DOCSLIB.ORG

Identification and Characterization of Cancer Stem Cells in Mouse Medulloblastoma and Glioma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification and Characterization of Cancer Stem Cells in Mouse Medulloblastoma and Glioma Identification and Characterization of Cancer Stem Cells in Mouse Medulloblastoma and Glioma by Ryan Jackson Ward A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Laboratory Medicine and Pathobiology University of Toronto © Copyright by Ryan Jackson Ward 2010 Cancer Stem Cells in Mouse Brain Tumours Ryan Jackson Ward Doctor of Philosophy Department of Laboratory Medicine and Pathobiology University of Toronto 2010 Abstract According to the cancer stem cell hypothesis a subpopulation of cells within a tumour has the capacity to sustain its growth. These cells are termed cancer stem cells, and are most simply defined as the cells within a primary tumour that can self-renew, differentiate and regenerate a phenocopy of that cancer when transplanted in vivo. Cancer stem cells have now been prospectively identified from numerous human tumours and are actively sought in many cancer types, both clinical and experimental. The cancer stem cell hypothesis remains controversial, with evidence both supporting and challenging its existence in human tumours and in animal models of disease. Here we prospectively identify and study brain cancer stem cells in clinically representative mouse models of the medulloblastoma and glioma. Cancer stem cells from both mouse brain tumour types are prospectively enriched by fluorescent activated cell sorting freshly dissociated cells for the surface antigen CD15, display a neural precursor phenotype, exhibit the hallmark stem cell characteristics of self-renewal and multilineage differentiation, and regenerate a phenocopy of the original tumour after orthotopic transplantation. Additionally, novel mouse medulloblastoma and glioma cancer stem cell lines were established and studied in vitro as adherent cultures in the same serum-free media conditions that support the growth of normal neural stem cells. When mouse and human glioma stem cell lines were compared, many novel molecular mediators of the tumour phenotype were identified, as were chemical compounds that ii selectively inhibit their growth. Our results have important implications regarding the cancer stem cell hypothesis, the mechanisms that drive brain tumour stem cell growth and the therapeutic strategies that may prove effective for the treatment of glioma and medulloblastoma. iii Table of Contents Table of Contents ........................................................................................................................... iv List of Abbreviations ................................................................................................................... viii List of Tables ................................................................................................................................. xi List of Figures ............................................................................................................................... xii List of Supplemental Figures ....................................................................................................... xiv List of Supplemental Tables ......................................................................................................... xv Chapter 1 ......................................................................................................................................... 1 1 Introduction ................................................................................................................................ 1 1.1 Brain Tumours .................................................................................................................... 1 1.1.1 Medulloblastoma ..................................................................................................... 1 1.1.2 Hedgehog Signalling & Human Medulloblastoma ................................................. 3 1.1.3 Human Glioma ........................................................................................................ 7 1.1.4 Mouse Glioma ....................................................................................................... 10 1.2 Developmental Neurobiology ........................................................................................... 12 1.2.1 Cerebellar Development ....................................................................................... 15 1.2.2 Forebrain Development ........................................................................................ 16 1.3 Mouse and Human Neural Stem Cells .............................................................................. 17 1.4 Cancer Stem Cells ............................................................................................................. 19 1.4.1 The Cancer Stem Cell Hypothesis ........................................................................ 19 1.4.2 Leukemia Stem Cells ............................................................................................ 22 1.4.3 Cancer Stem Cells in Solid Malignancies ............................................................. 23 1.4.4 Brain Tumour Stem Cells ..................................................................................... 23 1.4.5 The Cancer Stem Cell Controversy ...................................................................... 24 1.5 The Cell-of-origin: Cancerous Stem Cells versus Cancer Stem Cells .............................. 25 iv 1.6 Hypothesis, Potential Significance and Specific Aims of this Ph.D. Thesis .................... 27 1.6.1 Specific Aims ........................................................................................................ 