Transformation with Human Dihydrofolate Reductase Renders Malaria Parasites Insensitive to WR99210 but Does Not Affect the Intrinsic Activity of Proguanil

Proc. Natl. Acad. Sci. USA Vol. 94, pp. 10931–10936, September 1997 Medical Sciences

Transformation with human dihydrofolate reductase renders malaria parasites insensitive to WR99210 but does not affect the intrinsic activity of proguanil

DAVID A. FIDOCK*† AND THOMAS E. WELLEMS*‡

*Laboratory of Parasitic Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892-0425; and †Laboratoire de Parasitologie Bio-Me´dicale,Institut Pasteur, 75724 Paris cedex 15, France

Communicated by Louis H. Miller, National Institute of Allergy and Infectious Diseases, Bethesda, MD, July 31, 1997 (received for review June 25, 1997)

ABSTRACT Increasing resistance of Plasmodium falcipa- tolerance (11), the reduction of side effects by administration rum malaria parasites to chloroquine and the dihydrofolate of a pro-drug [PS-15 (12)] and the potency of this drug on the reductase (DHFR) inhibitors pyrimethamine and cycloguanil opportunistic pathogens Pneumocystis carinii (13), Toxoplasma have sparked renewed interest in the antimalarial drugs gondii (14), and Mycobacterium avium complex (15) have led WR99210 and proguanil, the cycloguanil precursor. To inves- to renewed interest in its use. tigate suggestions that WR99210 and proguanil act against a In marked contrast to the clear evidence for the action of target other than the reductase moiety of the P. falciparum pyrimethamine against P. falciparum DHFR, data from vari- bifunctional DHFR–thymidylate synthase enzyme, we have ous studies have suggested that WR99210 might hit another transformed P. falciparum with a variant form of human target in addition to or instead of this enzyme (16). Inhibition DHFR selectable by methotrexate. Human DHFR was found studies demonstrated that although WR99210 resulted in to fully negate the antiparasitic effect of WR99210, thus depletion of dTTP pools (consistent with inhibition of demonstrating that the only significant action of WR99210 is DHFR), addition of 5-formyl tetrahydrofolate (a source of against parasite DHFR. Although the human enzyme also reduced folate) with drug neither restored dTTP levels nor resulted in greater resistance to cycloguanil, no decrease was readily attenuated the effects of WR99210, leading to the found in the level of susceptibility of transformed parasites to proposal that this drug was acting on an alternative enzyme proguanil, thus providing evidence of intrinsic activity of this involved in the folate synthesis and metabolism pathway (17). parent compound against a target other than DHFR. The In a separate study in which DHFR-deficient yeast were transformation system described here has the advantage that transformed with different variants of P. falciparum DHFR, P. falciparum drug-resistant lines are uniformly sensitive to relative differences in the levels of susceptibility to WR99210 methotrexate and will complement transformation with ex- were maintained between these variants in both yeast and P. isting pyrimethamine-resistance markers in functional stud- falciparum (18). However, the IC50 values of this drug were up ies of P. falciparum genes. This system also provides an to 10-fold higher in the transformed yeast, leading to the approach for screening and identifying novel DHFR inhibitors proposal that a second target present in P. falciparum had not that will be important in combined chemotherapeutic formu- been brought over in the transformation (18). The possibility lations against malaria. of a second target has also been thought to explain the slow and difficult appearance of resistance to WR99210 in animal The development and wide use of synthetic antimalarial drugs models (19) and the fact that WR99210 retains full potency on in the latter half of the 20th century has been accompanied by lines resistant to pyrimethamine or cycloguanil (9, 10). the rapid genesis and spread of drug-resistant strains of the A related question has also emerged in studies of proguanil, deadliest of human malaria species, the apicomplexan proto- used since the 1940s to treat falciparum and vivax malaria and zoan Plasmodium falciparum. Among the most serious losses now formulated in combination with the electron transport are chloroquine and the dihydrofolate reductase (DHFR, EC inhibitor atovaquone as the new drug