn Ala Thir Lell Wall His Ile Asp 29 O 295 3 OO

Wall Luell Pro Ala Tyr Glu Glu Arg Asn Tyr Thir Pro Asp Wall Glu Luell 3. OS 310 315

Wall Gly Asp Ile Ala Gly Thir Luell Asn Lys Luell Ala Glin Asn Ile Asp 3.25 330 335

His Arg Luell Wall Lell Ser Pro Glin Ala Ala Glu Ile Lell Arg Asp Arg 34 O 345 35. O

Glin His Glin Arg Glu Lell Lell Asp Arg Arg Gly Ala Glin Luell Asn Glin 355 360 365

Phe Ala Luell His Pro Lell Arg Ile Wall Arg Ala Met Glin Asp Ile Wall 37 O 375

Asn Ser Asp Wall Thir Lell Thir Wall Asp Met Gly Ser Phe His Ile Trp 385 390 395 4 OO

Ile Ala Arg Lell Tyr Thir Phe Arg Ala Arg Glin Wall Met Ile Ser 4 OS 415

Asn Gly Glin Glin Thir Met Gly Wall Ala Luell Pro Trp Ala Ile Gly Ala 425 43 O

Trp Luell Wall Asn Pro Glu Arg Lys Wall Wall Ser Wall Ser Gly Asp Gly 435 44 O 445

Gly Phe Luell Glin Ser Ser Met Glu Luell Glu Thir Ala Wall Arg Luell 450 45.5 460

Ala Asn Wall Luell His Lell Ile Trp Wall Asp ASn Gly Tyr Asn Met Wall 465 470 48O

Ala Ile Glin Glu Glu Glin Arg Luell Ser Gly Wall Glu Phe 485 490 495

US 8,945,859 B2 69 70 - Continued

1O 15

Lell Gly Cys Arg Phe Met Gly Arg Asp Glu Phe Ala Asp Gly Ala 25

Ser Luell Glin Gly Wall Wall Ile Wall Gly Cys Gly Ala Glin 35 4 O 45

Gly Luell Asn Glin Gly Lell Asn Met Arg Asp Ser Gly Lell Asp Ile Ser SO 55 6 O

Tyr Ala Luell Arg Lys Glu Ala Ile Ala Glu Lys Arg Ala Ser Trp Arg 65 70

Ala Thir Glu Asn Gly Phe Wall Gly Thir Glu Glu Luell Ile 85 90 95

Pro Glin Ala Asp Lell Wall Ile Asn Luell Thir Pro Asp Glin His Ser 105 11 O

Asp Wall Wall Arg Thir Wall Glin Pro Luell Met Asp Gly Ala Ala Luell 115 12 O 125

Gly Tyr Ser His Gly Phe Asn Ile Wall Glu Wall Gly Glu Glin Ile Arg 13 O 135 14 O

Lys Asp Ile Thir Wall Wall Met Wall Ala Pro Lys Pro Gly Thir Glu 145 150 155 160

Wall Arg Glu Glu Tyr Arg Gly Phe Gly Wall Pro Thir Luell Ile Ala 1.65 17O 17s

Wall His Pro Glu Asn Asp Pro Gly Glu Gly Met Ala Ile Ala 18O 185 19 O

Ala Trp Ala Ala Ala Thir Gly Gly His Arg Ala Gly Wall Luell Glu Ser 195

Ser Phe Wall Ala Glu Wall Lys Ser Asp Luell Met Gly Glu Glin Thir Ile 21 O 215 22O

Lell Gly Met Lell Glin Ala Gly Ser Luell Luell Phe Asp Luell 225 23 O 235 24 O

Wall Glu Glu Gly Thir Asp Pro Ala Ala Glu Lell Ile Glin Phe 245 250 255

Gly Trp Glu Thir Ile Thir Glu Ala Luell Glin Gly Gly Ile Thir Luell 26 O 265 27 O

Met Met Asp Arg Lell Ser Asn Pro Ala Luell Arg Ala Ala Luell 28O 285

Ser Glu Glin Luell Lys Glu Ile Met Ala Pro Luell Phe Glin His Met 29 O 295 3 OO

Asp Asp Ile Ile Ser Gly Glu Phe Ser Ser Gly Met Met Ala Asp Trp 3. OS 310 315

Ala Asn Asp Asp Lys Lell Luell Thir Trp Arg Glu Glu Thir Gly 3.25 330 335

Thir Ala Phe Glu Thir Ala Pro Glin Tyr Glu Gly Ile Gly Glu Glin 34 O 345 35. O

Glu Phe Asp Lys Gly Wall Luell Met Ile Ala Met Wall Ala Gly 355 360 365

Wall Glu Luell Ala Phe Glu Thir Met Wall Asp Ser Gly Ile Ile Glu Glu 37 O 375 38O

Ser Ala Glu Ser Lell His Glu Luell Pro Lell Ile Ala Asn Thir 385 390 395 4 OO

Ile Ala Arg Lell Glu Met Asn Wall Wall Ile Ser Asp Thir 4 OS 41O 415

Ala Glu Gly Asn Lell Phe Ser Ala Wall Pro Luell Luell 42O 425 43 O

US 8,945,859 B2 73 - Continued acgc.cgaaaa atcgtgaacg. t caggtotCc tittgc cctgc gtgct tatgc cagcctggca 18OO accagcgc.cg acaaaggcgc ggtgcgcgat aaatcgaaac tigggggitta a 1851

<210s, SEQ ID NO 6 &211s LENGTH: 616 212. TYPE: PRT <213> ORGANISM: E. coli

<4 OOs, SEQUENCE: 6 Met Pro Llys Tyr Arg Ser Ala Thr Thr Thr His Gly Arg Asn Met Ala 1. 5 1O 15 Gly Ala Arg Ala Lieu. Trp Arg Ala Thr Gly Met Thr Asp Ala Asp Phe 2O 25 3O Gly Llys Pro Ile Ile Ala Val Val Asn Ser Phe Thr Glin Phe Val Pro 35 4 O 45 Gly His Val His Lieu. Arg Asp Lieu. Gly Lys Lieu Val Ala Glu Glin Ile SO 55 6 O Glu Ala Ala Gly Gly Val Ala Lys Glu Phe Asn. Thir Ile Ala Val Asp 65 70 7s 8O Asp Gly Ile Ala Met Gly His Gly Gly Met Leu Tyr Ser Leu Pro Ser 85 90 95 Arg Glu Lieu. Ile Ala Asp Ser Val Glu Tyr Met Val Asn Ala His Cys 1OO 105 11 O Ala Asp Ala Met Val Cys Ile Ser Asn. Cys Asp Llys Ile Thr Pro Gly 115 12 O 125 Met Lieu Met Ala Ser Lieu. Arg Lieu. ASn Ile Pro Val Ile Phe Val Ser 13 O 135 14 O Gly Gly Pro Met Glu Ala Gly Lys Thir Lys Lieu. Ser Asp Glin Ile Ile 145 150 155 160 Llys Lieu. Asp Lieu Val Asp Ala Met Ile Glin Gly Ala Asp Pro Llys Val 1.65 17O 17s Ser Asp Ser Glin Ser Asp Glin Val Glu Arg Ser Ala Cys Pro Thr Cys 18O 185 19 O Gly Ser Cys Ser Gly Met Phe Thr Ala Asn Ser Met Asn Cys Lieu. Thr 195 2OO 2O5 Glu Ala Lieu. Gly Lieu. Ser Glin Pro Gly Asn Gly Ser Lieu. Lieu Ala Thr 21 O 215 22O His Ala Asp Arg Lys Glin Lieu. Phe Lieu. Asn Ala Gly Lys Arg Ile Val 225 23 O 235 24 O Glu Lieu. Thir Lys Arg Tyr Tyr Glu Glin Asn Asp Glu Ser Ala Lieu Pro 245 250 255 Arg Asn. Ile Ala Ser Lys Ala Ala Phe Glu Asn Ala Met Thr Lieu. Asp 26 O 265 27 O Ile Ala Met Gly Gly Ser Thr Asn. Thr Val Lieu. His Lieu. Lieu Ala Ala 27s 28O 285

Ala Glin Glu Ala Glu Ile Asp Phe Thr Met Ser Asp Ile Asp Llys Lieu 29 O 295 3 OO

Ser Arg Llys Val Pro Glin Lieu. Cys Llys Val Ala Pro Ser Thr Glin Lys 3. OS 310 315 32O Tyr His Met Glu Asp Val His Arg Ala Gly Gly Val Ile Gly Ile Lieu. 3.25 330 335

Gly Glu Lieu. Asp Arg Ala Gly Lieu. Lieu. Asn Arg Asp Wall Lys Asn. Wall 34 O 345 35. O

Lieu. Gly Lieu. Thir Lieu Pro Gln Thr Lieu. Glu Gln Tyr Asp Val Met Leu US 8,945,859 B2 75 76 - Continued

355 360 365

Thir Glin Asp Asp Ala Wall Lys Asn Met Phe Arg Ala Gly Pro Ala Gly 37 O 375

Ile Arg Thir Thr Glin Ala Phe Ser Glin Asp Cys Arg Trp Asp Thir Lieu 385 390 395 4 OO

Asp Asp Asp Arg Ala Asn Gly Cys Ile Arg Ser Lell Glu His Ala Tyr 4 OS 41O 415

Ser Asp Gly Gly Lieu Ala Val Lieu. Tyr Gly Asn Phe Ala Glu Asn 425 43 O

Gly Ile Val Llys Thr Ala Gly Val Asp Asp Ser Ile Lieu Lys Phe 435 44 O 445

Thir Gly Pro Ala Lys Val Tyr Glu Ser Glin Asp Asp Ala Wall Glu Ala 450 45.5 460

Ile Luell Gly Gly Llys Val Val Ala Gly Asp Wall Wall Wall Ile Arg Tyr 465 470 47s

Glu Gly Pro Lys Gly Gly Pro Gly Met Glin Glu Met Lell Tyr Pro Thr 485 490 495

Ser Phe Lieu Lys Ser Met Gly Lieu. Gly Lys Ala Ala Lieu. Ile Thr SOO 505 51O

Asp Gly Arg Phe Ser Gly Gly Thr Ser Gly Lieu. Ser Ile Gly His Val 515 525

Ser Pro Glu Ala Ala Ser Gly Gly Ser Ile Gly Lell Ile Glu Asp Gly 53 O 535 54 O

Asp Luell Ile Ala Ile Asp Ile Pro Asn Arg Gly Ile Glin Lieu. Glin Wall 545 550 555 560

Ser Asp Ala Glu Lieu Ala Ala Arg Arg Glu Ala Glin Asp Ala Arg Gly 565 st O sts

Asp Ala Trp Thr Pro Lys Asn Arg Glu Arg Glin Wall Ser Phe Ala 585 59 O

Lell Arg Ala Tyr Ala Ser Lieu Ala Thir Ser Ala Asp Lys Gly Ala Val 595 605 Arg Asp Llys Ser Llys Lieu. Gly Gly 610 615

