INTERFERENCE BETWEEN GERBERIN/PARASORBOSIDE AND CAROTENOID BIOSYNTHESIS
Cuong Xuan Nguyen Master’s thesis University of Helsinki Department of Applied Biology Plant Production Science / Plant Breeding May 2012
HELSINGIN YLIOPISTO HELSINGFORS UNIVERSITET UNIVERSITY OF HELSINKI
Tiedekunta/Osasto Fakultet/Sektion Faculty Laitos Institution Department Faculty of Agriculture and Forestry Department of Agricultural Sciences
Tekijä Författare Autho
rCuong Xuan Nguyen
Työn nimi Arbetets titel Title Interference between gerberin/parasorboside and carotenoid biosynthesis
Oppiaine Läroämne Subject Plant Breeding
Työn laji Arbetets art Level Aika Datum Month and year Sivumäärä Sidoantal Number of pages Master’s Thesis May 2012 59 pages
Tiivistelmä Referat Abstract Phytoene desaturase (PDS) plays a key role in the carotenoid biosynthesis in plants. Knocked-down the expression of PDS gene by virus induced gene silencing (VIGS) shows the photobleached phenotype in infected plants so that it has been used as a marker or a long time in VIGS systems with range of plant species. Tobacco rattle virus (TRV) based VIGS system, which uses PDS as the visual marker has been successfully applied and showed the white phenotype in Gerbera hybrida. However, 2-pyrone synthase (PS) gene, which encodes the first enzyme in gerebrin/parasorboside biosynthesis, is significantly reduced in these infected VIGS albino sectors. The transcription level of 2PS gene was also strongly suppressed in leaves treated with photobleaching herbicide, Norflurazon (NF), which inhibits the activity of PDS. Thus, down-regulation of 2PS gene in photobleaching sectors is caused by silencing PDS gene rather than by reacting of gerbera to TRV in VIGS treatment. Interestingly, expression of 2PS in transgenic tobacco (Nicotina tabacum SR1) causes photooxidative bleaching of the leaves. The reduction of ȕ-carotene in white leaves which analyzed by thin layer chromatograph (TLC) is the main reason; however, the interference between gerberin/parasorboside and carotenoid biosynthesis in these transgenic plants is still unclear. To overcome the effect of overexpression 2PS gene, exogenous mevalonic acid lactone (MAL) could be applied to partially rescue this transgenic phenotype at the seedling stages.
Avainsanat Nyckelord Keywords VIGS, 2 pyrone synthase, phytoene desaturase, gerbera, norflurazon
Säilytyspaikka Förvaringsställe Where deposited Department of Agricultural Sciences and Viikki Campus Library
Muita tietoja Övriga uppgifter Further information Supervisor: Professor Teemu Teeri
Table of Contents ABBREVIATIONS ...... 7
1 INTRODUCTION ...... 8
1.1 Terpenoids/Isoprenoids ...... 8
1.1.1 Biosynthesis of plant isoprenoids ...... 9
1.1.2 Plant carotenoids ...... 12
1.2 Phenolic compounds ...... 15
1.2.1 Plant polyketide biosynthesis ...... 16
1.2.2 Gerbera 2-pyrone synthase ...... 16
1.3 Virus induced gene silencing (VIGS), an efficient reverse genetic tool ...... 18
1.3.1 Molecular mechanism of VIGS...... 18
1.3.2 Tobacco rattle virus (TRV), a successful VIGS vector...... 19
2 OBJECTIVES ...... 21
3 MATERIALS AND METHODS...... 22
3.1 Plant materials ...... 22
3.2 Chemical treatments ...... 23
3.3 VIGS treatment ...... 23
3.4 RNA extraction and cDNA synthesis ...... 24
3.5 Quantitative real-time PCR...... 26
3.6 Carotenoid extraction and thin layer chromatography ...... 27
4 RESULTS ...... 28
4.1 Photobleached phenotypes were observed in VIGS and NF treatment ...... 28
4.2 PDS-VIGS and Norflurazon-treated plants had reduced ȕ-carotene and accumulated phytoene ...... 30
4.3 The accumulation of phytoene on VIGS treated plants, but not on NF treated plants, was caused by reduced expression levels of PDS ...... 30
4.4 Down regulation of G2PS in white sectors of VIGS and NF treated gerbera plants ...... 31
4.5 Detection of TRV in VIGS-treated gerbera ...... 33
4.6 Over-expression G2PS gene in tobacco caused a phototbleached phenotype, and reduction of ȕ-carotene, but not accumulation of phytoene ...... 34
4.7 TAL inhibited germination and growth of tobacco seedlings invitro ...... 36
4.8 Exogenous MAL rescued the tobacco over-expressing 2PS invitro conditions, but BR not...... 36
5 DISCUSSION ...... 40
6 CONCLUSIONS ...... 45
7 ACKNOWLEDGEMENTS...... 46
8 REFERENCES ...... 47
9 APPENDICES ...... 57
Appendix 1: Growth media used for rooting of Gerbera hybrida and sowing of tobacco...... 57
Appendix 2: Chemicals used for rescue and toxic treatment ...... 57
Appendix 3 Agarose gel for checking the quality of RNA ...... 58
Appendix 4: Details and sequence of primers used for qPCR assays ...... 59
ABBREVIATIONS
2PS 2-pyrone synthase BR epibrassinolide CoA coenzyme A DMAPP dimethyllallyl diphosphate GAP D-glyceraldehyde-3-phosphate IPP isopentenyl diphosphate MAL mevalonic acid lactone MEP 2-C-methylerythritol 4-phosphate MES 2-(N-morpholino) ethanesulfonic acid MVA mevalonic acid NF norflurazon PDS phytoene desaturase PKS polyketide synthase
RT room temperature TAL triacetolactone TLC thin-layer chromatography TRV Tobacco rattle virus VIGS virus induced gene silencing
8
1 INTRODUCTION
While primary metabolites are essential for all living cell types, secondary metabolites were suspected as the waste products of plant cells in the 1950s (Hartmann 2007). Nowadays, these compounds are proven to play a key role in maintaining the ¿tness of plants in natural environment such as defense against herbivores, pathogens, competing with other plants for light, water, and nutrients or attracting insects or animal for pollinating or seed dispersing. Besides playing a signal for communication between plants and biotic environment, plant secondary metabolites also protect plants against UV light or other physical stresses (Wink 2010). Not only important for plants themselves, plant secondary metabolites have been being utilized by human for a long time as a source of medicines, dyes, insecticides, flavors and fragrances.
There are nearly 200,000 plant secondary metabolites (Dixon & Strack 2003) which have enormous diversity and specificity among plant species, organs, tissues, cells or compartments of cell (Yonekura-Sakakibara & Saito 2009, Wink 2010 ). In contrast to the range of functional and structural diversities, these compounds could be divided into three main groups: phenolic, terpenoids/isoprenoids, and nitrogen, or sulfur containing compounds according to their biosynthetic origins (Aharoni & Galili 2011). Glycolysis, the Krebs cycle, and the shikimate pathway are the main primary metabolic pathways that supply precursors for secondary metabolisms. The knowledge of biosynthesis and regulation of plant secondary metabolisms is, however, still poorly understood. Thus, a better understanding of the regulatory and metabolic pathways will increase the efficiency of useful plant productions in fields such as molecular farming, functional food, and plant resistance.
1.1 Terpenoids/Isoprenoids
Isoprenoids are the largest group of plant secondary metabolites, which contain more than 30,000 substrates (Broun & Somerville 2001). They play diverse of functions from fundamental physiological, and developmental processes such as photosynthesis 9
(carotenoids, chlorophylls, plastoquinone, ubiquinone), photo-oxidative protection (carotenoids), growth and development (cytokinins, sterols, brassinosteroids, gibberellins, abscisic acid) to defense and communication (plant volatile terpenoids) (Lange et al. 2000, Dudareva et al. 2006). From the human points of view, they are widely used as flavor and color enhancers, agricultural chemicals, and pharmaceuticals. Taxol and artemisinin, well-known terpenoids are high economic value in cancer and malaria treatment, respectively (Kirby & Keasling 2009). Thus, understanding the biosynthesis and regulation pathway of isoprenoids in plants is an interest of basic and applied sciences.
1.1.1 Biosynthesis of plant isoprenoids
Despite the variety of structures and functions, isoprenoid compounds are synthesized from two general C5 isoprenoid precursors: isopentenyl diphosphate (IPP) and its isomer, dimethyllallyl diphosphate (DMAPP). For a long time, it was assumed that these basic C5 precursors were exclusively synthesized by the mevalonic acid (MVA) pathway, which is the ubiquitous pathway in all organisms, based on yeast and animal researches. However, an alternative 2-C-methylerythritol 4-phosphate (MEP) pathway was discovered by Rohmer‘s group who used isotope-labeling experiments in bacteria and higher plants (Rohmer 1999, Lichtenthaler 1999). These two pathways are clearly distributed in different plant cell compartments, where the MEP pathway locates in the plastid, and the MVA pathway mainly locates in the endoplasmic reticulum (ER), cytosol, and mitochondria (Vranova et al. 2011). Because of the distinct subcellular localization, the end-products of these pathways are also different (Figure 1).
IPP and DMAPP of the MVA pathway in plants are biosynthesized in cytosol through several steps. Three molecules of acetyl-CoA, the precursor of MVA pathway, are first condensed by reaction of acetoacetyl (AcAc)-CoA thiolase (AACT), and 3-hydroxy-3- methylglutaryl coenzyme A synthase (HMGS), respectively to synthesize hydroxyl- methylglutaryl (HMG)-CoA. 3-hydroxy-3-methylglutaryl CoA reductase (HMGR), the activity of which has been shown to play a key role in regulating the metabolic Àux in this pathway (Manzano et al. 2004, Suzuki et al. 2004, Suzuki et al. 2009), catalyzes the 10 reductive conversion of HMG-CoA to MVA. Two sequential ATP-dependent phosphorylation and decarboxylation steps which are catalyzed by mevalonate kinase (MK), phosphormevalonate kinase (PMK) and mevalonate diphosphate decarboxylase (MVD) will convert MVA into IPP. DMAPP is formed from IPP, by the action of IPP isomerase (Figure 2). IPP and DMAPP from MVA pathway are mainly precursors for the downstream cytosolic isoprenoid pathways to as sterols, brassinosteroids, sesquiterpenes, cytokinin, and polyprenols (Figure 1).
Figure 1. Isoprenoids biosynthesis pathways and their subcellular organization in plant. Taken from Vranova et al. 2011 11
In contrast with MVA pathway, MEP pathway is catalyzed in the plastids of the plant cell, and their precursors are also different. Pyruvate and D-glyceraldehyde-3-phosphate (GAP) are condensed by 1-deoxy-D-xylulose 5-phosphate synthase (DXS) to synthesize the first product 1-deoxy-D-xylulose 5-phosphate (DXP) of this pathway. In the second step of this pathway, DXP is converted into 2-C-methyl-D-erythritol 4-phosphate (MEP) through the reaction of 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR). MEP is then converted via 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol (CDP-ME) and CDP-ME 2-phosphate (CDP-MEP) into 2-C-methyl-D-erythritol 2,4- cyclodiphosphate (ME-CPP) by the enzymes MEP cytidylyl transferase (MCT), CDPME kinase (CMK) and ME-CPPsynthase (MDS), respectively. In the last two steps in the pathway, the enzyme 4-hydroxy-3-methylbut-2enyl diphosphate (HMBPP) synthase (HDS) transforms ME-CPP into HMBPP, while HMBPP reductase (HDR) converts HMBPP into IPP and DMAP (Figure 2). Gibberellins, monoterpenes, isoprenes, carotenoids, and the side chain of chlorophylls: tocopherols, phylloquinones, and plastoquinone are down-stream products of this plastidial isopernoid pathway (Figure 1).
