VOLUME 45 NUMBER 4 DECEMBER 2013 KMJ KUWAIT MEDICAL JOURNAL

The Official Journal of The Kuwait Medical Association

EDITORIAL Diabetes, Antidiabetic Drugs, and Cancer: Separating Background Risk from Iatrogenesis 283 Intekhab Ahmed, Samuel Dagogo-Jack REVIEW ARTICLE Metabolic Acidosis in the Critically Ill and Continuous Renal Replacement Therapy – A Review 286 Prashant G Kedlaya ORIGINAL ARTICLES Association between Patients’ Sociodemographic Characteristics and Their Satisfaction with Primary Health Care Services in Turkey 291 Davut Baltaci, Recep Eroz, Handan Ankarali, Ozgur Erdem, Ahmet Celer, Yasemin Korkut Antenatal Ultrasound Diagnosis of Fetal Anomalies at a University Hospital 300 Naglaa Mostafa Elsayed, Sondos Abuzenadah Electrophysiologic Effects of Statins in Patients with Ischemic Cardiomyopathy and Ventricular Tachyarrhythmia 307 Aleks Degirmencioglu, Gultekin Karakus, Ali Buturak, Nazmiye Cakmak, Ilke Sipahi, Ahmet Akyol Variant Analysis of the Sirtuin (SIRT1) Gene in Multiple Sclerosis 313 Tuba Gokdogan Edgunlu, Sevim Karakas Celik, Ufuk Emre, Aysun Eroglu Unal, Ahmet Dursun Acquired Multiple Clotting Factor Inhibitors in Children 319 Adekunle Adekile, Asmaa Farag Azab, Rajaa Marouf, Sundus Al-Sharida, Hanan Al-Abboh Predictors of Quality of Life in Renal Transplant Recipients 324 Rizna Abdul Cader, Rozita Mohd, Halim Abdul Gafor, Rafidah Mamat, Norhayati Arrifin CASE REPORTS Extraperitoneal Presentation of Pseudomyxoma Peritonei as a Pleural Effusion: A Case Report 329 Mohamad Abdulrahman Tayeb, Ersan Al-Zamel Colobronchial Fistula as a Complication of Advanced Colorectal Cancer: A Case Report 332 Mohamad AbdulrahmanTayeb, Yassin Mustafa, Ersan Al- Zamel Gamma Knife Radiosurgery for Recurrent Anaplastic Ependymoma with Intracranial Disseminations: A Case Report 335 Aftab A Khan, Hasan Khajah,Yousef Al Awadi Isolated Pancreatic Tuberculosis: A Medical Disease Causing Surgical Dilemmas: A Case Report and Review of Literature 339 Mohammed Nabil Y M Riyad, Mohammed Alaa Sallam, Mohammed Sulaiman Hana Twin Pregnancy with a Complete Hydatidiform Mole and Surviving Co-Existent Fetus: Report of a Case 344 Naorem Gopendro Singh, Shirien Raj Shahed, Amre Ahmed Rifaat Colpocephaly, a Wide Clinical Spectrum for One Cephalic Disorder: Three New Cases from Kuwait 348 Tarek MM Seoudi, Abeer Ahmed Al-Tararwa, Irene Yousef Aziz Cuff Herniation with Laryngeal Mask Airway 353 Fawzy Mohamed, Mohamed Al-Khashty, Svetlana Konioukhova

KU ISSN 0023-5776 Continued inside Vol. 45 No. 4 DECEMBER 2013 KUWAIT MEDICAL JOURNAL CONTENTS

Continued from cover

LETTER TO THE EDITOR Neutropenia Induced by Ceftriaxone Sodium 356 Husrev Diktas, Murat Velioglu A Mechanism Hypothesis for NMDA Receptor Antagonists Induces Schizophrenia 358 Chao-Jin Xu SELECTED ABSTRACTS OF ARTICLES PUBLISHED ELSEWHERE BY AUTHORS IN KUWAIT 359

FORTHCOMING CONFERENCES AND MEETINGS 361

WHO-FACTS SHEET 371 1. Rabies 2. Echinococcosis 3. Dengue and Severe Dengue

YEARLY TITLE INDEX 377

YEARLY AUTHOR INDEX 379

❈ ❈ ❈

Open access for articles at: www.kma.org.kw/KMJ

Indexed and abstracted in: EMBASE (The Excerpta Medica Database) Science Citation Index Expanded (also known as SciSearch®) Journal Citation Reports/Science Edition IMEMR Current Contents (Index Medicus for the Eastern Mediterranean Region; available online at: www.emro.who.int/EMRJorList/online.aspx

THE PUBLICATION OF ADVERTISEMENTS IN THE KUWAIT MEDICAL JOURNAL DOES NOT CONSTITUTE ANY GUARANTEE OR ENDORSEMENT BY THE KUWAIT MEDICAL ASSOCIATION OR THE EDITORIAL BOARD OF THIS JOURNAL, OF THE ADVERTISED PRODUCTS, SERVICES, OR CLAIMS MADE BY THE ADVERTISERS. THE PUBLICATION OF ARTICLES AND OTHER EDITORIAL MATERIAL IN THE JOURNAL DOES NOT NECESSARILY REPRESENT POLICY RECOMMENDATIONS OR ENDORSEMENT BY THE ASSOCIATION.

PUBLISHER: The Kuwait Medical Journal (KU ISSN-0023-5776) is a quarterly publication of THE KUWAIT MEDICAL ASSOCIATION. Address: P.O. Box 1202, 13013 Safat, State of Kuwait; Telephone: 1881181 Fax: 25317972, 25333276. E-mail : [email protected] COPYRIGHT: The Kuwait Medical Journal. All rights reserved. No part of this publication may be reproduced without written permission from the publisher. Printed in Kuwait. INSTRUCTIONS FOR AUTHORS: Authors may submit manuscripts prepared in accordance with the Uniform Requirements for Manuscripts Submitted to Biomedical Journals. These Requirements are published in each issue of the Kuwait Medical Journal. CHANGE OF ADDRESS: Notice should be sent to the Publisher six weeks in advance of the effective date. Include old and new addresses with mail codes. KUWAIT MEDICAL JOURNAL (previously The Journal of the Kuwait Medical Association) is added to the list of journals adhering to the “Uniform Requirements for Manuscripts Submitted to Biomedical Journals”, American College of Physicians, Independence Mall West, Sixth Street at Race, Philadelphia, PA 19106-1572, USA, and can be located at http://www.icmje.org/jrnlist.html Kuwait Medical Journal (KMJ) Published by the Kuwait Medical Association Previously known as The Journal of the Kuwait Medical Association (Est. 1967)

