Detection of SHOX2 DNA Methylation by Methylation-Specific PCR in Non-Small Cell Lung Cancer

Total Page:16

File Type:pdf, Size:1020Kb

Detection of SHOX2 DNA Methylation by Methylation-Specific PCR in Non-Small Cell Lung Cancer 6077 Original Article Detection of SHOX2 DNA methylation by methylation-specific PCR in non-small cell lung cancer Hongxiang Feng1#, Weipeng Shao2#, Lanfang Du3#, Xin Qing4, Zhenrong Zhang1, Chaoyang Liang1, Deruo Liu1 1Department of Thoracic Surgery, China-Japan Friendship Hospital, Beijing, China; 2Department of Thoracic Surgery, Peking University China- Japan Friendship School of Clinical Medicine and China-Japan Friendship Hospital, Beijing, China; 3Department of Emergency, Peking University Third Hospital, Beijing, China; 4Department of Pathology, Harbor-UCLA Medical Center, Torrance, CA, USA Contributions: (I) Conception and design: W Shao, H Feng, L Du, D Liu; (II) Administrative support: D Liu, X Qing; (III) Provision of study materials or patients: All authors; (IV) Collection and assembly of data: W Shao, H Feng, L Du; (V) Data analysis and interpretation: W Shao, H Feng, L Du; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. #These authors contributed equally to this work. Correspondence to: Deruo Liu. Department of Thoracic Surgery, China-Japan Friendship Hospital, No. 2, Yinghua, East Rd, Beijing, China. Email: deruoliu@163.com. Background: Lung cancer is the leading cause of cancer-related death worldwide. Short stature homeobox 2 (SHOX2) methylation detected by real-time polymerase chain reaction (PCR) has recently been demonstrated to be a potential biomarker in the diagnosis of lung cancer. However, more cost-effective methods are still needed to help cancer detection in the early stage of lung cancer. The aim of this study was to examine the methylation status of the SHOX2 gene and to investigate its diagnostic value in non-small cell lung cancer (NSCLC) patients. Methods: A total of 89 Chinese NSCLC patients and 9 non-tumor patients was enrolled in this study. The methylation status of SHOX2 gene in NSCLC tumor tissues/corresponding non-neoplastic lung tissues and lung tissues from non-tumor patients was examined by methylation-specific PCR (MSP). Results: We found that SHOX2 methylation was significantly associated with NSCLC (P=0.003). We also analyzed the correlation of SHOX2 methylation with clinicopathological variables including sex, age, tumor pathologic classification, tumor differentiation degree, TNM stage, T stage, and nodal status, and found no significant correlation between them. Conclusions: These results suggested that SHOX2 gene methylation was closely associated with lung carcinogenesis. Thus, SHOX2 methylation could be used as a potential marker to help NSCLC detection. MSP might be used as a cost-effective method alternative to real-time PCR in detection of SHOX2 methylation in the early diagnosis of NSCLC. Keywords: Stature homeobox 2 methylation (SHOX2 methylation); non-small cell lung cancer (NSCLC); diagnosis; methylation-specific PCR (MSP) Submitted Feb 06, 2020. Accepted for publication Aug 21, 2020. doi: 10.21037/tcr-20-887 View this article at: http://dx.doi.org/10.21037/tcr-20-887 Introduction cancer incidence and mortality in 2012, respectively (2). Over one million people die from lung cancer globally Lung cancer is the leading cause of cancer-related deaths every year, among which approximately 0.6 million are worldwide (1). In China, lung cancer is the most prevalent from China. Worse yet, the incidence of lung cancer is still cancer type and accounted for 