Although differed in distribution, some evidences have shown the crosstalk between these two pathways by feeding plants with stable isotope precursors (Lichtenthaler 1999, Rohmer 1999, Kasahara et al. 2002, Hemmerlin et al. 2003, Dudareva et al. 2005) or rescuing the dxs null mutant Arabidopsis with mevalonic acid lactone (MAL) (Nagata et al. 2002). The mechanism for regulating this exchange remains unknown although Bick & Lange (2003) and Flügge & Gao (2005) had shown that IPP could be transported through plastid membranes. However, the exchange rate is quite low to rescue the production of plastidial and cytosolic isoprenoids (Flügge & Gao 2005, RodrÕguez-Concepcion 2010). 12
Figure 2. Biosynthesis of IPP and DMAPP via the cytosolic MVA and plastidial MEP pathway in plant cell. Abbreviations for enzymes and metabolites are as described in the text. Adapted from Bouvier et al. 2005.
1.1.2 Plant carotenoids
Plant carotenoids are a subgroup of isoprenoid compounds, which use C5 isoprenoid precursors derived from MEP pathway, and are mainly synthesized in plastids (Rohmer 1999, RodrÕguez-Concepcion & Boronat 2002, Joyard et al. 2009). Major plant pigments which are responsible for the yellow, orange to red pigments in different plant organs are members of this group. On chloroplast, they play a key role in membrane stabilizers, light harvesting, and photo-protection (Niyogi 2000, Cazzonelli & Pogson 2010). They also provide precursors for biosynthesis of plant hormones such as abscisic 13 acid (ABA) and strigolactones (Cazzonelli & Pogson 2010) which regulate plant growth and development. Carotenoids are important components in human diet and health as well because we cannot synthesize them ourselves. Carotenoids have a broad range of functions; especially to prevent diseases such as vitamin A de¿ciency, cardiovascular disease or cancer (Fraser & Bramley 2004).
The vast majority of plant carotenoids derive from the C40 backbone, phytoene (Britton
1995). This colorless C40 skeleton then is modified by desaturases, isomerases, cyclases, hydroxylases, ketolases and other enzymes to produce a wide diversity of carotenoids with range of colors and functions (Cunningham & Gantt 1998, DellaPenna & Pogson 2006, Walter & Strack 2011). Phytoene is the product of condensation reaction of two molecules of C20 geranylgeranyl pyrophosphate (GGPP) which is catalyzed by phytoene synthase (PSY). Besides playing a precursor for carotenoids, GGPP also participates in the synthesis of many other terpenoid compounds such as gibberellin, the phytyl side chain of chlorophyll and tocopherols. The 20-carbon GGPP is formed by reaction of geranylgeranyl pyrophosphate synthase (GGPPS) with three molecules of plastidial IPP and one molecule of DMAPP.
Carbon–carbon double bonds are introduced into phytoene by desaturation reactions, which transform the colorless phytoene into the red-colored lycopene. In plants, phytoene and ȗ-carotene desaturases (PDS, ZDS) are the main enzymes which catalyze conversion of phytoene to produce phytoÀuene, ȗ-carotene, neurosporene, and lycopene through four reactions, respectively. During the desaturation, isomerization reactions are also generated by 15-cis-ȗ-carotene isomerase (Z-ISO), carotenoid isomerase (CRTISO), and light-mediate photoisomerization. These isomerization reactions produce specificity substrates for ZDS and all-trans-lycopene (Breitenbach & Sandmann 2005, Cazzonelli & Pogson 2010). 14
Gibberellins Chlorophylls Tocopherols Plastoquinones
PQ
NF, VIGS S D P
PQH2
Figure 3. Carotenoid biosynthetic pathway in higher plants and model describing the effect of PDS on plastoquinone (PQ) status in NF-treated tissues and VIGS- PDS treatment. Abbreviations for enzymes are described in text. Modified from Zhu et al. 2010 and Breitenbach et al. 2001.
15
PDS has been shown to play an important role in the carotenoid pathway and photosynthesis in plants. Plastoquinone, an electron carrier of the photosynthetic electron transport chain, is a cofactor, hydrogen acceptor, which is necessary for dehydrogenase action of PDS. The competition with plastoquinone by the bleaching herbicide norflurazon (NF) directly inhibits carotenoid biosynthesis and consequently, photosynthesis (Breitenbach et al. 2001). Cyclization of terminal units of the linear C40 backbone of all-trans lycopene is the next step and, subsequently, a large number of modi¿cations are generated to produce a wide spectrum of structural diversities of plant carotenoids. These processes have been clearly reviewed by Walter & Strack (2011).
1.2 Phenolic compounds
Phenolic compounds are synthesized in large amount in plants. It is estimated that 2 percent of photosynthesized carbon atoms are converted into phenolic compounds (Robard & Antolovich 1997). Several thousands of their structures have been characterized, and these numbers are increasing (Boudet 2007). As sessile organisms, plants need phenolic compounds for resistance to pathogens, attracting pollinators and dispersing seeds through a wide range of pigmentations. More importantly, phenolic compounds are the basic elements support of structures of land plants, which are uncommon in bacteria, fungi or algae (Boudet 2007).
Based on their structures, phenolic compounds could be divided into two groups: non- flavonoids such as phenolic acids, stilbene (resveratrol), lignan, and flavonoids such as anthocyanin, flavanon, isoflavone (Daglia 2012). Though a wide range of structures, the shikimate derived phenylpropanoid pathway, and/or polyketide pathways are the main routes, which produce monomeric and polymeric phenols in plants (Lattanzio et al. 2008). Aromatic amino acid phenylalanine, the product of the shikimate pathway, is the major precursor for producing plant flavonoids through phenylpropanoid pathway. Phenylalanine ammonia lyase (PAL), cinnamate 4 hydroxylase (C4H), and 4-coumaroyl CoA-ligase (4CL) are the three enzymes, which catalyze the conversion of phenylalanine to p-coumaroyl-CoA. This substrate is a starter of the next polyketide synthase reaction of flavonoid and stilbene biosynthesis, or precursor for the lignin biosynthesis pathway in plants. The biosynthesis of phenylpropanoid and their 16 branching pathways have been clearly described in reviews (Ferrer et al. 2008, Chong et al. 2009).
1.2.1 Plant polyketide biosynthesis
As mention above, polyketide synthases play a key role in the biosynthesis of phenolic compounds. Chalcone synthase (CHS), a well-studied enzyme which is a member of this gene family, synthesizes the precursor to produce more than 9,000 different flavonoid structures (Ferrer et al. 2008). Besides this enzyme, a large number of plant enzymes with amino acid sequences highly similar to CHS are increasingly described (Abe & Morita 2010). They belong to plant polyketide synthases due to their catalytic activity. Plant type III polyketide synthases (PKS III) or CHS-related polyketide synthases use coenzyme A (CoA)-linked starter substrates, and then decarboxylatively condense with malonyl-CoA molecules to form a polyketide chain. The polyketide chain is immediately cyclized to form products. Cyclization reaction can be divided into three types: Claisen and aldol cyclizations which form the carbon-carbon bond at different C positions in polyketide chains, and lactonization (Figure 4A). Besides the cyclization reaction, some enzymes such as benzalacetone synthase and curcuminoid synthase do not use these reactions and do not make new aromatic rings (Flores- Sanchez & Verpoorte 2009). The end-products of plant type III polyketide synthases are varieties in their structures due to their starters, the number of condensation reactions and different types and number of cyclization (Figure 4A) (Flores-Sanchez & Verpoorte 2009).
1.2.2 Gerbera 2-pyrone synthase
Although sharing 74% similarity in amino acid sequence with CHS and belonging to plant PKSIII family, 2-pyrone synthase (2PS) in Gerbera hybrida is different from CHS. At the time of discovery, gerbera 2PS was the first plant PKS found to use acetyl- CoA as a starter while p-coumaryl CoA is the substrate for CHS and stilbene synthase (STS) (Figure 4B) (Eckermann et al. 1998). The number of PKS III enzymes which use acetyl-CoA as a starter has increasingly been reported such as aloesone synthase (ALS) 17
in Rheum palmatum ( Abe et al. 2004), PinPKS in Plumbago indica L. (Springob et al. 2007), HpPKS2 in Hypericum perforatum (Karppinen et al. 2008), PKS3 in Aloe arborescens (Mizuuchi et al. 2009).
Figure 4. The reaction of plant polyketide synthase type III (A) and gerbera 2 pyrone synthase (B). Three types of cyclization catalyzed by plant PKS III enzymes (C5-oxygen /C1 lactonization, C6/C1 Claisen condensation or C2/C7 Aldol condensation) produce different products. These figures were modified from Austin et al. 2008 (A) and Eckermann et al. 1998 (B).
2PS condenses two malony-CoA molecules to make a triketide instead of three molecules to produce tetraketides as the catalyzation of CHS and STS. This triketide chain is formed 6-methyl-4-hydroxy-2-pyrone or triacetolactone (TAL) immediately after lactonization reaction. TAL is a precursor for downstream process to form gerberin aglycones (GA) and parasorboside aglycones (PA) through one or two reduction steps, respectively (Figure 4B) (Eckermann et al. 1998). Gerberin and parasorboside, glycoside form of GA and PA, then are biosynthesized by glucosyl transferases. Until now, neither reductases nor glucosyl transferases have been confirmed, but candidate genes for all activities have been identified (Teemu Teeri, personal communication). 2PS plays a key role in gerberin/parasorboside biosynthetic pathway, which is of importance for gerbera to resist fungal disease and insects. GA and PA are the 18 compounds induced under the infection of Botrytis cinerea, and they also inhibit the growth of this fungus (Koskela et al. 2011). Suppression of 2PS gene by antisense technique, these transgenic gerbera plants were susceptible to fungus infections and eaten by insects (Teeri et al. 2006). The amounts of gerberin, parasorboside and their derivatives were strongly reduced (Eckermann et al. 1998, Koskela et al. 2011).
1.3 Virus induced gene silencing (VIGS), an efficient reverse genetic tool
The number of sequenced plant genomes has increased rapidly, since the first plant genome Arabidopsis was completely sequenced in 2000 (http://www.phytozome.org/). They provide a great opportunity to understand the function of genes. Forward genetics is traditional approach to study gene functions. Reverse genetics is based on the genome sequence, bioinformatics and molecular techniques to study the function of genes. Stable transformation is a frequently used method to overexpress and suppress target genes in plant; however, time and labor consuming are the drawbacks of this approach. These problems could be solved by a transient method.