Honorary President: Abdulaziz Al-Babtain

EDITORIAL BOARD Editor-in-Chief: Fuad Abdulla M Hasan, Kuwait Editor: Adel Khader Ayed, Kuwait International Editor: Pawan K Singal, Canada Associate Editors: Adel A Alzayed, Kuwait Ignacio Rodriguez, USA Michael Redmond, USA Mousa Khoursheed, Kuwait Mustafa M Ridha, Kuwait Nasser Behbehani, Kuwait Noura Al-Sweih, Kuwait INTERNATIONAL ADVISORY BOARD

Ananda S Prasad, USA Giuseppe Botta, Italy Oleg Eremin, UK Anders Lindstrand, Sweden James W Roach, USA Peter RF Bell, UK Andrew J Rees, UK Jan T Christenson, Switzerland Philip M Moody, USA Belle M Hegde, India Jasbir S Bajaj, India Raymond M Kirk, UK Bengt Jeppsson, Sweden John V Forester, UK Samuel Dagogo-Jack, USA Charles A Dinarello, USA Julian Little, Canada S Muralidharan, India Christian Imielinski, Poland Kostadin L Karagiozov, Japan Stig Bengmark, Sweden Elizabeth Dean, Canada Lewis D Ritchie, UK Tulsi D Chugh, India Fiona J Gilbert, UK Mechael M Meguid, USA William A Tweed, Canada Frank D Johnston, UK Mohammed Zayer, Sweden William B Greenough, USA George Russell, UK Neva E Haites, UK Zoheir Bshouty, Canada Graeme RD Catto, UK Nirmal K Ganguli, India REGIONAL ADVISORY BOARD

Abdulla Behbehani Habib Abul Nasser J Hayat Abeer K Al-Baho Joseph C Longenecker Nawaf Al-Mutairi Alexander E Omu Kamal Al-Shoumer Nebojsa Rajacic Ali Al-Mukaimi Kefaya AM Abdulmalek Sami Asfar Ali Al-Sayegh Khalid Al-Jarallah Soad Al-Bahar Asmahan Al-Shubaili Mazen Al Essa Sukhbir Singh Uppal Chacko Mathew Mohamed AA Moussa Waleed Alazmi Eiman M Mokaddas Mousa Khadadah Waleed A Aldhahi Faisal A Al-Kandari Mustafa Al-Mousawi

EDITORIAL OFFICE Editorial Manager : Babichan K Chandy Language Editor : Abhay U Patwari EDITORIAL ADDRESS P.O. Box: 1202, 13013-Safat, Kuwait Telephone: (00-965) 1881181(Ext. 201) - Fax: (00-965) 25317972, 25333276 E-mail: [email protected] Website: www.kma.org.kw KUWAIT MEDICAL JOURNAL

KUWAIT MEDICAL JOURNAL (KMJ) Instructions for Authors

INTRODUCTION files. All the figures including illustrations should be Formerly known as ‘The Journal of the Kuwait saved as Fig. 1, Fig. 2, etc in running sequence and Medical Association’, the Kuwait Medical Journal submitted as seperate attachments along with the (KMJ) was established in the year 1967. It is the official manuscript. Incomplete/improper submissions will not publication of the Kuwait Medical Association and be processed, and will be returned. published quarterly and regularly in March, June, Following a peer review process, the corresponding September and December. author will be advised of the status; acceptance/ recommendation for revision or rejection of the paper, in AIMS AND SCOPE a formal letter sent through post and/or e-mail. A galley KMJ aims to publish peer-reviewed manuscripts of proof will be forwarded to the corresponding author international interest. Submissions on clinical, scientific through e-mail before publication of the accepted papers or laboratory investigations of relevance to medicine and which must be returned to the journal office within 48 health science come within the scope of its publication. hours with specific comments, if any. Corrections in the Original articles, case reports, brief communications, galley proof, in case any, must be limited to typographical book reviews, insights and letters to the editor are errors, or missing contents only. all considered. Review articles are solicited. Basic medical science articles are published under the section ETHICAL CONSIDERATIONS ‘Experimental Medicine’. Where human investigations or animal experiments are part of the study, the design of the work has to GENERAL be approved by local ethics committee. A relevant The Kuwait Medical Journal is a signatory journal to statement of approval should be added in the ‘Subjects the Uniform Requirements for Manuscripts Submitted and Methods’ section of the manuscript. to Biomedical Journals, the fifth (1997) revision of a document by the international Committee of Medical PREPARATION OF THE MANUSCRIPT Journal Editors. A description of important features The manuscript should be typed as ‘normal text’ in of this document is available on the Lancet website at single column, with no hyphenation and no hard returns http://www.thelancet.com. Alternatively, you may within paragraphs (use automatic word wrap) on A4 size consult the following: N Engl J Med 1997; 336:307-315 or (29.7 x 21 cm) paper in single column format, preferably order the leaflet“Uniform Requirements for Manuscripts in font size no.12. Cell format for paragraphs, artwork Submitted to Biomdical Journals” by writing to the and/or special effects for the text and/or table(s) are Editor of the British Medical Journal (BMJ), BMA House, not acceptable. Italics shall be used only for foreign/ Tavistock Square, London WC1H 9JR, UK. Latin expressions and/or special terminologies such as To present your original work for consideration, names of micro organisms. Maintain a minimum of 2 cm one complete set of the manuscript, written in English margin on both sides of the text and a 3 cm margin at the (only), accompanied by tables, and one set of figures top and bottom of each page. No part of the text other (if applicable), should be submitted to the Editor. than abbreviations and/or subtitles shall be written in Authors should also provide the manuscript on an IBM upper case (ALL capital). Header/foot notes, end notes, compatible medium such as floppy, CD (in MS word lines drawn to separate the paragraphs or pages etc. are format) or pen-drive, if not submitted through e-mail. not acceptable. Do not submit articles written/saved in The KMJ editorial office uses Microsoft ‘Office 2007’ ‘Track-change’ mode word processing and ‘Excel’ programs. Details of the type of computer used, the software employed and the THE ORDER OF THE TEXT disk system, if known, would be appreciated. Original Articles: Title page, Abstract (in structured format for original articles) of no more than 250 words, ELECTRONIC SUBMISSIONS Key Words (no more than five),followed by Introduction, A manuscript could be submitted through e-mail Subjects (or Materials) and methods, Results, Discussion, as an attached word-document (.doc), together with Conclusion, Acknowledgment/s (if any), References, a scanned copy of the signed consent letter of the Legends to figures, Tables, and Figures. Each section author(s). The consent letter could otherwise be faxed should begin on a new page. to the journal office at (00965) 25317972 or 25333276. Figures/photographs, photomicrogrphs etc, if any, need Review Articles (solicited): Title Page, Abstract of to be in .jpg/.jpeg/.bmp format with 300 dpi resolution no more than 250 words, Key Words (no more than and illustrations such as drawings, charts etc., as Excel five), followed by Introduction, Methods/History