27 Chapter 2 ....................................................................................................................................... 28 2 Multipotent CD15+ Cancer Stem Cells in Patched-1 Deficient Mouse Medulloblastoma ...... 28 2.1 Abstract ............................................................................................................................. 28 2.2 Introduction ....................................................................................................................... 29 2.3 Materials & Methods ........................................................................................................ 31 2.3.1 Mouse Husbandry and Tumour Processing .......................................................... 31 2.3.2 Flow Cytometry, Cell Sorting and In vivo Injections ........................................... 31 2.3.3 Intracerebellar Ganciclovir Infusion ..................................................................... 32 2.3.4 Tissue Culture, DNA, RNA and Protein Analysis ................................................ 32 2.3.5 Immunocytochemistry & Immunohistochemistry ................................................ 33 2.4 Results ............................................................................................................................... 34 2.4.1 Rare, Phenotypically Primitive and Multipotent Ptc1+/- MB Cells can be Propagated In Vitro. .............................................................................................. 34 2.4.2 Ptc1+/-p53-/- MB Cell Lines Initiate the Growth of Phenotypically Representative Tumours In Vivo. .......................................................................... 37 2.4.3 Ptc1+/- MB Cell Lines Maintain Activated Hedgehog and Notch Signalling Pathways. .............................................................................................................. 40 2.4.4 Loss of Ptc1 Heterozygosity, or WT RNA Expression, is not required for Ptc1+/- MB Development. ...................................................................................... 42 2.4.5 CD15 Enriches for Proliferative Cells In Vitro and Tumourigenic Cells In Vivo ....................................................................................................................... 44 2.5 Discussion ......................................................................................................................... 48 Chapter 3 ....................................................................................................................................... 60 3 Percoll Density Centrifugation Separates Functionally Distinct CD15+ Patched-1 Mouse Medulloblastoma Cells. ............................................................................................................ 60 3.1 Abstract ............................................................................................................................. 60 3.2 Introduction ....................................................................................................................... 61 v 3.3 Materials and Methods ...................................................................................................... 63 3.4 Results ............................................................................................................................... 65 3.5 Discussion ......................................................................................................................... 70 Chapter 4 ....................................................................................................................................... 73 4 Cellular, Molecular and Chemical Profile of Clinically Representative Cancer Stem Cells from a Chemical-Genetic Mouse Model of Glioma. ............................................................... 73 4.1 Abstract ............................................................................................................................
Load more

Recommended publications
  • Non-Canonical Notch Signaling During Early Heart Development
    Non-Canonical Notch Signaling During Early Heart Development By Matthew Miyamoto A thesis submitted to Johns Hopkins University in conformity with the requirements for the degree of Master of Science Baltimore, Maryland May 2017 ©2017 Matthew Miyamoto All Rights Reserved Abstract: The canonical Notch signaling pathway has been studied extensively and plays a key role during embryonic development. Recent evidence points to the existence of a non-canonical function of the Notch protein. Elucidation of a non-canonical Notch signaling pathway would significantly alter how the Notch protein is viewed in biological systems. Perhaps more importantly, the identification of downstream effectors could lead to discovery of novel gene networks functioning throughout development. One potential downstream effector of non-canonical Notch is Numb, which interacts with Notch during development. We provide evidence of the existence of a non-canonical pathway in both the embryonic stem cell and during early heart development. By developing two models that alter either the Notch protein or the canonical Notch signaling pathway, we studied non-canonical Notch signaling in vitro and in vivo. Upon overexpression of a tethered form of Notch, which cannot initiate canonical Notch signaling, we observed remarkable apoptosis in embryonic stem cells. Furthermore, Notch overexpression during early heart development led to decreased heart size due to decreased myocyte proliferation when the essential transcription factor to canonical Notch signaling, RBP-j, was knocked out. Similar phenotypes observed in a Numb knockout setting led us to hypothesize that an interaction between Numb and Notch is involved in heart development. Elucidation of a non-canonical Notch signaling pathway may lead to not only a better understanding of congenital heart disease, but also development of other organ systems, as well.
