DOCSLIB.ORG

Shox2 Is Required for the Proper Development of the Facial Motor

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Shox2 Is Required for the Proper Development of the Facial Motor Rosin et al. BMC Neurosci (2015) 16:39 DOI 10.1186/s12868-015-0176-0 RESEARCH ARTICLE Open Access Shox2 is required for the proper development of the facial motor nucleus and the establishment of the facial nerves Jessica M Rosin1, Deborah M Kurrasch2† and John Cobb1*† Abstract Background: Axons from the visceral motor neurons (vMNs) project from nuclei in the hindbrain to innervate autonomic ganglia and branchial arch-derived muscles. Although much is known about the events that govern specification of somatic motor neurons, the genetic pathways responsible for the development of vMNs are less well characterized. We know that vMNs, like all motor neurons, depend on sonic hedgehog signaling for their generation. Similarly, the paired-like homeobox 2b (Phox2b) gene, which is expressed in both proliferating progenitors and post- mitotic motor neurons, is essential for the development of vMNs. Given that our previous study identified a novel role for the short stature homeobox 2 (Shox2) gene in the hindbrain, and since SHOX2 has been shown to regulate transcription of islet 1 (Isl1), an important regulator of vMN development, we sought to determine whether Shox2 is required for the proper development of the facial motor nucleus. Results: Using a Nestin-Cre driver, we show that elimination of Shox2 throughout the brain results in elevated cell death in the facial motor nucleus at embryonic day 12.5 (E12.5) and E14.5, which correlates with impaired axonal projection properties of vMNs. We also observed changes in the spatial expression of the vMN cell fate factors Isl1 and Phox2b, and concomitant defects in Shh and Ptch1 expression in Shox2 mutants. Furthermore, we demonstrate that elimination of Shox2 results in the loss of dorsomedial and ventromedial subnuclei by postnatal day 0 (P0), which may explain the changes in physical activity and impaired feeding/nursing behavior in Shox2 mutants. Conclusions: Combined, our data show that Shox2 is required for development of the facial motor nucleus and its associated facial (VII) nerves, and serves as a new molecular tool to probe the genetic programs of this understudied hindbrain region. Keywords: Short stature homeobox 2 (Shox2) gene, Islet 1 (Isl1), Sonic hedgehog (Shh), Visceral motor neurons (vMNs), Facial motor nucleus, Facial (VII) nerves Background homeotic (Hox) gene clusters [3–6]. Motor neuron pro- In the hindbrain, motor neuron progenitors are born in genitors in the hindbrain can differentiate into somato- a region-specific manner, neighboring the floor plate, motor neurons (sMNs), which innervate the skeletal in response to their level of exposure to different mor- muscles of the body, or visceromotor neurons (vMNs), phogenetic gradients [1, 2]. These neuronal progenitors which innervate autonomic ganglia (general vMNs) and differentiate in a rhombomere-specific pattern, which branchial arch-derived muscles (special vMNs) [3, 7, 8]. requires the correct spatiotemporal expression of the Facial (VII) motor neurons, which originate from rhom- bomeres 4/5, belong to the vMN class of motor neurons. At embryonic day 11.25 (E11.25), facial motor neurons *Correspondence: [email protected] begin to migrate caudally to the pial side of the hindbrain †Deborah M Kurrasch and John Cobb contributed equally to this work 1 Department of Biological Sciences, University of Calgary, 2500 University to form the facial motor nucleus, which subsequently Drive N.W., BI286D, Calgary, AB T2N 1N4, Canada segregates into two lobes [6, 9, 10]. Despite the elucida- Full list of author information is available at the end of the article tion of the genetic mechanisms that specify sMN identity, © 2015 Rosin et al. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/ publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Rosin et al. BMC Neurosci (2015) 16:39 Page 2 of 17 the corresponding pathways responsible for the estab- to regulate transcription of Isl1 [34], an important regu- lishment of vMNs are less well understood. Furthermore, lator of vMN development [7, 8, 19, 22]. In the current even though sonic hedgehog (SHH) signaling is known to study we show that conditional inactivation of Shox2 in be required for the development of all motor neurons [7, the brain results in impaired axonal projections of vMNs 11–15], the upstream regulators of Shh expression and and a concomitant loss of medially located neurons in the function during late embryonic and early postnatal devel- facial motor nucleus postnatally. Furthermore, we dem- opment, especially within the vMNs of the facial motor onstrate that Shox2-mutant neonates display impaired nucleus, remain largely unknown [16]. feeding behavior, perhaps due to facial paralysis as a The paired-like homeobox 2b (Phox2b) gene is result of improper development and function of the facial expressed in both proliferating progenitors and post- nerves. mitotic motor neurons and is required for the develop- ment of vMNs [17, 18]. Similarly, the homeodomain Results transcription factor islet1 (ISL1), which is expressed in Shox2 expression in the face and facial motor nucleus both post-mitotic sMNs and vMNs, plays a broad role during development in motor neuron identity and specification [7, 8, 17, 19, Whole-mount in situ hybridization (WISH) at E11.5 20]. In the absence of Isl1, mice die during embryogenesis showed Shox2 expression in the trigeminal (V) and facial around E11.5. This embryonic lethality is associated with (VII) ganglia, in addition to the developing maxillary an increase in cell death in the hindbrain and neural tube, process and mandibular arch (Figure 1a). Shox2 contin- suggesting that loss of Isl1 function results in the death of ued to be expressed in the trigeminal (V) ganglia, max- cells that were fated to differentiate into motor neurons illary process and mandibular arch at E12.5 (Figure 1b). [19]. In the trigeminal and dorsal root ganglia (DRG), Isl1 We also visualized the Shox2 expression pattern with appears to play distinct roles during early (i.e. neurogen- a novel Shox2lacz allele (described in “Methods”). X-gal esis) versus late (i.e. subtype specification) development staining of embryos carrying the Shox2lacz allele accu- [21]. In cranial ganglia, Isl1 is required for cell survival rately reproduced the endogenous Shox2 expression and Isl1 mutants show thinner blunted facial (VII) gan- pattern with increased sensitivity and less background glia [22]. However, the precise role of Isl1 in these cell compared to WISH (Additional file 1: Figure S1). At types and in their respective hindbrain nuclei, such as the E10.5, Shox2lacZ/+ embryos showed lacZ staining in the facial motor nucleus, remains poorly documented. trigeminal (V) and facial (VII) ganglia of the embryo The adult facial motor nucleus contains seven subnu- (Figure 1f). Similarly at E11.5, lacZ staining was vis- clei; the lateral, dorsolateral, dorsal intermediate, ventral ible in the trigeminal (V) and facial (VII) nerves of the intermediate, dorsomedial and ventromedial nuclei are embryo, in addition to the maxillary process and man- located within the main nucleus, while the seventh, the dibular arch (Figure 1g). LacZ continued to be expressed dorsal accessory nuclei, is located above the main nucleus in the trigeminal (V) ganglion of the embryonic face [23, 24]. Neurons innervating the nasolabial musculature from E12.5 to