<210s, SEQ ID NO 7 &211s LENGTH: 1662 &212s. TYPE: DNA <213s ORGANISM: Lactococcus lact is

<4 OO > SEQUENCE: 7 tctaga cata totatact.gt gggggattac Ctgctggatc gccticacga actggggatt 6 O gaagaaattt t cqgtgtgcc aggcgatt at aacct gcagt tcc tiggacca gattatctog 12 O

Cacaaagata talagtgggit cggtaacgc.c aacgaactga acgcgagct a tatggcagat 18O ggittatgc cc gtaccaaaaa tittctgacga CCtttggcgt togaactg 24 O agcgc.cgt.ca acggactggc aggaagctac gcc.gagalacc tgc.cagttgt cqaaattgtt 3OO gggit cqccta Cttctalaggt t cagaatgaa ggcaaatttg tgcaccatac totggctgat 360 ggggattitta aacatttitat gaaaatgcat gaaccggitta Ctgcggc.ccg cacgctgctg acagcagaga atgctacggit tgagat.cgac cgcgt.cctgt Ctgcgctgct gaaagagcgc 48O aag.ccggitat at at caat ct gcc titcgat gttgcc.gcag cgaaag.ccga aaa.gc.cgt.cg 54 O ctgccactgaaaaaagaaaa cagcacct co aatacatcgg accaggaaat tctgaataaa atcCaggaat cactgaagaa tgcgaagaaa ccgatcqtca t caccggaca tdagatcatc 660 US 8,945,859 B2 77 78 - Continued tcttittggcc tggaaaaaac ggt cacgcag tt catttgtta agaccaaact gccitat cacc 72 O accctgaact tcq.gcaaatc tagcgt.cgat gaa.gc.gctgc cgagttittct gggitatictat aatgg taccc tgtc.cgaacc gaacctgaaa gaatticgt.cg aaag.cgcgga ctittatcctg 84 O atgctggg.cg tgaaactgac ggatagdt CC acaggcgcat ttaccCacca tctgaacgag 9 OO aataaaatga titt coctdaa tat cacgaa ggcaaaatct ttalacgagcg catccagaac 96.O titcgattittg aatctotgat tagttcgctg Ctggatctgt ccgaaattga gtatalaaggit aaatatattg ataaaaaa.ca ggaggattitt gtgc.cgt.cta atgcgctgct gagt caggat

aag.ccgtaga aaacctgaca cagtictaatg aaacgattgt tgcggaacag 14 O ggaact tcat tttitcggcgc cit cat coatt tittctgaaat c caaaagcca titt cattggc 2OO caac cqctgt gggggagtat tggittatacc titt Coggcgg cgctgggttc acagattgca 26 O gataaggaat cacgc.cat ct gctgtttatt ggtgacggca gccticagot gactgtc.ca.g 32O galactggggc tggcgat.ccg tgaaaaaatc aatcc.gattit gctittat cat caataacgac ggct acaccg tcgaacgcga aatt catgga ccgaatcaaa gttacaatga catc.ccgatg 44 O tggalactata gcaaactgcc ggaatcctitt ggcgcgacag aggat.cgcgt. ggtgagtaaa SOO attgttgcgta cggaaaacga atttgttgtcg gtt atgaaag aag.cgcaggc tgaccc.gaat 560 cgcatgitatt ggattgaact gatcctggca aaagaaggcg Caccgaaagt tctgaaaaag atggggaaac tgtttgcgga gcaaaataaa agctaaggat cc. 662

SEQ ID NO 8 LENGTH: 548 TYPE : PRT ORGANISM: Lactococcus lact is

< 4 OOs SEQUENCE: 8

Met Tyr Thr Val Gly Asp Tyr Lieu. Lieu. Asp Arg Lell His Glu Lieu. Gly 1. 1O 15

Ile Glu Glu Ile Phe Gly Val Pro Gly Asp Tyr Asn Lell Glin Phe Lieu. 25

Asp Glin Ile Ile Ser His Lys Asp Met Lys Trp Wall Gly Asn Ala Asn 35 4 O 45

Glu Luell Asn Ala Ser Tyr Met Ala Asp Gly Tyr Ala Arg Thir SO 55 6 O

Ala Ala Ala Phe Lieu. Thir Thir Phe Gly Val Gly Glu Lell Ser Ala Wall 65 70 8O

Asn Gly Luell Ala Gly Ser Tyr Ala Glu Asn Lieu. Pro Wall Wall Glu Ile 85 90 95

Wall Gly Ser Pro Thir Ser Lys Val Glin Asn. Glu Gly Phe Wall His 105 11 O

His Thir Luell Ala Asp Gly Asp Phe Llys His Phe Met Lys Met His Glu 115 12 O 125

Pro Wall Thir Ala Ala Arg Thr Lieu. Lieu. Thir Ala Glu Asn Ala Thir Wall 13 O 135 14 O

Glu Ile Asp Arg Val Lieu. Ser Ala Lieu. Lieu Lys Glu Arg Pro Wall 145 150 155 160

Ile Asn Lieu Pro Val Asp Wall Ala Ala Ala Ala Glu Llys Pro 1.65 17O 17s

Ser Luell Pro Lieu Lys Lys Glu Asn Ser Thir Ser Asn Thir Ser Asp Glin 18O 185 19 O US 8,945,859 B2 79 - Continued

Glu Ile Lieu. Asn Lys Ile Glin Glu Ser Lieu Lys Asn Ala Lys Llys Pro 195 2OO 2O5 Ile Val Ile Thr Gly His Glu Ile Ile Ser Phe Gly Lieu. Glu Lys Thr 21 O 215 22O Val Thr Glin Phe Ile Ser Lys Thr Lys Lieu Pro Ile Thr Thr Lieu. Asn 225 23 O 235 24 O Phe Gly Lys Ser Ser Val Asp Glu Ala Lieu Pro Ser Phe Lieu. Gly Ile 245 250 255 Tyr Asn Gly Thr Lieu. Ser Glu Pro Asn Lieu Lys Glu Phe Val Glu Ser 26 O 265 27 O Ala Asp Phe Ile Lieu Met Lieu. Gly Val Lys Lieu. Thir Asp Ser Ser Thr 27s 28O 285 Gly Ala Phe Thr His His Lieu. Asn. Glu Asn Llys Met Ile Ser Lieu. Asn 29 O 295 3 OO Ile Asp Glu Gly Lys Ile Phe Asn. Glu Arg Ile Glin Asn. Phe Asp Phe 3. OS 310 315 32O Glu Ser Lieu. Ile Ser Ser Lieu. Lieu. Asp Lieu. Ser Glu Ile Glu Tyr Lys 3.25 330 335 Gly Lys Tyr Ile Asp Llys Lys Glin Glu Asp Phe Val Pro Ser Asn Ala 34 O 345 35. O Lieu. Lieu. Ser Glin Asp Arg Lieu. Trp Glin Ala Val Glu Asn Lieu. Thr Glin 355 360 365 Ser Asn Glu Thir Ile Val Ala Glu Gln Gly Thr Ser Phe Phe Gly Ala 37 O 375 38O Ser Ser Ile Phe Lieu Lys Ser Llys Ser His Phe Ile Gly Glin Pro Lieu 385 390 395 4 OO Trp Gly Ser Ile Gly Tyr Thr Phe Pro Ala Ala Lieu. Gly Ser Glin Ile 4 OS 41O 415 Ala Asp Llys Glu Ser Arg His Lieu. Lieu. Phe Ile Gly Asp Gly Ser Lieu 42O 425 43 O Glin Lieu. Thr Val Glin Glu Lieu. Gly Lieu Ala Ile Arg Glu Lys Ile Asn 435 44 O 445 Pro Ile Cys Phe Ile Ile Asn Asn Asp Gly Tyr Thr Val Glu Arg Glu 450 45.5 460 Ile His Gly Pro Asn Glin Ser Tyr Asn Asp Ile Pro Met Trp Asn Tyr 465 470 47s 48O Ser Lys Lieu Pro Glu Ser Phe Gly Ala Thr Glu Asp Arg Val Val Ser 485 490 495 Lys Ile Val Arg Thr Glu Asn. Glu Phe Val Ser Val Met Lys Glu Ala SOO 505 51O Glin Ala Asp Pro Asn Arg Met Tyr Trp Ile Glu Lieu. Ile Lieu Ala Lys 515 52O 525 Glu Gly Ala Pro Llys Val Lieu Lys Llys Met Gly Llys Lieu. Phe Ala Glu 53 O 535 54 O

Glin Asn Llys Ser 5.45

<210s, SEQ ID NO 9 &211s LENGTH: 1164 &212s. TYPE: DNA <213> ORGANISM: E. coli

<4 OOs, SEQUENCE: 9 atgaacaact ttaatctgca caccc caa.cc cqcattctgt ttggtaaagg cqcaatcgct 6 O

US 8,945,859 B2 83 84 - Continued

Pro Val Tyr Thr Tyr Thr Leu Pro Pro Arg Glin Wall Ala Asn Gly Wall 18O 185 19 O

Wall Asp Ala Phe Val His Thr Val Glu Glin Tyr Wall Thir Lys Pro Wall 195 2OO

Asp Ala Lys Ile Glin Asp Arg Phe Ala Glu Gly Ile Lell Luell Thir Luell 21 O 215

Ile Glu Asp Gly Pro Lys Ala Lieu Lys Glu Pro Glu Asn Tyr Asp Wall 225 23 O 235 24 O

Arg Ala Asn. Wal Met Trp Ala Ala Thr Glin Ala Lell Asn Gly Luell Ile 245 250 255

Gly Ala Gly Val Pro Glin Asp Trp Ala Thir His Met Lell Gly His Glu 26 O 265 27 O

Lell Thir Ala Met His Gly Lieu. Asp His Ala Glin Thir Lell Ala Ile Wall 27s 28O 285

Lell Pro Ala Lieu. Trp Asn. Glu Lys Arg Asp Thir Lys Arg Ala Luell 29 O 295 3 OO

Lell Glin Tyr Ala Glu Arg Val Trp Asn Ile Thir Glu Gly Ser Asp Asp 3. OS 310 315

Glu Arg Ile Asp Ala Ala Ile Ala Ala Thir Arg Asn Phe Phe Glu Glin 3.25 330 335

Lell Gly Val Pro Thr His Leu Ser Asp Tyr Gly Lell Asp Gly Ser Ser 34 O 345 35. O

Ile Pro Ala Lieu Lleu Lys Llys Lieu. Glu Glu His Gly Met Thir Glin Luell 355 360 365

Gly Glu Asn His Asp Ile Thr Lieu. Asp Wall Ser Arg Arg Ile Glu 37 O 375 38O

Ala Ala Arg 385

<210s, SEQ ID NO 11 &211s LENGTH: 29 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 11