25.2% and 29.5% of the total increasing in China due to the high prevalence of cigarette © Translational Cancer Research. All rights reserved. Transl Cancer Res 2020;9(10):6070-6077 | http://dx.doi.org/10.21037/tcr-20-887 Translational Cancer Research, Vol 9, No 10 October 2020 6071 use and other factors (3). Compared with real-time PCR-based methods, MSP is Non-small cell lung cancer (NSCLC) accounts for much more cost-effective. It is also fast, sensitive, and approximately 85% of all lung cancers and carries a specific, and has been widely used for DNA methylation dismal 5-year survival rate of 15% (3). Nevertheless, analyses (15,16). Therefore, we chose to investigate the the International Early Lung Cancer Action Program diagnostic value of SHOX2 methylation detection by MSP Investigators reported that, among 302 participants in lung cancer as this method may reduce costs and thus with clinical stage I lung cancer who underwent surgical may facilitate the use of SHOX2 methylation in large-scale resection within 1 month after diagnosis, the survival rate lung cancer screening, especially in developing countries was 92% (4). These results suggest that timely detection where cost is a limiting factor. Specifically, we examined of lung cancer and appropriate treatment may prevent or SHOX2 methylation by the MSP method in tumor tissue interrupt cancer progression and improve overall survival and corresponding non-tumor lung tissue from a cohort rate. However, more than 75% of lung cancer patients are of Chinese NSCLC patients, and further analyzed the diagnosed at a locally advanced stage or with metastatic diagnostic value of SHOX2 methylation measured by MSP disease, partially due to the lack of an effective screening in NSCLC detection. We present the following article in program for early detection (5). Therefore, simple, safe, accordance with the STARD reporting checklist (available and cost-effective methods to aid in early detection of lung at http://dx.doi.org/10.21037/tcr-20-887). cancer are greatly needed. Tumor markers are molecules specifically expressed by tumor cells or produced by the host in response to Methods tumors. Epigenetic changes of certain genes, such as DNA Patients methylation, could occur at early stage of carcinogenesis, thus could be used as a type of tumor marker. DNA methylation The study was conducted in accordance with the based diagnostic devices has been used in screening of Declaration of Helsinki (as revised in 2013). The patients malignant diseases including colorectal cancer (6). SHOX2 underwent surgery after providing informed consent, and gene is located on human chromosome 3. SHOX2 gene is the requirement for the individual consent of patients widely expressed in tissue including skeleton, branchial whose records were evaluated was waived because they arches, heart tissue and central nervous system (7). SHOX2 were de-identified in the study. The study was approved methylation is closely related to tumor occurrence and by institutional ethics board of China-Japan Friendship progression. In colorectal cancer, SHOX2 methylation Hospital (No. 2018-13-K08). A total of 89 NSCLC patients could be used as a powerful biomarker for cancer screening and 9 non-tumor patients were included in this study. and post-therapeutic monitoring (8). SHOX2 gene Clinicopathological characteristics of the participating methylation status could also be used as potent prognostic patients with cancer or non-cancer are presented in Tables 1 parameter for predicting patient survival in lower-grade and 2, respectively. All tumors