E13.5, and could be seen in the developing are located in the lateral facial motor nucleus, while neu- pharyngeal arch (Figure 1h, i). At E14.5 lacZ expression rons supplying the auricular musculature are located in was present in the facial mesenchyme that contributes the medial facial motor nucleus [23, 24]. Together the to the maxilla and mandible (Figure 1j). However, from lateral, intermediate and medial subnuclei comprise 43, E12.5 onward lacZ staining was no longer observed 27.1, and 28.7%, respectively, of the motor neurons in in the facial (VII) ganglia (Figure 1h–j). Postnatally the adult facial motor nucleus, with the dorsal accessory (P0) lacZ expression was maintained in the facial mes- nuclei contributing the final 1.2% [23]. enchyme surrounding the facial (VII) nerves, but not Studies with mouse knockout models have shown within the axons themselves (Figure 1k). Examination of that Shox2 is required for normal development of the Shox2 expression early embryonically in the developing humerus and femur [25–27], the anterior palate [28], the brain showed Shox2 staining in a region of post-mitotic temporomandibular joint of the jaws [29], the sinoatrial neurons adjacent to the floor plate (Additional file 2: Fig- valves and pacemaker region of the heart [30, 31], and ure S2A–B), a region where Phox2b+/Isl1+ are localized TrkB-positive mechanosensory neurons of the dorsal (Additional file 2: Figure S2C–E) [18]. Later in the P0 root ganglia [32]. Most recently, Shox2 has been shown brain, Shox2 was expressed in the facial motor nucleus to play an important role in development of the inferior (Figure 1c–e). Similarly, in Shox2lacZ/+ animals, lacZ colliculus and cerebellum [33]. We suspected a function staining was strongly expressed in both the lateral and for Shox2 during facial motor nucleus development given medial lobes of the facial motor nucleus (Figure 1l–o); our previous study demonstrating a novel role for Shox2 however, staining was not visible within the trigeminal in the hindbrain [33], and since SHOX2 has been shown nucleus (Figure 1n, arrowhead). Rosin et al. BMC Neurosci (2015) 16:39 Page 3 of 17 Figure 1 Shox2 mRNA and lacZ expression in the developing embryonic face and postnatal facial motor nucleus.
Load more

Recommended publications
  • Non-Canonical Notch Signaling During Early Heart Development
    Non-Canonical Notch Signaling During Early Heart Development By Matthew Miyamoto A thesis submitted to Johns Hopkins University in conformity with the requirements for the degree of Master of Science Baltimore, Maryland May 2017 ©2017 Matthew Miyamoto All Rights Reserved Abstract: The canonical Notch signaling pathway has been studied extensively and plays a key role during embryonic development. Recent evidence points to the existence of a non-canonical function of the Notch protein. Elucidation of a non-canonical Notch signaling pathway would significantly alter how the Notch protein is viewed in biological systems. Perhaps more importantly, the identification of downstream effectors could lead to discovery of novel gene networks functioning throughout development. One potential downstream effector of non-canonical Notch is Numb, which interacts with Notch during development. We provide evidence of the existence of a non-canonical pathway in both the embryonic stem cell and during early heart development. By developing two models that alter either the Notch protein or the canonical Notch signaling pathway, we studied non-canonical Notch signaling in vitro and in vivo. Upon overexpression of a tethered form of Notch, which cannot initiate canonical Notch signaling, we observed remarkable apoptosis in embryonic stem cells. Furthermore, Notch overexpression during early heart development led to decreased heart size due to decreased myocyte proliferation when the essential transcription factor to canonical Notch signaling, RBP-j, was knocked out. Similar phenotypes observed in a Numb knockout setting led us to hypothesize that an interaction between Numb and Notch is involved in heart development. Elucidation of a non-canonical Notch signaling pathway may lead to not only a better understanding of congenital heart disease, but also development of other organ systems, as well.