Malarone (20). Progua- 1.5.1.3) inhibitors pyrimethamine and cycloguanil, the latter nil is metabolized to cycloguanil in the liver principally by the being the active metabolite of proguanil. DHFR catalyzes the hepatic cytochrome P450 isoenzyme CYP2C19 (21). Although NADPH-dependent reduction of dihydrofolate to tetrahydro- it is widely assumed that the effect of proguanil is due solely folate, an essential cofactor in de novo nucleotide synthesis. In to activity of the cycloguanil metabolite, and several studies the case of the DHFR inhibitors, several point mutations in the argue strongly that cycloguanil acts upon DHFR (4, 5, 8), early reductase moiety of the bifunctional P. falciparum DHFR– reports described an intrinsic activity of proguanil separate thymidylate synthase (DHFR-TS) enzyme have been linked to from cycloguanil, suggesting inhibition of a separate target. In different profiles of resistance against pyrimethamine or cy- addition, proguanil was found to be equally effective in vitro on cloguanil (1–5). These findings have led to the suggestion that lines of P. falciparum that were either resistant or sensitive to drug-resistant strains might be countered by combinations of cycloguanil (22). When tested in humans or simian models, alternative DHFR inhibitors (4, 6–8). proguanil was found to be 2- to 4-fold more active than the One promising antimalarial compound is the dihydrotri- same concentration of cycloguanil (23, 24), with subsequent azine WR99210, an antifolate that has been found to be studies demonstrating that this was not due to differences in effective against P. falciparum in vitro at exquisitely low rates of metabolism, indicating that a significant part of the concentrations (in the nano- to picomolar range) (9, 10). antimalarial activity resided in the parent compound (25). Although early clinical trials revealed poor absorption and Abbreviations: DHFR-TS, dihydrofolate reductase–thymidylate syn- The publication costs of this article were defrayed in part by page charge thase; MTX, methotrexate. ‡To whom reprint requests should be addressed at: Malaria Genetics payment. This article must therefore be hereby marked ‘‘advertisement’’ in Section, Laboratory of Parasitic Diseases, National Institute of accordance with 18 U.S.C. §1734 solely to indicate this fact. Allergy and Infectious Diseases, National Institutes of Health, Build- © 1997 by The National Academy of Sciences 0027-8424͞97͞9410931-6$2.00͞0 ing 4, Room B1-32, 9000 Rockville Pike, Bethesda, MD 20892-0425. PNAS is available online at http:͞͞www.pnas.org. e-mail: [email protected].

10931 Downloaded by guest on September 29, 2021 10932 Medical Sciences: Fidock and Wellems Proc. Natl. Acad. Sci. USA 94 (1997)

The unambiguous identification and characterization of the Table 1. Luciferase activities of P. falciparum parasite cultures targets of WR99210 and proguanil has important and clear transfected with the reporter construct pHLH-1 using high versus implications for the development and testing of new antima- low voltage settings larial drugs. To directly investigate the role of DHFR in the Luciferase action of these drugs, we have transformed P. falciparum with Exp. Voltage͞capacitance activity* a human DHFR sequence that is innately resistant to antima- larial agents and confers resistance to the folate analog 1 2.5 kV, 25 ␮F 0.91 methotrexate (MTX). This report relates the findings from 0.31 kV, 960 ␮F 3.69 these experiments and discusses their implications for drug 2 2.5 kV, 25 ␮F 3.43 screening and combination chemotherapy. 0.31 kV, 960 ␮F 16.60 3 2.5 kV, 25 ␮F 0.64 0.31 kV, 960 ␮F 6.19 MATERIALS AND METHODS 4 2.5 kV, 25 ␮F 0.19 Plasmid Constructs. The human dhfr gene was amplified 0.31 kV, 960 ␮F 0.73 from a cDNA clone (26) using PCR with the primers 5Ј- *Calculated from duplicate transfected cultures. The wide variation in cctttttatgcatggttcgctaaactgcatcg and 3Ј-aatttcaagcttaatcattct- signal between experiments reflects differences in the quantity of tctcatatacttc. This cDNA encodes the introduced mutation DNA (20–65 ␮g), the initial parasitemia (3–12%), and the parasite Leu 3 Tyr at residue 22 located within the active site (27). This stages predominating in the cultures at the time of transfection. mutation greatly decreases the affinity of MTX for the apoen- ing 100 ng of purified P. falciparum genomic DNA into SURE zyme in the presence of dihydrofolate and