    [Show full text]
  • Cover Petra B
    UvA-DARE (Digital Academic Repository) The role of Polycomb group proteins throughout development : f(l)avoring repression van der Stoop, P.M. Link to publication Citation for published version (APA): van der Stoop, P. M. (2009). The role of Polycomb group proteins throughout development : f(l)avoring repression. Amsterdam: Nederlands Kanker Instituut - Antoni Van Leeuwenhoekziekenhuis. General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons). Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible. UvA-DARE is a service provided by the library of the University of Amsterdam (http://dare.uva.nl) Download date: 27 Oct 2019 Chapter 4 Ubiquitin E3 Ligase Ring1b/Rnf2 of Polycomb Repressive Complex 1 Contributes to Stable Maintenance of Mouse Embryonic Stem Cells Petra van der Stoop*, Erwin A. Boutsma*, Danielle Hulsman, Sonja Noback, Mike Heimerikx, Ron M. Kerkhoven, J. Willem Voncken, Lodewyk F.A. Wessels, Maarten van Lohuizen * These authors contributed equally to this work Adapted from: PLoS ONE (2008) 3(5): e2235 Ring1b regulates ES cell fate Ubiquitin E3 Ligase Ring1b/Rnf2 of Polycomb Repressive Complex 1 Contributes to Stable Maintenance of Mouse Embryonic Stem Cells Petra van der Stoop1*, Erwin A.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • A Mouse Model for Human Short-Stature Syndromes Identifies Shox2 As an Upstream Regulator of Runx2 During Long-Bone Development
    A mouse model for human short-stature syndromes identifies Shox2 as an upstream regulator of Runx2 during long-bone development John Cobb*, Andre´ e Dierich†, Yolande Huss-Garcia†, and Denis Duboule*‡ *Department of Zoology and Animal Biology and National Research Center ‘‘Frontiers in Genetics,’’ Sciences III, University of Geneva, Quai Ernest Ansermet 30, 1211 Geneva 4, Switzerland; and †Institut de Ge´ne´ tique et de Biologie Mole´culaire et Cellulaire͞Institut Clinique de la Souris, Centre National de la Recherche Scientifique͞Institut National de la Sante´et de la Recherche Me´dicale͞Universite´Louis Pasteur͞Colle`ge de France, BP 10142, 67404 Strasbourg, France Edited by Pierre Chambon, Institut de Ge´ne´ tique et de Biologie Mole´culaire, Strasbourg, France, and approved January 11, 2006 (received for review December 7, 2005) Deficiencies or mutations in the human pseudoautosomal SHOX wall up to the hand plate (8), from which it is excluded, thus gene are associated with a series of short-stature conditions, recapitulating the expression of both human SHOX and SHOX2 including Turner syndrome, Leri–Weill dyschondrosteosis, and and further suggesting that it displays a function in developing Langer mesomelic dysplasia. Although this gene is absent from the limbs related to that of its two human counterparts. mouse genome, the closely related paralogous gene Shox2 dis- We identified Shox2 as a candidate target gene of HOXD plays a similar expression pattern in developing limbs. Here, we proteins in developing distal limbs by using a microarray screen report that the conditional inactivation of Shox2 in developing (9). Shox2 appeared up-regulated in the presumptive digit do- appendages leads to a strong phenotype, similar to the human main after deletion of the Hoxd gene cluster, indicating a conditions, although it affects a different proximodistal limb seg- potential repressive effect of Hoxd genes on Shox2 transcription ment.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Spatial Distribution of Leading Pacemaker Sites in the Normal, Intact Rat Sinoa