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • A Mouse Model for Human Short-Stature Syndromes Identifies Shox2 As an Upstream Regulator of Runx2 During Long-Bone Development
    A mouse model for human short-stature syndromes identifies Shox2 as an upstream regulator of Runx2 during long-bone development John Cobb*, Andre´ e Dierich†, Yolande Huss-Garcia†, and Denis Duboule*‡ *Department of Zoology and Animal Biology and National Research Center ‘‘Frontiers in Genetics,’’ Sciences III, University of Geneva, Quai Ernest Ansermet 30, 1211 Geneva 4, Switzerland; and †Institut de Ge´ne´ tique et de Biologie Mole´culaire et Cellulaire͞Institut Clinique de la Souris, Centre National de la Recherche Scientifique͞Institut National de la Sante´et de la Recherche Me´dicale͞Universite´Louis Pasteur͞Colle`ge de France, BP 10142, 67404 Strasbourg, France Edited by Pierre Chambon, Institut de Ge´ne´ tique et de Biologie Mole´culaire, Strasbourg, France, and approved January 11, 2006 (received for review December 7, 2005) Deficiencies or mutations in the human pseudoautosomal SHOX wall up to the hand plate (8), from which it is excluded, thus gene are associated with a series of short-stature conditions, recapitulating the expression of both human SHOX and SHOX2 including Turner syndrome, Leri–Weill dyschondrosteosis, and and further suggesting that it displays a function in developing Langer mesomelic dysplasia. Although this gene is absent from the limbs related to that of its two human counterparts. mouse genome, the closely related paralogous gene Shox2 dis- We identified Shox2 as a candidate target gene of HOXD plays a similar expression pattern in developing limbs. Here, we proteins in developing distal limbs by using a microarray screen report that the conditional inactivation of Shox2 in developing (9). Shox2 appeared up-regulated in the presumptive digit do- appendages leads to a strong phenotype, similar to the human main after deletion of the Hoxd gene cluster, indicating a conditions, although it affects a different proximodistal limb seg- potential repressive effect of Hoxd genes on Shox2 transcription ment.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Spatial Distribution of Leading Pacemaker Sites in the Normal, Intact Rat Sinoa
    Supplementary Material Supplementary Figure 1: Spatial distribution of leading pacemaker sites in the normal, intact rat sinoatrial 5 nodes (SAN) plotted along a normalized y-axis between the superior vena cava (SVC) and inferior vena 6 cava (IVC) and a scaled x-axis in millimeters (n = 8). Colors correspond to treatment condition (black: 7 baseline, blue: 100 µM Acetylcholine (ACh), red: 500 nM Isoproterenol (ISO)). 1 Supplementary Figure 2: Spatial distribution of leading pacemaker sites before and after surgical 3 separation of the rat SAN (n = 5). Top: Intact SAN preparations with leading pacemaker sites plotted during 4 baseline conditions. Bottom: Surgically cut SAN preparations with leading pacemaker sites plotted during 5 baseline conditions (black) and exposure to pharmacological stimulation (blue: 100 µM ACh, red: 500 nM 6 ISO). 2 a &DUGLDFIoQChDQQHOV .FQM FOXVWHU &DFQDG &DFQDK *MD &DFQJ .FQLS .FQG .FQK .FQM &DFQDF &DFQE .FQM í $WSD .FQD .FQM í .FQN &DVT 5\U .FQM &DFQJ &DFQDG ,WSU 6FQD &DFQDG .FQQ &DFQDJ &DFQDG .FQD .FQT 6FQD 3OQ 6FQD +FQ *MD ,WSU 6FQE +FQ *MG .FQN .FQQ .FQN .FQD .FQE .FQQ +FQ &DFQDD &DFQE &DOP .FQM .FQD .FQN .FQG .FQN &DOP 6FQD .FQD 6FQE 6FQD 6FQD ,WSU +FQ 6FQD 5\U 6FQD 6FQE 6FQD .FQQ .FQH 6FQD &DFQE 6FQE .FQM FOXVWHU V6$1 L6$1 5$ /$ 3 b &DUGLDFReFHSWRUV $GUDF FOXVWHU $GUDD &DY &KUQE &KUP &KJD 0\O 3GHG &KUQD $GUE $GUDG &KUQE 5JV í 9LS $GUDE 7SP í 5JV 7QQF 3GHE 0\K $GUE *QDL $QN $GUDD $QN $QN &KUP $GUDE $NDS $WSE 5DPS &KUP 0\O &KUQD 6UF &KUQH $GUE &KUQD FOXVWHU V6$1 L6$1 5$ /$ 4 c 1HXURQDOPURWHLQV