NADPH (Ki increase of 3,200 relative to wild-type enzyme) while leading cells (Stratagene) and plating out on Luria–Bertani broth plus ␮ to only minimal loss in catalytic efficiency at physiological pH 100 g͞ml ampicillin. For Southern hybridization analysis, (26). The vector pHD22Y (see Fig. 2A) was generated by plasmid and P. falciparum genomic DNA were digested to inserting the human dhfr gene (as a NsiI–HindIII fragment) in completion and 2 ␮g and 0.2 ng, respectively, were loaded onto the place of the luciferase gene in the pHLH-1 construct (28). a 0.8%, 30-cm agarose gel and run overnight in 1ϫ TAE buffer Expression occurs under the control of the flanking P. falci- at 45 V. Following positive pressure (PosiBlot; Stratagene) parum regulatory elements 5Јhrp3 and 3Јhrp2 (28). transfer onto NylonPlus (Schleicher & Schuell) and prehybrid- ization, the blot was hybridized overnight at 60°C with linear- P. falciparum Transfection, Selection of Transformants, and 32 DNA Analysis. P. falciparum parasites (FCB strain) were ized, P-labeled pBS vector and washed up to a final strin- cultivated as described (29). Transfection of parasites was as gency of 0.3ϫ SSPE͞0.5% SDS at 62°C. The blot was exposed previously reported (28), except for adjustments in the elec- to x-ray film (Kodak Bio-Max) for 30 min at Ϫ70°C. troporator settings to improve the delivery of supercoiled Drug Response Assays. MTX (tissue culture grade) was DNA. These adjustments were made based on results from purchased from Sigma. WR99210 [BRL 6231 (31)], proguanil transfection experiments with the luciferase reporter construct (chlorguanide), and cycloguanil were obtained from W. pHLH-1 (28). Immediately after transfection, electroporated Milhous and D. Kyle (Walter Reed Army Institute of Re- samples were mixed with 10 ml of culture medium [RPMI 1640 search, Washington, DC). All drugs were dissolved in dimethyl with L-glutamine (catalogue no. 31800, Life Technologies, sulfoxide at 5–10 mg͞ml and stored at Ϫ80°C. Working Gaithersburg, MD), 50 mg͞liter hypoxanthine (Sigma), 25 mM solutions (made in complete medium) were kept at 4°C and renewed every week. Drug susceptibilities were determined by Hepes (ultrol grade, Calbiochem), 0.225% NaHCO3 (Bioflu- ids, Rockville, MD), 0.5% Albumax I (Life Technologies), and the method of Thaithong and Beale (32). Parasites were 10 ␮g͞ml gentamycin (Life Technologies)] and grown at 37°C cultured at a starting parasitemia of 0.2–0.4% in 96-well tissue in tissue culture flasks gassed with 5% CO2,5%O2, and 90% culture plates and exposed to drug for 72 hr, with one change N2. For the luciferase assays, parasites were harvested by of medium at 48 hr. Giemsa-stained smears were made at the centrifugation 72 hr later and each culture was lysed for 5 min end of the 72-hr incubation. Parasitemia was calculated after at room temperature with 0.5 ml 1ϫ PBS (pH 7.4) containing counting a total of at least 2,000 red blood cells (RBC) or, in 0.15% saponin. A total of 10 ml 1ϫ PBS was then added and the case of parasitemia Ͻ0.2%, examining 25–30 fields of the sample spun 10 min at 10,000 ϫ g. Following removal of 150–100 RBC͞field. Percentage inhibition of growth and the supernatant and erythrocyte ghosts, the parasite pellet was inhibition constants (IC) were calculated by comparison with washed once with 1.0 ml 1ϫ PBS and transferred to a 1.5-ml parasitemia determined from Ն4,000 cells counted in two Eppendorf tube. After recentrifugation (5 min at 13,000 ϫ g), control wells without drug. remaining ghosts were removed and the pellet was gently resuspended in 50 ␮l1ϫlysis buffer (Promega). To each RESULTS luminometer cuvette was added 100 ␮l luciferin substrate (Promega) at room temperature. Luciferase activity was mea- Uniform Susceptibility to MTX in P. falciparum Isolates sured 30–60 sec following the addition of 20 ␮l of parasite Expressing Known DHFR Variants. To test the possible effect lysate to the cuvette. Initial experiments with low voltage, high of P. falciparum DHFR point mutations on susceptibility to capacitance conditions showed high luciferase activity with MTX [a powerful DHFR inhibitor (33)], we performed drug 0.3–0.32 kV, 960 ␮F, with a steep decrease in signal at lower assays on representative parasite lines chosen to cover the set voltages (data not shown). The settings 0.31 kV, 960 ␮F (used of substitutions reported at five different positions in this