in these patients were glioma patients (9). Recently, Dietrich et al. reported completely resected (R0 category) by surgery. Additionally, that SHOX2 methylation is a reliable biomarker for the histologically normal lung tissue specimens obtained diagnosis of lung cancer (10-14). Based on this potential, at surgery from 9 patients with no evidence of cancer SHOX2 methylation has been developed as a commercially were used as a control group (including 8 patients with available assay, the Epi proLung BL Reflex Assay, for early pulmonary bulla and 1 patient with benign tumor). In lung cancer detection (13). the control group, 6 patients were men and 6 were under Specific DNA methylation can be measured by several 60 years old. polymerase chain reaction (PCR)-based methods, including methylation-specific PCR (MSP) and real-time quantitative Tissue acquisition and DNA extraction PCR. The aforementioned commercial SHOX2 methylation assay detects SHOX2 methylation through the Tissues for DNA analysis were obtained immediately after generation of bisulfate-converted template DNA followed lung resection before starting mediastinal lymphadenectomy by real-time PCR using TaqMan probes (13). While this and were frozen in liquid nitrogen. Tissues were analyzed is sensitive and quantitative, it is also relatively expensive. as tumors or uninvolved lung tissues taken from the farthest © Translational Cancer Research. All rights reserved. Transl Cancer Res 2020;9(10):6070-6077 | http://dx.doi.org/10.21037/tcr-20-887 6072 Feng et al. MSP and SHOX2 methylation Table 1 Clinicopathological characteristics of 89 non-small cell distance from tumors. Ten µm thick frozen sections were lung cancer patients taken from blocks of tumor tissues and stained with H&E Characteristics N (%) for histopathological evaluation. Sections were pooled Sex for analysis from areas of estimated 75% malignant cells. Genomic DNA was isolated from frozen tissue by standard Male 63 (70.8) methods of proteinase K digestion and phenol-chloroform Female 26 (29.2) extraction using Tiangen Cells and Tissue DNA Isolation Age* Kit (Tiangen Biotech Co., LTD, Beijing, China) according <60 42 (47.2) to the manufacturer’s instructions. ≥60 47 (52.8) Pathologic classification Detection of SHOX2 methylation using MSP Squamous cell carcinoma 34 (38.2) A total of 500 ng genomic DNA extracted from tissue Adenocarcinoma 47 (52.8) samples was modified by sodium bisulfite with DNA Methylation Detection Kit (BioChain, USA) according to Other 8 (9.0) the manufacturer’s instructions. 7 µL modified DNA was Differentiation degree used for PCR in a total reaction volume of 25 µL. PCR Undifferentiated/poorly 39 (43.8) program was set as 35 cycles of melting (95 for 30 s), annealing (58 for 30 s) and extension (72 for 30 s). Moderately/well 50 (56.2) ℃ The 25 µL reaction mixture contained 1× PCR Buffer ℃ ℃ TNM stage (Mg2+ Plus), 200 µM of each dNTP, 0.5 µM forward primer, I/II 52 (58.4) 0.5 µM reverse primer, and 0.5 unit of GoTaq Hot Start III/IV 37 (41.6) Polymerase (Promega, USA). PCR products were separated in 3% agarose gel supplemented with ethidium bromide.
Recommended publications
  • Non-Canonical Notch Signaling During Early Heart Development