i Instructions for Authors

(if applicable), Literature Review, Conclusion, DESIGN OF THE WORK Acknowledgment/s (if any), References, Legends to This should be stated clearly. The rationale behind figures (if applicable), Tables, and Figures. Each section the choice of sample size should be given. Those about should begin on a new page. to begin randomized controlled studies may wish to study the CONSORT statement (JAMA 1996; 276:637- Case Studies: Title page followed by Abstract (a 639). short summary of not more than 200 words), Key Words, Introduction, Case history/report, Discussion, ILLUSTRATIONS Conclusion, Acknowledgment/s (if any), References, Photographs, Photomicrographs, line drawings, Legends to figures (if applicable), Tables, and Figures. transparencies, etc. must be of high quality and supplied Manuscript should not be paginated Manually, in original (not photocopies or laser prints) of size 10 x instead to use 'insert page number' to the document 15 cm (4” x 6”). Regarding scanned image requirements, commencing the title page. Main headings, see ‘Electronic Submissions’. Photographs should fit introduction, subjects and methods, etc., should be within a print area of 164 x 235 mm. All the figures must placed on separate lines. be numbered serially (Fig 1, Fig 2 etc.) and the figure number written on the back side of each (in case of hard THE TITLE PAGE copy submission) and an arrow drawn to indicate the top Title page of the submitted manuscript should edge. Figures where patient’s identity is not concealed, provide a clear title of the study followed by full authors need to submit a written consent of the patient names of all authors, the highest academic degree or of the patient’s guardian, in case of minors. Figure and affiliations if any, the name and address of the legends/titles should be listed separately after the institution/s where the work was done including ‘References’ section. If any of the tables, illustrations the department, the name and complete address or photomicrographs have been published elsewhere of the corresponding author to whom proofs and previously, a written consent for re-production is required correspondences shall be sent, duly supported with from the copyright holder along with the manuscript. contacts such as telephone, mobile/cell, fax and e- Charts and drawings must be professionally done, duly mail address. titled and submitted in Excel format as separate files. When charts are submitted, the numerical data on which STRUCTURED ABSTRACT they were based should be supplied. A structured abstract of no more than 250 words is required for studies under the section “Original ABBREVIATIONS Articles”. It must provide an overview of the entire Except for units of measurement, abbreviations paper, and should contain succinct statements on should be defined on first use and then applied the following, where appropriate: Objective(s), consistently throughout the article. Non-standard Design, Setting, Subjects, Intervention(s), Main abbreviations or those appearing fewer than three times Outcome Measure(s), Result(s), and Conclusion(s). are not accepted. Use abbreviated units of measure, (See: Haynes RB, Mulrow CD, Huth AJ, Altman DG, only when used with numbers. Abbreviations used as Gardner MJ. More informative abstracts revisited. legends in tables and/or figures should be duly defined Annals of Internal Medicine 1990; 113:69-76). Abstract below the respective item. for all other category of submissions shall be a short summary not more than 200 words followed by Key NUMBERS AND UNITS words and the report or review. Measurements of length, height, weight and volume must be reported in metric units (meter, KEY WORDS kilogram, liter etc.) or their decimal multiples. Key Words should be preferably MeSH terms, and Temperature should be given in degrees Celsius. shall not duplicate words already in the manuscript Blood pressure in mm Hg, and hematological and title; MesH terms can be checked at: . (SI) units. For decimal values, use a point, and not a comma, e.g., 5.7. Use a comma for numbers > 10,000 TABLES (i.e., 103) and for numbers < 9999, do not use a comma Tables typed on separate pages using table format (e.g., 6542). should follow the list of references. All tables must be numbered consecutively and provided with appropriate DRUG NAMES titles. Contents of the table should be simple, and Non-proprietary (generic) names of product information therein not duplicated, but duly referred should be employed. If a brand name for a drug is to, in the main text. Tables recording only a few values used, the British or international non-proprietary are not appreciated, since such information can be (approved) name should be given in parentheses. The more accurately, usefully and concisely presented as a source of any new or experimental preparation should sentence or two in the text. also be given.

ii KUWAIT MEDICAL JOURNAL REFERENCES abstract form. In consideration of the KMJ accepting my/our Indicate references in the text in sequence using submission for publication, the author(s) undersigned hereby Arabic numerals within square brackets and as assign all copyrights ownership to the KMJ and shall have superscripts (e.g.,[1, 3-5] etc). Do not quote additional no right to withdraw its publication. It is expressly certified data (like part of the title, year of publication etc.) that I/we, have done/actively participated in this study and from the references with citations in the text, unless agree to the accuracy of contents of this manuscript. It was very important. In the References section, list them conducted in accordance with current ethical considerations in the same sequence as they appeared in the text. and meets with the committee’s approval. I/all of us agree to Include the names and initials of all authors if not its publication in KMJ and to the authorship as expressed in more than six (≤ 6); when authorship exceeds six, use this declaration and in the title page of our manuscript”. The et al after three author names. Do not use automatic participation of the authors must include: conception, numbering, end notes or footnotes for references. design, analysis, interpretation, or drafting the article References to manuscripts either in preparation or for critically important intellectual content. A change submitted for publication, personal communications, in authorship after initial submission of a manuscript unpublished data, etc. are not acceptable. should be duly supported with a documented request The author’s name should be followed by the title from the main author, duly endorsed by the author of the article, the title of the journal abbreviated in the removed and/or-added. No changes in authorship style of the Index Medicus, the year of publication, the will be permitted after acceptance for publication of a volume number and the first and last page numbers. manuscript. References to books should give the title of the book, More than six authors are not appreciated for an followed by the place of publication, the publisher, the article and if listed, the authors may be asked to justify year and the relevant pages. Journal titles should be the contribution of each individual author. For case abbreviated according to the style in Index Medicus. reports, not more than three authors are acceptable. References should be limited to those relating directly Regarding contributions of authors over the limit to the contents of the paper and should be set out in mentioned above, read the ‘Acknowledgment’ Vancouver style, as shown in the examples below. section.