    Supplementary Material Supplementary Figure 1: Spatial distribution of leading pacemaker sites in the normal, intact rat sinoatrial 5 nodes (SAN) plotted along a normalized y-axis between the superior vena cava (SVC) and inferior vena 6 cava (IVC) and a scaled x-axis in millimeters (n = 8). Colors correspond to treatment condition (black: 7 baseline, blue: 100 µM Acetylcholine (ACh), red: 500 nM Isoproterenol (ISO)). 1 Supplementary Figure 2: Spatial distribution of leading pacemaker sites before and after surgical 3 separation of the rat SAN (n = 5). Top: Intact SAN preparations with leading pacemaker sites plotted during 4 baseline conditions. Bottom: Surgically cut SAN preparations with leading pacemaker sites plotted during 5 baseline conditions (black) and exposure to pharmacological stimulation (blue: 100 µM ACh, red: 500 nM 6 ISO). 2 a &DUGLDFIoQChDQQHOV .FQM FOXVWHU &DFQDG &DFQDK *MD &DFQJ .FQLS .FQG .FQK .FQM &DFQDF &DFQE .FQM í $WSD .FQD .FQM í .FQN &DVT 5\U .FQM &DFQJ &DFQDG ,WSU 6FQD &DFQDG .FQQ &DFQDJ &DFQDG .FQD .FQT 6FQD 3OQ 6FQD +FQ *MD ,WSU 6FQE +FQ *MG .FQN .FQQ .FQN .FQD .FQE .FQQ +FQ &DFQDD &DFQE &DOP .FQM .FQD .FQN .FQG .FQN &DOP 6FQD .FQD 6FQE 6FQD 6FQD ,WSU +FQ 6FQD 5\U 6FQD 6FQE 6FQD .FQQ .FQH 6FQD &DFQE 6FQE .FQM FOXVWHU V6$1 L6$1 5$ /$ 3 b &DUGLDFReFHSWRUV $GUDF FOXVWHU $GUDD &DY &KUQE &KUP &KJD 0\O 3GHG &KUQD $GUE $GUDG &KUQE 5JV í 9LS $GUDE 7SP í 5JV 7QQF 3GHE 0\K $GUE *QDL $QN $GUDD $QN $QN &KUP $GUDE $NDS $WSE 5DPS &KUP 0\O &KUQD 6UF &KUQH $GUE &KUQD FOXVWHU V6$1 L6$1 5$ /$ 4 c 1HXURQDOPURWHLQV
    [Show full text]
  • Epigenetic Services Citations
    Active Motif Epigenetic Services Publications The papers below contain data generated by Active Motif’s Epigenetic Services team. To learn more about our services, please give us a call or visit us at www.activemotif.com/services. Technique Target Journal Year Reference Justin C. Boucher et al. CD28 Costimulatory Domain- ATAC-Seq, Cancer Immunol. Targeted Mutations Enhance Chimeric Antigen Receptor — 2021 RNA-Seq Res. T-cell Function. Cancer Immunol. Res. doi: 10.1158/2326- 6066.CIR-20-0253. Satvik Mareedu et al. Sarcolipin haploinsufficiency Am. J. Physiol. prevents dystrophic cardiomyopathy in mdx mice. RNA-Seq — Heart Circ. 2021 Am J Physiol Heart Circ Physiol. doi: 10.1152/ Physiol. ajpheart.00601.2020. Gabi Schutzius et al. BET bromodomain inhibitors regulate Nature Chemical ChIP-Seq BRD4 2021 keratinocyte plasticity. Nat. Chem. Biol. doi: 10.1038/ Biology s41589-020-00716-z. Siyun Wang et al. cMET promotes metastasis and ChIP-qPCR FOXO3 J. Cell Physiol. 2021 epithelial-mesenchymal transition in colorectal carcinoma by repressing RKIP. J. Cell Physiol. doi: 10.1002/jcp.30142. Sonia Iyer et al. Genetically Defined Syngeneic Mouse Models of Ovarian Cancer as Tools for the Discovery of ATAC-Seq — Cancer Discovery 2021 Combination Immunotherapy. Cancer Discov. doi: doi: 10.1158/2159-8290 Vinod Krishna et al. Integration of the Transcriptome and Genome-Wide Landscape of BRD2 and BRD4 Binding BRD2, BRD4, RNA Motifs Identifies Key Superenhancer Genes and Reveals ChIP-Seq J. Immunol. 2021 Pol II the Mechanism of Bet Inhibitor Action in Rheumatoid Arthritis Synovial Fibroblasts. J. Immunol. doi: doi: 10.4049/ jimmunol.2000286. Daniel Haag et al.