Knock-down or knock-out of gene expression is a crucial method for studying gene function. At least four methods have been developed and applied in this field: hairpin RNA interference (hpRNAi), artificial microRNAs (amiRNA), miRNA-induced gene silencing (MIGS) and virus-induced gene silencing (VIGS) (de Felippes et al. 2012). Each method has its own advantages as well as disadvantages. VIGS has been seen as a promising reverse genetics tool, especially for non-model plant species (Burch-Smith et al. 2004). Successful application has been demonstrated in more than 30 plant species (Becker & Lange 2010)
1.3.1 Molecular mechanism of VIGS
VIGS, a transient method, uses virus as a vector to trigger a natural defense mechanism, post-transcriptional gene silencing (PTGS), in plants (Voinnet 2001, Lu et al. 2003). Double-stranded RNA, generated by activity of virus or host RNA-dependent RNA 19 polymerase (RDR/RdRp) in RNA viruses (Soosaar et al. 2005), or complementary RNA strands in DNA viruses (Voinnet 2005), is recognized by Dicer-like proteins (DCL). DCL ribonuclease cleaves viral doubled-stranded RNA into small fragments, 21–24 base pairs in length, which are called short-interfering RNAs (siRNAs). Consequently, single strand RNA, which is protected by the methyl group on the 3ƍ-terminal nucleotide added by the methyltransferase HUA ENHANCER 1 (HEN 1) (Brodersen & Voinnet 2006), is incorporated into an Argonaute (AGO) protein to form RNA-induced silencing complex (RISC) (Ding & Voinnet 2007). This complex will cleave RNA homologous with the guide strand siRNA and lead to PTGS. Moreover, the effect of RNA-silencing reactions is amplified and spread systemically in plant by recruiting host RDR6 and other components (Brodersen & Voinnet 2006).
Kumagai et al. (1995) developed, for the first time, Tobacco mosaic virus (TMV) as a vector to knock down the endogenous PDS gene in Nicotiana benthamiana based on this mechanism. From that, VIGS has been developed by incorporating the viral genome as cDNA into the T-DNA region of Agrobacteium tumerfaciens Ti-plasmids for transient transformation. Within the viral genome, plant endogenous target genes will be knocked down by PTGS (Stratmann & Hind 2011). More than 34 RNA and DNA viral genomes (Senthil-Kumar & Mysore 2011) have been developed to generate VIGS systems, in which Tobacco rattle virus (TRV) is most widely used and successfully applied to several plant species
1.3.2 Tobacco rattle virus (TRV), a successful VIGS vector
Two positive-sense, single-stranded RNA genomes, a broad range of hosts, systemic movement, and mild symptoms (Ratcliff et al. 2001, Macfarlane 2010) are the advantages, which TRV has been chosen to develop VIGS vector system at the beginning of the 2000s (Ratcliff et al. 2001, Liu et al. 2002). In these systems, cDNA of TRV RNA1 and RNA2 are separately cloned in different Agrobacterium binary plasmids under the 35S promoter to produce pTRV1 and pTRV2, respectively. They then will be transformed into bacteria and infiltrated into plants through the mixing of two bacterial cultures. The non-structural genes in TRV RNA2 construct were replaced 20 by a multiple cloning site where the host target gene will be inserted to trigger PTGS (Figure 5) (Ratcliff et al. 2001, Liu et al. 2002).
Figure 5. TRV based VIGS vector developed by Liu et al. 2002. TRV cDNA clones were placed between duplicated 35S promoter (2×35S) and nopaline synthase terminator (NOSt) in a T-DNA vector. RdRp, RNA-dependent RNA polymerase; 16K, 16 kDa cysteine rich protein; MP, movement protein; CP, coat protein; LB and RB, left and right borders of T-DNA; Rz, self-cleaving ribozyme; MCS, multiple cloning sites.
TRV based VIGS vector, which developed by Liu et al. (2002), has been successful applied in model and crop plants such as tomato, Nicotiana benthamiana and several Solanaceous species (Burch-Smith et al. 2004, Senthil-Kumar et al. 2007), poppy (Hileman et al. 2005, Wege et al. 2007), Arabidopsis (Burch-Smith et al. 2006), Aquilegia (Gould & Kramer 2007), Thalictrum dioicum (Di Stilio et al. 2010), Jatropha curcas (Ye et al. 2009), cotton (Gao et al. 2011), strawberry (Jia et al. 2011), Cysticapnos vesicaria (Hidalgo et al. 2012). It has been shown to be a powerful tool for studying the flower development in emerging model plant systems (Di Stilio 2011) and plant metabolic pathways (Burch-Smith et al. 2004). This system, besides the advantages, there are some limitations such as interference from viral symptoms with interpretation of data, off-target silencing, and low silencing efficiency, which need to be overcome to obtain meaningful results (Senthil-Kumar & Mysore 2011).
21
2 OBJECTIVES
Previous studies on gerbera and transgenic tobacco indicated two incidences of interference between 2PS and carotenoid biosynthesis. The two phenomena may or may not be related, but the coincidence is striking.
First, when using PDS as a marker for VIGS effect in gerbera leaves, it was observed that 2PS was strongly suppressed in the white sectors. Suppression occurs also when Mg-chelatase was used as VIGS reporter. It has not been resolved if 2PS transcripts react to virus or to lack of chlorophyll.
Second, expression of 2PS in transgenic Nicotina tabacum SR1 causes photooxidative bleaching of the leaves.
Information about the interference of gerberin/parasorboside pathway with the carotenoid pathway is important from several points of view. It is an attractive idea to express the gerberin/parasorboside pathway in other crop plants than gerbera for pest control. Further, understanding why PDS (or Mg-chelatase) as a marker in VIGS causes down-regulation of 2PS expression may lead us to find a better way for studying the secondary metabolic pathway gerbera. Thus, this study was conducted to figure out the answers to these questions:
1. Is down regulation of 2PS under VIGS induced photobleaching and effect of VIGS, or by photobleaching itself? 2. Can 35S-2PS expressing transgenic tobacco lines be rescued with mevalonic acid or brassinosteroid? Is TAL toxic to tobacco? 3. Are 35S-2PS expressing transgenic tobacco lines accumulating phytoene?
22
3 MATERIALS AND METHODS
3.1 Plant materials
Gerbera (Gerbera hybrida var. ‘Terra Regina’), Nicotiana bethamiana, tobacco (Nicotiana tabacum SR1) T1 progeny seeds carrying 35S-2PS constructs, which segregate for white and green seedlings, and wild type tobacco were used in this study.
Three weeks after on in-vitro rooting medium (Appendix 1), gerbera plantlets were planted on soil pots (mixing of peat and sand with ratio 5:1). The pots were covered by a transparent lid, which was lifted after a week to ensure optimal acclimatization of the developing plantlet to growth room conditions (16-h photoperiod at 20 – 220C). These plantlets were used for VIGS and norflurazon (NF) treatment.
Six weeks old wild type tobacco plants, sowed on soil pots in growth room, were used for NF treatment. Four-week-aged N. benthamiana plants were used for VIGS and NF treatment.
35S-2PS transgenic lines #36 and #37 and wild-type tobacco seeds were surface sterilized and sown on half-strength MS medium (Appendix 1), which was supplemented with NF, mevalolactone (MAL), 6-methyl-4-hydroxy-2-pyrone (TAL) or epibrassinolide (BR) at different concentrations to test the effect of these chemicals on the germination and growth of tobacco seedlings. For surface sterilization, tobacco seeds were placed in eppendorf tube, immersed in 70% ethanol for 20 seconds and then in Na-hypochloride (commercial bleach, diluted 1:2) for seven minutes. Seeds were thoroughly washed five times with sterilized MiliQ water, and dried out on sterile filter paper.Ten to fifteen sterile seeds then were spread on testing medium invitro and kept at 1,800lux light intensity under the 16-h photoperiod at 250C.
23
A month after sowing on half-strength MS medium, segregated transgenic tobacco seedlings were planted into soil pots and grown in growth room. These materials were used for quantitative real time PCR and TLC analysis to test the transcription level of 2PS, and PDS, and phytoene, and carotene content in transgenic and non-transgenic tobacco.
As there was no carotene and phytoene standard from commercial source, carrot and bell pepper were used as a standard for carotene. Phytoene, produced by plants grown in the presence of desaturation inhibitors such as NF, was used as a standard (Britton et al. 2004).
3.2 Chemical treatments
Different concentration of NF (0, 5 µM), MAL (0, 1, 3, 10 µM), TAL (0, 0.1, 0.5, 1, 5, 10mM) and BR (0, 10 nM, 100 nM, 1µM) were applied in cooled (60 to 650C) autoclaved medium for invitro testing. The same amounts of solvents were applied as controls. The solvents, stock concentration, and storage condition of these chemicals are described at Appendix 2.
Two upper leaves of gerbera, tobacco, and N. benthamiana were sprayed once per day for seven days with 20 µM NF or MiliQ water as a control. White sectors of nine days after NF-treated plants were collected, frozen in liquid nitrogen and stored at –800C until use.
3.3 VIGS treatment
Agrobacterium tumerfaciens strain C58(pGV2260) and C58(pGV3101) carrying different plasmids were generated: pTRV1, pTRV2, pTRV2::GPDS and pTRV2::StPDS. A 437 bp fragment of gerbera PDS, and 400 bp of potato PDS which contains highly similar with N. benthamiana PDS were cloned into multiple cloning 24 sites of pTRV2 (Liu et al. 2002) to produce pTRV2::GPDS and pTRV2::StPDS, respectively. Agrobacteium which containing these plasmid constructs were received from M.Sc Xianbao Deng.
For infiltration, the method, according to Dinesh-Kumar et al. (2003), was used. Agrobacterium containing the plasmids mentioned above were separately inoculated into 5 ml LB liquid media containing kanamycin (50 mg/l), rifampicin (25 mg/l), and carbenicillin (50 mg/l). Agrobacterium strain pGV3101 carrying pTRV2::StPDS was inoculated in the same medium without carbenicillin. These cultures were growth overnight with shaking at 280C. Next day, the cultures were used to inoculate in 50 ml
LB medium containing antibiotics as described above and supplemented with 10 mM 0 MES (pH 6.0) and 20 µM acetosyringone. The cultures were shaked at 28 C overnight. Agrobacterium cells were harvested by centrifugation at 3,000 g for 10 min. The pellets were resuspended initially in about 5 ml of infiltration media (10 mM MgCl2, 10 mM MES, and 200 µM acetosyringone), then adjusted with infiltration media to a final
OD600 of 1.0 and left at room temperature (RT) for three hours. Two lower leaves of six N. benthamiana plants and six gerbera plantlets were infiltrated with a 1:1 mixture of Agrobacterium carrying pTRV1 and pTRV2::StPDS, and pTRV1 and pTRV2::GPDS, respectively using a 1-mL syringe. Mock-infected control plants were infiltrated with infiltration medium only. TRV control plants were infiltrated with pTRV1, and pTRV2. White sectors of the infected leaves were dissected, frozen in liquid nitrogen and stored at –800C. On mock and TRV control plants, which did not show the photo-bleaching phenotype, samples were randomly collected from leaves which were the same age as infected plants.
3.4 RNA extraction and cDNA synthesis
Total RNA was extracted by TRIzol® Reagent (InvitrogenTM). Briefly, -800C stored samples were ground to fine powder under liquid nitrogen using Retsch® MM400 grinding machine. These samples were immediately incubated in 1.5 ml Trizol at RT for 5 minutes, and then centrifuged at 12,000 g at RT for 10 minutes. Supernatants were removed into new eppendorf tubes. 400 µl of chloroform was added, mixed by inverting 25 and incubated at RT for 10 minutes. These mixtures were centrifuged at 12,000 g for 15 minutes at RT. The clear supernatant was transferred into a fresh tube. Equal volumes of isopropanol were added, followed by a ten-minute incubation and centrifugation at 12,000 g for 20 minutes at 40C. Pellets were washed with 1 ml of 75% ethanol by vortex, and then centrifuged 12,000 g for 5 minutes at 40C. Pellets containing RNA were dried out and dissolved in 70 µl DEPC treated water. The quality and concentration of total RNA were determined by loading on 1% agarose gel (Appendix 3) and measuring with the spectrophotometer (GeneQuant 1300).