EXAMPLES ACKNOWLEDGMENT Article The objective of this section is to disclose affiliations Burrows B, Lebowitz MD. The ß agonists dilemma with or association of any organization with a direct (editorial). N Engl J Med 1992; 326:560-561. financial interest in the study. Otherwise, it will be considered as having no such interests. Contributions Book of others who have involved in the study, such as Roberts NK. The cardiac conducting system and statisticians, radiologists etc. and/or those who have His bundle electrogram. New York, Appleton-Century- assisted in the preparation of the manuscript submitted Crofts, 1981; 49-56. could also be included in this section.

Book chapter COPY RIGHT Philips SJ, Whisnam JP. Hypertension and stroke, The publisher reserves copyright on the Journal’s In: Laragh JH, Bremner BM, editors. Hypertension: contents. No part may be reproduced, translated or pathophysiology, diagnosis, and management. 2nd Ed. transmitted in any form by any means, electronic New York: Raven Press; 1995. p 465-478. or mechanical, including scanning, photocopying, recording or any other information storage and retrieval Weblinks system without prior permission from the publisher. U.S. positions on selected issues at the third The publisher shall not be held responsible for any negotiating session of the Framework Convention on inaccuracy of the information contained therein. Tobacco Control. Washington, D.C.: Committee on Government Reform, 2002. (Accessed June 4, 2003, at SUBMISSION OF A MANUSCRIPT http://www.house.gov/reform/min/inves.tobacco/ index_accord.htm.) Manuscripts to be submitted to: The Editor AUTHORSHIP AND CONSENT FORM Kuwait Medical Journal All authors must give their signed consent for P.O. Box: 1202 publication in a letter of submission, which should Code-13013-Safat accompany the manuscript. This letter should contain Kuwait the statement that “This manuscript (write the title) Telephone (965) 1881181(Ext. 201) is an unpublished work which is not under consideration Fax (965) 25317972; 25333276 elsewhere and the results contained in this paper have E-mail: [email protected] not been published previously in whole or part, except in Website: www.kma.org.kw

iii OUR GRATITUDE

The Editorial Board of the Kuwait Medical Journal gladly expresses its gratitude to

The Kuwait Foundation for the Advancement of Sciences (KFAS)

for the financial support accorded to this journal during the year 2012 December 2013 KUWAIT MEDICAL JOURNAL 283 Editorial

Diabetes, Antidiabetic Drugs, and Cancer: Separating Background Risk from Iatrogenesis

Intekhab Ahmed1, Samuel Dagogo-Jack2 1Division of Endocrinology, Thomas Jefferson University, Philadelphia, Pennsylvania, USA 2Division of Endocrinology, Diabetes and Metabolism, University of Tennessee Health Science Center, Memphis, Tennessee, USA

Kuwait Medical Journal 2013; 45 (4): 283 - 285

Diabetes is a well-recognized risk factor for longterm Most reports and studies on the subject of diabetes microvascular and macrovascular complications, via and cancer have focused on type 2 diabetes. Support mechanisms that include glycemic and nonglycemic for a link between diabetes and increased cancer mediators. However, an association between diabetes risk comes from many globally conducted meta- and increased risk of cancer, though first reported in analyses[8,9]. Several reports have indicated that diabetic 1932, is less well recognized and often controversial[1]. patients are twice as likely to have cancers of the liver, In 2009, a metaanalyses linking increased risk of cancer pancreas, and endometrium, compared to persons with use of insulin in patients with diabetes generated without diabetes. The link between colon, rectum, tremendous attention on the subject in the medical breast, and bladder cancers and diabetes also has been literature[2-4]. Given the high prevalence of cancer and observed, though reported association is weaker than diabetes, both conditions can be expected to occur in the aforementioned cancers[10]. Interestingly, a notable certain individuals as a matter of chance. Of critical exception is prostate cancer, where lower risk has been importance to biomedicine is the question as to whether consistently reported for diabetic patients[11]. there is a causal or biologically plausible association between diabetes and cancer and if so, what could be Potential Mechanisms and Mediators the underlying mechanisms? Some common risk factors shared by diabetes The discussion in the literature has tended to and cancer include obesity, insulin resistance, separate type 1 diabetes from type 2 diabetes in the inflammation, dietary factors, and smoking. It is consideration of cancer association. Specific data plausible that the aggregation of these risk factors for patients with type 1 diabetes and cancer risk is in a genetically susceptible individual could create conflicting. A survey of 28,900 British patients with favorable grounds for the coexistence of diabetes and insulin-treated diabetes, followed for 520,517 person- cancer. Obesity, a major risk factor for type 2 diabetes years, showed a significant increased risk of ovarian has been linked to increased prevalence of several cancer in patients with diabetes diagnosed under cancers, including adenocarcinoma of the gastric age 30 years (mostly thought to be type 1)[5]. Risks cardia, gall bladder cancer, liver cancer, pancreatic of cancer at other major sites were not substantially cancer, hematopoietic malignancies, and advanced raised for people with type 1 diabetes. Similarly, a prostate cancer[12,13]. A large epidemiological study in Swedish cohort study that examined cancer incidence the United Kingdom implicated increased adiposity as among 29,187 patients, who were hospitalized for type a contributory factor to increased cancer risk among 1 diabetes from 1965 to 1999, reported a 20% increase postmenopausal women[14]. Although the exact in overall cancer incidence among type 1 diabetes mechanisms remain to be elucidated, the adverse patients compared to the background age matched metabolic effects of over-nutrition, excess body fat, population[6]. Specifically, elevated risks of cancers of and insulin resistance represent putative triggers of the stomach, cervix, and endometrium were noted[6]. A abnormal cell proliferation in the obese state. At the fairly consistent finding of increased risk of pancreatic molecular level, an attractive candidate mediator cancer in patients with type 1 diabetes has also been is hyperinsulinemia (common in obesity, insulin noted[7]. resistance and type 2 diabetes), which could promote

