Ancestral Regulatory Mechanisms Specify Conserved Midbrain Circuitry in Arthropods and Vertebrates
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Análise Integrativa De Perfis Transcricionais De Pacientes Com
UNIVERSIDADE DE SÃO PAULO FACULDADE DE MEDICINA DE RIBEIRÃO PRETO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Ribeirão Preto – 2012 ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Tese apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo para obtenção do título de Doutor em Ciências. Área de Concentração: Genética Orientador: Prof. Dr. Eduardo Antonio Donadi Co-orientador: Prof. Dr. Geraldo A. S. Passos Ribeirão Preto – 2012 AUTORIZO A REPRODUÇÃO E DIVULGAÇÃO TOTAL OU PARCIAL DESTE TRABALHO, POR QUALQUER MEIO CONVENCIONAL OU ELETRÔNICO, PARA FINS DE ESTUDO E PESQUISA, DESDE QUE CITADA A FONTE. FICHA CATALOGRÁFICA Evangelista, Adriane Feijó Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. Ribeirão Preto, 2012 192p. Tese de Doutorado apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo. Área de Concentração: Genética. Orientador: Donadi, Eduardo Antonio Co-orientador: Passos, Geraldo A. 1. Expressão gênica – microarrays 2. Análise bioinformática por module maps 3. Diabetes mellitus tipo 1 4. Diabetes mellitus tipo 2 5. Diabetes mellitus gestacional FOLHA DE APROVAÇÃO ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. -
A Survey of Ciidae (Coleoptera, Tenebrionoidea) of the Hyrcanian Forest (Iran) with New Faunistic Records
Zoodiversity, 54(4): 317–328, 2020 DOI 10.15407/zoo2020.04.317 UDC 595.76(23.071:55) A SURVEY OF CIIDAE (COLEOPTERA, TENEBRIONOIDEA) OF THE HYRCANIAN FOREST (IRAN) WITH NEW FAUNISTIC RECORDS S. Amini1,3, R. Krolik2, J. Nozari1*, M. E. Farashiani3 & F. Kazerani3 1Department of Plant Protection, College of Agriculture and Natural Resources, University of Tehran, Karaj, Iran. E-mail: [email protected] 2Mickiewicza, 8, 46-200 Kluczbork, Poland E-mail: [email protected] 3Research institute of Forest and Rangeland, Agriculture Research, Education and Extension Organization (AREEO), Tehran, Iran E-mail: [email protected], [email protected] E-mail: [email protected] *Corresponding author A Survey of Ciidae (Coleoptera, Tenebrionoidea) of the Hyrcanian Forest (Iran) with New Faunistic Records. Amini, S., Krolik, R., Nozari, J., Ebrahim Farashiani, M., Kazerani, F. — Ciidae are a small family of mycetophagous beetles with only fifteen species so far recorded in Iran. The occurrence of nine of them has now been confirmed. Additional 8 species belonging to 5 genera collected during the 2014– 2017 survey in the Hyrcanian Forest, North Iran, are recorded for the first time in Iran. Four species are excluded form the Iranian fauna. As a result of this study, the number of species known from Iran has increased to 19. Key words: Ciid beetles, new records, fauna, forest, fungi, Iran, Middle East. Introduction Ciidae Leach, 1819 is a cosmopolitan family of minute tree-fungus beetles comprising more than 700 described species in 51 genera worldwide (Lawrence, 2016, 2019; Souza-Gonçalves et al., 2018). There have been only limited taxonomic studies of this family with only fifteen species so far recorded from Iran (Jelínek, 2008; Amini et al., 2014; Królik, 2016; Lopes-Andrade et al., 2016, Samin et al., 2018 a, b). -
The Emergence of French Medical Entomology: the Influence of Universities, the Institut Pasteur and Military Physicians (1890–C.1938)
Medical History, 2008, 52: 387–405 The Emergence of French Medical Entomology: The Influence of Universities, the Institut Pasteur and Military Physicians (1890–c.1938) ANNICK OPINEL* The term medical entomology (entomologie me´dicale) was used for the first time in France around 1910. As far as France is concerned,1 the study of arthropods as critical components in the propagation of severe diseases such as yellow fever, trypanosomiasis, and malaria gradually emerged after 1890 in three main types of institution: civilian faculties of medicine, a specialized military medical training centre, and the Institut Pasteur. In each of these settings, medical entomology developed from different ratio- nales and interests, and came to influence different spheres of activity. Although identified very early in France—in the last decade of the nineteenth century—as the necessary associate of parasitology and the study of tropical diseases, it was nearly twenty years before medical entomology became a defined field of knowledge within the wider dis- cipline of entomology. The present article surveys the respective roles of the three teaching and research institutions that played a part in the emergence of medical entomology in France. Not only were these institutions the major actors in the country at the time, but, despite their differences, they were destined in some way closely to collaborate or to create parallel international networks of research and teaching while generating a complex array of subsidiary institutions, nearly all dealing with -