Caccatggac aaa.cagtatic cqgtacgc.c 29

<210s, SEQ ID NO 12 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 12 cgaagggcga tagctttacc aatcC 25

<210s, SEQ ID NO 13 &211s LENGTH: 29 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 13 caccatggct aac tacttica atacactga 29 US 8,945,859 B2 85 86 - Continued

SEQ ID NO 14 LENGTH: 28 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer

SEQUENCE: 14 cCaggagaag gccttgagtg ttitt Ctcc 28

SEO ID NO 15 LENGTH: 29 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer

SEQUENCE: 15 caccatgcct aagtaccgtt cogccacca 29

SEQ ID NO 16 LENGTH: 26 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer

SEQUENCE: 16 cgcago actg ct cittaaata titcggc 26

SEQ ID NO 17 LENGTH: 29 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer

SEQUENCE: 17 caccatgaac aactittaatc togcacaccc 29

SEQ ID NO 18 LENGTH: 29 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer

SEQUENCE: 18 caccatgaac aactittaatc togcacaccc 29

SEQ ID NO 19 LENGTH: 45 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer

SEQUENCE: 19 gcatgcctta agaaaggaggggggt cacat ggacaaacag tat Co 45

SEQ ID NO 2 O LENGTH: 39 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer US 8,945,859 B2 87 88 - Continued

<4 OOs, SEQUENCE: atgcatttaa ttaattacag aatctgactic agatgcago 39

<210s, SEQ ID NO 21 &211s LENGTH: 45 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 21 gtcgacgcta gcaaaggagg gaatcaccat ggctaactac ttcaa 45

<210s, SEQ ID NO 22 &211s LENGTH: 31 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 22 tctagattaa ccc.gcaa.cag caatacgttt c 31

<210s, SEQ ID NO 23 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

< 4 OO SEQUENCE: 23 tctagaaaag gaggaataaa gtatgcct aa gtaccgttc 39

<210s, SEQ ID NO 24 &211s LENGTH: 31 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 24 ggat.cc titat taaccoccca gtttcgattt a 31

<210s, SEQ ID NO 25 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 25 ggat.ccaaag gaggct agaic atatgtatac ttggggga 39

<210s, SEQ ID NO 26 &211s LENGTH: 31 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer

<4 OOs, SEQUENCE: 26 gagct cittag cittittattitt gct cogcaaa c 31

<210s, SEQ ID NO 27 &211s LENGTH: 39 US 8,945,859 B2 89 90 - Continued

TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer

SEQUENCE: 27 gagotcaaag gaggagcaag taatgaacaa Ctttaatct 39

SEQ ID NO 28 LENGTH: 43 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer

SEQUENCE: 28 gaattic act a gtc.ctaggitt agcgggcggc titcgtatata C9g 43

SEQ ID NO 29 LENGTH: 25 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer

SEQUENCE: 29 caac attagc gattitt ctitt tot ct 25

SEQ ID NO 3 O LENGTH: 45 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer

SEQUENCE: 3 O catgaagctt act agtgggc titaagttittgaaaataatga aaact 45

SEQ ID NO 31 LENGTH: 61 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N11 O2

SEQUENCE: 31 gagotcacta gtcaattgta agtaagtaaa aggaggtggg to acatggac aaa.cagtatic 6 O c 61

SEQ ID NO 32 LENGTH: SO TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N111.2

SEQUENCE: 32 ggat.ccgatc gaCttalagcc ticagottaca gaatctgact Cagatgcagc SO

SEQ ID NO 33 LENGTH: 44 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N112.2 US 8,945,859 B2 91 92 - Continued

<4 OOs, SEQUENCE: 33 gagctic citta agaaggaggit aat caccatg gctaact act tcaa 44

<210s, SEQ ID NO 34 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer N113.2

<4 OOs, SEQUENCE: 34 ggat.ccgatc gagctagogc ggcc.gcttaa ccc.gcaa.cag caatacgttt C 51

<210s, SEQ ID NO 35 &211s LENGTH: 44 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer N1142

<4 OOs, SEQUENCE: 35 gagotcgcta gcaaggaggit ataaagtatg cctaagtacc gttc 44

<210s, SEQ ID NO 36 &211s LENGTH: 52 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer N115.2

< 4 OO SEQUENCE: 36 ggat.ccgatc gattaattaa cctaaggitta tta accc.ccc agttt cqatt ta 52

<210s, SEQ ID NO 37 &211s LENGTH: 46 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer N116.2

<4 OO > SEQUENCE: 37 gagotcttaa ttaaaaggag gttagacata titat actgt ggggga 46

<210s, SEQ ID NO 38 &211s LENGTH: 49 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer 117.2

<4 OOs, SEQUENCE: 38 ggat.ccagat citcc taggac atgtttagct tittattittgc ticcgcaaac 49

<210s, SEQ ID NO 39 &211s LENGTH: 3883 &212s. TYPE: DNA <213> ORGANISM: Escherichia coli

<4 OOs, SEQUENCE: 39 citat attgct gaaggtacag gogtttcc at aac tatttgc ticgcgtttitt tact caagaa 6 O gaaaatgcca aatagdalaca toaggcagac aat accc.gaa attgc galaga aaactgtctg 12 O gtag ccticg tdgtcaaaga gitatic ccagt cggcgttgaa agcagcacala tcc caag.cga 18O actggcaatt togaaaaccaa totagaaagat cgt.cgacgac aggcgctitat caaagtttgc 24 O

US 8,945,859 B2 97 98 - Continued

<210s, SEQ ID NO 43 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N13 OSeqF4 <4 OOs, SEQUENCE: 43 aaaataccag cqcctgtc.c 19

<210s, SEQ ID NO 44 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N13 OSeqR1 <4 OOs, SEQUENCE: 44 tgaatggcca C catgttg 18

<210s, SEQ ID NO 45 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N13 OSeqR2 <4 OOs, SEQUENCE: 45 gaggat.ct Co gcc.gc.ctg 18

<210s, SEQ ID NO 46 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N13 OSeqR3 <4 OOs, SEQUENCE: 46 aggc.cgagca ggalagatc 18

<210s, SEQ ID NO 47 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N13 OSeqR4 <4 OOs, SEQUENCE: 47 tgat Caggitt ggalacagcc 19

<210s, SEQ ID NO 48 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N131SeqF1

<4 OOs, SEQUENCE: 48 aagaactgat CCC acaggc 19

<210s, SEQ ID NO 49 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: US 8,945,859 B2 99 100 - Continued OTHER INFORMATION: Primer N131SeqF2 SEQUENCE: 49 atcCtgtgcg gtatgttgc 19

SEO ID NO 5 O LENGTH: 18 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N131Seqf3 SEQUENCE: 5 O attgcgatgg taaag.cg 18

SEO ID NO 51 LENGTH 19 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N131SeqR1

SEQUENCE: 51 atggtgttgg caatcagcg 19

SEO ID NO 52 LENGTH: 18 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N131SeqR2

< 4 OOs SEQUENCE: 52 gtgctt.cggit gatggttt 18

SEO ID NO 53 LENGTH 19 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N131SeqR3

SEQUENCE: 53 ttgaaaccgt gcgagtagc 19

SEO ID NO 54 LENGTH 19 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N132 SeqF1 SEQUENCE: 54 tatt cactgc catctogcg 19

SEO ID NO 55 LENGTH: 18 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N132 SeqF2

SEQUENCE: 55 cc.gtaa.gcag ctgttc ct 18 US 8,945,859 B2 101 102 - Continued

<210s, SEQ ID NO 56 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N132 SeqF3 <4 OOs, SEQUENCE: 56 gctggaacaa tacgacgtta

<210s, SEQ ID NO 57 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N132 SeqF4 <4 OO > SEQUENCE: 57 tgct ct accc aaccagottc

<210s, SEQ ID NO 58 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N132 SeqR1 <4 OOs, SEQUENCE: 58 atggaaagac cagaggtgcc

<210 SEQ ID NO 59 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N132 SeqR2 <4 OO > SEQUENCE: 59 tgcctgttgttg gtacgaat 18

<210s, SEQ ID NO 60 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N132 SeqR3 <4 OOs, SEQUENCE: 60 tattacgcgg cagtgcact 19

<210s, SEQ ID NO 61 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N132 SeqR4

<4 OOs, SEQUENCE: 61 ggtgattttgtc.gcagttag ag 22

<210s, SEQ ID NO 62 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N133SeqF1 US 8,945,859 B2 103 104 - Continued

<4 OOs, SEQUENCE: 62 tcgaaattgt tdgtc.gc 18

<210s, SEQ ID NO 63 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N133SeqF2 <4 OOs, SEQUENCE: 63 ggtcacgcag tt catttcta ag 22

<210s, SEQ ID NO 64 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N133SeqF3 <4 OOs, SEQUENCE: 64 tgtggcaa.gc cqtagaaa 18

<210s, SEQ ID NO 65 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N133SeqF4 < 4 OO SEQUENCE: 65 aggat.cgc.gt ggtgagtaa 19

<210s, SEQ ID NO 66 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N133SeqR1 <4 OOs, SEQUENCE: 66 gtagcc.gtcg ttattgatga

<210s, SEQ ID NO 67 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N133SeqR2 <4 OO > SEQUENCE: 67 gcagcgaact aat cagagat tic 22

<210s, SEQ ID NO 68 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N133SeqR3

<4 OOs, SEQUENCE: 68 tggit Cogatg tattggagg 19

<210s, SEQ ID NO 69 &211s LENGTH: 19 US 8,945,859 B2 105 106 - Continued

&212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N133SeqR4 <4 OOs, SEQUENCE: 69 tctgccatat agct cqcgt. 19

<210s, SEQ ID NO 70 &211s LENGTH: 42 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Promoter 1.6GI Wariant

<4 OO > SEQUENCE: 7 O gcc.cttgaca atgccacatc ctdagcaaat aattcaacca ct 42

<210s, SEQ ID NO 71 &211s LENGTH: 42 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Promoter 1.5GI

<4 OOs, SEQUENCE: 71 gcc.cttgact atgccacatc ctdagcaaat aattcaacca ct 42

<210s, SEQ ID NO 72 &211s LENGTH: 18 & 212 TYPE DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer Scr1

<4 OOs, SEQUENCE: 72 c ctittctttgttgaatcgg 18

<210s, SEQ ID NO 73 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer Scr2

<4 OO > SEQUENCE: 73 agaaac aggg ttgat Co 18

<210s, SEQ ID NO 74 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer Scre

<4 OOs, SEQUENCE: 74 agtgat catc acctgttgcc

<210s, SEQ ID NO 75 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer Scra

<4 OO > SEQUENCE: 75

US 8,945,859 B2 117 118 - Continued

<4 OOs, SEQUENCE: 88 ggtttctgtc. tctggtgacg

<210s, SEQ ID NO 89 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N99SeqR1 <4 OOs, SEQUENCE: 89 gtctggtgat t ctacgc.gca ag 22

