Proc. Natl. Acad. Sci. USA Vol. 94, pp. 10931–10936, September 1997 Medical Sciences Transformation with human dihydrofolate reductase renders malaria parasites insensitive to WR99210 but does not affect the intrinsic activity of proguanil DAVID A. FIDOCK*† AND THOMAS E. WELLEMS*‡ *Laboratory of Parasitic Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892-0425; and †Laboratoire de Parasitologie Bio-Me´dicale,Institut Pasteur, 75724 Paris cedex 15, France Communicated by Louis H. Miller, National Institute of Allergy and Infectious Diseases, Bethesda, MD, July 31, 1997 (received for review June 25, 1997) ABSTRACT Increasing resistance of Plasmodium falcipa- tolerance (11), the reduction of side effects by administration rum malaria parasites to chloroquine and the dihydrofolate of a pro-drug [PS-15 (12)] and the potency of this drug on the reductase (DHFR) inhibitors pyrimethamine and cycloguanil opportunistic pathogens Pneumocystis carinii (13), Toxoplasma have sparked renewed interest in the antimalarial drugs gondii (14), and Mycobacterium avium complex (15) have led WR99210 and proguanil, the cycloguanil precursor. To inves- to renewed interest in its use. tigate suggestions that WR99210 and proguanil act against a In marked contrast to the clear evidence for the action of target other than the reductase moiety of the P. falciparum pyrimethamine against P. falciparum DHFR, data from vari- bifunctional DHFR–thymidylate synthase enzyme, we have ous studies have suggested that WR99210 might hit another transformed P. falciparum with a variant form of human target in addition to or instead of this enzyme (16). Inhibition DHFR selectable by methotrexate. Human DHFR was found studies demonstrated that although WR99210 resulted in to fully negate the antiparasitic effect of WR99210, thus depletion of dTTP pools (consistent with inhibition of demonstrating that the only significant action of WR99210 is DHFR), addition of 5-formyl tetrahydrofolate (a source of against parasite DHFR. Although the human enzyme also reduced folate) with drug neither restored dTTP levels nor resulted in greater resistance to cycloguanil, no decrease was readily attenuated the effects of WR99210, leading to the found in the level of susceptibility of transformed parasites to proposal that this drug was acting on an alternative enzyme proguanil, thus providing evidence of intrinsic activity of this involved in the folate synthesis and metabolism pathway (17). parent compound against a target other than DHFR. The In a separate study in which DHFR-deficient yeast were transformation system described here has the advantage that transformed with different variants of P. falciparum DHFR, P. falciparum drug-resistant lines are uniformly sensitive to relative differences in the levels of susceptibility to WR99210 methotrexate and will complement transformation with ex- were maintained between these variants in both yeast and P. isting pyrimethamine-resistance markers in functional stud- falciparum (18). However, the IC50 values of this drug were up ies of P. falciparum genes. This system also provides an to 10-fold higher in the transformed yeast, leading to the approach for screening and identifying novel DHFR inhibitors proposal that a second target present in P. falciparum had not that will be important in combined chemotherapeutic formu- been brought over in the transformation (18). The possibility lations against malaria. of a second target has also been thought to explain the slow and difficult appearance of resistance to WR99210 in animal The development and wide use of synthetic antimalarial drugs models (19) and the fact that WR99210 retains full potency on in the latter half of the 20th century has been accompanied by lines resistant to pyrimethamine or cycloguanil (9, 10). the rapid genesis and spread of drug-resistant strains of the A related question has also emerged in studies of proguanil, deadliest of human malaria species, the apicomplexan proto- used since the 1940s to treat falciparum and vivax malaria and zoan Plasmodium falciparum. Among the most serious losses now formulated in combination with the electron transport are chloroquine and the dihydrofolate reductase (DHFR, EC inhibitor atovaquone as the new drug Malarone (20). Progua- 1.5.1.3) inhibitors pyrimethamine and cycloguanil, the latter nil is metabolized to cycloguanil in the liver principally by the being the active metabolite of proguanil. DHFR catalyzes the hepatic cytochrome P450 isoenzyme CYP2C19 (21). Although NADPH-dependent reduction of dihydrofolate to tetrahydro- it is widely assumed that the effect of proguanil is due solely folate, an essential cofactor in de novo nucleotide synthesis. In to activity of the cycloguanil metabolite, and several studies the case of the DHFR inhibitors, several point mutations in the argue strongly that cycloguanil acts upon DHFR (4, 5, 8), early reductase moiety of the bifunctional P. falciparum DHFR– reports described an intrinsic activity of proguanil separate thymidylate synthase (DHFR-TS) enzyme