Comparative Transcriptomics Reveals Similarities and Differences
Seifert et al. BMC Cancer (2015) 15:952 DOI 10.1186/s12885-015-1939-9 RESEARCH ARTICLE Open Access Comparative transcriptomics reveals similarities and differences between astrocytoma grades Michael Seifert1,2,5*, Martin Garbe1, Betty Friedrich1,3, Michel Mittelbronn4 and Barbara Klink5,6,7 Abstract Background: Astrocytomas are the most common primary brain tumors distinguished into four histological grades. Molecular analyses of individual astrocytoma grades have revealed detailed insights into genetic, transcriptomic and epigenetic alterations. This provides an excellent basis to identify similarities and differences between astrocytoma grades. Methods: We utilized public omics data of all four astrocytoma grades focusing on pilocytic astrocytomas (PA I), diffuse astrocytomas (AS II), anaplastic astrocytomas (AS III) and glioblastomas (GBM IV) to identify similarities and differences using well-established bioinformatics and systems biology approaches. We further validated the expression and localization of Ang2 involved in angiogenesis using immunohistochemistry. Results: Our analyses show similarities and differences between astrocytoma grades at the level of individual genes, signaling pathways and regulatory networks. We identified many differentially expressed genes that were either exclusively observed in a specific astrocytoma grade or commonly affected in specific subsets of astrocytoma grades in comparison to normal brain. Further, the number of differentially expressed genes generally increased with the astrocytoma grade with one major exception. The cytokine receptor pathway showed nearly the same number of differentially expressed genes in PA I and GBM IV and was further characterized by a significant overlap of commonly altered genes and an exclusive enrichment of overexpressed cancer genes in GBM IV. Additional analyses revealed a strong exclusive overexpression of CX3CL1 (fractalkine) and its receptor CX3CR1 in PA I possibly contributing to the absence of invasive growth. -
Download Validation Data
PrimePCR™Assay Validation Report Gene Information Gene Name dachshund homolog 2 (Drosophila) Gene Symbol DACH2 Organism Human Gene Summary This gene is one of two genes which encode a protein similar to the Drosophila protein dachshund a transcription factor involved in cell fate determination in the eye limb and genital disc of the fly. The encoded protein contains two characteristic dachshund domains: an N-terminal domain responsible for DNA binding and a C-terminal domain responsible for protein-protein interactions. This gene is located on the X chromosome and is subject to inactivation by DNA methylation. The encoded protein may be involved in regulation of organogenesis and myogenesis and may play a role in premature ovarian failure. Multiple transcript variants encoding different isoforms have been found for this gene. Gene Aliases FLJ31391, MGC138545 RefSeq Accession No. NC_000023.10, NT_011651.17, NG_012817.1 UniGene ID Hs.86603 Ensembl Gene ID ENSG00000126733 Entrez Gene ID 117154 Assay Information Unique Assay ID qHsaCID0009489 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000373131, ENST00000373125, ENST00000508860, ENST00000510272, ENST00000484479, ENST00000344497, ENST00000400297 Amplicon Context Sequence AGCAAGTGGAGCAGGCACTTAAGCAAGCCACCACTAGTGACAGTGGCCTGAGG ATGTTAAAAGATACTGGAATTCCAGATATTGAAATAGAAAACAATGGGACTCCTC ATGATAGTGCTGCTATGCAAGGAGGTAACTATTACTGTTTAGAAATGGC Amplicon Length (bp) 126 Chromosome Location X:86069775-86087136 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) -
Nº Ref Uniprot Proteína Péptidos Identificados Por MS/MS 1 P01024