Address correspondence to: Sam Dagogo-Jack, MD, FRCP, A C Mullins Professor of Medicine and Director, Division of Endocrinology, Diabetes and Metabolism, University of Tennessee Health Science Center, 920 Madison Avenue, Memphis, TN 38163, USA. Tel: 901-448-1246; Fax: 901-448-5332; E-mail: [email protected] 284 Diabetes, Antidiabetic Drugs, and Cancer: Separating Background Risk from Iatrogenesis December 2013 cell proliferation through cross-activation of insulin thyroid cancer (so far detected only in rodents). Recently, like growth factor (IGF-I) receptors[15]. Clearly, further GLP-1 agonists and dipeptidylpeptidase-4 (DPP- research is needed to unravel the mechanism(s) linking 4) inhibitors have been associated with histological diabetes and cancer. changes in animal and postmortem human pancreatic tissue[21], but the significance of those findings has been Antidiabetes Medications questioned[22]. Because reports of increased cancer risk were In conclusion, type 2 diabetes and cancer are two developed mostly from patients already receiving prevalent conditions that can be expected to co-exist antidiabetic medications, attention has been given to by chance in many individuals. Several common an examination of the specific roles of these agents. At risk factors shared by both conditions also increase issue is whether insulin and the other medications used the risk for their coexistence in susceptible persons. for management of diabetes account for, or contribute Some medications used for treatment of diabetes to, some of the increased risk of cancers in diabetes have been reported to be associated with either patients. In general, the metabolic effects of insulin increased or decreased risk of certain cancers, but the species correlate with binding affinities to the insulin level of evidence often falls short of the randomized, receptor, whereas the mitogenic effects correlate better controlled standard. The few reports from randomized, with IGF-I receptor affinities. Thus, the finding that controlled studies or longitudinal follow-up data insulin analogs have variable (and often weak) binding provide reassurance that the antidiabetes medications affinities for IGF-I receptors[16] suggests that clinical in common use are unlikely to be associated with use of insulin in diabetes therapy should have minimal a significant systematic increase in cancer risk[17,19]. potential for stimulating mitogenesis. Indeed, the However, continued surveillance and further studies findings of the ORIGIN trial, a prospective randomized are needed, particularly among patients treated with controlled long-term study, provide reassurance that agents that have been implicated in cancer risk. In this the use of insulin glargine was not associated with regard, numerous prospective, randomized trials of increased risk of cancer in any anatomical region[17]. incretin agents are in progress to answer this question. With regard to noninsulin agents, a recent Drug manufacturers also have been requested to metaanalysis using primary data of published studies provide all available patient-level data that can help reported that metformin use was associated with clarify whether any of the anti-diabetes agents in decreased cancer risk, whereas sulfonylureas use was current use poses a significant risk for cancer. In the associated with increased risk[18]. The mechanism(s) meantime, physicians should discuss the pros and cons for any “anticancer” effect of metformin are yet to of every medication with their patients, and follow be clarified from randomized prospective studies. established prescription guidelines. However, such a metformin effect could introduce artificial elevation of cancer risk by non-metformin Disclosures: Dr. Ahmed has received honoraria for drugs in clinical, epidemiologic, or database studies service on advisory panels from Boehringer Ingelheim, of crude cancer rates among diabetic patients taking Bristol Myers Squibb, and Sanofi Aventis. Dr. Dagogo- different medications. Adjustment for multivariables Jack has received honoraria for consultant services ought to minimize such confounding. Data from the from Merck, Novo Nordisk, Janssen and Santarus; existing randomized controlled trials that included research grants from Astra Zeneca, Novo Nordisk and thousands of patients treated with metformin, Boehringer Ingelheim; and consulting fees from Sidley sulfonylurea or rosiglitazone for many years did not Austin and Adams and Reese for expert opinion on support a cancer-lowering effect of metformin versus diabetes. rosiglitazone[19]. However, they do not refute the possibility of a difference in cancer incidence among REFERENCES metformin-treated subjects compared with those treated with sulfonylureas[19]. In 2011, the Food and 1. Wilson EB, Maher HC. Cancer and tuberculosis with Drug Administration added a warning to pioglitazone some comments on cancer and other diseases. Am J label after a weak link between increased risk of bladder Cancer 1932; 16:227-250. cancer and long-term use of pioglitazone was detected 2. Hemkens LG, Grouven U, Bender R, Gunster C, [20] Gutschmidt S. Risk of malignancies in patients in an interim report of a longitudinal cohort study . with diabetes treated with human insulin or insulin Further update from that cohort should demonstrate analogues: a cohort study. Diabetologia 2009; 52:1732- whether the observed weak association strengthens or 1744. disappears with accrual of additional patient-years of 3. Jonasson JM, Ljung R, Talback M, Haglund B, follow-up. Glucagon-like peptide-1 (GLP-1) agonists Gudbjornsdottir S, Steineck G. Insulin glargine use and also have a warning regarding the risk of medullary short-term incidence of malignancies - a population December 2013 KUWAIT MEDICAL JOURNAL 285