    Non-Canonical Notch Signaling During Early Heart Development By Matthew Miyamoto A thesis submitted to Johns Hopkins University in conformity with the requirements for the degree of Master of Science Baltimore, Maryland May 2017 ©2017 Matthew Miyamoto All Rights Reserved Abstract: The canonical Notch signaling pathway has been studied extensively and plays a key role during embryonic development. Recent evidence points to the existence of a non-canonical function of the Notch protein. Elucidation of a non-canonical Notch signaling pathway would significantly alter how the Notch protein is viewed in biological systems. Perhaps more importantly, the identification of downstream effectors could lead to discovery of novel gene networks functioning throughout development. One potential downstream effector of non-canonical Notch is Numb, which interacts with Notch during development. We provide evidence of the existence of a non-canonical pathway in both the embryonic stem cell and during early heart development. By developing two models that alter either the Notch protein or the canonical Notch signaling pathway, we studied non-canonical Notch signaling in vitro and in vivo. Upon overexpression of a tethered form of Notch, which cannot initiate canonical Notch signaling, we observed remarkable apoptosis in embryonic stem cells. Furthermore, Notch overexpression during early heart development led to decreased heart size due to decreased myocyte proliferation when the essential transcription factor to canonical Notch signaling, RBP-j, was knocked out. Similar phenotypes observed in a Numb knockout setting led us to hypothesize that an interaction between Numb and Notch is involved in heart development. Elucidation of a non-canonical Notch signaling pathway may lead to not only a better understanding of congenital heart disease, but also development of other organ systems, as well.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD (cevansmo@iu.edu) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • A Mouse Model for Human Short-Stature Syndromes Identifies Shox2 As an Upstream Regulator of Runx2 During Long-Bone Development
    A mouse model for human short-stature syndromes identifies Shox2 as an upstream regulator of Runx2 during long-bone development John Cobb*, Andre´ e Dierich†, Yolande Huss-Garcia†, and Denis Duboule*‡ *Department of Zoology and Animal Biology and National Research Center ‘‘Frontiers in Genetics,’’ Sciences III, University of Geneva, Quai Ernest Ansermet 30, 1211 Geneva 4, Switzerland; and †Institut de Ge´ne´ tique et de Biologie Mole´culaire et Cellulaire͞Institut Clinique de la Souris, Centre National de la Recherche Scientifique͞Institut National de la Sante´et de la Recherche Me´dicale͞Universite´Louis Pasteur͞Colle`ge de France, BP 10142, 67404 Strasbourg, France Edited by Pierre Chambon, Institut de Ge´ne´ tique et de Biologie Mole´culaire, Strasbourg, France, and approved January 11, 2006 (received for review December 7, 2005) Deficiencies or mutations in the human pseudoautosomal SHOX wall up to the hand plate (8), from which it is excluded, thus gene are associated with a series of short-stature conditions, recapitulating the expression of both human SHOX and SHOX2 including Turner syndrome, Leri–Weill dyschondrosteosis, and and further suggesting that it displays a function in developing Langer mesomelic dysplasia. Although this gene is absent from the limbs related to that of its two human counterparts. mouse genome, the closely related paralogous gene Shox2 dis- We identified Shox2 as a candidate target gene of HOXD plays a similar expression pattern in developing limbs. Here, we proteins in developing distal limbs by using a microarray screen report that the conditional inactivation of Shox2 in developing (9). Shox2 appeared up-regulated in the presumptive digit do- appendages leads to a strong phenotype, similar to the human main after deletion of the Hoxd gene cluster, indicating a conditions, although it affects a different proximodistal limb seg- potential repressive effect of Hoxd genes on Shox2 transcription ment.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: mkfurue@nibiohn.go.jp Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Spatial Distribution of Leading Pacemaker Sites in the Normal, Intact Rat Sinoa