Subsequently, these total RNA were treated with DNase (RQ1 RNase-Free DNase, Promega) to remove the contaminated DNA. 15 µg of total RNA, adjusted with DEPC- water to reach 40 µl, was mixed with DNase mix included 5 µl RQ1-DNase Reaction Buffer and 5 µl RQ1 RNase-Free DNase, and then incubated at 370C for 30 minutes. DEPC-treated water was added to 300 µl, and equal amount of Phenol/Chloroform/ iso Amyl alcohol (25:24:1) was added. These mixtures were vortexed and centrifuged at 12,000 rpm for 10 minutes at RT. The upper phase was transferred into a fresh tube, equal volume of Chloroform/Isoamyl alcohol (24:1) was added, and followed by centrifugation as before. The upper water phase was transferred to a new tube. Total RNA was precipitated by adding 0.1 volume of 3 M sodium acetate (pH 5.2) and two volumes of 99% ethanol, incubated at -800C for at least two hours or overnight. 500 µl of 75% ethanol were added to pellets, which were collected from centrifugation at 11,000 rpm for 10 minutes at 40C. Following centrifugation at 11,000 rpm for 5 minutes at 40C, supernatant was poured off and pellets were air dried. The dried pellets containing RNA were dissolved in 50 µl DEPC-treated water. The quality and concentration of RNA were determined as described above.
For reverse transcription, 1 µg of total RNA was used for cDNA synthesis using SuperScript® III Reverse Transcriptase Kit (Invitrogen). Reverse transcription was started by mixing 1 µg of total RNA and 1 µl random hexamer primer (400 ng/µl). The volume was adjusted by adding DEPC treated water to 12.5 µl, then heated five min at 650C, immediately cool down and kept on ice. cDNA synthesis mix which included 4µl 5X first strand buffer; 1 µl DTT 0.1 M; 1 µl RNase out RNAse inhibitor, 1 µl dNTPs 10 mM, and 0.5 µl Superscript III was added to each sample. These mixtures were 26 incubated at RT for 10 min, for 1.5 hours at 500C, then 10 min at 700C. MiliQ water was added to the mixture to dilute to a final volume of 200 ȝl and stored at -200C until use.
3.5 Quantitative real-time PCR
qRT-PCR was performed on LightCycler 480 instrument and monitored with SYBR- green I dye (Roche Applied Science). The assays were carried out in a 15 ȝl volume for each RNA sample, containing 1.5 µl of each primer (5 µM), 7.5 ȝl 2X SYBR Green I Master, and 4.5 ȝl cDNA. The PCR cycle condition was set as follows: initial incubation at 950C for 5 min, followed by 45 cycles of 950C for 10 seconds, 620C for 10 s and 720C for 10 s.
The transcript levels of 2PS and PDS in NF and VIGS treatment in gerbera plant were quantified using primers G2PS and GPDS. The presences of TRV1 and TRV2 in VIGS treatment in gerbera were determined with TRV1 and TRV2 primers. NbPDS and NtPDS primers were used to quantify the transcript level of PDS in N. benthamiana and tobacco, respectively. G2PS primer was used to measure the expression level of 2PS gene on transgenic and non-transgenic tobacco. The transcript level of PDS in transgenic tobacco was quantified with NtPDS primer. For gerbera samples, the expression levels were normalized to ACTIN expression levels (G-Actin primers) while elongation factor-1 alpha gene (NbElf primer) was used for N. benthamia and tobacco. The primer sequences were shown in Appendix 4. Three technical replicates were performed for each of RNA sample and three biological replicate samples for each treatment. The PCR efficiencies were calculated for primers based on six serial dilutions (1:1; 1:2; 1:5; 1:10; 1:20; 1:50) of the cDNA sample. The relative expression level of genes was analyzed using qBASEPlus software (version 2.2, trial license, Biogazelle, Ghent, Belgium) (Hellenmans et al. 2007). Student’s t-test and one-way ANOVA (LSD test) (PASW statistic software version 18.0, Chicago, IL, USA) were used to assess statistical significance of differences in gene expression among NF and VIGS treatments, respectively. P-values less than 0.05 were considered significant difference.
27
3.6 Carotenoid extraction and thin layer chromatography
The same samples which had been used for RNA extraction were freeze-dried for 23 hours. The extraction method was done as described by Fraser et al. (2000). Briefly, 400 µl cold methanol was added to 10 mg of ground freeze-dried samples, vigorously vortex and incubated on ice for 5 min. 400 µl of Tris-HCl (50 mM, pH 7.5, containing 1 M NaCl) was then added and a further incubation on ice for 10 min. 1 ml of chloroform was added to the mixture and incubated on ice for 10 min. The lower organic phase was removed after centrifugation at 10,000 g for 5 minutes at 40C. The aqueous phase was re-extracted with 1 ml of chloroform. The chloroform extracts were pooled and dried by centrifugal evaporation. The residues were dissolved in 50 µl petroleum ether.
50 µl petroleum ether extracts were chromatographed on silica gel plates (Silica gel 60
F254, 0.2 mm, Merck, Darmstadt, Germany) with petroleum ether and acetone in a ratio 10:90 (volume/volume) as mobile phase (Giuliano et al. 1986). The phytoene and carotene were visualized under UV light (Ȝ=254, 360 nm) and normal light also compared the Rf values with Giuliano et al.1986.
28
4 RESULTS
4.1 Photobleached phenotypes were observed in VIGS and NF treatment
PDS, a key enzyme in the carotenoid biosynthesis in plants, has been being used as a marker in VIGS experiments for a long time and in a wide-range of plant species (Becker & Lange 2010). The infected leaves with PDS silencing plasmid constructs are turned white due to reduced amounts of carotenoids and a consequent destruction of chlorophyll by photo-oxidation (Kumagai et al. 1995). Gerbera plants, infiltrated with pTRV2::GPDS, showed this phenotype in younger leaves. In contrast, there was no photobleached phenotype on mock and TRV control plants. Plants infected with TRV control showed no differences with the mock plants in the growth rate and the morphology of leaves (Figure 6).
The stronger and faster photobleaching symptom was observed on infected pTRV2::StPDS N. benthamiana compared to gerbera. White leaf phenotype exhibited on infected N. benthamiana plant after one week, while some bleached sectors were clearly observed on infiltrated gerbera leaves only after four weeks (Figure 6 and 7). Unlikely gerbera, TRV-infected control N. benthamiana plants showed symptoms of virus infection (Figure 7B). This phenomenon was also observed by previous studies (Ratcliff et al. 2001, Page et al. 2004).
Figure 6. Effect of virus-induced gene silencing of GPDS on leaves of gerbera plant four weeks after agroinfiltration. No white sector was showed on mock (A) and empty vector- infected TRV control (B) while those infected with pTRV2::GPDS plant (C) exhibited photobleached phenotype.
29
Figure 7. Effect of virus-induced gene silencing of NbPDS on leaves of N. benthamiana plants 12 days after infiltration. Photobleached phenotype was exhibited on the systemically infected leaves of pTRV2::StPDS infected plant (C). TRV symptom was observed in younger leaves of the TRV control (B) while there was no symptom expression on mock plant. A similar photobleached phenotype was observed on NF-treated leaves in all plant materials. White leaves exhibited five days after spraying with 20 µM NF in tobacco, and N. benthamiana, while the symptom was clearly observed in gerbera leaves after a week. In contrast with VIGS treatment, where albino sectors were only exhibited on systemically infected leaves, completely bleached leaves were observed in the treated leaves of gerbera plantlets (Figure 8). Photobleached phenotype was also observed in tobacco seedlings, which were germinated and grown invitro with NF (Figure 9).
Figure 8. Completely white leaves were observed in treated gerbera (B) and tobacco (D) with 20 µM Norflurazon after nine days while green leaves were observed in controls (A, C). 30
Figure 9. Four weeks after grown on half-strength MS medium supplemented with 5 µM NF (left) and control (right).
4.2 PDS-VIGS and Norflurazon-treated plants had reduced ȕ-carotene and accumulated phytoene
As expected, the ȕ-carotene concentration in white tissues of plants (gerbera, tobacco and N. benthamiana) treated with NF was reduced to levels below detection on TLC, and phytoene was accumulated in these samples (Figure 10). These phenomena were also observed after VIGS treatment. The photobleached tissue of pTRV2::GPDS infiltrated gerbera showed no signal of ȕ-carotene on TLC, and the concentration of ȕ- carotene was reduced on VIGS-treated N. benthamiana (Figure 17). Phytoene was found in white sectors of infected gerbera and N. benthamiana but not in mock-infected leaves.
4.3 The accumulation of phytoene on VIGS treated plants, but not on NF treated plants, was caused by reduced expression levels of PDS
Although there were similarities in photobleached phenotypes, induced by VIGS and NF treatments, reduction of carotenoids and induction of phytoene, the transcript abundance of PDS was different in these treatments. The transcript level of PDS in white sectors of VIGS-treated plants was significantly decreased about twelve and two times lower than in mock-treated leaves of gerbera and N. benthamiana, respectively (Figure 11). In contrast with VIGS treatment, the transcription levels of the PDS gene in 31 all plant samples which were treated with 5 µM or 20 µM NF was not significantly changed in comparison to control (Figure 12).
Front
Phytoene ȕ -carotene
1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8
Figure 10. TLC analysis of carotenes and phytoene after VIGS and NF treatment. Lane 1 and 3 were extractions from white sector of VIGS, and NF treated gerbera plants
respectively, while lane 2 and 4 were mock and control plants. Lane 5 and 6 were extracts of carrot and bell pepper as carotene standards. Tobacco treated with 20 µM NF served as phytoene standard (lane 7), tobacco control extract was loaded on lane 8. Carotene was visualized under normal light (A) while phytoene was only detected under UV light (Ȝ = 254 nm) (B). The Rf value of phytoene and carotene were 0.9 and 0.87, respectively.
4.4 Down regulation of G2PS in white sectors of VIGS and NF treated gerbera plants
The expression level of G2PS in white sectors in NF and VIGS-treated gerbera dramatically decreased compared to control or mock-infiltrated plants. Transcript level of G2PS on albino leaves of NF and VIGS treatment expressed as 1%, and 1.5% of control, and mock-infiltrated plants (Figure 13). 2.50 32 1.40 S S
D D P
P 1.20 b
G
N
2.00 f f o
o
s 1.00 l s l e e v v e l 1.50 e
l
0.80 n n o i o i s s s s
e 0.60 e r 1.00 r p p
x * x e
e
0.40 e e v i v i t 0.50 t a l a
l 0.20 e * e R R 0.00 0.00 A TRV::GPDS TRV control mock B TRV::StPDS TRV control mock A Figure 11. Relative expression levels of GPDS (A) and NbPDS (B) in VIGS-treated on gerbera and N. benthamiana, determined by qRT-PCR. Error bars represent the standard errors of mean from three biological replicates. Asterisks indicate a statistically significant difference among treated and control samples values (P < 0. 05).