based follow-up study in Sweden. Diabetologia 2009; in the million women study: cohort study. BMJ 2007; 52:1745-1754. 335:1134-1157. 4. Currie CJ, Poole CD, Gale EAM. The influence of 15. Samami AA, Yakar S, LeRoith D, Brodt D. The role of the glucose-lowering therapies on cancer risk in type 2 IGF system in cancer growth and metastasis: overview diabetes. Diabetologia 2009; 9:1766-1777. and recent insights. Endocr Rev 2007; 28:20-47. 5. Swerdlow AJ, Laing SP, Qiao Z, et al. Cancer incidence 16. P Kurtzhals, Schäffer L, Sørensen A, Kristensen C, and mortality in patients with insulin-treated diabetes: Jonassen I, Schmid C, Trüb T. Correlations of receptor a UK cohort study. Br J Cancer 2005; 92:2070-2075. binding and metabolic and mitogenic potencies of 6. Zendehdel K, Nyren O, Ostenson CG, Adami HO, insulin analogs designed for clinical use. Diabetes 2000; Ekbom A, Ye W. Cancer incidence in patients with type 49:999-1005. 1 diabetes mellitus: a population-based cohort study in 17. The Origin Trial Investigators. Basal Insulin and Sweden. J Natl Cancer Inst 2003; 95:1797-1800. Cardiovascular and Other Outcomes in Dysglycemia. 7. Pannalal R, Basu A, Peterson GM, Chari ST. New N Engl J Med 2012; 367:319-328. onset-diabetes: a potential clue to the early diagnosis of 18. Bindiya Thakkar, Konstantinos NA, Maria TV, Kelsey pancreatic cancer. Lancet Oncol 2009, 10:88-95. Shields, Kristos SM. Metformin and sulfonylureas in 8. Huxley R, Ansary-Moghaddam A, Berrington Gonzalez relation to cancer risk in Type II diabetes patients: A A, Barzi F, Woddward M. Type II diabetes and pancreatic meta-analysis using primary data of published studies. cancer: a meta-analysis of 36 studies. Br J Cancer 2005; Metabolism 2013; 62:922-934. 92:2076-2083. 19. Home PD, Kahn SE, Jones NP, Noronha D, Beck-Nielsen 9. Coughlin SS, Calle EE, Teras LR, Petrelli J, Thun MJ. H, Viberti G. ADOPT Study Group; RECORD Steering Diabetes mellitus as a predictor of cancer mortality Committee. Experience of malignancies with oral in a large cohort of US adults. Am J Epidemiol 2004; glucose-lowering drugs in the randomised controlled 159:1160-1167. ADOPT (A Diabetes Outcome Progression Trial) and 10. Karin B, Michels SCD, Caren G, et al. Type 2 diabetes RECORD (Rosiglitazone Evaluated for Cardiovascular and subsequent incidence of breast cancer in Nurses Outcomes and Regulation of Glycaemia in Diabetes) Health Study. Diabetes Care 2003; 26:1752-1758. clinical trials. Diabetologia 2010; 53:1838-1845. 11. Pierce BL, Ahsan H. Genetic susceptibility to type 2 20. Lewis JD, Ferrara A, Peng T, et al. Risk of bladder cancer diabetes is associated with reduced prostate cancer risk. among diabetic patients treated with pioglitazone: Human Heredity 2010; 69:193-201. interim report of a longitudinal cohort study. Diabetes 12. Calle EE, Kaaks R. Overweight, Obesity, and Cancer: Care 2011; 34:916-922. epidemiological evidence and proposed mechanisms. 21. Butler AE, Campell-Thomson M, Gurlo T, Dawson DW, Nat Rev Cancer 2004; 4:579-591. Atkinson M, Butler PC. Marked expansion of exocrine 13. Calle E, Rodriguez C, Walker-Thurmond K, Thun M. and endocrine pancreas with incretin therapy in Overweight, obesity and mortality from cancer in a humans with increased exocrine pancreas dysplasia and prospectively studied cohort of US adults. N Engl J the potential for glucagon-producing neuroendocrine Med 2003; 348:1625-1638. tumors. Diabetes Care 2013; 62:2595-2604. 14. Reeves GK, Pirie K, Beral V, Green J, Spencer E, Bull 22. Steven EK. Incretin therapy and islet pathology: A time D. For the Million Women Study Collaborators. Cancer for caution. Diabetes 2013; 62:2178-2180. incidence and mortality in relation to body mass index 286 KUWAIT MEDICAL JOURNAL December 2013

Review Article Metabolic Acidosis in the Critically Ill and Continuous Renal Replacement Therapy – A Review

Prashant G Kedlaya Department of Nephrology, St. John’s Medical College Hospital, Bangalore, India

Kuwait Medical Journal 2013; 45 (4): 286 - 290

ABSTRACT

Metabolic acidosis is common in critically ill patients in acid base changes in CRRT is governed by the intensity of intensive care units with or without acute kidney injury. plasma water exchange / dialysis and by the buffer content Metabolic acidosis is usually of multifactorial etiology. of the replacement fluid / dialysate used. Bicarbonate Often these patients have lactic acidosis. The routine use containing replacement fluid is the preferred choice over of intravenous sodium bicarbonate to manage acidemia is lactate containing fluid as buffering agent in many centers. debatable. Continuous renal replacement therapy (CRRT) However, lactate containing replacement fluid can be used in is often indicated in the management of these oliguric, most patients for managing acidemia in CRRT, as it is easily catabolic sick patients with metabolic acidosis. The extent of available and less costly.

KEYWORDS: critically ill, CRRT, metabolic acidosis

INTRODUCTION correction but possibly clinical outcomes. The review Acute Kidney Injury (AKI), occurs in critically here briefly deals with metabolic acidosis in critically ill ill patients often as a part of multiorgan failure. The patients and the useful role of CRRT in these scenarios, clinical spectrum of AKI has changed over the past as to how it rectifies metabolic acidosis and also the few years from that of a single organ disease managed importance of buffering agents in the replacement / only by nephrologists in the ward to a disease that dialysate fluids. occur in intensive care units (ICU), managed both by intensivists and nephrologists[1]. This subset LITERATURE REVIEW of patients is often septic, fluid-logged, acidemic Metabolic acidosis in critically ill patients is usually and hemodynamically unstable. Continuous renal of multifactorial etiology. Sepsis with hemodynamic replacement therapy (CRRT) is one of the common compromise with or without AKI, often with lactic modalities of renal replacement therapy (RRT) used in acidosis contributing to a decrease in blood pH, is a these patients and is hemodynamically well-tolerated common scenario. and efficientin achieving good control of uremic milieu, Metabolic acidosis with AKI in the critically ill is fluid status and acid base balance. During CRRT, alkali due to complex interaction between the acidifying administration either by the replacement fluid and/ effect of unmeasured anions, hyperphosphatemia, or by diffusive uptake from the dialysate replaces the hyperlactatemia, hypocalcemia and the minimum bicarbonate lost in the buffering of endogenous acid alkalinising effect of hypoalbuminemia. In the early and also that lost across the hemodiafilter. CRRT stages of AKI, hyperchloremia causes a decrease in also removes many endogenous acids accumulated, strong ion difference (SID) leading to acidosis. In by convective or diffusive transport across the the later stages, unmeasured anions like ketoacids, hemodiafilter. Correction of metabolic acidosis is one diverse acids of intermediary metabolism (Kreb’s of the primary aims in CRRT. Depending on the type cycle) like citrate, acetate, fumarate and others like of CRRT prescribed the buffer balance is influenced by sulphate, urate, oxalate, and propionates are major several factors which in turn not only affects acid base contributors to acidosis in AKI[2,3]. These unmeasured