Document downloaded from http://www.elsevier.es, day 26/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Nº Ref Uniprot Proteína Péptidos identificados 1 P01024 CO3_HUMAN Complement C3 OS=Homo sapiens GN=C3 PE=1 SV=2 por 162MS/MS 2 P02751 FINC_HUMAN Fibronectin OS=Homo sapiens GN=FN1 PE=1 SV=4 131 3 P01023 A2MG_HUMAN Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=3 128 4 P0C0L4 CO4A_HUMAN Complement C4-A OS=Homo sapiens GN=C4A PE=1 SV=1 95 5 P04275 VWF_HUMAN von Willebrand factor OS=Homo sapiens GN=VWF PE=1 SV=4 81 6 P02675 FIBB_HUMAN Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 78 7 P01031 CO5_HUMAN Complement C5 OS=Homo sapiens GN=C5 PE=1 SV=4 66 8 P02768 ALBU_HUMAN Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 66 9 P00450 CERU_HUMAN Ceruloplasmin OS=Homo sapiens GN=CP PE=1 SV=1 64 10 P02671 FIBA_HUMAN Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 58 11 P08603 CFAH_HUMAN Complement factor H OS=Homo sapiens GN=CFH PE=1 SV=4 56 12 P02787 TRFE_HUMAN Serotransferrin OS=Homo sapiens GN=TF PE=1 SV=3 54 13 P00747 PLMN_HUMAN Plasminogen OS=Homo sapiens GN=PLG PE=1 SV=2 48 14 P02679 FIBG_HUMAN Fibrinogen gamma chain OS=Homo sapiens GN=FGG PE=1 SV=3 47 15 P01871 IGHM_HUMAN Ig mu chain C region OS=Homo sapiens GN=IGHM PE=1 SV=3 41 16 P04003 C4BPA_HUMAN C4b-binding protein alpha chain OS=Homo sapiens GN=C4BPA PE=1 SV=2 37 17 Q9Y6R7 FCGBP_HUMAN IgGFc-binding protein OS=Homo sapiens GN=FCGBP PE=1 SV=3 30 18 O43866 CD5L_HUMAN CD5 antigen-like OS=Homo -
Loss of DACH2 Is a Candidate Early Event in Breast and Ovarian Carcinogenesis
Loss of DACH2 is a candidate early event in breast and ovarian carcinogenesis By Rania Chehade A thesis submitted in conformity with the requirements for Degree of Master of Science Medical Biophysics Department University of Toronto Copyright by Rania Chehade 2013 Loss of DACH2 is a candidate early event in breast and ovarian carcinogenesis Rania Chehade Master of Science Medical Biophysics Department University of Toronto 2013 Abstract Mechanistic insights into how enduring menstrual cycle hormonal signaling promotes tumorigenesis are emerging. We performed a genome-wide screen in primary epithelial cells to identify hormonally-regulated candidates that initiate pro-tumorigenic phenotypes in normal cells. One candidate, DACH2, has been described as part of a network that regulates organogenesis during development. In vitro, we find that DACH2 expression is regulated by estrogen and progesterone in a dosage dependent manner. Lentiviral-mediated shRNA silencing of DACH2 in hormonally responsive tissues promotes expansion of cells with progenitor characteristics. Within gene expression profiles of fallopian tubes, DACH2 is a member of a minimal gene classifier that distinguishes follicular versus luteal phases. Decreased DACH2 is characteristic of luteal-phase tubal cells and the majority of ovarian serous carcinomas. These studies suggest that DACH2 may orchestrate a physiological program that, when deregulated, locks cells in a progenitor-state, induces uncontrolled proliferation, and predisposes cells for breast and ovarian carcinogenesis. ii Acknowledgements Graduate school has been a bountiful journey of learning opportunities in academic, work and life relationships. I have developed various skills and I have matured both as a researcher and a human being. First and foremost, I would like to acknowledge my supervisor Dr. -
Coleoptera, Ciidae) in Southern Africa
African InvertebratesThe 59(1):Cis 25–35bilamellatus (2018) species-group (Coleoptera, Ciidae) in southern Africa... 25 doi: 10.3897/AfrInvertebr.59.22269 RESEARCH ARTICLE http://africaninvertebrates.pensoft.net The Cis bilamellatus species-group (Coleoptera, Ciidae) in southern Africa: Cis mooihoekite sp. n. and new distributional records Igor Souza-Gonçalves1,2, Cristiano Lopes-Andrade2 1 Programa de Pós-Graduação em Ecologia, Departamento de Biologia Geral, Universidade Federal de Viçosa, 36570-900, Viçosa, Minas Gerais, Brazil 2 Laboratório de Sistemática e Biologia de Coleoptera, Departamen- to de Biologia Animal, Universidade Federal de Viçosa, 36570-900, Viçosa, Minas Gerais, Brazil Corresponding author: Igor Souza-Gonçalves ([email protected]) Academic editor: Y. Mutafchiev | Received 14 November 2017 | Accepted 17 January 2018 | Published 26 January 2018 