<210s, SEQ ID NO 90 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N99SeqR2 <4 OOs, SEQUENCE: 90 catcgactgc attacgcaac to 22

<210s, SEQ ID NO 91 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N99SeqR3 <4 OOs, SEQUENCE: 91 cgatcgtcag aacaa.cat cit gc 22

<210s, SEQ ID NO 92 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N99SeqR4 <4 OOs, SEQUENCE: 92 cctt cagtgt togctgtcag

<210s, SEQ ID NO 93 &211s LENGTH: 36 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer N136

<4 OOs, SEQUENCE: 93 cc.gcggatag atctgaaatgaataacaata ctgaca 36

<210s, SEQ ID NO 94 &211s LENGTH: 65 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer N137

<4 OOs, SEQUENCE: 94 taccaccgaa gttgatttgc titcaa.catcc ticagotc tag atttgaatat g tatt acttg 6 O gttat 65 US 8,945,859 B2 119 120 - Continued

SEO ID NO 95 LENGTH: 28 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N138

SEQUENCE: 95 atgttgaagc aaatcaactt C9gtggta 28

SEO ID NO 96 LENGTH: 22 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N139

SEQUENCE: 96 ttattggttt totggtctica ac 22

SEO ID NO 97 LENGTH: 57 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N14 O

SEQUENCE: 97 aagttgagac cagaaaacca ataattaatt aat catgitaa ttagttatgt cacgctt

SEO ID NO 98 LENGTH: 30 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N141

SEQUENCE: 98 gcggcc.gc.cc gcaaattaaa gcctt.cgagc 3 O

SEO ID NO 99 LENGTH: 28 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N142

SEQUENCE: 99 ggat.ccgcat gcttgcattt agt cqtgc 28

SEQ ID NO 100 LENGTH: 56 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: N143

SEQUENCE: 1.OO cagg taatcc cccacagtat a catcct cag c tattgtaat atgtgttgttt gtttgg 56

SEQ ID NO 101 LENGTH: 22 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N144 US 8,945,859 B2 121 122 - Continued

< 4 OOs SEQUENCE: 101 atgt at actg tdggggatta cc 22

SEQ ID NO 102 LENGTH: 22 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N145

SEQUENCE: 1 O2 ttagcttitta ttittgctic cq ca 22

SEQ ID NO 103 LENGTH: 57 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N146

SEQUENCE: 103 tittgcggagc aaaataaaag ctaattaatt aagagtaagc gaatttctta tdattta

SEQ ID NO 104 LENGTH: 28 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N147

SEQUENCE: 104 actagtacca Caggtgttgt cct ctgag 28

SEO ID NO 105 LENGTH: 22 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N151

SEQUENCE: 105 ctagagagct titcgttitt ca td 22

SEQ ID NO 106 LENGTH: 57 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N152

SEQUENCE: 106 ct catgaaaa cqaaagct ct c tagttaatt aat catgitaa ttagttatgt cacgctt

SEO ID NO 107 LENGTH: 25 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N155

SEQUENCE: 107 atggcaaaga agctcaacaa gtact 25

SEQ ID NO 108 US 8,945,859 B2 123 124 - Continued

LENGTH: 22 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N156

SEQUENCE: 108 t caa.gcatct aaaacacaac cq 22

SEQ ID NO 109 LENGTH: 57 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N157

SEQUENCE: 109 aacggttgttgttittagatgc titgattaatt aagagtaagc gaatttctta tdattta

SEQ ID NO 11O LENGTH: 28 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N158

SEQUENCE: 11O ggat.ccttitt ctdgcaacca aacccata 28

SEQ ID NO 111 LENGTH: 56 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N159

SEQUENCE: 111 cgagtacttgttgagcttct ttgc.catcct cagcgagata gttgattgta togcttg 56

SEQ ID NO 112 LENGTH 19 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N16 OSeqF1

SEQUENCE: 112 gaaaacgtgg catcct ct c 19

SEQ ID NO 113 LENGTH 19 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N16 OSeqF2

SEQUENCE: 113 gctgactggc caa.gagaaa 19

SEQ ID NO 114 LENGTH: 2O TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N16 OSeqF3

SEQUENCE: 114 US 8,945,859 B2 125 126 - Continued tgtact tctic ccacggitttc

<210s, SEQ ID NO 115 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N16OSeqF4 <4 OOs, SEQUENCE: 115 agct acccaa tot citat acc ca 22

<210s, SEQ ID NO 116 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N16 OSeqF5 <4 OOs, SEQUENCE: 116 cctgaagt ct aggtoccitat tt 22

<210s, SEQ ID NO 117 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: N16 oSeqR1 <4 OOs, SEQUENCE: 117 gcgtgaatgt aag.cgtgac 19

<210s, SEQ ID NO 118 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N16OSeqR2 <4 OOs, SEQUENCE: 118 cgt.cgt attg agccaagaac

<210s, SEQ ID NO 119 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N16OSeqR3 <4 OOs, SEQUENCE: 119 gcatcggaca acaagttcat

<210s, SEQ ID NO 120 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N16OSeqR4

<4 OOs, SEQUENCE: 120 tcqttcttga agtagt ccaa ca 22

<210s, SEQ ID NO 121 &211s LENGTH: 19 &212s. TYPE: DNA US 8,945,859 B2 127 128 - Continued <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N16 OSeqR5 <4 OOs, SEQUENCE: 121 tgagc.ccgaa agagaggat 19

<210s, SEQ ID NO 122 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N161SeqF1 <4 OOs, SEQUENCE: 122 acggtatacg gcc titc citt 19

<210s, SEQ ID NO 123 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N161SeqF2 <4 OOs, SEQUENCE: 123 gggtttgaaa got atgcagt

<210s, SEQ ID NO 124 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N161SeqF3 <4 OOs, SEQUENCE: 124 ggtgg tatgt at actgccala Ca 22

<210s, SEQ ID NO 125 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N161SeqF4 <4 OOs, SEQUENCE: 125 ggtggit accc aatctgttgat ta 22

<210s, SEQ ID NO 126 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N161SeqF5 <4 OOs, SEQUENCE: 126 cggitttgggit aaagatgttg

<210s, SEQ ID NO 127 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N161SeqF6

<4 OOs, SEQUENCE: 127 aaacgaaaat t cittatt citt ga 22 US 8,945,859 B2 129 130 - Continued

<210s, SEQ ID NO 128 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N161SeqR1 <4 OOs, SEQUENCE: 128 tcqttittaaa acctaagagt ca 22

<210s, SEQ ID NO 129 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N161SeqR2 <4 OOs, SEQUENCE: 129 c caaac cqta acc cat cag 19

<210s, SEQ ID NO 130 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N161SeqR3 <4 OOs, SEQUENCE: 130

Cacagattgg gtaccacca 19

<210s, SEQ ID NO 131 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N161Seqr 4 <4 OOs, SEQUENCE: 131 accacaagaa ccaggacctg

<210s, SEQ ID NO 132 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N161SeqR5 <4 OOs, SEQUENCE: 132 catagotttcaaaccogct 19

<210s, SEQ ID NO 133 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer N161SeqR6

<4 OOs, SEQUENCE: 133 cgtataccgt togct cattag ag 22

<210s, SEQ ID NO 134 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: US 8,945,859 B2 131 132 - Continued

223s OTHER INFORMATION: Primer N162

<4 OOs, SEQUENCE: 134 atgttgacaa aagcaacaaa aga 23

SEO ID NO 135 LENGTH: 38 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N189

<4 OOs, SEQUENCE: 135 atcc.gcggat agatctagtt cqagtttatc attat caa 38

SEQ ID NO 136 LENGTH: 53 TYPE: DNA ORGANISM: Artificial Sequemce FEATURE: OTHER INFORMATION: Primer N19 O1

SEQUENCE: 136 ttcttttgtt gcttttgtca acatcct cag cott tatgtg togtttatt cq aaa 53

SEO ID NO 137 LENGTH: 38 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N176

< 4 OOs SEQUENCE: 137 atcc.gcggat agatct atta gaa.gc.cgc.cg agcgggcg 38

SEQ ID NO 138 LENGTH: 31 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Primer N177

<4 OOs, SEQUENCE: 138 atcc to agct titt citccttg acgittaaagt a 31

<210s, SEQ ID NO 139 &211s LENGTH: 477 212. TYPE : PRT &213s ORGANISM: Escherichia coli

<4 OOs, SEQUENCE: 139

Met Thr Glin Ser Arg Lell His Ala Ala Glin ASn Ala Lell Ala Lys Luell 1. 5 1O 15

His Glu His Arg Gly Asn Thir Phe Tyr Pro His Phe His Luell Ala Pro 25

Pro Ala Gly Trp Met Asn Asp Pro Asn Gly Luell Ile Trp Phe Asn Asp 35 4 O 45

Arg Tyr His Ala Phe Glin His His Pro Met Ser Glu His Trp Gly SO 55 6 O

Pro Met His Trp Gly His Ala Thir Ser Asp Asp Met Ile His Trp Glin 65 70 8O

His Glu Pro Ile Ala Lell Ala Pro Gly Asp Asp Asn Asp Asp Gly 85 90 95 US 8,945,859 B2 133 134 - Continued

Phe Ser Gly Ser Ala Wall Asp Asp Asn Gly Wall Lell Ser Luell Ile 105 11 O

Thir Gly His Wall Trp Lell Asp Gly Ala Gly Asn Asp Asp Ala Ile 115 12 O 125

Arg Glu Wall Glin Cys Lell Ala Thir Ser Arg Asp Gly Ile His Phe Glu 13 O 135 14 O

Lys Glin Gly Wall Ile Lell Thir Pro Pro Glu Gly Ile Met His Phe Arg 145 150 155 160

Asp Pro Wall Trp Arg Glu Ala Asp Thir Trp Trp Met Wall Wall Gly 1.65 17s

Ala Asp Pro Gly Asn Thir Gly Glin Ile Luell Lell Arg Gly Ser 18O 185 19 O

Ser Luell Arg Glu Trp Thir Phe Asp Arg Wall Luell Ala His Ala Asp Ala 195

Gly Glu Ser Met Trp Glu Pro Asp Phe Phe Ser Luell Gly Asp 21 O 215 22O

Glin His Luell Met Phe Ser Pro Glin Gly Met Asn Ala Glu Gly Tyr 225 23 O 235 24 O

Ser Arg Asn Arg Phe Glin Ser Gly Wall Ile Pro Gly Met Trp Ser 245 250 255

Pro Gly Arg Luell Phe Ala Glin Ser Gly His Phe Thir Glu Luell Asp Asn 26 O 265 27 O