    [Show full text]
  • Epigenetic Services Citations
    Active Motif Epigenetic Services Publications The papers below contain data generated by Active Motif’s Epigenetic Services team. To learn more about our services, please give us a call or visit us at www.activemotif.com/services. Technique Target Journal Year Reference Justin C. Boucher et al. CD28 Costimulatory Domain- ATAC-Seq, Cancer Immunol. Targeted Mutations Enhance Chimeric Antigen Receptor — 2021 RNA-Seq Res. T-cell Function. Cancer Immunol. Res. doi: 10.1158/2326- 6066.CIR-20-0253. Satvik Mareedu et al. Sarcolipin haploinsufficiency Am. J. Physiol. prevents dystrophic cardiomyopathy in mdx mice. RNA-Seq — Heart Circ. 2021 Am J Physiol Heart Circ Physiol. doi: 10.1152/ Physiol. ajpheart.00601.2020. Gabi Schutzius et al. BET bromodomain inhibitors regulate Nature Chemical ChIP-Seq BRD4 2021 keratinocyte plasticity. Nat. Chem. Biol. doi: 10.1038/ Biology s41589-020-00716-z. Siyun Wang et al. cMET promotes metastasis and ChIP-qPCR FOXO3 J. Cell Physiol. 2021 epithelial-mesenchymal transition in colorectal carcinoma by repressing RKIP. J. Cell Physiol. doi: 10.1002/jcp.30142. Sonia Iyer et al. Genetically Defined Syngeneic Mouse Models of Ovarian Cancer as Tools for the Discovery of ATAC-Seq — Cancer Discovery 2021 Combination Immunotherapy. Cancer Discov. doi: doi: 10.1158/2159-8290 Vinod Krishna et al. Integration of the Transcriptome and Genome-Wide Landscape of BRD2 and BRD4 Binding BRD2, BRD4, RNA Motifs Identifies Key Superenhancer Genes and Reveals ChIP-Seq J. Immunol. 2021 Pol II the Mechanism of Bet Inhibitor Action in Rheumatoid Arthritis Synovial Fibroblasts. J. Immunol. doi: doi: 10.4049/ jimmunol.2000286. Daniel Haag et al.
    [Show full text]
  • Download (PDF)
    Supplemental Information Biological and Pharmaceutical Bulletin Promoter Methylation Profiles between Human Lung Adenocarcinoma Multidrug Resistant A549/Cisplatin (A549/DDP) Cells and Its Progenitor A549 Cells Ruiling Guo, Guoming Wu, Haidong Li, Pin Qian, Juan Han, Feng Pan, Wenbi Li, Jin Li, and Fuyun Ji © 2013 The Pharmaceutical Society of Japan Table S1. Gene categories involved in biological functions with hypomethylated promoter identified by MeDIP-ChIP analysis in lung adenocarcinoma MDR A549/DDP cells compared with its progenitor A549 cells Different biological Genes functions transcription factor MYOD1, CDX2, HMX1, THRB, ARNT2, ZNF639, HOXD13, RORA, FOXO3, HOXD10, CITED1, GATA1, activity HOXC6, ZGPAT, HOXC8, ATOH1, FLI1, GATA5, HOXC4, HOXC5, PHTF1, RARB, MYST2, RARG, SIX3, FOXN1, ZHX3, HMG20A, SIX4, NR0B1, SIX6, TRERF1, DDIT3, ASCL1, MSX1, HIF1A, BAZ1B, MLLT10, FOXG1, DPRX, SHOX, ST18, CCRN4L, TFE3, ZNF131, SOX5, TFEB, MYEF2, VENTX, MYBL2, SOX8, ARNT, VDR, DBX2, FOXQ1, MEIS3, HOXA6, LHX2, NKX2-1, TFDP3, LHX6, EWSR1, KLF5, SMAD7, MAFB, SMAD5, NEUROG1, NR4A1, NEUROG3, GSC2, EN2, ESX1, SMAD1, KLF15, ZSCAN1, VAV1, GAS7, USF2, MSL3, SHOX2, DLX2, ZNF215, HOXB2, LASS3, HOXB5, ETS2, LASS2, DLX5, TCF12, BACH2, ZNF18, TBX21, E2F8, PRRX1, ZNF154, CTCF, PAX3, PRRX2, CBFA2T2, FEV, FOS, BARX1, PCGF2, SOX15, NFIL3, RBPJL, FOSL1, ALX1, EGR3, SOX14, FOXJ1, ZNF92, OTX1, ESR1, ZNF142, FOSB, MIXL1, PURA, ZFP37, ZBTB25, ZNF135, HOXC13, KCNH8, ZNF483, IRX4, ZNF367, NFIX, NFYB, ZBTB16, TCF7L1, HIC1, TSC22D1, TSC22D2, REXO4, POU3F2, MYOG, NFATC2, ENO1,