    [Show full text]
  • Download (PDF)
    Supplemental Information Biological and Pharmaceutical Bulletin Promoter Methylation Profiles between Human Lung Adenocarcinoma Multidrug Resistant A549/Cisplatin (A549/DDP) Cells and Its Progenitor A549 Cells Ruiling Guo, Guoming Wu, Haidong Li, Pin Qian, Juan Han, Feng Pan, Wenbi Li, Jin Li, and Fuyun Ji © 2013 The Pharmaceutical Society of Japan Table S1. Gene categories involved in biological functions with hypomethylated promoter identified by MeDIP-ChIP analysis in lung adenocarcinoma MDR A549/DDP cells compared with its progenitor A549 cells Different biological Genes functions transcription factor MYOD1, CDX2, HMX1, THRB, ARNT2, ZNF639, HOXD13, RORA, FOXO3, HOXD10, CITED1, GATA1, activity HOXC6, ZGPAT, HOXC8, ATOH1, FLI1, GATA5, HOXC4, HOXC5, PHTF1, RARB, MYST2, RARG, SIX3, FOXN1, ZHX3, HMG20A, SIX4, NR0B1, SIX6, TRERF1, DDIT3, ASCL1, MSX1, HIF1A, BAZ1B, MLLT10, FOXG1, DPRX, SHOX, ST18, CCRN4L, TFE3, ZNF131, SOX5, TFEB, MYEF2, VENTX, MYBL2, SOX8, ARNT, VDR, DBX2, FOXQ1, MEIS3, HOXA6, LHX2, NKX2-1, TFDP3, LHX6, EWSR1, KLF5, SMAD7, MAFB, SMAD5, NEUROG1, NR4A1, NEUROG3, GSC2, EN2, ESX1, SMAD1, KLF15, ZSCAN1, VAV1, GAS7, USF2, MSL3, SHOX2, DLX2, ZNF215, HOXB2, LASS3, HOXB5, ETS2, LASS2, DLX5, TCF12, BACH2, ZNF18, TBX21, E2F8, PRRX1, ZNF154, CTCF, PAX3, PRRX2, CBFA2T2, FEV, FOS, BARX1, PCGF2, SOX15, NFIL3, RBPJL, FOSL1, ALX1, EGR3, SOX14, FOXJ1, ZNF92, OTX1, ESR1, ZNF142, FOSB, MIXL1, PURA, ZFP37, ZBTB25, ZNF135, HOXC13, KCNH8, ZNF483, IRX4, ZNF367, NFIX, NFYB, ZBTB16, TCF7L1, HIC1, TSC22D1, TSC22D2, REXO4, POU3F2, MYOG, NFATC2, ENO1,
    [Show full text]
  • Downregulation of Carnitine Acyl-Carnitine Translocase by Mirnas
    Page 1 of 288 Diabetes 1 Downregulation of Carnitine acyl-carnitine translocase by miRNAs 132 and 212 amplifies glucose-stimulated insulin secretion Mufaddal S. Soni1, Mary E. Rabaglia1, Sushant Bhatnagar1, Jin Shang2, Olga Ilkayeva3, Randall Mynatt4, Yun-Ping Zhou2, Eric E. Schadt6, Nancy A.Thornberry2, Deborah M. Muoio5, Mark P. Keller1 and Alan D. Attie1 From the 1Department of Biochemistry, University of Wisconsin, Madison, Wisconsin; 2Department of Metabolic Disorders-Diabetes, Merck Research Laboratories, Rahway, New Jersey; 3Sarah W. Stedman Nutrition and Metabolism Center, Duke Institute of Molecular Physiology, 5Departments of Medicine and Pharmacology and Cancer Biology, Durham, North Carolina. 4Pennington Biomedical Research Center, Louisiana State University system, Baton Rouge, Louisiana; 6Institute for Genomics and Multiscale Biology, Mount Sinai School of Medicine, New York, New York. Corresponding author Alan D. Attie, 543A Biochemistry Addition, 433 Babcock Drive, Department of Biochemistry, University of Wisconsin-Madison, Madison, Wisconsin, (608) 262-1372 (Ph), (608) 263-9608 (fax), [email protected]. Running Title: Fatty acyl-carnitines enhance insulin secretion Abstract word count: 163 Main text Word count: 3960 Number of tables: 0 Number of figures: 5 Diabetes Publish Ahead of Print, published online June 26, 2014 Diabetes Page 2 of 288 2 ABSTRACT We previously demonstrated that micro-RNAs 132 and 212 are differentially upregulated in response to obesity in two mouse strains that differ in their susceptibility to obesity-induced diabetes. Here we show the overexpression of micro-RNAs 132 and 212 enhances insulin secretion (IS) in response to glucose and other secretagogues including non-fuel stimuli. We determined that carnitine acyl-carnitine translocase (CACT, Slc25a20) is a direct target of these miRNAs.