Gly His Asp Phe Tyr Ala Pro Glin Ser Phe Luell Ala Lys Asp Gly Arg 285

Arg Ile Wall Ile Gly Trp Met Asp Met Trp Glu Ser Pro Met Pro Ser 29 O 295 3 OO

Lys Arg Glu Gly Trp Ala Gly Met Thir Luell Ala Arg Glu Luell Ser 3. OS 310 315

Glu Ser Asn Gly Lys Lell Lell Glin Arg Pro Wall His Glu Ala Glu Ser 3.25 330 335

Lell Arg Glin Glin His Glin Ser Wall Ser Pro Arg Thir Ile Ser Asn 34 O 345 35. O

Wall Luell Glin Glu Asn Ala Glin Ala Wall Glu Ile Glin Luell Glin Trp 355 360 365

Ala Luell Asn Ser Asp Ala Glu His Gly Lell Glin Luell Gly Thir 37 O 375

Gly Met Luell Tyr Ile Asp Asn Glin Ser Glu Arg Lell Wall Luell Trp 385 390 395 4 OO

Arg Pro His Glu Asn Luell Asp Gly Arg Ser Ile Pro Luell 4 OS 41O 415

Pro Glin Arg Asp Thir Lell Ala Luell Arg Ile Phe Ile Asp Thir Ser Ser 425 43 O

Wall Glu Wall Phe Ile Asn Asp Gly Glu Ala Wall Met Ser Ser Arg Ile 435 44 O 445

Pro Glin Pro Glu Glu Arg Glu Luell Ser Luell Tyr Ala Ser His Gly 450 45.5 460

Wall Ala Wall Luell Glin His Gly Ala Luell Trp Luell Lell Gly 465 470 47s

<210s, SEQ ID NO 140 &211s LENGTH: 212. TYPE : PRT <213> ORGANISM: Escherichia coli US 8,945,859 B2 135 136 - Continued

<4 OOs, SEQUENCE: 140 Met Ser Ala Lys Val Trp Val Lieu. Gly Asp Ala Val Val Asp Lieu. Lieu. 1. 5 1O 15 Pro Glu Ser Asp Gly Arg Lieu. Lieu Pro Cys Pro Gly Gly Ala Pro Ala 2O 25 3O Asn Val Ala Val Gly Ile Ala Arg Lieu. Gly Gly. Thir Ser Gly Phe Ile 35 4 O 45 Gly Arg Val Gly Asp Asp Pro Phe Gly Ala Lieu Met Glin Arg Thr Lieu. SO 55 6 O Lieu. Thr Glu Gly Val Asp Ile Thr Tyr Lieu Lys Glin Asp Glu Trp His 65 70 7s 8O Arg Thir Ser Thr Val Lieu Val Asp Lieu. Asn Asp Glin Gly Glu Arg Ser 85 90 95 Phe Thr Phe Met Val Arg Pro Ser Ala Asp Leu Phe Lieu. Glu. Thir Thr 1OO 105 11 O Asp Lieu Pro Cys Trp Arg His Gly Glu Trp Lieu. His Lieu. Cys Ser Ile 115 12 O 125 Ala Leu Ser Ala Glu Pro Ser Arg Thr Ser Ala Phe Thr Ala Met Thr 13 O 135 14 O Ala Ile Arg His Ala Gly Gly Phe Val Ser Phe Asp Pro Asn. Ile Arg 145 150 155 160 Glu Asp Lieu. Trp Glin Asp Glu. His Lieu. Lieu. Arg Lieu. Cys Lieu. Arg Glin 1.65 17O 17s Ala Lieu. Glin Lieu Ala Asp Val Val Lys Lieu. Ser Glu Glu Glu Trp Arg 18O 185 19 O Lieu. Ile Ser Gly Llys Thr Glin Asn Asp Glin Asp Ile Cys Ala Lieu Ala 195 2OO 2O5 Lys Glu Tyr Glu Ile Ala Met Lieu. Lieu Val Thir Lys Gly Ala Glu Gly 21 O 215 22O Val Val Val Cys Tyr Arg Gly Glin Val His His Phe Ala Gly Met Ser 225 23 O 235 24 O Val Asn. Cys Val Asp Ser Thr Gly Ala Gly Asp Ala Phe Val Ala Gly 245 250 255 Lieu. Lieu. Thr Gly Lieu. Ser Ser Thr Gly Lieu. Ser Thr Asp Glu Arg Glu 26 O 265 27 O Met Arg Arg Ile Ile Asp Lieu Ala Glin Arg Cys Gly Ala Lieu Ala Val 27s 28O 285 Thir Ala Lys Gly Ala Met Thr Ala Lieu Pro Cys Arg Glin Glu Lieu. Glu 29 O 295 3 OO

<210s, SEQ ID NO 141 &211s LENGTH: 415 212. TYPE: PRT <213> ORGANISM: Escherichia coli

<4 OOs, SEQUENCE: 141 Met Ala Lieu. Asn. Ile Pro Phe Arg Asn Ala Tyr Tyr Arg Phe Ala Ser 1. 5 1O 15

Ser Tyr Ser Phe Lieu. Phe Phe Ile Ser Trp Ser Leu Trp Trp Ser Lieu. 2O 25 3O Tyr Ala Ile Trp Lieu Lys Gly His Lieu. Gly Lieu. Thr Gly. Thr Glu Lieu. 35 4 O 45

Gly Thr Lieu. Tyr Ser Val Asn Glin Phe Thr Ser Ile Leu Phe Met Met SO 55 6 O US 8,945,859 B2 137 138 - Continued

Phe Gly Ile Wall Glin Asp Luell Gly Luell Lys Lys Pro Luell Ile 65 70

Trp Met Ser Phe Ile Lell Wall Luell Thir Gly Pro Phe Met Ile Tyr 85 90 95

Wall Glu Pro Lell Lell Glin Ser Asn Phe Ser Wall Gly Luell Ile Luell 105 11 O

Gly Ala Luell Phe Phe Gly Lell Gly Luell Ala Gly Cys Gly Luell Luell 115 12 O 125

Asp Ser Phe Thir Glu Met Ala Arg Asn Phe His Phe Glu Tyr Gly 13 O 135 14 O

Thir Ala Arg Ala Trp Gly Ser Phe Gly Tyr Ala Ile Gly Ala Phe Phe 145 150 155 160

Ala Gly Ile Phe Phe Ser Ile Ser Pro His Ile Asn Phe Trp Luell Wall 1.65 17s

Ser Luell Phe Gly Ala Wall Phe Met Met Ile ASn Met Arg Phe Asp 18O 185 19 O

Asp His Glin Wall Ala Ala Asp Ala Gly Gly Wall Glu 195

Asp Phe Ile Ala Wall Phe Lys Asp Arg Asn Phe Trp Wall Phe Wall Ile 21 O 215

Phe Ile Wall Gly Thir Trp Ser Phe Asn Ile Phe Asp Glin Glin Luell 225 23 O 235 24 O

Phe Pro Wall Phe Tyr Ser Gly Luell Phe Glu Ser His Asp Wall Gly Thir 245 250 255

Arg Lieu Tyr Gly Tyr Lieu Asn Ser Phe Gln Wall Wall Lieu Glu Ala Lieu 26 O 265 27 O

Met Ala Ile Ile Pro Phe Phe Wall Asn Arg Wall Gly Pro Asn 28O 285

Luell Luell Ile Gly Wall Wall Ile Met Ala Luell Arg Ile Luell Ser 29 O 295 3 OO

Luell Phe Wall Asn Pro Trp Ile Ile Ser Luell Wall Luell Luell His 310 315

Ile Glu Wall Pro Lell Wall Ile Ser Wall Phe Ser Wall 3.25 330 335

Asn Phe Asp Lys Arg Lell Ser Ser Thir Ile Phe Lell Ile Gly Phe 34 O 345 35. O

Ile Ala Ser Ser Lell Gly Ile Wall Luell Luell Ser Thir Pro Thir Gly 355 360 365

Luell Phe Asp His Ala Gly Tyr Glin Thir Wall Phe Phe Ala Ile Ser 37 O 375

Ile Wall Cys Lell Met Lell Luell Phe Gly Ile Phe Phe Luell Ser Lys 390 395 4 OO

Arg Glu Glin Ile Wall Met Glu Thir Pro Wall Pro Ser Ala Ile 4 OS 41O 415

SEQ ID NO 142 LENGTH: 6341 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Plasmid pFP988DssPspac

<4 OOs, SEQUENCE: 142 gatccaagtt taaactgtac act agatatt tottctic cqc ttaaatcatc aaagaaatct titat cacttg taaccagtico gtc. cacatgt cqaattgcat citgaccgaat tttacgttt c 12 O US 8,945,859 B2 139 140 - Continued cctgaataat t ct cat caat cqttt catca attittat citt tatactittat attttgttgcg 18O ttaatcaaat cataatttitt atatgtttico toatgattta tot ctittatt attatag titt 24 O ttatt citctic tittgattatgtc.tttgtatic ccgtttgtat tacttgatcc tittaact citg 3OO gcaa.ccctica aaattgaatgaga catgcta cacct cogga taataaatat atataaacgt. 360 atatagattt cataaagt ct aacacactag act tatttac titcgtaatta agt cqttaaa 42O cc.gtgtgctic tacgaccalaa actataaaac ctittaagaac titt cittittitt tacaagaaaa 48O aagaaattag ataaatct ct catat cittitt attcaataat cqcatc.cgat tdcagtataa 54 O atttaacgat cact catcat gttcatattt atcagagctic gtgctataat tatactaatt 6OO ttataaggag gaaaaaatat giggcatttitt agtatttittg taatcagcac agttcattat 660 caac caaaca aaaaataagt gigittataatgaatcgittaat aagcaaaatt catataacca 72 O aattaaagag ggittataatgaacgagaaaa atataaaa.ca cagtcaaaac titt attactt 78O caaaacataa tatagataaa ataatgacaa atataagatt aaatgaacat gataatat ct 84 O ttgaaatcgg ct caggaaaa ggc catttta CCCttgaatt agtaaagagg totaattitcg 9 OO taactgcc at tdaaatagac cataaattat gcaaaactac agaaaataaa cittgttgat c 96.O acgataattt coaagttitta aacaaggata tattgcagtt taaattt colt aaaaaccaat O2O cctataaaat atatgg taat ataccttata acatalagtac ggatataata cqcaaaattg O8O tttittgatag tatagotaat gagatttatt taatcgtgga atacgggittt gctaaaagat 14 O tattaaatac aaaacgct cattggcattac ttittaatggc agaagttgat atttctatat 2OO taagtatggit to caagagaa tattitt catc ctaaacctaa agtgaatago toactitatica 26 O gattaagtag aaaaaaatca agaatat cac acaaagataa acaaaagtat aattattitcg 32O titatgaaatg ggittaacaaa gaatacaaga aaatatttac aaaaaat caa tittaacaatt 38O ccittaaaa.ca tdcaggaatt gacgatttaa acaat attag ctittgaacaa ttctitat citc 44 O ttittcaatag ctataaatta tittaataagt aagttaaggg atgcagttca togatgaagg SOO Calactacagc ticaggcgaca accatacgct gagagat cot Cactacgtag aagataaagg 560 ccacaaatac ttagtatttg aagcaaacac taactgaa gatggct acc aaggcgalaga 62O atctittattt aacaaag.cat act atggcaa aag cacatca ttct tcc.gtc. aagaaagtica 68O aaaact tctg caaag.cgata aaaaacgcac ggctgagtta gcaaacggcg Ctctcggitat 74 O gattgagcta aacgatgatt acacactgaa aaaagtgatgaaaccgctga ttgcatctaa 8OO