Address correspondence to: Dr Prashant G Kedlaya, MD, DM, DNB (Nephrology), Department of Nephrology, St. John’s Medical College Hospital, Sarjapur Road, Bangalore 560 034, India. Tel: 919845369060 (Mobile), 080 22065301 (Office), Fax: 080 25633844, E-mail: [email protected] December 2013 KUWAIT MEDICAL JOURNAL 287 anions contribute to nearly 50% of the acidosis[4]. Lactic ‘replacement fluids’ without major volume restrictions acidosis in these hemodynamically compromised because fluid balance can be maintained and regulated patients with multiorgan dysfunction also contributes by adjustments in ultrafiltration rate. In adults about 8 to metabolic acidosis. - 10 times the total amount of body plasma water can be The aim and extent of correction of acidosis in filtered in 24 hrs and replaced by replacement solutions. the critically ill patients is a matter of debate. Severe Generally, higher the ultrafiltration rate, higher the metabolic acidosis arbitrarily definedas pH less than 7.1 ‘convective’ removal of acidifying substances from the has a number of adverse effects on the patient including blood and faster replacement of ‘buffering’ agent by myocardial depression and refractory shock. However, replacement fluid and faster control of acidemic status. the overall effect of increased extracellular [H+] on However, this theoretical advantage of hemofiltration the myocardium is related to the underlying disease techniques being able to achieve better uremic toxin state producing acidosis, catecholamine response, clearances with high ultrafiltration can be technically intracellular energy stores and other variables like tissue demanding to realize whenever ultrafiltration is > 25 oxygen tension, concentration of various electrolytes l/day[14]. Fluid balancing with replacement fluids and and lactate. Sepsis and lactic acidosis have a profound filter clotting due to extracorporeal hemoconcentration negative ionotropic effect on the heart than other forms poses a problem in practicality. Evidence shows that in of metabolic acidosis. Also, there are different effects of CRRT, ultrafiltration rate of between 20 ml/kg body acidosis seen in animal experimental setting and actual weight/hr to 35 ml/kg/hr achieves optimal uremic clinical settings[5-7]. Intravenous bicarbonate therapy toxin clearances and metabolic control in critically ill for correction of severe acidosis has a basket of adverse AKI patients[15]. effects like hypervolemia, hypernatremia, increase in It is important to discuss the following to clearly lactate production, increased pCO2 and also may cause depict how CRRT is helpful to correct acidosis in the overshoot alkalosis[8-10]. critically ill: Severe metabolic acidosis caused or aggravated • What are the acids which are dialyzable? by AKI is an indication for RRT when intravenous • Are ‘bases’ (bicarbonate) also dialysed during bicarbonate buffering becomes insufficient or CRRT? complicates therapy due to fluid logging in the • During CRRT, which replacement fluid is preferred presence of compromised renal function[11]. Additional for correcting acid-base disorder, ‘bicarbonate indications for initiating RRT are often present like based’ replacement fluid or ‘lactate based’? hyperkalemia, hypercatabolic states, fluid overload • Is there any difference in the ‘outcomes’ when and to replenish sufficient nutrition. Rarely, an acid- bicarbonate based fluid Vs lactate based fluid is base disorder is an exclusive indication for RRT. used? Metabolic acidosis which is refractory to RRT may CRRT corrects acidosis by way of acid removal define a subset of population with very high mortality and adding buffer to the plasma. CRRT can correct and acidosis may reflect underlying severity of illness acidemia in most circumstances by 24 / 48 hours with poor prognosis. Metabolic acidosis itself, may not and balanced acid base milieu can be maintained be a causative factor in morbidity and mortality in the for 24 hours a day by virtue of being a continuous critically ill[12]. technique[16]. The acidifying substances removed by RRT is a symptomatic therapy of acid base RRT are phosphates and unmeasured anions. Mineral disorder and treatment of underlying disease is acids have low molecular weight and high diffusibility essential. Specific physiological end points for acid and hence are dialyzable. Depending on the molecular base intervention via RRT in the critically ill patient weight, organic acids can be removed by RRT as well are undefined. CRRT especially continuous veno- but to variable extent. venous hemofiltration (CVVHF) and continuous veno- Inborn errors of metabolism in the neonates and venous hemodiafiltration (CVVHDF) are often used pediatric age group may present as severe acidosis in critically ill hemodynamically unstable patients as often along with hyperammonemias. Both ammonia these therapies are hemodynamically well-tolerated, which may cause neurological sequale and the correct metabolic abnormalities as they evolve (steady offending organic acids are effectively removed in state chemistry) and are highly effective is removing CRRT, making this a useful adjuvant treatment in the excess fluid even in patients requiring high inotropic acute management of these patients[17]. support[13]. Only small amounts of lactate (< 3 - 5%) are removed CVVHF and CVVHDF remove acids from the by CRRT[18]. The nature and extent of acid base changes body by way of diffusive and convective transport brought about by CRRT depends not only on the across the hemofilter membrane. The buffer type amount of accumulated acid dialyzed but also on the and concentration can be chosen and replaced by buffer content of the replacement fluid / dialysate and 288 Metabolic Acidosis in the Critically Ill and Continuous Renal Replacement Therapy ... December 2013 the metabolic rate of these anions[19]. Treatment of lactic (HCA). However, the net plasma chloride gain and its acidosis must always address tissue perfusion and effect on acid base status cannot be easily predicted oxygenation, hemodynamic stability and management due to multiple variable factors in CRRT. The serum of basic etiology of illness. RRT cannot rectify lactic chloride level may fall below the concentration level acidosis and is not the treatment for lactic acidosis. in the replacement fluid especially in high volume During standard CRRT, up to 800 - 1000 mmol per CRRT and exert an alkalinizing effect[23]. The site of day of bicarbonate is lost in the ultrafiltration. During replacement fluid infusion, i.e., prefilter or postfilter CRRT, buffer is administered to make up for the losses also has an effect on the ultimate serum concentration in the ultrafiltration and also to combat base deficit of various cations and anions which in turn affects the which had occurred due to acidemia. The required SID and acid base milieu[24]. At present there is limited ‘buffering agent’ is delivered during CRRT by way of data regarding HCA in CRRT. dialysate fluid across the hemofilter to the blood stream The choice is made mainly between bicarbonate and and also by way of ‘replacement’ fluid infusion. lactate as buffers. The evidence for or against lactate or Nowadays, dialysate solutions and replacement bicarbonate as replacement buffer is less clear cut as fluids are commercially, easily available packaged in there are only few prospective, randomized controlled five liter bags. The same dialysate fluid can be used trials with small patient numbers[25-28]. Data mainly as replacement fluid infused either pre-hemofilter or comes from small case series and retrospective cohort post-hemofilter. Available fluid comes in a variety studies. A number of case series reported better acidosis of fluid composition, differing in buffer type and control in severely ill patients when lactate was replaced content, amount of sodium, calcium, magnesium and by bicarbonate replacement fluids[29]. However, potassium (Table 1). many controlled studies reported equal efficacy for The patient’s clinical profile, biochemical acidemia correction for the two solutions[26,27]. Again, parameters and ability to metabolize lactate influence an important caveat is that the clinical subgroup of the choice of ‘buffers’ in correction of acidosis by patients with high initial blood lactic acid levels have continuous RRT in critically ill patients. ‘Acetate’ as a not been included in many studies comparing lactate buffer was used previously but it is almost abandoned Vs bicarbonate replacement fluids. nowadays as it causes severe vasodilation and worsens Lactate is normally converted in the liver on a hemodynamic instability[20]. Lactate and bicarbonate 1:1 basis to bicarbonate and is capable of providing containing solutions offer better acidosis control and sufficient alkali load to correct acidemia, when fully hemodynamic stability than acetate based solutions. metabolized. The effect on blood pH of different replacement Hyperlactatemia becomes a problem in patients solution depends on the strong ionic difference (SID) of with hepatic dysfunction as ‘lactate’ in replacement the fluid. Normal value of plasma SID is 39 ± 1 mmol/l. fluid is not fully converted to bicarbonate. ‘Lactate High SID values of replacement fluid have alkalinizing intolerance’ during CRRT is defined arbitrarily as effects and low values have acidifying effects[21,22]. If the a > 5 mmol/l rise in serum lactate levels. Iatrogenic replacement fluid has got high chloride concentration hyperlactatemia may cause hyperglycemia[25]. The the SID value of the fluid will be low, leading to net effect of this iatrogenic hyperlactatemia on patient plasma chloride gain and hyperchloremic acidosis outcome viz acidosis, hemodynamic instability and