with 0.2-cm cuvettes) were subsequently chosen for compari- enzyme (4, 5) (Fig. 1A). Results showed no differences in levels son with the previous values of 2.5 kV, 25 ␮F (ref. 28; of susceptibility, with 50–83% inhibition at 50 nM and 100% employing 0.4-cm cuvettes). The same cell numbers and DNA inhibition at 100 nM (Fig. 1B). These values were reproduced quantities were transfected in the 0.4-cm cuvette (one sample) in tests on FCR-3 and 3B-D5 whose dhfr sequences match and 0.2-cm cuvettes (two transfections of half the sample those of FCB and HB3, respectively (data not shown). each). The low voltage, high capacitance setting was found to Transformation of P. falciparum Erythrocyte Stages with an increase expression signals in transfected parasites by 4- to Episomally Replicating DNA Encoding a Human DHFR Se- 10-fold (Table 1). quence. The transfection vector pHD22Y expresses a human P. falciparum genomic DNA was prepared from 25–100 ml DHFR sequence [containing the highly MTX-resistant L22Y of culture at Ն5% schizonts as described (30). Rescue of substitution (26)] under the regulatory control of P. falciparum plasmids into Escherichia coli was performed by electroporat- promoter and terminator sequences (Fig. 2A). Following Downloaded by guest on September 29, 2021 Medical Sciences: Fidock and Wellems Proc. Natl. Acad. Sci. USA 94 (1997) 10933

FIG.2. (A) Map of the P. falciparum transfection vector pHD22Y expressing the highly MTX-resistant human L22Y dhfr allele under regulatory control of the P. falciparum elements 5Ј-hrp3 and 3Ј-hrp2 (28). (B) Detection of pHD22Y DNA replicated as episomes in transfected P. falciparum.T1ϩMTX genomic DNA (prepared 2 months posttransfection) and DNA from a representative plasmid rescued from T1ϩMTX were restricted with ScaI (S; which cuts once in the vector) or ScaI ϩ DpnI(SϩD; with over a dozen recognition FIG.1. (A) Pyrimethamine and cycloguanil susceptibilities of P. sites) and hybridized with a probe corresponding to the pBluescriptII falciparum lines containing different point mutations in the DHFR SK(ϩ) vector backbone. Although P. falciparum-replicated episomes -Value reflects folate and were resistant to DpnI digestion, digestion of E. coli-replicated plas ,ء .(sequence (ref. 4 and unpublished data p-aminobenzoic acid (PABA) antagonism of the effect of cycloguanil mids resulted in detection of bands of the expected sizes 2.3, 1.0, 0.7, on Dd2 (4). (B) Growth inhibition curves of the five different parasite and 0.3 kb (the largest being fainter as the majority of this fragment lines as a function of MTX concentration. contains 5Ј-hrp3 sequences).

electroporation of this vector into P. falciparum, the culture enzyme produced multiple fragments from E. coli-replicated was split into two lines (T1ϩMTX and T2ϩMTX) and MTX pHD22Y DNA, indicating that the transfected plasmid DNA (2.2 ␮M and 8.8 ␮M, respectively) was added 48 hr later. had been replicating episomally in P. falciparum (Fig. 2B). For Parasites were detected by microscopy at days 16–18 and both sources of replicated DNA, ScaI digestion alone gave the subsequently maintained at a MTX concentration of 8.8 ␮M. expected size of the linearized 5.8-kb construct. Identical These high MTX levels prevented selection of nontransfected results were obtained with DNA from the T2ϩMTX line (data MTX-resistant mutants. Control cultures electroporated with not shown). equivalent amounts of the control vector pHRPCAT (28) and MTX Resistance of P. falciparum Transformed by pHD22Y. maintained under the same MTX levels for as long as 50 days MTX drug assays on lines T1ϩMTX and T2ϩMTX trans- posttransfection showed no parasite growth. formed with the pHD22Y plasmid showed IC values of 100 Plasmid rescue performed on T1ϩMTX and T2ϩMTX 90 ␮M and 400 ␮M, over 4,000-fold higher than the control value genomic DNA prepared 1 and 2 months after transfection ␮ yielded comparable numbers of E. coli transformants (1–1.5 ϫ of 0.1 M found for the nontransfected parental strain FCB 105 cfu͞␮g of genomic DNA), indicating that episomes were (Fig. 3A). The killing curve for the episomally transformed maintained in the transfected cultures. Restriction enzyme and lines extended to even higher concentrations, as viable ring- PCR analyses of a dozen plasmid clones from each rescued stage T2ϩMTX parasites were found to grow even at 1,100 sample showed no DNA rearrangements compared with the ␮M. To confirm that increased resistance was due to episomal pretransfection pHD22Y plasmid (data not shown). To dem- replication of the human dhfr vector, parallel tests were onstrate replication of the episomes by P. falciparum,we conducted on the lines T1-MTX and T2-MTX, which 1 month employed the restriction enzyme DpnI, which depends on earlier had been split from the transformed lines and allowed DNA methylation for cleavage and therefore cuts DNA rep- to propagate in the absence of drug. This regimen results in licated by E. coli but not by P. falciparum (34). Results showed loss of episomes from the parasites due to outgrowth of lack of DpnI cleavage of plasmid sequences present in the daughter progeny lacking these elements (34–36). Without T1ϩMTX parasite genomic DNA preparation, whereas this MTX pressure the pHD22Y episomes were lost and the Downloaded by guest on September 29, 2021 10934 Medical Sciences: Fidock and Wellems Proc. Natl. Acad. Sci. USA 94 (1997)

IG F . 3. Inhibition levels of transfected versus control parasites as FIG. 4. Effect of (A) proguanil and (B) cycloguanil on human a function of (A) MTX and (B) WR99210 concentration, shown in DHFR-transfected versus nontransfected control parasites. Inhibition logarithmic scale (log4). These assays were performed on three levels are shown as a function of drug concentration, shown in ;separate occasions, with similar results. --؋--, FCB; —F—, T1ϩMTX logarithmic scale (log2). These results were confirmed on three ■ ᮀ ;E– -, T1-MTX; — —, T2ϩMTX; — – -, T2-MTX. Lines separate occasions. --؋--, FCB; —F—, T1ϩMTX; —E– -, T1-MTX— T1ϩMTX and T2ϩMTX had been maintained 65 days under MTX —■—, T2ϩMTX; —ᮀ– -, T2-MTX. The inhibitory concentrations pressure whereas lines T1-MTX and T2-MTX were grown for 39 days required for cycloguanil on the parental strain FCB closely matched under pressure and then a further 26 days (13 generations) without those recorded for this same strain by Childs and Lambros (10), though MTX. the concentrations are 10-fold higher than those determined by Peterson et al. (4). Sequencing of the dhfr loci confirmed identity MTX-resistant populations were overgrown by parasites that between FCB used in this study and that previously described (4). had reverted to a fully sensitive phenotype. Human DHFR Complements the Reductase Function of P. 55–71% whereas 100 ␮M resulted in Ͼ98% inhibition. This falciparum DHFR-TS and Fully Negates the Antiparasitic finding for proguanil was in marked contrast to the cycloguanil Effect of WR99210. Transfected and control parasites were response, which was decreased in the transformed parasites compared for their response to the experimental antimalarial (Fig. 4B). Indeed, whereas 1.6 ␮M of cycloguanil inhibited compound WR99210 (Fig. 3B). This drug was found to exert 77–97% of the control parasites FCB, T1-MTX, and T2-MTX, a profound effect on nontransformed parasites at 0.65 nM similar inhibition (75–92%) was only seen at 25 ␮Minthe (87% inhibition) and was fully effective at 2.6 nM, consistent episomally transfected lines (T1 MTX and T2 MTX) and up with values previously reported for the FCB strain (10). In ϩ ϩ contrast, 2,660 nM was required to produce 87% and 62% to 100 ␮M was needed to obtain full inhibition of the inhibition in the T1ϩMTX and T2ϩMTX lines containing the T2ϩMTX line. We can discount the possibility that the effect pHD22Y episomes. Even at concentrations Ͼ5,000 nM, viable of proguanil was due to any conversion into the metabolite transformed parasites were detected (data not shown). Full cycloguanil as otherwise an increase in resistance to proguanil sensitivity to WR99210 was completely restored in parasites would have been observed in the transformed parasites, and that had lost the episomes following removal of MTX pressure. previous data has shown lack of metabolism of proguanil to Evidence that Proguanil Itself Acts on a Target Separate cycloguanil in vitro (22). In the transformed parasites, the 20- from DHFR. Transformed parasites expressing the human to 40-fold reduction in susceptibility to cycloguanil, compared DHFR sequence were found to have no decrease in their level with the 4,000-fold reduction for MTX, is presumably ex- of susceptibility to proguanil (Fig. 4A). Inhibition profiles were plained by the presence of the paired A16V and S108T the same for all cultures tested (transformed and nontrans- mutations in the dhfr locus that reduce binding of cycloguanil formed controls): 50 ␮M resulted in inhibition levels of to the parasite enzyme (8). Downloaded by guest on September 29, 2021 Medical Sciences: Fidock and Wellems Proc. Natl. Acad. Sci. USA 94 (1997) 10935