    [Show full text]
  • Downregulation of Carnitine Acyl-Carnitine Translocase by Mirnas
    Page 1 of 288 Diabetes 1 Downregulation of Carnitine acyl-carnitine translocase by miRNAs 132 and 212 amplifies glucose-stimulated insulin secretion Mufaddal S. Soni1, Mary E. Rabaglia1, Sushant Bhatnagar1, Jin Shang2, Olga Ilkayeva3, Randall Mynatt4, Yun-Ping Zhou2, Eric E. Schadt6, Nancy A.Thornberry2, Deborah M. Muoio5, Mark P. Keller1 and Alan D. Attie1 From the 1Department of Biochemistry, University of Wisconsin, Madison, Wisconsin; 2Department of Metabolic Disorders-Diabetes, Merck Research Laboratories, Rahway, New Jersey; 3Sarah W. Stedman Nutrition and Metabolism Center, Duke Institute of Molecular Physiology, 5Departments of Medicine and Pharmacology and Cancer Biology, Durham, North Carolina. 4Pennington Biomedical Research Center, Louisiana State University system, Baton Rouge, Louisiana; 6Institute for Genomics and Multiscale Biology, Mount Sinai School of Medicine, New York, New York. Corresponding author Alan D. Attie, 543A Biochemistry Addition, 433 Babcock Drive, Department of Biochemistry, University of Wisconsin-Madison, Madison, Wisconsin, (608) 262-1372 (Ph), (608) 263-9608 (fax), [email protected]. Running Title: Fatty acyl-carnitines enhance insulin secretion Abstract word count: 163 Main text Word count: 3960 Number of tables: 0 Number of figures: 5 Diabetes Publish Ahead of Print, published online June 26, 2014 Diabetes Page 2 of 288 2 ABSTRACT We previously demonstrated that micro-RNAs 132 and 212 are differentially upregulated in response to obesity in two mouse strains that differ in their susceptibility to obesity-induced diabetes. Here we show the overexpression of micro-RNAs 132 and 212 enhances insulin secretion (IS) in response to glucose and other secretagogues including non-fuel stimuli. We determined that carnitine acyl-carnitine translocase (CACT, Slc25a20) is a direct target of these miRNAs.
    [Show full text]
  • Detection of SHOX2 DNA Methylation by Methylation-Specific PCR in Non-Small Cell Lung Cancer
    6077 Original Article Detection of SHOX2 DNA methylation by methylation-specific PCR in non-small cell lung cancer Hongxiang Feng1#, Weipeng Shao2#, Lanfang Du3#, Xin Qing4, Zhenrong Zhang1, Chaoyang Liang1, Deruo Liu1 1Department of Thoracic Surgery, China-Japan Friendship Hospital, Beijing, China; 2Department of Thoracic Surgery, Peking University China- Japan Friendship School of Clinical Medicine and China-Japan Friendship Hospital, Beijing, China; 3Department of Emergency, Peking University Third Hospital, Beijing, China; 4Department of Pathology, Harbor-UCLA Medical Center, Torrance, CA, USA Contributions: (I) Conception and design: W Shao, H Feng, L Du, D Liu; (II) Administrative support: D Liu, X Qing; (III) Provision of study materials or patients: All authors; (IV) Collection and assembly of data: W Shao, H Feng, L Du; (V) Data analysis and interpretation: W Shao, H Feng, L Du; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. #These authors contributed equally to this work. Correspondence to: Deruo Liu. Department of Thoracic Surgery, China-Japan Friendship Hospital, No. 2, Yinghua, East Rd, Beijing, China. Email: [email protected]. Background: Lung cancer is the leading cause of cancer-related death worldwide. Short stature homeobox 2 (SHOX2) methylation detected by real-time polymerase chain reaction (PCR) has recently been demonstrated to be a potential biomarker in the diagnosis of lung cancer. However, more cost-effective methods are still needed to help cancer detection in the early stage of lung cancer. The aim of this study was to examine the methylation status of the SHOX2 gene and to investigate its diagnostic value in non-small cell lung cancer (NSCLC) patients.