Cacagtaiaca gatgaaattgaacgc.gcgaa cqt ctittaala atgaacggca aatgg tacct 86 O gttcactgac toccg.cggat caaaaatgac gattgacggc attacgt.cta acgatattta 92 O catgcttggit tatgtttcta attctittaac tdgcc catac aagcc.gctga acaaaactgg 98 O ccttgttgtta aaaatggat.c ttgat cotaa catgitalacc titt act tact cacactt cqc 2O4. O tgtacct caa gcgaaaggaa acaatgtcgt gattacaagc tatatgacaa acagaggatt 21OO

Ctacgcagac aaacaatcaa C9tttgcgcc aagcttgcat gcgagagtag ggaactgc.ca 216 O ggcatcaaat aaaacgaaag gct cagtc.ga aagactgggc Ctttcgttitt atctgttgtt 222 O tgtcggtgaa cqctict Cotg agtaggacaa atcc.gc.cggg agcggatttgaacgttgcga 228O agcaacggcc cqgagggtgg C9ggCaggac gcc.cgc.cata aactgcc agg catcaaatta 234 O agcagaaggc catcctgacg gatggccttt ttgcgtttct acaaact citt tttgtttatt 24 OO tittctaaata cattcaaata totaticcgct catgctic cqg atctgcatcg caggatgctg 246 O

US 8,945,859 B2 149 150 - Continued ataaaaatag gcgitat cacg aggcc ctitt C gtc.tc.gc.gcg titt cqgtgat gacggtgaaa 534 O acct Ctgaca catgcagctic ccggagacgg to acagottgtctgtaagcg gatgc.cggga 54 OO gCagacaa.gc ccgtcagggc gcgtcagogg gtgttcatgt gcgtaactala Cttgc catct 546 O tcaaac agga gggctggaag aag cagaccg cta acacagt acataaaaaa ggaga catga 552O acgatgaaca toaaaaagtt togcaaaacaa goalacagtat taacctttac taccgcactg 558 O

Ctggcaggag gcgcaactica agcgtttgcg aaagaaacga accaaaagcc atataaggaa 564 O acatacggca ttt cocatat tacacgc.cat gatatgctgc aaatc cctda acagoaaaaa st OO aatgaaaaat atcaagttcc tdaatticgat t cqtccacaa ttaaaaatat citc.ttctgca 576. O aaaggcctgg acgtttggga cagctggcca ttacaaaacg Ctgacggcac tdtcgcaaac 582O tat cacggct accacatcgt ctittgcatta gcc.ggagatc ctaaaaatgc ggatgacaca 588 O tcqatttaca tottctatica aaaagttcggc gaaactticta ttgacagct g gaaaaacgct 594 O gg.ccg.cgt.ct ttaaagacag cqacaaattic gatgcaaatg attctat colt aaaagaccala 6 OOO acacaagaat gigt caggttc agccacattt acatctgacg gaaaaatccg tittatt citac 6 O6 O actgatttct c cqgtaaa.ca ttacggcaaa caaac actga caactgcaca agittaacgta 612 O t cagcatcag acagotctitt gaa catcaac gigtgtagagg attataaatc aatctittgac 618O ggtgacggaa aaacgt atca aaatgtacag aatticgagct C 6221

<210s, SEQ ID NO 144 &211s LENGTH: 4 O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer T-bud (BamHI)

<4 OOs, SEQUENCE: 144 agatagatgg atc.cggaggt gggtcacatg gacaaac agt 4 O

<210s, SEQ ID NO 145 &211s LENGTH: 29 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer B-kivD (BamHI)

<4 OOs, SEQUENCE: 145 Ctctagagga t c cagact Co tagga catg 29

<210s, SEQ ID NO 146 &211s LENGTH: 6O39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Vector fragment pFP988Dss <4 OOs, SEQUENCE: 146 gatccaagtt taaactgtac act agatatt tottctic cqc ttaaatcatc aaagaaatct 6 O titat cacttg taaccagtico gtc. cacatgt cqaattgcat citgaccgaat tttacgttt c 12 O cctgaataat t ct cat caat cqttt catca attittat citt tatactittat attttgttgcg 18O ttaatcaaat cataatttitt atatgtttico toatgattta tot ctittatt attatag titt 24 O ttatt citctic tittgattatgtc.tttgtatic ccgtttgtat tacttgatcc tittaact citg 3OO gcaa.ccctica aaattgaatgaga catgcta cacct cogga taataaatat atataaacgt. 360 atatagattt cataaagt ct aacacactag act tatttac titcgtaatta agt cqttaaa 42O

US 8,945,859 B2 155 156 - Continued gacacatgca gct cocggag acggit cacag Cttgtctgta agcggatgcc gggagcagac 522 O aagc.ccgt.ca gggcgcgt.ca gC9ggtgttc atgtgcgitaa ctaacttgcc at Cttcaaac 528 O aggagggctg. galagaa.gcag accoctaa.ca Cagtacataa aaaaggagac atgaacgatg 534 O aacatcaaaa agtttgcaaa acaa.gcaa.ca gtattaacct ttact accqc actgctggca 54 OO ggaggcgcaa citcaag.cgtt tgcgaaagaa acgaaccaaa agc catataa ggaaacatac 546 O ggcatttic cc at attacacg c catgatatg ctgcaaatcc ctdaacagoa aaaaaatgaa 552O aaatat caag titcctgaatt cgatt cqt cc acaattaaaa at atctott C tgcaaaaggc 558 O

Ctggacgttt gggacagctg gcc attacaa aacgctgacg gCactgtc.gc aaact at CaC 564 O ggctaccaca togtotttgc attagc.cgga gatcc taaaa atgcggatga cacat cqatt st OO tacatgttct atcaaaaagt cggcgaaact tctattgaca gctggaaaaa cgctggcc.gc 576. O gtctittaaag acagcgacala att catgca aatgatticta t cotaaaaga C. Calaa Cacala 582O gaatggtcag gttcagccac atttacat Ct gacggaaaaa to cqtttatt ctacact gat 588 O ttct coggta aac attacgg Caaacaaa.ca ctgacaactg. cacaagttaa cgitat cagoa 594 O t cagacagct ctittgaac at Caacggtgta gaggattata aat caat citt tgacggtgac 6 OOO ggaaaaacgt atcaaaatgt acagaatticg agct citcga

<210s, SEQ ID NO 147 &211s LENGTH: 44 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence & 22 O FEATURE; <223> OTHER INFORMATION: Primer T-groE (XhoI) <4 OOs, SEQUENCE: 147 agatagat ct cagagct at ttaa cataa ticggtacggg ggtg 44

<210s, SEQ ID NO 148 &211s LENGTH: 51 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer B-groEL (Spel. BamH1) <4 OOs, SEQUENCE: 148 attatgtcag gatccactag titt cotcc tt taattgggaa ttgttatccg c 51

<210s, SEQ ID NO 149 &211s LENGTH: 30 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer T-groEL <4 OOs, SEQUENCE: 149 agctattgta acataatcgg tacgggggtg 3 O

<210s, SEQ ID NO 150 &211s LENGTH: 45 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer T-ilvC. s. (BamHI)

<4 OOs, SEQUENCE: 150 acattgatgg atcc cataac aagggagaga ttgaaatggit aaaag 45 US 8,945,859 B2 157 158 - Continued

<210s, SEQ ID NO 151 &211s LENGTH: 47 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer B-ilvCB. s. (SpeIBamHI) <4 OOs, SEQUENCE: 151 taga caacgg atcCactagt ttaattittgc gcaacggaga ccaccgc 47

<210s, SEQ ID NO 152 &211s LENGTH: 47 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer T-BD64. (DraIII)

<4 OOs, SEQUENCE: 152 ttaccgtgga ct caccgagt ggg talactag cct cqc.cgga aagagcg 47

<210s, SEQ ID NO 153 &211s LENGTH: 48 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer B-BD64. (Dra.II)

<4 OOs, SEQUENCE: 153 t cacagttaa gacacctggit gcc.gittaatg cgc catgaca gcc atgat 48

<210s, SEQ ID NO 154 &211s LENGTH: 49 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer T-lacIq (DraIII) <4 OOs, SEQUENCE: 154 acagatagat Caccaggtgc aagctaattic cqgtggaaac gaggt catc 49

<210s, SEQ ID NO 155 &211s LENGTH: 48 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer B-lacIq (DraIII) <4 OO > SEQUENCE: 155 acagtacgat acacggggtg tcactgc.ccg Cttt C cagtic gggaalacc 48

<210s, SEQ ID NO 156 &211s LENGTH: 49 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer T-groE (DraIII)

<4 OOs, SEQUENCE: 156 tcggattacg Caccc.cgtga gct attgtaa cataatcggit acgggggtg 49

<210s, SEQ ID NO 157 &211s LENGTH: 48 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer B-B. S. ilwC (Dra.II) US 8,945,859 B2 159 160 - Continued

<4 OO > SEQUENCE: 157 ctgctgat ct cacaccgtgt gttaattittg cqcaacggag accaccgc 48

<210s, SEQ ID NO 158 &211s LENGTH: 1221 &212s. TYPE: DNA <213> ORGANISM: Clostridium acetobutyllicum