DISCUSSION proguanil in poor versus extensive metabolizers has recently been confirmed in a large prophylactic study in Vanuatu (A. In the development of antimalarial agents there have been Kaneko, personal communication). These clinical data com- important and unresolved questions regarding the targets and plement and strengthen our transformation results, indicating mechanisms of action of two compounds presumed to affect an intrinsic activity of proguanil that may act on a target the folate pathway. For both of these compounds, WR99210 separate from DHFR. Proguanil in combination with new and proguanil, various lines of evidence have suggested the compounds such as atovaquone may therefore prove to be an chemotherapeutic action was directed against one or more efficient therapeutic tool even in regions where poor metabo- targets independent of the DHFR enzyme. Using the DHFR lizers are frequent or where resistance to cycloguanil already inhibitor MTX, we have selected transformed lines of P. exists. falciparum in which the parasite DHFR activity is supple- In apicomplexan and kinetoplastid protozoa, DHFR resides mented by a MTX-resistant human DHFR. Transformed on the same polypeptide chain as TS. These two enzymes parasites showed a 4,000-fold increase in resistance to both catalyze sequential reactions in the biosynthesis of dTMP. MTX and WR99210. This result demonstrates that the action Evidence for channeling of the dihydrofolate product from the of WR99210 must be against parasite DHFR and is consistent TS moiety to DHFR (47) is thought to support the proposal with previous data indicating the excellent therapeutic window that physical association and coordinated expression of these of this drug (37). Significant inhibition of a second target in P. two enzymes conferred an evolutionary advantage resulting in falciparum by WR99210 is not supported by these results. fixation of the bifunctional dhfr-ts gene (48). While such a WR99210 shows no cross-resistance with pyrimethamine or cycloguanil (refs. 10 and 18; our unpublished results); in fact selection advantage may exist, our results indicate that the one study reported that pyrimethamine-resistant cycloguanil- noncoupled human DHFR enzyme is able to provide the sensitive parasites display collateral hypersensitivity to parasite with sufficient tetrahydrofolate pools at concentra- WR99210 (18). In vivo studies in Aotus monkeys have also tions of MTX (or WR99210) that block the function of the revealed that WR99210 and its pro-drug (which are rapidly parasite DHFR moiety, thus showing that physical association eliminated, possibly favorable for reducing selection pressure of these two crucial enzymes is not a necessity for the parasite. on inducing resistance) are far more potent than proguanil or We also note that complementation of the parasite enzyme by cycloguanil (12). Recently, an in vitro study on alternatives to the human DHFR selectable marker provides the means to pyrimethamine-sulfadoxine (Fansidar; Hoffman–La Roche) genetically manipulate parasites already resistant to py- found the greatest synergistic potency with WR99210 and the rimethamine. Given the uniform susceptibility of P. falciparum dihydropteroate synthase inhibitor dapsone, their inhibitory DHFR variants to MTX, this system will be broadly applicable concentrations being 2–3 orders of magnitude lower than those to in vitro transformation of drug-resistant or -sensitive P. required for pyrimethamine-sulfadoxine (37). The efficacy of falciparum. WR99210 against opportunistic pathogens (13–15, 40) and the Parasites transformed with the human enzyme provide a synergistic effects of combining this drug with sulfa com- potentially powerful resource in the search for DHFR inhib- pounds (38, 39) should help promote pharmaceutical interest itors that are effective against the various mutant forms of P. in WR99210 and may provide an effective addition to the falciparum DHFR. WR99210 is an example of an inhibitor that antimalarial pharmacopoeia. acts with very high and comparable efficiency against known Proguanil contrasts with both cycloguanil and WR99210 in mutant forms of the