4.00 2.00 S S D D P P 3.50 b G
N f
f o
3.00 o 1.50 s
l s l e e v v e 2.50 l
e l
n n o
i 2.00 1.00 o s i s s s e r 1.50 e r p x p x e
e
e 1.00 0.50 e v i v t i t a
l 0.50 a l e e R 0.00 R 0.00 Norflurazol control Norflurazol Control treatment B treatment A
1.60 1.20 S S D D P P
t 1.40 t
N N 1.00
f f o o
1.20 s s l l
e e 0.80
v 1.00 v e e l l
n n
o 0.80 o 0.60 i i s s s s e e
r 0.60 r
p p 0.40 x x e e 0.40 e e v v i i 0.20 t t
a 0.20 a l l e e R 0.00 R 0.00 Norflurazol control Norflurazol control C treatment D treatment
Figure 12. Relative expression levels of PDS in 20 µM NF-treated gerbera (A), N. benthamiana (B), tobacco plantlets (C), and tobacco seedlings grown on 5 µM NF invitro medium (D) measured by qRT-PCR. Error bars represent the standard errors of mean from three biological replicates. Statistically significant differences between treated and un- treated were not observed at P < 0. 05. 33
12.00 9.00 S P S 2 P 8.00 2 G
f
G 10.00
o f 7.00
o s
l s e l
v 6.00 e 8.00 e v l
e l n 5.00 o n i o s i
6.00 s
s 4.00 e s r e p r
x 3.00 p e x 4.00 e e
v 2.00 e i v t i a t l
a 1.00 e
l 2.00 R e * R * 0.00 0.00 Norflurazol control TRV::GPDS TRV control mock treatment A B Figure 13. Relative expression level of G2PS in VIGS-treated (A) and 20 µM NF-treated (B) gerbera plantlets, measured by qRT-PCR. Error bars represent the standard errors of mean from three biological replicates. Statistically significant differences among samples were determined at P < 0. 05.
4.5 Detection of TRV in VIGS-treated gerbera
In addition to the reduction of GPDS transcript level, the presence of TRV vectors was also measured by qPCR to confirm the efficiency of VIGS on gerbera. The expression levels of TRV1 and TRV2 on photobleached sectors of gerbera were significant while no signals of these vectors were detected on mock and TRV control infiltration (Figure 14).
500 * 2 100 *
2 1 V V R
R 1 800 T T
400 f f o o
l
l 1 500 e e v v e e l
l
300
n 1 200 n o o i i s s s s e e
r 900 r 200 p p x x e
e
e 600 e v v i i t t
100 c a a l l 300 e e R R 0 0 TRV::PDS TRV control mock TRV::PDS TRV control mock A B Figure 14. Relative expression levels of TRV1 (A) and TRV2 (B) in VIGS-treated gerbera were determined by qRT-PCR. Error bars represent the standard errors of mean from three biological replicates. Asterisks indicate a statistically significant difference among treated and control samples values (P < 0. 05). 34
4.6 Over-expression G2PS gene in tobacco caused a phototbleached phenotype, and reduction of ȕ-carotene, but not accumulation of phytoene
Overexpression G2PS in tobacco showed an interesting phenotype under the growth room conditions. One month after germination and growth on half-strength MS medium, the transgenic and non-transgenic tobaccos were transferred into soil. Their older leaves changed from pale green to be completed white, while the non-transgenic plants were normal. The growth and development of transgenic plants were retarded but the plants did not die (Figure 15).
Figure 15. The phenotype of over expression G2PS on tobacco line 36 one month after planted on soil pot (A). Wild type tobacco (B) was sowed on the soil after a month.
Albino leaves of transgenic tobacco showed similar phenotypes as NF-treated tobacco. These white leaves were used to measure the transcript levels of PDS, and carotenes and phytoene by TLC.
Driven by 35S promoter, the expression level of G2PS in albino leaves of transgenic tobacco was high, while it was not detected in non-transgenic. The transcript level of PDS on these white leaves was not changed in comparison with non-transgenic tobacco (Figure 16). The ȕ-carotene content was slightly reduced when visualized on TLC; however, the phytoene content did not accumulate as VIGS or NF-treatment (Figure 17). 35
1.60 2.00 S S * D P P 2 1.40 t G
N
f f o
o
1.50
s 1.20 l s l e e v v
e 1.00 l e
l
n n o
i o 1.00
0.80 i s s s s e e r 0.60 r p p x x e
e
e 0.40 0.50 e v i v i t t a
l 0.20 a l e e R 0.00 R 0.00 Nontransgenic transgenic plant Nontransgenic transgenic plant plant B plant A Figure 16. Relative expression levels of G2PS (A) and NtPDS (B) of transgenic and nontransgenic tobacco were measured by qRT-PCR. Error bars represent the standard errors of mean from three biological replicates. Statistically significant differences among samples were determined at P < 0. 05. Front
Phytoene ȕ-carotene
1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8
Figure 17. TLC analysis of the carotenes and phytoene of VIGS and NF treated N. benthamiana, and tobacco over-expressing G2PS. Lane 1 and 3 were extractions from white sector of NF, and VIGS-treated N. benthamiana plants, respectively. Lane 2 and 4 were control and mock plant. Lane 5, 6 and 7 were extracts of non-transgenic, completely white leaves of transgenic and heterozygotes transgenic tobacco. Extraction of carrot as carotene standard was loaded on lane 8. Carotene was visualized under normal light (A) while phytoene was only detected under UV light (Ȝ = 254 nm) (B). The Rf value of phytoene and carotene were 0.9 and 0.87, respectively. 36
4.7 TAL inhibited germination and growth of tobacco seedlings invitro
TAL, which was applied in half-strength MS medium, reduced the germination and growth of tobacco at high concentration. Tobacco seeds did not germinate on medium, which were added with 5 and 10mM TAL. Methanol, the solvent, did not affect the germination and growth of tobacco at the equal amounts. At the lower concentration of TAL, the growth of tobacco seedlings was reduced in comparison with control (Figure 18).
4.8 Exogenous MAL rescued the tobacco over-expressing 2PS invitro conditions, but BR not
MAL, a lactone form of mevalonic acid (MVA), was applied to test the effect on the growth of transgenic tobacco. Pale yellow to white, contracted cotyledons of transgenic plant (line # 36 and line # 37) were completely rescued on half-strength MS medium supplemented with 10 mM MAL, while no effect of MAL at lower concentration on these transgenic plants was observed (Figure 19). Seedlings, which were grown on added 10 mM MAL half-strength MS medium, were smaller than others concentration. Although MAL could rescue the transgenic tobacco at seedling stage invitro conditions, it did not affect these older transgenic plants when planted on soil (data not show).
Brassinolide, a steroid product of isoperoids pathways in plant, was also applied. Although the role of BR in promoting cell elongation was shown, it did not rescue these phenotypes (Figure 20). BR is one of the last products which are synthesized by the MVA pathway, so this could be a reason of insufficiency on rescuing phenotype of G2PS overexpression tobacco. 37
Figure 18. The effect of TAL on germination and growth of tobacco in-vitro. Four weeks after germinated on medium, which supplied with TAL at 0.1 mM (B), 0.5 mM (C), 1 mM (D), 5 mM (E) and 10 mM (F) , the growths of tobacco seedlings were inhibited and did not germinate at 10 mM TAL. There was no effect of solvent on the growth of tobacco seedlings (A).
38
Figure 19. The effect of different concentration MAL on growth of tobacco seedlings invitro two weeks after sowing. A-D, effect of MAL at 0, 1, 3, 10 mM respectively on growth of wild type tobacco seedlings. E -H, effect of MAL at 0, 1, 3, 10 mM respectively on growth of transgenic tobacco line # 37 seedlings. I-L, effect of MAL at 0, 1, 3, 10 mM respectively on growth of transgenic tobacco line # 36 seedlings. Note that offspring of lines #36 and #37 segregate for the 35S-G2PS transgene. Arrows point to seedlings showing the bleached phenotype.
39
Figure 20. The effect of different concentration BRs on growth of tobacco seedlings invitro two weeks after sowing. A-D, effect of BR at 0, 10, 100 nM, 1 µM respectively on growth of wild type tobacco seedlings. E -H, effect of effect of BRs at 0, 10, 100 nm, 1 µM on growth of transgenic tobacco line # 37 seedlings. Arrows point to seedlings showing the bleached phenotype.
40
5 DISCUSSION
TRV has been successfully used as a VIGS vector system for model and crop plants. A wide-range of hosts, mild disease symptoms, strong induced silencing in infected tissues are the advantages of TRV, which surpasses other VIGS systems such as tobacco mosaic virus (TMV), potato virus X (PVX), and tomato golden mosaic virus (TGMV) (Ratcliff et al. 2001). In this study, TRV-based VIGS vector was effective when applied in Gerbera hybrida.
TRV1 and TRV2 were unfortunately not detected in TRV control gerbera plantlets (Figure 13). No difference in symptoms of viral infection between systemic leaves and control plants was visible in these plants. The milder impact of the TRV-VIGS vector system was the main cause of sampling on gerbera, and this was also reported in other plant systems. Only 13.5% of 96 infected opium poppy plants with TRV virus were positive for TRV1 and TRV2 (Hileman et al. 2005), while it was impossible to detect TRV on Eschscholzia californica inoculated with TRV1 and empty TRV2 vectors (Wege et al. 2007). The probability of detecting TRV1 and TRV2 on infected gerbera with TRV control is 30% (Xianbao Deng, unpublished data). Although a marker gene such as PDS is needed to detect VIGS, these results showed that the TRV-VIGS-based vector system is a promising approach to study the functional genomics in gerbera.
PDS is one of the most commonly used reporter genes in VIGS experiments (Becker & Lange 2010). The distribution and efficiency of the silencing region are easily detected based on the analysis of photobleached sectors. Thus, it is useful to study the function of the gene of interest, which could be cloned into the same TRV2 construct with the PDS marker.
The photobleached phenotypes and down-regulation of endogenous GPDS mRNA in systemic leaves of infiltrated pTRV2::GPDS gerbera were observed (Figure 6C, Figure 11A). These effects were also reported on different VIGS-treated plants such as N. benthamiana (Kumagai et al. 1995), potato (Faivre-Rampant et al. 2004), barley (Holzberg et al. 2002) or wheat (Travella et al. 2006). The down regulation of GPDS is caused by siRNA mechanism, which is triggered by the VIGS system (Lu et al. 2003). 41
Moreover, the accumulation of phytoene in the white leaf sectors of gerbera was observed (Figure 10). Phytoene is the specific substrate which PDS converts to phytoÀuene (Breitenbach & Sandmann 2005). The activity of PDS is inhibited by NF, a competitor of the PDS cofactor plastoquinone (Breitenbach et al. 2001), which increases the phytoene content of the treated-NF tissue. However, the transcription levels of the PDS gene in all treated-NF plants were not significantly changed in comparison to control. The unchanged transcription levels of PDS gene by NF treatment were also reported in Arabidopsis (Wetzel and Rodermel 1998, Welsch et al. 2003), and pepper plants (Simkin et al. 2000). In contrast, up-regulation of PDS gene was observed in tomato seedlings (Giuliano et al. 1993, Simkin et al. 2003). In VIGS treatment, conversion of phytoene to phytofluene is inhibited in photobleached sectors of infected plants because of insufficiency of PDS due to the silencing of the PDS gene. Hence, the phytoene level increases in the photobleached sectors.