    Supplementary Material Supplementary Figure 1: Spatial distribution of leading pacemaker sites in the normal, intact rat sinoatrial 5 nodes (SAN) plotted along a normalized y-axis between the superior vena cava (SVC) and inferior vena 6 cava (IVC) and a scaled x-axis in millimeters (n = 8). Colors correspond to treatment condition (black: 7 baseline, blue: 100 µM Acetylcholine (ACh), red: 500 nM Isoproterenol (ISO)). 1 Supplementary Figure 2: Spatial distribution of leading pacemaker sites before and after surgical 3 separation of the rat SAN (n = 5). Top: Intact SAN preparations with leading pacemaker sites plotted during 4 baseline conditions. Bottom: Surgically cut SAN preparations with leading pacemaker sites plotted during 5 baseline conditions (black) and exposure to pharmacological stimulation (blue: 100 µM ACh, red: 500 nM 6 ISO). 2 a &DUGLDFIoQChDQQHOV .FQM FOXVWHU &DFQDG &DFQDK *MD &DFQJ .FQLS .FQG .FQK .FQM &DFQDF &DFQE .FQM í $WSD .FQD .FQM í .FQN &DVT 5\U .FQM &DFQJ &DFQDG ,WSU 6FQD &DFQDG .FQQ &DFQDJ &DFQDG .FQD .FQT 6FQD 3OQ 6FQD +FQ *MD ,WSU 6FQE +FQ *MG .FQN .FQQ .FQN .FQD .FQE .FQQ +FQ &DFQDD &DFQE &DOP .FQM .FQD .FQN .FQG .FQN &DOP 6FQD .FQD 6FQE 6FQD 6FQD ,WSU +FQ 6FQD 5\U 6FQD 6FQE 6FQD .FQQ .FQH 6FQD &DFQE 6FQE .FQM FOXVWHU V6$1 L6$1 5$ /$ 3 b &DUGLDFReFHSWRUV $GUDF FOXVWHU $GUDD &DY &KUQE &KUP &KJD 0\O 3GHG &KUQD $GUE $GUDG &KUQE 5JV í 9LS $GUDE 7SP í 5JV 7QQF 3GHE 0\K $GUE *QDL $QN $GUDD $QN $QN &KUP $GUDE $NDS $WSE 5DPS &KUP 0\O &KUQD 6UF &KUQH $GUE &KUQD FOXVWHU V6$1 L6$1 5$ /$ 4 c 1HXURQDOPURWHLQV
    [Show full text]
  • Epigenetic Services Citations
    Active Motif Epigenetic Services Publications The papers below contain data generated by Active Motif’s Epigenetic Services team. To learn more about our services, please give us a call or visit us at www.activemotif.com/services. Technique Target Journal Year Reference Justin C. Boucher et al. CD28 Costimulatory Domain- ATAC-Seq, Cancer Immunol. Targeted Mutations Enhance Chimeric Antigen Receptor — 2021 RNA-Seq Res. T-cell Function. Cancer Immunol. Res. doi: 10.1158/2326- 6066.CIR-20-0253. Satvik Mareedu et al. Sarcolipin haploinsufficiency Am. J. Physiol. prevents dystrophic cardiomyopathy in mdx mice. RNA-Seq — Heart Circ. 2021 Am J Physiol Heart Circ Physiol. doi: 10.1152/ Physiol. ajpheart.00601.2020. Gabi Schutzius et al. BET bromodomain inhibitors regulate Nature Chemical ChIP-Seq BRD4 2021 keratinocyte plasticity. Nat. Chem. Biol. doi: 10.1038/ Biology s41589-020-00716-z. Siyun Wang et al. cMET promotes metastasis and ChIP-qPCR FOXO3 J. Cell Physiol. 2021 epithelial-mesenchymal transition in colorectal carcinoma by repressing RKIP. J. Cell Physiol. doi: 10.1002/jcp.30142. Sonia Iyer et al. Genetically Defined Syngeneic Mouse Models of Ovarian Cancer as Tools for the Discovery of ATAC-Seq — Cancer Discovery 2021 Combination Immunotherapy. Cancer Discov. doi: doi: 10.1158/2159-8290 Vinod Krishna et al. Integration of the Transcriptome and Genome-Wide Landscape of BRD2 and BRD4 Binding BRD2, BRD4, RNA Motifs Identifies Key Superenhancer Genes and Reveals ChIP-Seq J. Immunol. 2021 Pol II the Mechanism of Bet Inhibitor Action in Rheumatoid Arthritis Synovial Fibroblasts. J. Immunol. doi: doi: 10.4049/ jimmunol.2000286. Daniel Haag et al.