    [Show full text]
  • Discerning the Role of Foxa1 in Mammary Gland
    DISCERNING THE ROLE OF FOXA1 IN MAMMARY GLAND DEVELOPMENT AND BREAST CANCER by GINA MARIE BERNARDO Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Dissertation Adviser: Dr. Ruth A. Keri Department of Pharmacology CASE WESTERN RESERVE UNIVERSITY January, 2012 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of Gina M. Bernardo ______________________________________________________ Ph.D. candidate for the ________________________________degree *. Monica Montano, Ph.D. (signed)_______________________________________________ (chair of the committee) Richard Hanson, Ph.D. ________________________________________________ Mark Jackson, Ph.D. ________________________________________________ Noa Noy, Ph.D. ________________________________________________ Ruth Keri, Ph.D. ________________________________________________ ________________________________________________ July 29, 2011 (date) _______________________ *We also certify that written approval has been obtained for any proprietary material contained therein. DEDICATION To my parents, I will forever be indebted. iii TABLE OF CONTENTS Signature Page ii Dedication iii Table of Contents iv List of Tables vii List of Figures ix Acknowledgements xi List of Abbreviations xiii Abstract 1 Chapter 1 Introduction 3 1.1 The FOXA family of transcription factors 3 1.2 The nuclear receptor superfamily 6 1.2.1 The androgen receptor 1.2.2 The estrogen receptor 1.3 FOXA1 in development 13 1.3.1 Pancreas and Kidney
    [Show full text]
  • The Prop1-Like Homeobox Gene Unc-42 Specifies the Identity Of
    RESEARCH ARTICLE The Prop1-like homeobox gene unc-42 specifies the identity of synaptically connected neurons Emily G Berghoff1, Lori Glenwinkel1, Abhishek Bhattacharya1, HaoSheng Sun1, Erdem Varol2, Nicki Mohammadi1, Amelia Antone1, Yi Feng1, Ken Nguyen3, Steven J Cook1, Jordan F Wood4, Neda Masoudi1, Cyril C Cros1, Yasmin H Ramadan1, Denise M Ferkey4, David H Hall3, Oliver Hobert1* 1Department of Biological Sciences, Columbia University, Howard Hughes Medical Institute, New York, United States; 2Department of Statistics, Zuckerman Institute, Columbia University, New York, United States; 3Dominick P. Purpura Department of Neuroscience, Albert Einstein College of Medicine, Bronx, United States; 4Department of Biological Sciences, University at Buffalo, The State University of New York, Buffalo, United States Abstract Many neuronal identity regulators are expressed in distinct populations of cells in the nervous system, but their function is often analyzed only in specific isolated cellular contexts, thereby potentially leaving overarching themes in gene function undiscovered. We show here that the Caenorhabditis elegans Prop1-like homeobox gene unc-42 is expressed in 15 distinct sensory, inter- and motor neuron classes throughout the entire C. elegans nervous system. Strikingly, all 15 neuron classes expressing unc-42 are synaptically interconnected, prompting us to investigate whether unc-42 controls the functional properties of this circuit and perhaps also the assembly of these neurons into functional circuitry. We found that unc-42 defines the routes of communication between these interconnected neurons by controlling the expression of neurotransmitter pathway genes, neurotransmitter receptors, neuropeptides, and neuropeptide receptors. Anatomical *For correspondence: analysis of unc-42 mutant animals reveals defects in axon pathfinding and synaptic connectivity, [email protected] paralleled by expression defects of molecules involved in axon pathfinding, cell-cell recognition, unc-42 Competing interest: See and synaptic connectivity.
    [Show full text]