The silencing of the PDS gene itself could affect the growth and development of plant, because, carotenoids have a variety of functions in plants. They act as membrane stabilizers, protect the chlorophyll against photo-oxidative damage, harvest light for photosynthesis, serve as precursors for the biosynthesis of the plant growth regulators such as abscisic acid, and strigolactone, and attract pollinators (Niyogi 2000, Cazzonelli & Pogson 2010). The disruption of the PDS3 gene in Arabidopsis by T-DNA method, Qin et al. (2007) showed that these mutant plants were albino and dwarf phenotypes. More interestingly, genes not only encoding the enzymes involved in the carotenoid biosynthesis pathway, but also in other metabolic pathways such as glycolysis, the trichloroacetic acid cycle, and the biosynthesis of terpenoids (the MVA pathway), phenylpropanoid or chlorophyll were down-regulated in these knockout plants. Microarray experiment was also carried out to investigate the effect of NF on the white leaf tissue of Arabidopsis (Aluru et al. 2009). This study showed that photosynthesis, starch metabolism, and pigment biosynthesis were repressed in the NF-treated tissue compared to the wild type. Recently, Romero et al. (2011) demonstrated that the carotenoid pathway, the flavonoid/phenylpropanoid and the alkaloid pathway on pTRV1/2-PDS tomato infiltrated fruits were significantly changed, while a dramatic decrease in sugars, deregulation of the tricarboxylic acid cycle and accumulation high amounts of asparagine were observed on VIGS-PDS treated Arabidopsis leaves (Quadrana et al. 2011). Moreover, the behavior of butterflies was also affected when 42
PDS was silenced by VIGS plants (Zheng et al. 2010). These above cited studies have shown the drawback of the PDS gene that was used as a reporter marker in the VIGS experiment.
In our gerbera model, the results also confirmed this phenomenon of secondary effects. Blocking the carotenoid pathway at the PDS step affected gerberin or parasorboside biosynthesis in gerbera plantlets. The 2PS gene, which encodes for the first enzyme in the gerberin/parasorboside biosynthesis pathway of gerbera, was significantly reduced in VIGS and NF-treated white sector compared with control (Figure 14). This suppression could affect the growth and development of gerbera plants, which has been shown on 2PS antisense gerbera (Teeri et al. 2006). Gerberin, parasorboside and their derivatives are the antifungal compounds of gerbera (Koskela et al. 2011), which were strongly reduced on 2PS antisense gerbera, so these transgenic plants were susceptible to fungi and insects.
More interestingly, knocked down the Mg-chelatase gene, which encodes for an enzyme involved in the chlorophyll biosynthesis (Walker & Willow 1997), by VIGS treatment, the expression level of 2PS gene in the yellow tissue of the infected gerbera was also strongly down-regulated (Xianbao Deng, unpublished data). Combined with PDS silencing, it could be concluded that the down regulation of 2PS gene in yellow or white sectors of VIGS or NF-treated gerbera was actually caused by lack of chlorophyll, possibly through inefficiency of photosynthesis
Acetyl-CoA, a starter substrate of 2PS in gerbera (Eckerman et al. 1998), is a product of the catabolism of carbohydrates (glycolysis), lipids, and amino acids in different compartments of plant cells (Oliver et al. 2009) (Figure 21). The insufficient products of photosynthesis in the white sector might supply not enough sucrose and starch as the principal substrates for glycolysis in plant, leading to reduced transcription levels of the 2PS gene in these treated tissues. This could be suggested by the feedback regulation due to the lack of starter acetyl-CoA.
43
Figure 21: The acetyl-CoA metabolism occurs in plant cells. Ac-CoA: acetyl-CoA; DMAPP: dimethylallyl diphosphate; G6P: glucose 6-phosphate; GAP: glyceraldehyde-3-phosphate; IPP: isopentenyl diphosphate; Leu: leucine; oPP: oxidative pentose phosphate pathway; Pyr: pyruvate; TAL: triacetolactone : molecule transporter. Modified from Hemmerlin et al. 2012.
The photobleached phenotype of overexpression 2PS tobacco plantlets is an interesting phenotype. The main cause of this phenotype is the reduction of ȕ-carotene in albino leaves, which was shown on TLC (Figure 17); however, the interaction between gerberin/parasorboside and carotenoid biosynthesis in this transgenic tobacco are still unclear. As discussed above, the down-regulation of 2PS in albino sectors of VIGS and NF-treated gerbera plants might be caused by the lack of the precursor, acetyl-CoA. Thus, the competition of carbon with the carotenoid pathway might be the reason for the white phenotype of tobacco overexpressing 2PS. Recent results published by Xie et al. (2008) suggested that the phenylpropanoids and the MEP pathway compete for carbon in basil glandular trichomes. Thus, this observation might support to the carbon competition hypothesis in transgenic tobacco. However, this challenge has not been solved. The carotenoid biosynthesis pathway is catalyzed in the plastid of plant cells and uses pyruvate and GAP as precursors (Rohmer 1999, RodrÕguez-Concepcion & Boronat 2002, RodrÕguez-Concepcion 2010). In addition, PDS was not affected by the overexpression of the 2PS gene in the albino leaves of transgenic tobacco. The transcription level of PDS was not significantly different between transgenic and non- 44 transgenic tobacco (Figure 16C), and the phytoene was not accumulated in transgenic plants (Figure 17).
The gerberin and the MVA biosynthesis in gerbera share the same substrate, acetyl- CoA. Furthermore, acetoacetyl-CoA, which is also the first condensed product of the MVA biosynthesis pathway (Figure 2, 4B), is a favorable substrate of 2PS (Eckermann et al. 1998). Thus, the competition between these two pathways for these substrates might be the reason for the photooxidative bleaching of transgenic tobacco. 10 mM MAL, a lactone form of MVA, was applied, and rescued the effect of overexpression of 2PS gene on invitro tobacco seedlings (Figure 19H, L). Although MVA and MEP pathways are located in different subcellular compartments in plant cells (Rohmer 1999, Vranova et al. 2011), isopentenyl diphosphate could be imported to the plastid from cytosol (Bick & Lange 2003, Flügge & Gao 2005). The crosstalk between the two isoprenoids pathways was successfully used to rescue the albino phenotype of cla1-1 mutation, the disruption of 1-deoxy-D-xylulose 5-phosphate synthase in the MEP pathway, Arabidopsis seedlings (Nagata et al. 2002) and fosmidomycin (a 1-deoxy-D- xylulose-5-phosphate reductoisomerase inhibitor) treated Tobacco Bright Yellow-2 (TBY-2) cells (Hemmerlin et al. 2003). The equal or higher amounts of MAL were applied on 35S-2PS tobacco plantlets; however, it did not success to recue these plants (data not shown). Taken together, it seems that the interference between the gerberin and the MVA instead of with the MEP pathways might lead to decrease the content of ȕ-carotene in 35S-2PS tobacco plants, although the interaction among them is still unclear.
The endogenous TAL, a polyketide product of 2PS, could be toxic for transgenic tobacco based on the results of exogenous application (Figure 18). Exogenous TAL reduced the germination ability and growth of tobacco seedlings, which were sown invitro. The phenotype of these seedlings, however, was different with transgenic tobacco when they were grown under the same conditions. Pale yellow to white, contracted cotyledons-symptoms of transgenic plant tobacco was not observed on TAL treated tobacco seedlings. In addition, the pH of supplemented TAL haft-strength MS medium decreased to 3.8 when the concentration of TAL increased to 10mM. Therefore, the germination and growth of tobacco seedlings were inhibited might be caused by the toxic of TAL itself, or the decreasing of pH media. 45
6 CONCLUSIONS
In this study, a part of the interference between gerberin/parasorboside and carotenoid biosynthesis has been revealed. The down-regulation 2PS gene on VIGS treated gerbera with PDS as a marker is caused by blocking carotenoid biosynthesis pathway, not by reacting to TRV. Overexpression 2PS gene decreases the ȕ-carotene content in transgenic tobacco; however, the reason of inhibited carotenoids pathway in these transgenic plants is still unclear. Further analysis on these tobacco plants should be carried out to clarify the interaction between gerberin/parasorboside and carotenoid biosynthesis. To overcome the effect of overexpression 2PS gene, exogenous MAL could be applied to partial rescue the phenotype at the seedlings stages.
46
7 ACKNOWLEDGEMENTS
I would like to thank my supervisor, Prof. Teemu Teeri for your guidance and offering me this opportunity to work with interesting topic. M.Sc. Xianbao Deng, who first introduced me to VIGS, is gratefully acknowledged. I appreciate all supports, advices and guidance from you. I express my appreciation to M.Sc. Hany ElSayed, Dr. Sari Tähtiharju who gave me advice on TLC technique and using BRs. All the members of the Gerbera laboratory and the staffs at the Department of Agricultural Sciences are acknowledged for creating a pleasant working atmosphere. Ms. Xin Fang and Ms. Evangelista Chiunga are acknowledged for your accepting as my opponents and Dr. Roy Siddall for language revisions. I am grateful to Vietnam International Education Development (VIED)-Ministry of Education and Training, for providing financial support for my master study. Finally, I wish to thank my parents from all my heart for their love and support at all times.
Helsinki, May 2012
Nguyen Xuan Cuong
47
8 REFERENCES
Abe, I. & Morita, H. 2010. Structure and function of the chalcone synthase superfamily of plant type III polyketide synthases. Natural Product Reports 27: 809–838.
Abe, I., Utsumi, Y., Oguro,S. & Noguchi, H. 2004. The first plant type III polyketide synthase that catalyzes formation of aromatic heptaketide. FEBS Letters 562:171-176.
Aharoni, A. & Galili, G. 2011. Metabolic engineering of the plant primary– secondary metabolism interface. Current Opinion in Biotechnology 22: 239 –244.
Aluru, M.R., Zola, J., Foudree, A. & Rodermel, S.R. 2009. Chloroplast photooxidation induced transcriptome reprogramming in Arabidopsis immutans white leaf sectors. Plant Physiology 150: 904–923.
Austin, M.B., O'Maille,P.E. & Noel, J.P. 2008. Evolving biosynthetic tangos negotiate mechanistic landscapes. Nature Chemical Biology 4: 217 - 222.
Becker, A. & Lange, M. 2010. VIGS – genomics goes functional. Trends in Plant Science 15: 1-4.
Bick, J.A. & Lange, B.M. 2003. Metabolic cross talk between cytosolic and plastidial pathways of isoprenoid biosynthesis: unidirectional transport of intermediates across the chloroplast envelope membrane. Archives of Biochemistry and Biophysics 415: 146– 154.
Boudet, A-M. 2007. Evolution and current status of research in phenolic compounds. Phytochemistry 68: 2722–2735.
Bouvier, F., Rahier, A. & Camara, B. 2005. Biogenesis, molecular regulation and function of plant isoprenoids. Progress in Lipid Research 44:357–429.
Breitenbach, J. & Sandmann, G. 2005. ȗ-Carotene cis isomers as products and substrates in the plant poly-cis carotenoid biosynthetic pathway to lycopene. Planta 220: 785–793.
Breitenbach, J., Zhu, C. & Sandmann, G. 2001. Bleaching herbicide norflurazon inhibits phytoene desaturase by competition with the cofactors. Journal of Agricultural and Food Chemistry 49: 5270í5272. 48
Britton, G. 1995. Structure and properties of carotenoids in relation to function. The FASEB Journal 9: 1551–1558.
Britton, G., Liaaen-Jensen, S. & Pfander, H. 2004. Carotenoids Handbook. Basel, Switzerland: Birkhäuser 671pp.
Brodersen, P. & Voinnet, O. 2006. The diversity of RNA silencing pathways in plants. Trends in Genetics 22: 268–280.