have been linked to from cycloguanil, suggesting inhibition of a separate target. In different profiles of resistance against pyrimethamine or cy- addition, proguanil was found to be equally effective in vitro on cloguanil (1–5). These findings have led to the suggestion that lines of P. falciparum that were either resistant or sensitive to drug-resistant strains might be countered by combinations of cycloguanil (22). When tested in humans or simian models, alternative DHFR inhibitors (4, 6–8). proguanil was found to be 2- to 4-fold more active than the One promising antimalarial compound is the dihydrotri- same concentration of cycloguanil (23, 24), with subsequent azine WR99210, an antifolate that has been found to be studies demonstrating that this was not due to differences in effective against P. falciparum in vitro at exquisitely low rates of metabolism, indicating that a significant part of the concentrations (in the nano- to picomolar range) (9, 10). antimalarial activity resided in the parent compound (25). Although early clinical trials revealed poor absorption and Abbreviations: DHFR-TS, dihydrofolate reductase–thymidylate syn- The publication costs of this article were defrayed in part by page charge thase; MTX, methotrexate. ‡To whom reprint requests should be addressed at: Malaria Genetics payment. This article must therefore be hereby marked ‘‘advertisement’’ in Section, Laboratory of Parasitic Diseases, National Institute of accordance with 18 U.S.C. §1734 solely to indicate this fact. Allergy and Infectious Diseases, National Institutes of Health, Build- © 1997 by The National Academy of Sciences 0027-8424y97y9410931-6$2.00y0 ing 4, Room B1-32, 9000 Rockville Pike, Bethesda, MD 20892-0425. PNAS is available online at http:yywww.pnas.org. e-mail: [email protected]. 10931 Downloaded by guest on September 29, 2021 10932 Medical Sciences: Fidock and Wellems Proc. Natl. Acad. Sci. USA 94 (1997) The unambiguous identification and characterization of the Table 1. Luciferase activities of P. falciparum parasite cultures targets of WR99210 and proguanil has important and clear transfected with the reporter construct pHLH-1 using high versus implications for the development and testing of new antima- low voltage settings larial drugs. To directly investigate the role of DHFR in the Luciferase action of these drugs, we have transformed P. falciparum with Exp. Voltageycapacitance activity* a human DHFR sequence that is innately resistant to antima- larial agents and confers resistance to the folate analog 1 2.5 kV, 25 mF 0.91 methotrexate (MTX). This report relates the findings from 0.31 kV, 960 mF 3.69 these experiments and discusses their implications for drug 2 2.5 kV, 25 mF 3.43 screening and combination chemotherapy. 0.31 kV, 960 mF 16.60 3 2.5 kV, 25 mF 0.64 0.31 kV, 960 mF 6.19 MATERIALS AND METHODS 4 2.5 kV, 25 mF 0.19 Plasmid Constructs. The human dhfr gene was amplified 0.31 kV, 960 mF 0.73 from a cDNA clone (26) using PCR with the primers 59- *Calculated from duplicate transfected cultures. The wide variation in cctttttatgcatggttcgctaaactgcatcg and 39-aatttcaagcttaatcattct- signal between experiments reflects differences in the quantity of tctcatatacttc. This cDNA encodes the introduced mutation DNA (20–65 mg), the initial parasitemia (3–12%), and the parasite Leu 3 Tyr at residue 22 located within the active site (27). This stages predominating in the cultures at the time of transfection. mutation greatly decreases the affinity of MTX for the apoen- ing 100 ng of purified P. falciparum genomic DNA into SURE zyme in the presence of dihydrofolate and NADPH (Ki increase of 3,200 relative to wild-type enzyme) while leading cells (Stratagene) and plating out on Luria–Bertani broth plus m to only minimal loss in catalytic efficiency at physiological pH 100 gyml ampicillin. For Southern hybridization analysis, (26). The vector pHD22Y (see Fig. 2A) was generated by plasmid and P. falciparum genomic DNA were digested to inserting the human dhfr gene (as a NsiI–HindIII fragment) in completion and 2 mg and 0.2 ng, respectively, were loaded onto the place of the luciferase gene in the pHLH-1 construct (28). a 0.8%, 30-cm agarose gel and run overnight in 13 TAE buffer Expression occurs under the control of the flanking P. falci- at 45 V. Following positive pressure (PosiBlot; Stratagene) parum regulatory elements 59hrp3 and 39hrp2 (28). transfer onto NylonPlus (Schleicher & Schuell) and prehybrid- ization, the blot was hybridized overnight at 60°C with linear- P. falciparum Transfection, Selection of Transformants, and 32 DNA Analysis. P. falciparum parasites (FCB strain) were ized, P-labeled pBS vector and washed up to a final strin- cultivated as described (29). Transfection of parasites was as gency of 0.33 SSPEy0.5% SDS at 62°C. The blot was exposed previously reported (28), except for adjustments in the elec- to x-ray film (Kodak Bio-Max) for 30 min at 270°C. troporator settings to improve the delivery of supercoiled Drug Response Assays. MTX (tissue culture grade) was DNA.