    [Show full text]
  • Detection of SHOX2 DNA Methylation by Methylation-Specific PCR in Non-Small Cell Lung Cancer
    6077 Original Article Detection of SHOX2 DNA methylation by methylation-specific PCR in non-small cell lung cancer Hongxiang Feng1#, Weipeng Shao2#, Lanfang Du3#, Xin Qing4, Zhenrong Zhang1, Chaoyang Liang1, Deruo Liu1 1Department of Thoracic Surgery, China-Japan Friendship Hospital, Beijing, China; 2Department of Thoracic Surgery, Peking University China- Japan Friendship School of Clinical Medicine and China-Japan Friendship Hospital, Beijing, China; 3Department of Emergency, Peking University Third Hospital, Beijing, China; 4Department of Pathology, Harbor-UCLA Medical Center, Torrance, CA, USA Contributions: (I) Conception and design: W Shao, H Feng, L Du, D Liu; (II) Administrative support: D Liu, X Qing; (III) Provision of study materials or patients: All authors; (IV) Collection and assembly of data: W Shao, H Feng, L Du; (V) Data analysis and interpretation: W Shao, H Feng, L Du; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. #These authors contributed equally to this work. Correspondence to: Deruo Liu. Department of Thoracic Surgery, China-Japan Friendship Hospital, No. 2, Yinghua, East Rd, Beijing, China. Email: [email protected]. Background: Lung cancer is the leading cause of cancer-related death worldwide. Short stature homeobox 2 (SHOX2) methylation detected by real-time polymerase chain reaction (PCR) has recently been demonstrated to be a potential biomarker in the diagnosis of lung cancer. However, more cost-effective methods are still needed to help cancer detection in the early stage of lung cancer. The aim of this study was to examine the methylation status of the SHOX2 gene and to investigate its diagnostic value in non-small cell lung cancer (NSCLC) patients.
    [Show full text]
  • Store-Operated Ca2+ Entry in Proliferating and Retinoic Acid-Differentiated N- and S-Type Neuroblastoma Cells
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Biochimica et Biophysica Acta 1833 (2013) 643–651 Contents lists available at SciVerse ScienceDirect Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbamcr Store-operated Ca2+ entry in proliferating and retinoic acid-differentiated N- and S-type neuroblastoma cells Natalie Bell a, Victoria Hann a, Christopher P.F. Redfern b, Timothy R. Cheek a,⁎ a Institute for Cell and Molecular Biosciences, The Medical School, Newcastle University, Framlington Place, Newcastle upon Tyne, NE2 4HH, UK b Northern Institute for Cancer Research, The Medical School, Newcastle University, Framlington Place, Newcastle upon Tyne, NE2 4HH, UK article info abstract Article history: Neuroblastoma cell lines are heterogeneous, comprised of at least three distinct cell phenotypes; neuroblastic Received 26 October 2012 N-type cells, non-neuronal substrate-adherent S-type cells and intermediate I-type cells. N- and S-type cell Received in revised form 23 November 2012 populations were enriched from the parental SH-SY5Y neuroblastoma cell line and induced to differentiate Accepted 28 November 2012 by the addition of retinoic acid (RA), a drug used in the treatment of neuroblastoma. N- and S-type cells Available online 6 December 2012 were identified based on their differential expression of β-tubulin III, vimentin and Bcl-2. Store-operated Ca2+ entry (SOCE) was then measured in proliferating and differentiated N- and S-type cell populations Keywords: Store-operated Ca2+ entry and the expression of STIM1, Orai1 and TRPC1, three proteins reported to play a key role in SOCE, was determined.
    [Show full text]