Broun, P. & Somerville, C. 2001. Progress in plant metabolic engineering. Proceedings Of The National Academy Of Sciences Of The United States Of America 98: 8925– 8927.
Burch-Smith, T.M., Anderson, J.C., Martin, G.B. & Dinesh-Kumar, S.P. 2004. Applications and advantages of virus-induced gene silencing for gene function studies in plants. The Plant Journal 39: 734–746.
Burch-Smith, T.M., Schiff, M., Liu, Y. & Dinesh-Kumar, S.P. 2006. Efficient virus induced gene silencing in Arabidopsis thaliana. Plant Physiology 142:21-27.
Cazzonelli, C.I. & Pogson, B.J. 2010. Source to sink: regulation of carotenoid biosynthesis in plants. Trends in Plant Science 15: 266-274.
Chong, J., Poutaraud, A. & Hugueney, P. 2009. Metabolism and roles of stilbenes in plants. Plant Science 177:143–155.
Cunningham, F.X. & Gantt, E. 1998. Genes and enzymes of carotenoid biosynthesis in plants. Annual Review of Plant Physiology and Plant Molecular Biology 49: 557-583.
Daglia, M. 2012. Polyphenols as antimicrobial agents. Current Opinion in Biotechnology 23: 174–181. de Felippes, F. F., Wang, J.W. & Weigel, D. 2012. MIGS: miRNA-induced gene silencing. The Plant Journal 70: 541–547.
DellaPenna, D. & Pogson, B.J. 2006. Vitamin synthesis in plants: Tocopherols and Carotenoids. Annual Review of Plant Biology 57: 711-738.
Di Stilio, V. S. 2011. Empowering plant evo-devo: Virus induced gene silencing validates new and emerging model systems. Bioessays 33: 711–718. 49
Di Stilio, V.S., Kumar, S.A., Oddone, A.M., Tolkin, T.R., Salles, P. & McCarty, K. 2010. Virus-induced gene silencing as a tool for comparative functional studies in Thalictrum. PLoS One 5: e12064.
Dinesh-Kumar, S.P., Anaadalakshmi, R., Marathe, R., Schiff, M. & Liu, Y. 2003. Virus-induced gene silencing. Methods in Molecular Biology 236: 287–294.
Ding, S-W. & Voinnet, O. 2007. Antiviral immunity directed by small RNAs. Cell 130: 413-426.
Dixon, R. A. & Strack, D. 2003. Phytochemistry meets genome analysis, and beyond. Phytochemistry 62: 815–816.
Dudareva, N., Andersson, S., Orlova, I., Gatto, N., Reichelt, M., Rhodes, D., Boland, W. & Gershenzon, J. 2005. The nonmevalonate pathway supports both monoterpene and sesquiterpene formation in snapdragon flowers. Proceedings of The National Academy Of Sciences Of The United States Of America 102: 933–938.
Dudareva, N., Negre, F., Nagegowda, D.A. & Orlova, I. 2006. Plant volatiles: recent advances and future perspectives. Critical Reviews in Plant Sciences 25: 417–440.
Eckermann, S., Schröder, G., Schmidt, J., Strack, D., Edrada, R.A., Helariutta, Y.,Elomaa, P., Kotilainen, M., Kilpeläinen, I., Proksch, P., Teeri, T.H. & Schröder, J. 1998. New pathway to polyketides in plants. Nature 396: 387-390.
Faivre-Rampant, O., Gilroy, E.M., Hrubikova, K., Hein, I., Loake, G.J., Birch, P., Taylor, M. & Lacomme, C. 2004. Potato virus X-induced gene silencing in leaves and tubers of potato. Plant Physiology 134: 1308–1316.
Ferrer, J-L., Austin, M.B., Stewart, C. J. & Noel J.P. 2008. Structure and function of enzymes involved in the biosynthesis of phenylpropanoids. Plant Physiology and Biochemistry 46: 356-370.
Flores-Sanchez, I.J. & Verpoorte, R. 2009. Plant Polyketide Synthases: A fascinating group of enzymes. Plant Physiology and Biochemistry 47: 167–174.
Flügge, U-I. & Gao, W. 2005. Transport of isoprenoid intermediates across chloroplast envelope membranes. Plant Biology 7: 91–97. 50
Fraser, P. D., Pinto, M.E.S., Holloway, D.E. & Bramley, P.M. 2000. Application of high-performance liquid chromatography with photodiode array detection to the metabolic profiling of plant isoprenoids. The Plant Journal 24: 551–558.
Fraser, P.D. & Bramley, P.M. 2004. The biosynthesis and nutritional uses of carotenoids. Progress in Lipid Research 43: 228–265.
Gao, X., Wheeler, T., Li, Z., Kenerley, C.M., He, P. & Shan, L. 2011. Silencing GhNDR1 and GhMKK2 compromises cotton resistance to verticillium wilt. The Plant Journal 66: 293–305.
Giuliano, G., Bartley, G.E. & Scolnik, P.A. 1993. Regulation of carotenoid biosynthesis during tomato development. Plant Cell 5: 379–387.
Giuliano, G., Pollock, D. & Scolnik, P. A. 1986. The gene crtI mediates the conversion of phytoene into colored carotenoids in Rhodopseudomonas capsulata. The Journal of Biological Chemistry 261: 12925-12929.
Gould, B. & Kramer, E.M. 2007. Virus-induced gene silencing as a tool for functional analyses in the emerging model plant Aquilegia (columbine, Ranunculaceae). Plant Methods 3:6.
Hartmann, T. 2007. From waste products to ecochemicals: Fifty years research of plant secondary metabolism. Phytochemistry 68: 2831–2846.
Hellenmans, J., Mortier, G., De Paerpe, A., Speleman, F. &Vandesompele, J. 2007. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biology 8: R19.
Hemmerlin, A., Harwood, J.L. & Bach, T.J. 2012. A raison d’être for two distinct pathways in the early steps of plant isoprenoid biosynthesis? Progress in Lipid Research 51: 95–148.
Hemmerlin, A., HoeZer, J.F., Meyer, O., Tritsch, D., Kagan, I.A., Grosdemange- Billiard, C., Rohmer, M. & Bach, T.J. 2003. Cross-talk between the cytosolic mevalonate and the plastidial methylerythritol phosphate pathways in tobacco bright yellow-2 cells. The Journal of Biological Chemistry 278: 26666–26676. 51
Hidalgo, O., Bartholmes, C. & Gleissberg, S. 2012. Virus-induced gene silencing (VIGS) in Cysticapnos vesicaria,a zygomorphic-Àowered Papaveraceae (Ranunculales, basal eudicots). Annals of Botany 109: 911–920.
Hileman, L.C., Drea, S., Martino, G., Litt, A. & Irish, V.F. 2005. Virus-induced gene silencing is an effective tool for assaying gene function in the basal eudicot species Papaver somniferum (opium poppy). The Plant Journal 44: 334-341.
Holzberg, S., Brosio, P., Gross, C. & Pogue, G.P. 2002. Barley stripe mosaic virus- induced gene silencing in a monocot plant. The Plant Journal 30: 315–327.
Jia, H. F., Chai, Y.M., Li, C.L., Lu, D., Luo, J.J., Qin, L. & Shen, Y.Y. 2011. Abscisic acid plays an important role in the regulation of strawberry fruit ripening. Plant Physiology 157: 188–199.
Joyard, J., Ferro, M., Masselon, C., Seigneurin-Berny, D., Salvi, D., Garin, J., & Rolland, N. 2009. Chloroplast proteomics and the compartmentation of plastidial isoprenoid biosynthetic pathways. Molecular Plant 2: 1154-1180.
Karppinen, K., Hokkanen,J., Mattila,S., Neubauer, P. & Hohtola, A. 2008. Octaketide- producing type III polyketide synthase from Hypericum perforatum is expressed in dark glands accumulating hypericins. FEBS Journal 275:4329–4342.
Kasahara, H., Hanada, A., Kuzuyama, T., Takagi, M., Kamiya, Y.& Yamaguchi, S. 2002. Contribution of the mevalonate and methylerythritol phosphate pathways to the biosynthesis of gibberellins in Arabidopsis. Journal of Biological Chemistry 277: 45188-45194.
Kirby, J. & Keasling, J.D. 2009. Biosynthesis of plant isoprenoids: perspectives for microbial engineering. Annual Review of Plant Biology 60:335–355.
Koskela, S., Söderholm, P.P, Ainasoja, M., Wennberg, T., Klika, K.D., Ovcharenko, V.V., Kylänlahti, I., Auerma, T.,Yli-Kauhaluoma, J., Pihlaja, K., Vuorela, P.M. & Teeri, T.H. 2011. Polyketide derivatives active against Botrytis cinerea in Gerbera hybrida. Planta 233: 37–48.
Kumagai, M.H., Donson, J., Della-Cioppa, G., Harvey, D., Hanley, K. & Grill, L.K. 1995. Cytoplasmic inhibition of carotenoid biosynthesis with virus-derived RNA. 52
Proceedings Of The National Academy Of Sciences Of The United States Of America 92: 1679–1683.
Lange, B. M., Rujan, T., Martin, W. & Croteau, R. 2000. Isoprenoid biosynthesis: The evolution of two ancient and distinct pathways across genomes. Proceedings Of The National Academy Of Sciences Of The United States Of America 97: 13172–13177.
Lattanzio, V., Kroon, P.A., Quideau, S. & Treutter, D. 2008. Plant phenolics secondary metabolites with diverse functions. In: Daayf, F. & Lattanzio, V. (eds.). Recent advances in polyphenol research. Chichester, UK: John Wiley & Sons Ltd., pp 1-35.
Lichtenthaler, H.K. 1999. The 1-deoxy-d-xylulose-5-phosphate pathway of isoprenoid biosynthesis in plants. Annual Review of Plant Physiology and Plant Molecular Biology 50:47–65.
Liu,Y.L., Schiff, M. & Dinesh-Kumar, S.P. 2002. Virus-induced gene silencing in tomato. The Plant Journal 31: 777-786.
Lu, R., Martin-Hernandez, A.M., Peart, J.R., Malcuit, I. & Baulcombe, D.C. 2003. Virus-induced gene silencing in plants. Methods 30: 296–303.
Macfarlane, S.A. 2010. Tobraviruses—plant pathogens and tools for biotechnology. Molecular Plant Pathology 11: 577–583.
Manzano, D., Fernandez-Busquets, X., Schaller, H., Gonzalez, V., Boronat, A., Arro, M. & Ferrer, A. 2004. The metabolic imbalance underlying lesion formation in Arabidopsis thaliana overexpressing farnesyl diphosphate synthase (isoform 1S) leads to oxidative stress and is triggered by the developmental decline of endogenous HMGR activity. Planta 219: 982–992.
Mizuuchi, Y., Shi, S-P., Wanibuchi, K., Kojima, A., Morita, H., Noguchi, H. & Abe, I. 2009. Novel type III polyketide synthases from Aloe arborescens. FEBS Journal 276: 2391–2401.
Nagata, N., Suzuki, M., Yoshida, S. & Muranaka, T. 2002. Mevalonic acid partially restores chloroplast and etioplast development in Arabidopsis lacking the non- mevalonate pathway. Planta 216: 345–350.
Niyogi, K.K. 2000. Safety valves for photosynthesis. Current Opinion in Plant Biology 3: 455–460. 53
Oliver, D.J., Nikolau, B.J. & Wurtele, E.S. 2009. Acetyl-CoA-Life at the metabolic nexus. Plant Science 176: 597–601.