<4 OOs, SEQUENCE: 158 cacacggtgt aaataataat Ctaalacagga ggggittaaaa tggttgattit cgaat attca 6 O ataccalacta gaattitttitt cggtaaagat aagataaatg tacttggaag agagcttaaa 12 O aaatatggitt ctaaagtgct tatagittitat ggtggaggaa gtataaagag aaatggaata 18O tatgataaag citgitaagtat actitgaaaaa aac agtatta aattittatga acttgcagga 24 O gtagagccaa atccaa.gagt aactacagtt gaaaaaggag ttaaaatatg tagagaaaat 3OO ggagttgaag tag tactago tat aggtgga ggaagtgcaa. tagattgcgc aaaggittata 360 gcagcagcat gtgaatatga tggaaatc.ca tgggatattg tgttagatgg Ctcaaaaata aaaagggtgc titcctatagc tagtatatta accattgctg caa.caggat C agaaatggat acgtgggcag taataaataa tatggataca aacgaaaaac taattgcggc a catccagat 54 O atggct cota agttitt citat attagatcca acgtatacgt. at accot acc taccalat Caa acagcagcag galacagctga tattatgagt catatatttg aggtgtattt tag taataca 660 aaaa.ca.gcat atttgcagga tagaatggca gaagcgittat taagaacttg tattaalatat 72 O ggaggaatag Ctcttgagaa gcc.ggatgat tatgaggcaa. gagccaatct aatgtgggct t caagt ctitg cgataaatgg acttittaa.ca tatggtaaag acactaattg gagtgtacac 84 O ttaatggaac atgaattaag tgctt attac gacataacac acggcgtagg gcttgcaatt 9 OO ttaa.caccita attggatgga gtatattitta aataatgata Cagtgtacaa gtttgttgaa 96.O tatggtgtaa atgtttgggg aatagacaaa gaaaaaaatc actatgacat agcacat caa gcaatacaaa aaacaa.gaga ttactttgta aatgtactag gtttaccatc tag actgaga 108 O gatgttggaa ttgaagaaga aaaattggac ataatggcaa. aggaatcagt aaagcttaca 114 O ggaggalacca taggaalacct alagaccagta aacgcct cog aagtic ctaca aatattoaaa. 12 OO aaatctgtgt aac accqagt 9 1221

<210s, SEQ ID NO 159 &211s LENGTH: 54 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer T-bch (Dra.II)

<4 OOs, SEQUENCE: 159 tcgatagcat acacacggtg gttaacaaag gaggggittaa aatggttgat titcg 54

<210s, SEQ ID NO 160 &211s LENGTH: 91 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer B-boh (rrnBT1Dra)

<4 OOs, SEQUENCE: 160 atctacgcac toggtgataa aacgaaaggc ccagt ctitt c gactgagcct titcgtttitat 6 O US 8,945,859 B2 161 162 - Continued cittacacaga titttittgaat atttgtagga c 91

<210s, SEQ ID NO 161 &211s LENGTH: 29 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer LDH EcoRV F

<4 OOs, SEQUENCE: 161 gacgt.catga ccaccc.gc.cg atc ccttitt 29

<210s, SEQ ID NO 162 &211s LENGTH: &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer LDH AatR

<4 OOs, SEQUENCE: 162 gatat coaac accagogacc gacgt attac 3 O

<210s, SEQ ID NO 163 &211s LENGTH: 47 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer Cm F

<4 OOs, SEQUENCE: 163 atttaaatct Cagtagagg at C C Caacaa acgaaaattg gataaag 47

<210s, SEQ ID NO 164 &211s LENGTH: 29 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer Cm R

<4 OOs, SEQUENCE: 164 acgcgittatt ataaaag.cca gttcattagg 29

<210s, SEQ ID NO 165 &211s LENGTH: 58 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer P11 F-Stu

<4 OOs, SEQUENCE: 1.65 cctagogcta tagttgttga cagaatggac atact atgat at attgttgc tatagcga 58

<210s, SEQ ID NO 166 &211s LENGTH: 62 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer P11 R-Spel

<4 OOs, SEQUENCE: 166 c tagt cqcta tagcaacaat at at catagt atgtc. cattctgtcaacaac tatagcgcta 6 O

99 62

<210s, SEQ ID NO 167 &211s LENGTH: 38 US 8,945,859 B2 163 164 - Continued

&212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer PlchL F-HindIII

<4 OOs, SEQUENCE: 167 aagcttgtcg acaaac Caac attatgacgt gtctgggc 38

<210s, SEQ ID NO 168 &211s LENGTH: 28 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer PldhL R-BamHI

<4 OOs, SEQUENCE: 168 ggat.cct cat cotct cqtag togaaaatt 28

<210s, SEQ ID NO 169 &211s LENGTH: 36 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer F-ch3-Avr

<4 OOs, SEQUENCE: 169 titcc taggaa ggaggtggitt aaaatggttg attitcg 36

<210s, SEQ ID NO 170 &211s LENGTH: 29 & 212 TYPE DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer R-bdhB-BamHI

<4 OOs, SEQUENCE: 170 ttggat.cctt acacagattt tttgaatat 29

<210s, SEQ ID NO 171 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer F-ilvC (B.S.) -AflII

<4 OOs, SEQUENCE: 171 aact taagaa ggaggtgatt gaaatggtaa aagtatatt 39

<210s, SEQ ID NO 172 &211s LENGTH: 32 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer R-ilvC (B.S.) -NotI

<4 OOs, SEQUENCE: 172 aagcggcc.gc titaattittgc gcaacggaga cc 32

<210s, SEQ ID NO 173 &211s LENGTH: 30 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer F-Pnis.A (HindIII)

<4 OOs, SEQUENCE: 173 US 8,945,859 B2 165 166 - Continued ttaa.gcttga catacttgaa tdaccitagt c 3 O

<210s, SEQ ID NO 174 &211s LENGTH: 39 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Primer R-Pnis.A (Spel. BamHI) <4 OOs, SEQUENCE: 174 ttggat.ccaa act agtataa tittattttgt agttc ctitc 39

<210s, SEQ ID NO 175 &211s LENGTH: 38 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer N191

<4 OO > SEQUENCE: 175 atcc.gcggat agatct Coca ttaccgacat ttgggcgc 38

<210s, SEQ ID NO 176 &211s LENGTH: 31 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223s OTHER INFORMATION: Primer N192

<4 OOs, SEQUENCE: 176 at CCtcagcg atgattgatt gattgattgt a 31

<210s, SEQ ID NO 177 &211s LENGTH: 6509 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Vector pFP988 <4 OO > SEQUENCE: 177 tcgaggcc cc gCacatacga aaagactggc tigaaaacatt gag cctttga tigactgatga 6 O tittggctgaa gaagtggat.c gattgtttga gaaaagaaga agaccataala aataccttgt 12 O Ctgtcatcag acaggg tatt ttt tatgctg. tccagactgt cc.gctgttgta aaaaatagga 18O ataaaggggg gttgtt atta ttt tactgat atgtaaaata taatttgtat aaggaattgt 24 O gaggggataa caattic ctac gaaaatgaga gggagaggaa acatgattica aaaacgaaag 3OO cgga cagttt cqttcagact tdtgct tatgtgcacgctgt tatttgtcag tittgc.cgatt 360 acaaaaacat cagc.cggat.c ccaccatcac cat caccatt aagaatticct agaaact coa 42O agctat ctitt aaaaaatcta gtaaatgcac gagcaa.catc titttgttgct cagtgcattt 48O tittattttgt acactagata titt Cttct co gottaaatca toaaagaaat ctittat cact 54 O tgitalaccagt ccgt.ccacat gttctgaattgc atctgaccga attittacgtt tocctgaata 6OO attct catca atcgttt cat caattittatc tittatactitt at attttgttg cqttaat caa 660 at cataattt ttatatgttt cot catgatt tatgtctitta ttattatagt ttittatt ct c 72 O t ctittgatta tdt citttgta t ccc.gtttgt attacttgat cctittaactic tdgcaac cct 78O caaaattgaa tdagacatgc tacacctic cq gataataaat atatataaac gtatatagat 84 O tt cataaagt ctaacacact agacittattt actitcgtaat taagt cqtta aaccotgtgc 9 OO tctacgacca aaactataaa acctittaaga actitt cittitt tttacaagaa aaaagaaatt 96.O

US 8,945,859 B2 171 172 - Continued

Cagggcgcgt. Cagcgggtgt t catgtgcgt. aactaacttg cCatcttcaa acaggagggc 576. O tggaagaa.gc agaccgctaa cacagtacat aaaaaaggag acatgaacga tigaac at cala 582O aaagtttgca aaacaa.gcaa. cagtattaac citt tact acc gCactgctgg Caggagg.cgc 588 O aact caag.cg tttgcgaaag aaacgaacca aaag.c catat aaggaaa.cat acggcattt C 594 O c cat attaca cqc catgata tgctgcaaat CCCtgaacag caaaaaaatgaaaaatat ca 6 OOO agttcc tigaa titcgatt.cgt. CCaCaattaa. aaatatotot tctgcaaaag gcc tigacgt. ttggga cagc tiggcc attac aaaacgctga cgg cactgtc. gcaaactatic acggctacca 612 O catcgt.ctitt gcattagcc.g gagat CCtaa aaatgcggat gacacat cqa tttacatgtt 618O citat caaaaa gtcggcgaaa cittctattga Cagctggaaa aacgctggcc gcgtc.tttala 624 O agacagcgac aaattic gatg caaatgattic tat CCtaaaa. gaccaaacac aagaatggtc 63 OO aggttcagcc acatttacat Ctgacggaaa aatcc.gttta ttctacactg atttctic cqg 636 O taaacattac ggcaaacaaa cactgacaac tgcacaagtt aacgitat cag cat caga cag 642O citctittgaac atcaacggtg tagaggatta taaat Caatc. tittgacggtg acggaaaaac 648 O gtat caaaat gtacagcatg ccacgcgt.c 6509

<210s, SEQ ID NO 178 &211s LENGTH: 571 212. TYPE: PRT &213s ORGANISM: Bacillus subtilis

<4 OOs, SEQUENCE: 178

Met Lieu. Thir Lys Ala Thr Lys Glu Gln Lys Ser Lell Wall Lys Asn Arg 1. 5 1O 15

Gly Ala Glu Lieu Val Val Asp Cys Lieu Wall Glu Glin Gly Wall. Thir His 25 3O

Wall Phe Gly Ile Pro Gly Ala Lys Ile Asp Ala Wall Phe Asp Ala Lieu 35 4 O 45

Glin Asp Lys Gly Pro Glu Ile Ile Val Ala Arg His Glu Glin Asn Ala SO 55 6 O

Ala Phe Met Ala Glin Ala Val Gly Arg Lieu. Thr Gly Pro Gly Val 65 70 7s 8O

Wall Luell Val Thr Ser Gly Pro Gly Ala Ser Asn Lell Ala Thr Gly Lieu. 85 90 95

Lell Thir Ala Asn Thr Glu Gly Asp Pro Wal Wall Ala Lell Ala Gly Asn 105 11 O

Wall Ile Arg Ala Asp Arg Lieu Lys Arg Thr His Glin Ser Lieu. Asp Asn 115 12 O 125

Ala Ala Lieu. Phe Glin Pro Ile Thr Lys Tyr Ser Wall Glu Val Glin Asp 13 O 135 14 O