http://zoobank.org/C9DB8E9C-335F-4962-AD2F-66F5FFC07812 Citation: Souza-Gonçalves I, Lopes-Andrade C (2018) The Cis bilamellatus species-group (Coleoptera, Ciidae) in southern Africa: Cis mooihoekite sp. n. and new distributional records. African Invertebrates 59(1): 25–35. https://doi. org/10.3897/AfrInvertebr.59.22269 Abstract Cis mooihoekite sp. n. is described based on specimens collected at two localities in the province of Mpu- malanga, South Africa. The new species is included in the Cis bilamellatus species-group, which comprises species with a single plate on both anterocephalic edge and anterior pronotal edge in males, females with pronotum usually widest near the posterior end and gradually narrowing anteriorly and both sexes with dual elytral vestiture. Cis mooihoekite sp. n. can be distinguished from the other South African species in the group by the pronotum devoid of a median impunctate line, pronotal plate angularly emarginate forming two small and triangular horns with acute apex and anterocephalic edge with very acute corners. -
Coleoptera: Ciidae) from the USA, with Comments on the Use by Ciidae of Stereaceae Fungi (Basidiomycota: Agaricomycetes: Russulales) As Hosts
A New Species of Cis Latreille (Coleoptera: Ciidae) from the USA, with Comments on the Use by Ciidae of Stereaceae Fungi (Basidiomycota: Agaricomycetes: Russulales) As Hosts Authors: Lopes-Andrade, Cristiano, Ferro, Michael L., and Keller, Harold W. Source: The Coleopterists Bulletin, 74(1) : 93-100 Published By: The Coleopterists Society URL: https://doi.org/10.1649/0010-065X-74.1.93 BioOne Complete (complete.BioOne.org) is a full-text database of 200 subscribed and open-access titles in the biological, ecological, and environmental sciences published by nonprofit societies, associations, museums, institutions, and presses. Your use of this PDF, the BioOne Complete website, and all posted and associated content indicates your acceptance of BioOne’s Terms of Use, available at www.bioone.org/terms-of-use. Usage of BioOne Complete content is strictly limited to personal, educational, and non - commercial use. Commercial inquiries or rights and permissions requests should be directed to the individual publisher as copyright holder. BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, research libraries, and research funders in the common goal of maximizing access to critical research. Downloaded From: https://bioone.org/journals/The-Coleopterists-Bulletin on 01 Apr 2020 Terms of Use: https://bioone.org/terms-of-use Access provided by The Coleopterists Society The Coleopterists Bulletin, 74(1): 93–100. 2020. ANEW SPECIES OF CIS LATREILLE (COLEOPTERA:CIIDAE) FROM THE USA, WITH COMMENTS ON THE USE BY CIIDAE OF STEREACEAE FUNGI (BASIDIOMYCOTA: AGARICOMYCETES:RUSSULALES) AS HOSTS CRISTIANO LOPES-ANDRADE Laborat´orio de Sistem´atica e Biologia de Coleoptera Departamento de Biologia Animal, Universidade Federal de Viçosa Av. -
Epigenetic Analysis of the Critical Region I for Premature Ovarian Failure
Original article Epigenetic analysis of the critical region I for J Med Genet: first published as 10.1136/jmg.2007.056093 on 15 July 2008. Downloaded from premature ovarian failure: demonstration of a highly heterochromatic domain on the long arm of the mammalian X chromosome F Rizzolio,1 T Pramparo,3 C Sala,1 O Zuffardi,3 L De Santis,5 E Rabellotti,5 F Calzi,5 F Fusi,5 R Bellazzi,4 D Toniolo1,2 c Additional tables and figures ABSTRACT deletions of CR1 were not. These findings suggested are published online only at Background: X chromosome rearrangements defined a that POF CR1 may not carry genes for ovarian http://jmg.bmj.com/content/ critical region for premature ovarian failure (POF) that vol46/issue9 function as previously hypothesised and that such extended for .15 Mb in Xq. It has been shown genes should be present only in CR2. Indeed, 1 DIBIT, San Raffaele Scientific previously that the region could be divided into two mapping of several breakpoints in the region failed Institute, Milano, Italy; 2 Institute of Molecular Genetics, CNR, functionally distinct portions and suggested that balanced to identify ovary expressed genes that could be Pavia, Italy; 3 Department of translocations interrupting its proximal part, critical region responsible for POF. Such genes were found at the Pathology and Medical Genetics, 1 (CR1), could be responsible for POF through down- autosomal breakpoints, in six cases studied.9 University of Pavia, Pavia, Italy; 4 regulation of ovary expressed autosomal genes translo- Based on our data we suggested that POF CR1 Department of Computer cated to the X chromosome. -