Page, J.E., Hause, G., Raschke M., Gao, W.Y., Schmidt, J., Zenk, M.H. & Kutchan, T.M. 2004. Functional analysis of the ¿nal steps of the 1- deoxy-d-xylulose 5-phosphate (DXP) pathway to isoprenoids in plants using virus-induced gene silencing. Plant Physiology 134: 1401–1413.
Qin, G., Gu, H., Ma, L., Peng, Y., Deng, X.W., Chen, Z. & Qu, L. 2007. Disruption of phytoene desaturase gene results in albino and dwarf phenotypes in Arabidopsis by impairing chlorophyll, carotenoid, and gibberellin biosynthesis. Cell Research 17:471– 482.
Quadrana, L., Rodriguez, M.C., Lopez, M., Bermudez, L., Adriano Nunes-Nesi, A., Fernie, A.R., Descalzo, A., Asis, R., Rossi, M., Asurmendi, S. & Carrari, F. 2011. Coupling virus induced gene silencing to exogenous green fluorescence protein expression provides a highly efficient system for functional genomics, in Arabidopsis and across all stages of tomato fruit development. Plant Physiology 156: 1278–1291.
Ratcliff, F., Martin-Hernandez, A.M. & Baulcombe, D.C. 2001. Tobacco rattle virus as a vector for analysis of gene function by silencing. The Plant Journal 25: 237–245.
Robard, K. & Antolovich, M. 1997. Analytical chemistry of fruit bioflavonoids a review. Analyst 122: 11R–34R.
RodrÕguez-Concepcion, M. & Boronat, A. 2002. Elucidation of the methylerythritol phosphate pathway for isoprenoid biosynthesis in bacteria and plastids. a metabolic milestone achieved through genomics. Plant Physiology130: 1079–1089.
RodrÕguez-Concepcion, M. 2010. Supply of precursors for carotenoid biosynthesis in plants. Archives of Biochemistry and Biophysics 504: 118-122.
Rohmer, M. 1999. The discovery of a mevalonate-independent pathway for isoprenoid biosynthesis in bacteria, algae and higher plants. Natural Product Reports 16: 565–574.
Romero, I., Tikuno, Y. & Bovy, A. 2011. Virus-induced gene silencing in detached tomatoes and biochemical effects of phytoene desaturase gene silencing. Journal of Plant Physiology 168: 1129–1135. 54
Senthil-Kumar, M. & Mysore, K.S. 2011. New dimensions for VIGS in plant functional genomics. Trends in Plant Science 16: 656-665.
Senthil-Kumar, M., Hema, R., Anand, A., Kang, L., Udayakumar, M. & Mysore, K. S. 2007. A systematic study to determine the extent of gene silencing in Nicotiana benthamiana and other Solanaceae species when heterologous gene sequences are used for virus-induced gene silencing. New Phytologist 176:782–791.
Simkin, A.J., Breitenbach, J., Kuntz, M. & Sandmann, G. 2000. In vitro and in situ inhibition of carotenoid biosynthesis in Capsicum annuum by bleaching herbicides. Journal of Agricultural and Food Chemistry 48: 4676–4680.
Simkin, A.J., Laboure A-M., Kuntz, M. & Sandmann, G. 2003. Comparison of carotenoid content, gene expression and enzyme levels in tomato (Lycopersicon esculentum) leaves. Zeitschrift für Naturforschung C 58: 371–380.
Soosaar, J.L.M., Burch-Smith, T.M. & P. Dinesh-Kumar, S.P. 2005. Mechanisms of plant resistance to viruses. Nature Reviews Microbiology 3: 789-798.
Springob, K., Samappito, S., Jindaprasert, A., Schmidt, J., Page, J.E., De-Eknamkul, W. & Kutchan, T.M. 2007. A polyketide synthase of Plumbago indica that catalyzes the formation of hexaketide pyrones. FEBS Journal 274: 406–417.
Stratmann, J.W. & Hind, S.R. 2011. Gene silencing goes viral and uncovers the private life of plants. Entomologia Experimentalis et Applicata 140: 91–102.
Suzuki, M., Kamide, Y., Nagata, N., Seki, H., Ohyama, K., Kato, H., Masuda, K., Sato, S., Kato, T., Tabata, S., Yoshida, S. & Muranaka, T. 2004. Loss of function of 3- hydroxy-3-methylglutaryl coenzyme A reductase 1 (HMG1) in Arabidopsis leads to dwar¿ng, early senescence and male sterility, and reduced sterol levels. The Plant Journal 37: 750–761.
Suzuki, M., Nakagawa, S., Kamide, Y., Kobayashi, K., Ohyama, K., Hashinokuchi, H., Kiuchi, R., Saito, K., Muranaka, T. & Nagata, N. 2009. Complete blockage of the mevalonate pathway results in male gametophyte lethality. Journal of Experimental Botany 60: 2055–2064. 55
Teeri,T.H., Elomaa, P., Kotilainen, M. & Albert, V.A. 2006. Mining plant diversity: Gerbera as a model system for plant developmental and biosynthetic research. BioEssays 28:756–767.
Travella, S., Klimm, T.E. & Keller, B. 2006. RNA interference-based gene silencing as an efficient tool for functional genomics in hexaploid bread wheat. Plant Physiology 142: 6-20.
Voinnet, O. 2001. RNA silencing as a plant immune system against viruses. Trends in Genetics 17: 449-459.
Voinnet, O. 2005. Induction and suppression of RNA silencing: insights from viral infections. Nature Reviews Genetics 6: 206-220.
Vranova, E., Hirsch-Hoffmann, M. & Gruissem, W. 2011. AtIPD: a curated database of arabidopsis isoprenoid pathway models and genes for isoprenoid network analysis. Plant Physiology156: 1655–1660.
Walker, C.J. & Willow, R.D. 1997. Mechanism and regulation of Mg-chelatase. Biochemical Journal 327: 321-333.
Walter, M.H. & Dieter Strack, D. 2011. Carotenoids and their cleavage products: biosynthesis and functions. Natural Product Reports 28: 663–692.
Wege, S., Scholz, A., Gleissberg, S. & Becker, A. 2007. Highly efficient virus-induced gene silencing (VIGS) in California poppy (Eschscholzia californica): an evaluation of VIGS as a strategy to obtain functional data from non-model plants. Annals of Botany 100: 641–649.
Welsch, R., Medina, J., Giuliano, G., Beyer, P. & von Lintig, J. 2003. Structural and functional characterization of the phytoene synthase promoter from Arabidopsis thaliana. Planta 216: 523–534.
Wetzel, C.M. & Rodermel, S.R. 1998. Regulation of phytoene desaturase expression is independent of leaf pigment content in Arabidopsis thaliana. Plant Molecular Biology 37: 1045–1053.
Wink, M. 2010. Introduction: biochemistry, physiology and ecological functions of secondary metabolites. In Wink, M. (ed.) Biochemistry of Plant Secondary Metabolism, 2nd Edition. Chichester, UK: John Wiley & Sons Ltd., pp 1-19. 56
Xie, Z., Kapteyn, J. & Gang, D.R. 2008. A systems biology investigation of the MEP/terpenoid and shikimate/phenylpropanoid pathways points to multiple levels of metabolic control in sweet basil glandular trichomes. The Plant Journal 54: 349–361.
Ye, J., Qu, J., Bui, H.T.N. & Chua, N.H. 2009. Rapid analysis of Jatropa curcas gene functions by virus-induced gene silencing. Plant Biotechnology Journal 7: 964-976.
Yonekura-Sakakibara, K. & Saito, K. 2009. Functional genomics for plant natural product biosynthesis. Natural Product Reports 26:1466–1487.
Zheng, S.J., Snoeren, T.A.L., Hogewoning, S.W., van Loon, J.J.A. & Dicke,M. 2010. Disruption of plant carotenoid biosynthesis through virus-induced gene silencing affects oviposition behaviour of the butterÀy Pieris rapae. New Phytologist 186: 733–745.
Zhu, C., Bai, C., Sanahuja, G., Yuan, D., Farré, G., Naqvi, S., Shi, L., Capell, T. & Christou, P. 2010. The regulation of carotenoid pigmentation in Àowers. Archives of Biochemistry and Biophysics 504: 132–141.
57
9 APPENDICES
Appendix 1: Growth media used for rooting of Gerbera hybrida and sowing of tobacco
Rooting of gerbera Half strength MS medium MS macronutrients (20X) 25ml/l 25ml/l MS micronutrients (200X) 2.5ml/l 5ml/l Na-FeEDTA 2.5ml/l 5ml/l Gerbera vitamin (200X) 5ml/l MS vitamin (200X) 5ml/l
NaH2PO4.H2O 43mg/l L-tyrosine 50mg/l IBA 0.25mg/l Sucrose 45g/l 20g/l pH 6.0 5.7 Daishin agar 8g/l 8g/l
Appendix 2: Chemicals used for rescue and toxic treatment
Supplier Molar mass Solvent Stock Stored (g/mol) Concentration Norflurazon Sigma-Aldrich 303.67 Ethanol 5mM -200C Mevalonolactone Sigma-Aldrich 130.14 MiliQ water 100mM -200C 4-Hydroxyl-6-methyl-2 Sigma -Aldrich 126.11 Methanol 500mM -200C pyrone (TAL) Epibrassinolide Sigma -Aldrich 480.68 Ethanol 10mM -200C
58
Appendix 3 Agarose gel for checking the quality of RNA
Agarose 1%
TBE buffer 0.5X
Loading sample: 1µl RNA, 7µl miliQ water, 2µl loading dye (5X).
Running: 100 Volts for 20 minutes
59
Appendix 4: Details and sequence of primers used for qPCR assays
Gene GenBank Sequence (5–3) Size Ef¿ciency accession no (base pairs) Gerbera 2pyrone synthase Z38097.2 G2PS_F:TGACGAGGTGAGGAAGAGATCTAT 148 2.012±0.007 G2PS_R: ATTGGCAACCGCAGCAGTAA Gerbera phytoene desaturase GPDS_F: CCCTCTTCTCAGCGTTTATGCT 2.045±0.012 GPPD_R: AAGTTCTTTCATCGTGGCATCA Gerbera actin GER37: AGGAAATCACTGCTCTTGCG 2.082±0.029 GER38: AACAAACTCAACCCTCCAAACC Tobacco phytoene desaturase AJ616742 NtPDS_F: CCCTGACGAGCTTTCGATGCAGT 158 2.097±0,015 NtPDS_R:GTCTGACTTGGCCACCTTTTGACT Nicotiana bethamiana phytoene desaturase EU165355.1 NbPDS_F:GCAGTGGAAGGAACATTCAAT 72 NbPDS_R: GGAAAATCAAAGCGGCTGAAC Nicotiana bethamiana elongation factor AY206004.1 NbELF_F:TGAGGCTCTTGACCAGATTAATGA 76 1.994±0.003 D63396.1 NbELF_R:GTAAACATCCTGAAGTGGAAGACGTA Tobacco rattle virus RNA 1 NC_003805.1 TRV1_F:GAAAGGATGAGTGATTATGTCATAGTTTG 95 1.863±0.014
TRV1_R: GGTCCTAGATCCAGGGCACTT Tobacco rattle virus RNA 2 NC_003811.1 TRV2_F:GCATAAAATTTGCACTACAGTCTGGTA 139
TRV2_R:CTGTTAGCCCGTGAGTCTAAAAGG