parasite enzyme while leaving the human that the level of susceptibility is unaltered in human DHFR- enzyme unaffected. Numerous triazines, diaminoquinazolines, transformed parasite lines. These results suggest that proguanil diaminopyrimidines, and pyrrolopyrimidines have been de- has an intrinsic activity independent of DHFR, an activity that scribed (49, 50) and some of these have been shown to be may be an alternative target for the development of antima- effective against forms of parasite DHFR-TS expressed in E. larial drugs. Our data help to explain previous findings that coli or yeast (18, 50, 51). Using P. falciparum transformed with proguanil can be equally effective on cycloguanil-resistant or the human enzyme will now facilitate assessment of the -sensitive parasites and is considerably more effective in relative activities of novel lead compounds against parasite and monkeys than the equivalent dose of cycloguanil (22, 23, 25). host DHFR. Such a system can be expanded to incorporate Watkins et al. (22), however, calculated that the concentrations parasites differing in their drug-resistant profiles and cloned required for parasite inhibition by the parent compound transformants in which the human enzyme sequence is inte- proguanil exceed levels achievable by standard therapeutic grated into the parasite genome. doses and thus proposed that the clinical activity of the drug is due principally to the cycloguanil metabolite. This apparent Note. Since preparation of this manuscript we have identified inte- paradox may be resolved by the recent report that proguanil is gration of the pHD22Y construct into a targeted region of the parasite concentrated in red blood cells (12). genome. This removes the inherent instability of episomes in the transformed lines and provides stable lines that will facilitate the An alternative explanation for the unchanged proguanil screening of novel DHFR inhibitors. response of the transformed parasites is that the parasite and human enzymes could be equally affected by this drug, thereby We are grateful to Anna Liu for technical help. We thank Dr. conferring no increase in resistance from the presence of Raymond Blakley for the human dhfr cDNA clone; Dennis Kyle and human DHFR. We consider this unlikely because proguanil Wilbur Milhous for the antimalarial agents; Kirk Deitsch and Osamu has a high therapeutic window with no serious toxicity even Kaneko for discussions; and Akira Kaneko for sharing unpublished after long-term prophylaxis or administration of exceedingly results. high doses [up to 1,400 mg daily (41)]. Indeed, studies have shown that some individuals convert proguanil to cycloguanil 1. Peterson, D. S., Walliker, D. & Wellems, T. E. (1988) Proc. Natl. very poorly (16), with one large study in Tanzania revealing Acad. Sci. USA 85, 9114–9118. that the proguanil͞cycloguanil ratio varied from 0.8 to 249 2. Cowman, A. F., Morry, M. J., Biggs, B. A., Cross, G. A. & Foote, (42). Poor metabolizers of proguanil can account for up to S. J. (1988) Proc. Natl. Acad. Sci. USA 85, 9109–9113. 3. Zolg, J. W., Plitt, J. R., Chen, G. X. & Palmer, S. (1989) Mol. 70% of the population in endemic areas (43). Importantly, Biochem. Parasitol. 36, 253–262. several studies have indicated that prophylactic failure follow- 4. Peterson, D. S., Milhous, W. K. & Wellems, T. E. (1990) Proc. ing proguanil administration is no more frequent in these poor Natl. Acad. Sci. USA 87, 3018–3022. metabolizers than in extensive metabolizers that actively con- 5. Foote, S. J., Galatis, D. & Cowman, A. F. (1990) Proc. Natl. Acad. vert proguanil to cycloguanil (44–46). Equivalent efficacy of Sci. USA 87, 3014–3017. Downloaded by guest on September 29, 2021 10936 Medical Sciences: Fidock and Wellems Proc. Natl. Acad. Sci. USA 94 (1997)