    [Show full text]
  • Download (PDF)
    Supplemental Information Biological and Pharmaceutical Bulletin Promoter Methylation Profiles between Human Lung Adenocarcinoma Multidrug Resistant A549/Cisplatin (A549/DDP) Cells and Its Progenitor A549 Cells Ruiling Guo, Guoming Wu, Haidong Li, Pin Qian, Juan Han, Feng Pan, Wenbi Li, Jin Li, and Fuyun Ji © 2013 The Pharmaceutical Society of Japan Table S1. Gene categories involved in biological functions with hypomethylated promoter identified by MeDIP-ChIP analysis in lung adenocarcinoma MDR A549/DDP cells compared with its progenitor A549 cells Different biological Genes functions transcription factor MYOD1, CDX2, HMX1, THRB, ARNT2, ZNF639, HOXD13, RORA, FOXO3, HOXD10, CITED1, GATA1, activity HOXC6, ZGPAT, HOXC8, ATOH1, FLI1, GATA5, HOXC4, HOXC5, PHTF1, RARB, MYST2, RARG, SIX3, FOXN1, ZHX3, HMG20A, SIX4, NR0B1, SIX6, TRERF1, DDIT3, ASCL1, MSX1, HIF1A, BAZ1B, MLLT10, FOXG1, DPRX, SHOX, ST18, CCRN4L, TFE3, ZNF131, SOX5, TFEB, MYEF2, VENTX, MYBL2, SOX8, ARNT, VDR, DBX2, FOXQ1, MEIS3, HOXA6, LHX2, NKX2-1, TFDP3, LHX6, EWSR1, KLF5, SMAD7, MAFB, SMAD5, NEUROG1, NR4A1, NEUROG3, GSC2, EN2, ESX1, SMAD1, KLF15, ZSCAN1, VAV1, GAS7, USF2, MSL3, SHOX2, DLX2, ZNF215, HOXB2, LASS3, HOXB5, ETS2, LASS2, DLX5, TCF12, BACH2, ZNF18, TBX21, E2F8, PRRX1, ZNF154, CTCF, PAX3, PRRX2, CBFA2T2, FEV, FOS, BARX1, PCGF2, SOX15, NFIL3, RBPJL, FOSL1, ALX1, EGR3, SOX14, FOXJ1, ZNF92, OTX1, ESR1, ZNF142, FOSB, MIXL1, PURA, ZFP37, ZBTB25, ZNF135, HOXC13, KCNH8, ZNF483, IRX4, ZNF367, NFIX, NFYB, ZBTB16, TCF7L1, HIC1, TSC22D1, TSC22D2, REXO4, POU3F2, MYOG, NFATC2, ENO1,
    [Show full text]
  • Downregulation of Carnitine Acyl-Carnitine Translocase by Mirnas
    Page 1 of 288 Diabetes 1 Downregulation of Carnitine acyl-carnitine translocase by miRNAs 132 and 212 amplifies glucose-stimulated insulin secretion Mufaddal S. Soni1, Mary E. Rabaglia1, Sushant Bhatnagar1, Jin Shang2, Olga Ilkayeva3, Randall Mynatt4, Yun-Ping Zhou2, Eric E. Schadt6, Nancy A.Thornberry2, Deborah M. Muoio5, Mark P. Keller1 and Alan D. Attie1 From the 1Department of Biochemistry, University of Wisconsin, Madison, Wisconsin; 2Department of Metabolic Disorders-Diabetes, Merck Research Laboratories, Rahway, New Jersey; 3Sarah W. Stedman Nutrition and Metabolism Center, Duke Institute of Molecular Physiology, 5Departments of Medicine and Pharmacology and Cancer Biology, Durham, North Carolina. 4Pennington Biomedical Research Center, Louisiana State University system, Baton Rouge, Louisiana; 6Institute for Genomics and Multiscale Biology, Mount Sinai School of Medicine, New York, New York. Corresponding author Alan D. Attie, 543A Biochemistry Addition, 433 Babcock Drive, Department of Biochemistry, University of Wisconsin-Madison, Madison, Wisconsin, (608) 262-1372 (Ph), (608) 263-9608 (fax), adattie@wisc.edu. Running Title: Fatty acyl-carnitines enhance insulin secretion Abstract word count: 163 Main text Word count: 3960 Number of tables: 0 Number of figures: 5 Diabetes Publish Ahead of Print, published online June 26, 2014 Diabetes Page 2 of 288 2 ABSTRACT We previously demonstrated that micro-RNAs 132 and 212 are differentially upregulated in response to obesity in two mouse strains that differ in their susceptibility to obesity-induced diabetes. Here we show the overexpression of micro-RNAs 132 and 212 enhances insulin secretion (IS) in response to glucose and other secretagogues including non-fuel stimuli. We determined that carnitine acyl-carnitine translocase (CACT, Slc25a20) is a direct target of these miRNAs.