Wall ASn Ile Pro Glu Ala Wall Thir Asn Ala Phe Arg Ile Ala Ser 145 150 155 160

Ala Gly Glin Ala Gly Ala Ala Phe Wall Ser Phe Pro Glin Asp Val Val 1.65 17O 17s

Asn Glu Val Thr Asn Thr Lys Asn Val Arg Ala Wall Ala Ala Pro Llys 18O 185 19 O

Lell Gly Pro Ala Ala Asp Asp Ala Ile Ser Ala Ala Ile Ala Lys Ile 195 2O5

Glin Thir Ala Lys Lieu Pro Val Val Lieu Val Gly Met Gly Gly Arg 21 O 215 22O US 8,945,859 B2 173 174 - Continued

Pro Glu Ala Ile Ala Wall Arg Llys Luell Luell Lys Lys Wall Glin Luell 225 23 O 235 24 O

Pro Phe Wall Glu Thir Glin Ala Ala Gly Thir Lell Ser Arg Asp Luell 245 250 255

Glu Asp Glin Tyr Phe Gly Arg Ile Gly Luell Phe Arg Asn Glin Pro Gly 26 O 265 27 O

Asp Luell Luell Luell Glu Glin Ala Asp Wall Wall Luell Thir Ile Gly Tyr Asp 28O 285

Pro Ile Glu Tyr Asp Pro Lys Phe Trp Asn Ile Asn Gly Asp Arg Thir 29 O 295 3 OO

Ile Ile His Luell Asp Glu Ile Ile Ala Asp Ile Asp His Ala Glin 3. OS 310 315

Pro Asp Luell Glu Lell Ile Gly Asp Ile Pro Ser Thir Ile Asn His Ile 3.25 330 335

Glu His Asp Ala Wall Wall Glu Phe Ala Glu Arg Glu Glin Ile 34 O 345 35. O

Lell Ser Asp Luell Glin Tyr Met His Glu Gly Glu Glin Wall Pro Ala 355 360 365

Asp Trp Ser Asp Arg Ala His Pro Luell Glu Ile Wall Glu Luell 37 O 375 38O

Arg Asn Ala Wall Asp Asp His Wall. Thir Wall Thir Asp Ile Gly Ser 385 390 395 4 OO

His Ala Ile Trp Met Ser Arg Tyr Phe Arg Ser Glu Pro Luell Thir 4 OS 415

Lieu Met Ile Ser Asn Gly Met Gn. Thir Lieu Gly Ala Luell Pro Trp 425 43 O

Ala Ile Gly Ala Ser Lell Wall Llys Pro Gly Glu Wall Wall Ser Wall 435 44 O 445

Ser Gly Asp Gly Gly Phe Lell Phe Ser Ala Met Glu Lell Glu Thir Ala 450 45.5 460

Wall Arg Luell Ala Pro Ile Wall His Ile Wall Trp Asn Asp Ser Thir 465 470 47s

Asp Met Wall Ala Phe Glin Gln Lieu. Lys Asn Arg Thir Ser 485 490 495

Ala Wall Asp Phe Gly Asn Ile Asp Ile Wall Ala Glu Ser Phe SOO 505

Gly Ala Thir Gly Lell Arg Wall Glu Ser Pro Asp Glin Lell Ala Asp Wall 515 52O 525

Lell Arg Glin Gly Met Asn Ala Glu Gly Pro Wall Ile Ile Asp Wall Pro 53 O 535 54 O

Wall Asp Ser Asp Asn Ile Asn Luell Ala Ser Asp Luell Pro Lys 5.45 550 555 560

Glu Phe Gly Glu Lell Met Thr Lys Ala Luell 565 st O

<210s, SEQ ID NO 179 &211s LENGTH: 1665 &212s. TYPE: DNA &213s ORGANISM: Lactococcus lactis

<4 OOs, SEQUENCE: 179 atgtctgaga aacaatttgg ggcgaacttg gttgtcgata gtttgattaa C cataaagtg aagtatgt at ttgggattico aggagcaaaa attgaccggg tttittgattt attagaaaat 12 O gaagaaggcc Ctcaaatggit cqtgacticgt catgagcaag gagctgctitt catggct Caa 18O

US 8,945,859 B2 177 178 - Continued

Ala His Glin Ser Met Asp Asn Ala Gly Met Met Glin Ser Ala Thir 115 12 O 125

Ser Ala Glu Wall Lell Asp Pro Asn Thir Luell Ser Glu Ser Ile Ala 13 O 135 14 O

Asn Ala Arg Ile Ala Ser Gly His Pro Gly Ala Thir Phe Luell 145 150 155 160

Ser Ile Pro Glin Asp Wall Thir Asp Ala Glu Wall Ser Ile Ala Ile 1.65 17O 17s

Glin Pro Luell Ser Asp Pro Met Gly Asn Ala Ser Ile Asp Asp Ile 18O 185 19 O

Asn Luell Ala Glin Ala Ile Lys Asn Ala Wall Lell Pro Wall Ile Luell 195

Wall Gly Ala Gly Ala Ser Asp Ala Wall Ala Ser Ser Luell Arg Asn 21 O 215 22O

Lell Luell Thir His Wall Asn Ile Pro Wall Wall Glu Thir Phe Glin Gly Ala 225 23 O 235 24 O

Gly Wall Ile Ser His Asp Lell Glu His Thir Phe Gly Arg Ile Gly 245 250 255

Lell Phe Arg Asn Glin Pro Gly Asp Met Luell Luell Arg Ser Asp Luell 26 O 265 27 O

Wall Ile Ala Wall Gly Asp Pro Ile Glu Glu Ala Arg Asn Trp 28O 285

Asn Ala Glu Ile Asp Ser Arg Ile Ile Wall Ile Asp Asn Ala Ile Ala 29 O 295 3 OO

Glu Ile Asp Thir Tyr Tyr Glin Pro Glu Arg Glu Lell Ile Gly Asp Ile 3. OS 310 315

Ala Ala Thir Luell Asp Asn Lell Luell Pro Wall Arg Gly Lys Ile 3.25 335

Pro Gly Thir Lys Asp Luell Asp Luell His Glu Wall Ala Glu 34 O 345 35. O

Glin His Glu Phe Asp Thir Glu Asn Thir Glu Gly Arg Met His Pro 355 360 365

Lell Asp Luell Wall Ser Thir Phe Glin Glu Wall Lys Asp Asp Glu Thir 37 O 375

Wall Thir Wall Asp Wall Gly Ser Luell Trp Met Ala Arg His Phe 385 390 395 4 OO

Ser Glu Pro Arg His Luell Luell Ser Asn Gly Met Glin Thir 4 OS 415

Lell Gly Wall Ala Lell Pro Trp Ala Ile Thir Ala Ala Lell Luell Arg Pro 425 43 O

Gly Lys Wall Tyr Ser His Ser Gly Asp Gly Gly Phe Luell Phe Thir 435 44 O 445

Gly Glin Glu Luell Glu Thir Ala Wall Arg Luell ASn Lell Pro Ile Wall Glin 450 45.5 460

Ile Ile Trp Asn Asp Gly His Asp Met Wall Phe Glin Glu Glu 465 470 47s

Met Gly Arg Ser Ala Ala Wall Asp Phe Wall Asp 485 490 495

Wall Ala Glu Ala Met Arg Ala Gly Arg Ala His Ser SOO 505

Glu Glu Luell Ala Glu Ile Luell Ser Ile Pro Asp Thir Thir Gly 515 52O 525 US 8,945,859 B2 179 180 - Continued Pro Val Val Ile Asp Val Pro Lieu. Asp Tyr Ser Asp Asn. Ile Llys Lieu. 53 O 535 54 O Ala Glu Lys Lieu Lleu Pro Glu Glu Phe Tyr 5.45 550

<210s, SEQ ID NO 181 &211s LENGTH: 395 212. TYPE: PRT <213> ORGANISM: Saccharomyces cerevisiae

<4 OOs, SEQUENCE: 181 Met Lieu. Arg Thr Glin Ala Ala Arg Lieu. Ile Cys Asn. Ser Arg Val Ile 1. 5 1O 15 Thir Ala Lys Arg Thr Phe Ala Lieu Ala Thr Arg Ala Ala Ala Tyr Ser 2O 25 3O Arg Pro Ala Ala Arg Phe Val Llys Pro Met Ile Thir Thr Arg Gly Lieu 35 4 O 45 Lys Glin Ile Asin Phe Gly Gly Thr Val Glu Thr Val Tyr Glu Arg Ala SO 55 6 O Asp Trp Pro Arg Glu Lys Lieu. Lieu. Asp Tyr Phe Lys Asn Asp Thir Phe 65 70 7s 8O Ala Lieu. Ile Gly Tyr Gly Ser Glin Gly Tyr Gly Glin Gly Lieu. Asn Lieu 85 90 95 Arg Asp Asin Gly Lieu. Asn Val Ile Ile Gly Val Arg Lys Asp Gly Ala 1OO 105 11 O Ser Trp Lys Ala Ala Ile Glu Asp Gly Trp Val Pro Gly Lys Asn Lieu. 115 120 125 Phe Thr Val Glu Asp Ala Ile Lys Arg Gly Ser Tyr Val Met Asn Lieu. 13 O 135 14 O Lieu. Ser Asp Ala Ala Glin Ser Glu Thir Trp Pro Ala Ile Llys Pro Lieu. 145 150 155 160 Lieu. Thir Lys Gly Lys Thr Lieu. Tyr Phe Ser His Gly Phe Ser Pro Val 1.65 17O 17s Phe Lys Asp Lieu. Thir His Val Glu Pro Pro Lys Asp Lieu. Asp Val Ile 18O 185 19 O Lieu Val Ala Pro Llys Gly Ser Gly Arg Thr Val Arg Ser Lieu. Phe Lys 195 2OO 2O5 Glu Gly Arg Gly Ile Asn. Ser Ser Tyr Ala Val Trp Asn Asp Val Thr 21 O 215 22O Gly Lys Ala His Glu Lys Ala Glin Ala Lieu Ala Val Ala Ile Gly Ser 225 23 O 235 24 O Gly Tyr Val Tyr Glin Thr Thr Phe Glu Arg Glu Val Asn Ser Asp Leu 245 250 255 Tyr Gly Glu Arg Gly Cys Lieu Met Gly Gly Ile His Gly Met Phe Leu 26 O 265 27 O Ala Glin Tyr Asp Val Lieu. Arg Glu Asn Gly His Ser Pro Ser Glu Ala 27s 28O 285

Phe Asin Glu Thr Val Glu Glu Ala Thr Glin Ser Lieu. Tyr Pro Leu. Ile 29 O 295 3 OO

Gly Lys Tyr Gly Met Asp Tyr Met Tyr Asp Ala Cys Ser Thr Thr Ala 3. OS 310 315 32O

Arg Arg Gly Ala Lieu. Asp Trp Tyr Pro Ile Phe Lys Asn Ala Lieu Lys 3.25 330 335

Pro Val Phe Glin Asp Leu Tyr Glu Ser Thr Lys Asn Gly Thr Glu Thr 34 O 345 35. O