6. Sirawaraporn, W., Sirawaraporn, R., Cowman, A. F., Yuthavong, 28. Wu, Y., Sifri, C. D., Lei, H. H., Su, X. Z. & Wellems, T. E. (1995) Y. & Santi, D. V. (1990) Biochemistry 29, 10779–10785. Proc. Natl. Acad. Sci. USA 92, 973–977. 7. Wellems, T. E. (1991) Parasitol. Today 7, 110–112. 29. Trager, W. & Jensen, J. B. (1976) Science 193, 673–675. 8. Sirawaraporn, W., Sathitkul, T., Sirawaraporn, R., Yuthavong, Y. 30. Wellems, T. E., Walliker, D., Smith, C. L., do Rosario, V. E., & Santi, D. V. (1997) Proc. Natl. Acad. Sci. USA 94, 1124–1129. Maloy, W. L., Howard, R. J., Carter, R. & McCutchan, T. F. 9. Rieckmann, K. H. (1973) W.H.O. Tech. Rep. Ser. 529, 58. (1987) Cell 49, 633–642. 10. Childs, G. E. & Lambros, C. (1986) Ann. Trop. Med. Parasitol. 80, 31. Knight, D. J. (1981) Ann. Trop. Med. Parasitol. 75, 1–6. 177–181. 32. Thaithong, S. & Beale, G. H. (1981) Trans. R. Soc. Trop. Med. 11. Canfield, C. J. (1986) in Chemotherapy of Malaria, Monograph Hyg. 75, 271–273. Series, ed. Bruce-Chwatt, L. J. (World Health Organization, 33. Huennekens, F. M. (1994) Adv. Enzyme Regul. 34, 397–419. Geneva), Vol. 27, pp. 99–100. 34. Wu, Y., Kirkman, L. A. & Wellems, T. E. (1996) Proc. Natl. Acad. 12. Canfield, C. J., Milhous, W. K., Ager, A. L., Rossan, R. N., Sci. USA 93, 1130–1134. Sweeney, T. R., Lewis, N. J., Jacobus, D. P., Hadiputranto, H., 35. van Dijk, M. R., Waters, A. P. & Janse, C. J. (1995) Science 268, Larasati, R. P., Pudjoprawoto, N., Subianto, B. & Hoffman, S. L. 1358–1362. (1993) Am. J. Trop. Med. Hyg. 49, 121–126. 36. Crabb, B. S. & Cowman, A. F. (1996) Proc. Natl. Acad. Sci. USA 13. Hughes, W. T., Jacobus, D. P., Canfield, C. & Killmar, J. (1993) 93, 7289–7294. Antimicrob. Agents Chemother. 37, 1417–1419. 37. Winstanley, P. A., Mberu, E. K., Szwandt, I. S., Breckenridge, 14. Brun-Pascaud, M., Chau, F., Garry, L., Jacobus, D., Derouin, F. A. M. & Watkins, W. M. (1995) Antimicrob. Agents Chemother. & Girard, P. M. (1996) Antimicrob. Agents Chemother. 40, 39, 948–952. 2067–2070. 38. Scott, H. V., Rieckmann, K. H. & O’Sullivan, W. J. (1987) Trans. 15. Meyer, S. C., Majumder, S. K. & Cynamon, M. H. (1995) R. Soc. Trop. Med. Hyg. 81, 715–721. 45, Antimicrob. Agents Chemother. 39, 1862–1863. 39. Yeo, A. E. & Rieckmann, K. H. (1994) Trop. Med. Parasitol. 136–137. 16. Peters, W. (1987) Chemotherapy and Drug Resistance in Malaria 40. Shah, L. M., DeStefano, M. S. & Cynamon, M. H. (1996) (Academic, London). Antimicrob. Agents Chemother. 40, 2644–2645. 17. Yeo, A. E., Seymour, K. K., Rieckmann, K. H. & Christopherson, 41. Adams, A. R., Maegraith, B. G., King, J. D., Townshend, R. H., R. I. (1997) Ann. Trop. Med. Parasitol. 91, 17–23. Davey, T. H. & Havard, R. E. (1945) Ann. Trop. Med. Parasitol. 18. Wooden, J. M., Hartwell, L. H., Vasquez, B. & Sibley, C. H. 39, 225–231. (1997) Mol. Biochem. Parasitol. 85, 25–40. 42. Skjelbo, E., Mutabingwa, T. K., Bygbjerg, I., Nielsen, K. K., 19. Knight, D. J., Mamalis, P. & Peters, W. (1982) Ann. Trop. Med. Gram, L. F. & Broosen, K. (1996) Clin. Pharmacol. Ther. 59, Parasitol. 76, 1–7. 304–311. 20. Looareesuwan, S., Viravan, C., Webster, H. K., Kyle, D. E., 43. Kaneko, A., Kaneko, O., Taleo, G., Bjorkman, A. & Koba- Hutchinson, D. B. & Canfield, C. J. (1996) Am. J. Trop. Med. Hyg. yakawa, T. (1997) Lancet 349, 921–922. 54, 62–66. 44. Mberu, E. K., Wansor, T., Sato, H., Nishikawa, Y. & Watkins, 21. Wright, J. D., Helsby, N. A. & Ward, S. A. (1995) Br. J. Clin. W. M. (1995) Trans. R. Soc. Trop. Med. Hyg. 89, 658–659. Pharmacol. 39, 441–444. 45. Mutabingwa, T. K., Malle, L. N., de Geus, A. & Oosting, J. (1993) 22. Watkins, W. M., Sixsmith, D. G. & Chulay, J. D. (1984) Ann. Trop. Geogr. Med. 45, 6–14. Trop. Med. Parasitol. 78, 273–278. 46. Ward, S. A., Watkins, W. M., Mberu, E., Saunders, J. E., Koech, 23. Schmidt, L. H., Loo, T. L., Fradkin, R. & Hughes, H. B. (1952) D. K., Gilles, H. M., Howells, R. E. & Breckenridge, A. M. (1989) Proc. Soc. Exp. Biol. Med. 80, 367–370. Br. J. Clin. Pharmacol. 27, 781–787. 24. Robertson, G. I. (1957) Trans. R. Soc. Trop. Med. Hyg. 51, 47. Meek, T. D., Garvey, E. P. & Santi, D. V. (1985) Biochemistry 24, 488–492. 678–686. 25. Smith, C. C., Ihrig, J. & Menne, R. (1961) Am. J. Trop. Med. Hyg. 48. Ivanetich, K. M. & Santi, D. V. (1990) FASEB J. 4, 1591–1597. 10, 694–703. 49. Mamalis, P. & Werbel, L. M. (1984) in Antimalarial Drugs, eds. 26. Lewis, W. S., Cody, V., Galitsky, N., Luft, J. R., Pangborn, W., Peters, W. & Richards, W. (Springer, New York), pp. 387–442. Chunduru, S. K., Spencer, H. T., Appleman, J. R. & Blakley, R. L. 50. Brobey, R. K., Sano, G., Itoh, F., Aso, K., Kimura, M., Mitamura, (1995) J. Biol. Chem. 270, 5057–5064. T. & Horii, T. (1996) Mol. Biochem. Parasitol. 81, 225–237. 27. Matthews, D. A., Alden, R. A., Bolin, J. T., Freer, S. T., Hamlin, 51. Sirawaraporn, W., Prapunwattana, P., Sirawaraporn, R., R., Xuong, N., Kraut, J., Poe, M., Williams, M. & Hoogsteen, K. Yuthavong, Y. & Santi, D. V. (1993) J. Biol. Chem. 268, 21637– (1977) Science 197, 452–455. 21644. Downloaded by guest on September 29, 2021