    [Show full text]
  • Discerning the Role of Foxa1 in Mammary Gland
    DISCERNING THE ROLE OF FOXA1 IN MAMMARY GLAND DEVELOPMENT AND BREAST CANCER by GINA MARIE BERNARDO Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Dissertation Adviser: Dr. Ruth A. Keri Department of Pharmacology CASE WESTERN RESERVE UNIVERSITY January, 2012 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of Gina M. Bernardo ______________________________________________________ Ph.D. candidate for the ________________________________degree *. Monica Montano, Ph.D. (signed)_______________________________________________ (chair of the committee) Richard Hanson, Ph.D. ________________________________________________ Mark Jackson, Ph.D. ________________________________________________ Noa Noy, Ph.D. ________________________________________________ Ruth Keri, Ph.D. ________________________________________________ ________________________________________________ July 29, 2011 (date) _______________________ *We also certify that written approval has been obtained for any proprietary material contained therein. DEDICATION To my parents, I will forever be indebted. iii TABLE OF CONTENTS Signature Page ii Dedication iii Table of Contents iv List of Tables vii List of Figures ix Acknowledgements xi List of Abbreviations xiii Abstract 1 Chapter 1 Introduction 3 1.1 The FOXA family of transcription factors 3 1.2 The nuclear receptor superfamily 6 1.2.1 The androgen receptor 1.2.2 The estrogen receptor 1.3 FOXA1 in development 13 1.3.1 Pancreas and Kidney
    [Show full text]
  • The Prop1-Like Homeobox Gene Unc-42 Specifies the Identity Of
    RESEARCH ARTICLE The Prop1-like homeobox gene unc-42 specifies the identity of synaptically connected neurons Emily G Berghoff1, Lori Glenwinkel1, Abhishek Bhattacharya1, HaoSheng Sun1, Erdem Varol2, Nicki Mohammadi1, Amelia Antone1, Yi Feng1, Ken Nguyen3, Steven J Cook1, Jordan F Wood4, Neda Masoudi1, Cyril C Cros1, Yasmin H Ramadan1, Denise M Ferkey4, David H Hall3, Oliver Hobert1* 1Department of Biological Sciences, Columbia University, Howard Hughes Medical Institute, New York, United States; 2Department of Statistics, Zuckerman Institute, Columbia University, New York, United States; 3Dominick P. Purpura Department of Neuroscience, Albert Einstein College of Medicine, Bronx, United States; 4Department of Biological Sciences, University at Buffalo, The State University of New York, Buffalo, United States Abstract Many neuronal identity regulators are expressed in distinct populations of cells in the nervous system, but their function is often analyzed only in specific isolated cellular contexts, thereby potentially leaving overarching themes in gene function undiscovered. We show here that the Caenorhabditis elegans Prop1-like homeobox gene unc-42 is expressed in 15 distinct sensory, inter- and motor neuron classes throughout the entire C. elegans nervous system. Strikingly, all 15 neuron classes expressing unc-42 are synaptically interconnected, prompting us to investigate whether unc-42 controls the functional properties of this circuit and perhaps also the assembly of these neurons into functional circuitry. We found that unc-42 defines the routes of communication between these interconnected neurons by controlling the expression of neurotransmitter pathway genes, neurotransmitter receptors, neuropeptides, and neuropeptide receptors. Anatomical *For correspondence: analysis of unc-42 mutant animals reveals defects in axon pathfinding and synaptic connectivity, or38@columbia.edu paralleled by expression defects of molecules involved in axon pathfinding, cell-cell recognition, unc-42 Competing interest: See and synaptic connectivity.
    [Show full text]
  • Predict AID Targeting in Non-Ig Genes Multiple Transcription Factor
    Downloaded from http://www.jimmunol.org/ by guest on September 26, 2021 is online at: average * The Journal of Immunology published online 20 March 2013 from submission to initial decision 4 weeks from acceptance to publication Multiple Transcription Factor Binding Sites Predict AID Targeting in Non-Ig Genes Jamie L. Duke, Man Liu, Gur Yaari, Ashraf M. Khalil, Mary M. Tomayko, Mark J. Shlomchik, David G. Schatz and Steven H. Kleinstein J Immunol http://www.jimmunol.org/content/early/2013/03/20/jimmun ol.1202547 Submit online. Every submission reviewed by practicing scientists ? is published twice each month by http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://www.jimmunol.org/content/suppl/2013/03/20/jimmunol.120254 7.DC1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 26, 2021. Published March 20, 2013, doi:10.4049/jimmunol.1202547 The Journal of Immunology Multiple Transcription Factor Binding Sites Predict AID Targeting in Non-Ig Genes Jamie L. Duke,* Man Liu,†,1 Gur Yaari,‡ Ashraf M. Khalil,x Mary M. Tomayko,{ Mark J. Shlomchik,†,x David G.
    [Show full text]