A Novel Chromosomal Translocation Identified Due to Complex Genetic
cells Article A Novel Chromosomal Translocation Identified due to Complex Genetic Instability in iPSC Generated for Choroideremia 1,2 3, 1,2, 3 Nejla Erkilic , Vincent Gatinois y , Simona Torriano y, Pauline Bouret , Carla Sanjurjo-Soriano 1,2, Valerie De Luca 1,2, Krishna Damodar 1,2, Nicolas Cereso 1,2, Jacques Puechberty 4, Rocio Sanchez-Alcudia 5,6, Christian P. Hamel 1,2,7, Carmen Ayuso 5,6, 1,2,7 3, 1,2, , Isabelle Meunier , Franck Pellestor z and Vasiliki Kalatzis * z 1 Inserm U1051, Institute for Neurosciences of Montpellier, 34091 Montpellier, France 2 University of Montpellier, 34095 Montpellier, France 3 Chromosomal Genetics Unit, Chromostem Platform, CHU, 34090 Montpellier, France 4 Service of Clinical Genetics, Department of Medical Genetics, Rare Diseases and Personalized Medicine, CHU, 34090 Montpellier, France 5 Department of Genetics, Institute for Sanitary Investigation, Foundation Jimenez Diaz, 28040 Madrid, Spain 6 Centre for Biomedical Network Research on Rare Diseases (CIBERER), 28029 Madrid, Spain 7 National Reference Centre for Inherited Sensory Diseases, CHU, 34295 Montpellier, France * Correspondence: [email protected]; Tel.: +33-(0)4-99-63-6076; Fax: +33-(0)4-99-63-6020 These authors contributed equally to this work. y These authors contributed equally to this work. z Received: 13 August 2019; Accepted: 7 September 2019; Published: 11 September 2019 Abstract: Induced pluripotent stem cells (iPSCs) have revolutionized the study of human diseases as they can renew indefinitely, undergo multi-lineage differentiation, and generate disease-specific models. However, the difficulty of working with iPSCs is that they are prone to genetic instability. Furthermore, genetically unstable iPSCs are often discarded, as they can have unforeseen consequences on pathophysiological or therapeutic read-outs. -
Genetics of Premature Ovarian Insufficiency and the Association with X-Autosome Translocations
160 4 REPRODUCTIONREVIEW Genetics of premature ovarian insufficiency and the association with X-autosome translocations Adriana Di-Battista, Mariana Moysés-Oliveira and Maria Isabel Melaragno Genetics Division, Department of Morphology and Genetics, Universidade Federal de São Paulo, São Paulo, Brazil Correspondence should be addressed to M I Melaragno; Email: [email protected] Abstract Premature ovarian insufficiency (POI) is the cessation of menstruation before the age of 40 and can result from different etiologies, including genetic, autoimmune, and iatrogenic. Of the genetic causes, single-gene mutations and cytogenetic alterations, such as X-chromosome aneuploidies and chromosome rearrangements, can be associated with POI. In this review, we summarize the genetic factors linked to POI and list the main candidate genes. We discuss the association of these genes with the ovarian development, the functional consequences of different mutational mechanisms and biological processes that are frequently disrupted during POI pathogenesis. Additionally, we focus on the high prevalence of X-autosome translocations involving the critical regions in Xq, known as POI1 and POI2, and discuss in depth the main hypotheses proposed to explain this association. Although the incorrect pairing of chromosomes during meiosis could lead to oocyte apoptosis, the reason for the prevalence of X-chromosome breakpoints at specific regions remains unclear. In most cases, studies on genes disrupted by balanced structural rearrangements cannot explain the ovarian failure. Thus, the position effect has emerged as a putative explanation for genetic mechanisms as translocations possibly result in changes in overall chromatin topology due to chromosome repositioning. Given the tremendous impact of POI on women’s quality of life, we highlight the value of investigations in to the interplay between ovarian function and gene regulation to deepen our understanding of the molecular mechanisms related to this disease, with the ultimate goal of improving patients’ care and assistance.