Table 1: Showing some of the CRRT solutions commercially available and their composition (Bicarbonate and lactate composition is highlighted)

Component Peritoneal dialysis Ringer Lactate Prismasate- L Prismasate Hemosol (mM/ l) fluid (Baxter) solution (Gambro renal product) (Gambro renal product)

Sodium 132 130 140 140 140 Potassium 0 4 0 0, 2, 4 0 Chloride 96 109 109 109 109 Bicarbonate Nil Nil - 22/ 32 32 Calcium 1.75 1.35 1.25 1.25 1.75 Magnesium 0.25 Nil 0.75 0.75 0.5 Lactate 40 28 35 3 3 Glucose (mg/dl) 1360 Nil 110 0 or 110 Nil

• Peritoneal dialysis fluid contains lactate based buffer and are easily available and can be used for CRRT but the problem is the high glucose content of fluid that can cause hyperglycemia. • Hemosol / prismasate contains two solutions (Sol A and Sol B) in a single bag of 5l separated by a barrier, which needs to be pre-mixed just prior to the usage. December 2013 KUWAIT MEDICAL JOURNAL 289 mortality is unclear. In an early study in patients with a constraint, most critically ill patients can still be combined hepatic and renal failure, lactate based CRRT safely managed with lactate containing replacement led to lactic acidosis and hemodynamic compromise[29]. solutions. In another prospective study involving 132 patients, no difference was found between bicarbonate based REFERENCES and lactate based fluids in terms of acidosis control and hemodynamic variables[30]. There are no studies 1. Ronco C, Monico Zamella, Allesandra Brendolan, et al. which show a significant mortality benefit for either Management of severe acute renal failure in critically bicarbonate or lactate based replacement fluid in CRRT ill patients: an international survey in 345 centres. as patient numbers were small in most series. Nephrol Dial Transplant 2001; 16:230-237. 2. Rocktaeschel J, Morimatsu H, Uchino S, Bellomo R. However, the working group of Acute Dialysis Unmeasured anions in critically ill patients: can they Quality Initiative (ADQI) recommend that bicarbonate predict mortality? Crit Care Med 2003; 31:2131-2136. based replacement fluid be used for patients with 3. Lui G Forni, William McKinnon, Gwyn A Lord, liver failure, presence of lactic acidosis at the initiation David F Treacher, Jean-Marie R Peron, Philip J Hilton. of RRT and when high volume hemofiltration is Circulating anions usually associated with the Krebs considered[31]. High volume hemofiltration (HVHF) cycle in patients with metabolic acidosis. Crit Care involves ultrafiltration volume filtration more than 50 2005; 9:R591-R595. l/ day (varying between 35 – 80 ml/kg/hr)[32]. 4. Rocktaeschel J, Morimatsu H, Uchino S, et al. Plasma A bicarbonate based solution seems to be more acid-base changes in chronic renal failure: a Stewart analysis. Int J Artif Organs 2005; 28:961-965. physiological and has become the buffer of choice 5. Yatani A, Fujino T, Kinoshita K, Goto M. Excess lactate in many centers. But bicarbonate solutions are more modulates ionic currents and tension components in expensive and unstable as they breakdown to CO2 frog atrial muscle. J Mol Cell Cardiol 1981; 13:147- and H2O. CO2 may be lost by diffusion from plastic 161. containers and decrease bicarbonate concentration. 6. Lagadic-Gossmann D, Buckler KJ, Vaughan-Jones RD. - 2+ Role of bicarbonate in pH recovery from intracellular Also, HCO3 form insoluble precipitates with Ca and Mg2+ when in solution and hence they cannot be mixed acidosis in the guinea-pig ventricular myocyte. J until shortly before use. The bicarbonate concentration Physiol 1992; 458:361-384. in the replacement fluid is much higher than the normal 7. Downing SE, Talner NS, Gardner TH. Cardiovascular responses to metabolic acidosis. Am J Physiol 1965; serum bicarbonate levels (supraphysiological) as this 208:237-242. is necessary to replenish the patient’s base deficit. 8. Kraut JA, Kurtz I. Use of base in the treatment of severe Lactate based solutions are less costly, more stable and acidemic states. Am J Kidney Dis 2001; 38:703-727. easily available. The use of lactate based solutions in 9. Gehlbach BK, Schmidt GA. Bench-to-bedside review: CRRT is well tolerated in most patients. Commercially Treating acid-base abnormalities in the intensive care available solutions are buffered with approximately 40 unit - the role of buffers. Crit Care 2004; 8:259-265. mmol/l of lactate. Monitoring of arterial lactate levels 10. Graf H, Leach W, Arieff AI. Evidence for a detrimental along with blood gases is advisable when lactate based effect of bicarbonate therapy in hypoxic lactic acidosis. fluids are used[33]. Science 1985; 227:754-756. 11. Bellomo R, Ronco C. Indications and criteria for initiating renal replacement therapy in intensive care CONCLUSION unit. Kidney Int 1998; 53:S 106-109. CRRT is a useful tool in the management of metabolic 12. Honore PM, Jamez J, Wauthier M, et al. Prospective acidosis in the critically ill patients with hemodynamic evaluation of short-term, high-volume isovolemic instability and multiorgan dysfunction. Being a hemofiltration on the hemodynamic course and continuous technique it is helpful in maintaining a outcome in patients with intractable circulatory failure balanced acid base milieu 24 hours a day. The extent of resulting from septic shock. Crit Care Med 2000; acid base changes in CRRT depends on multiple factors 28:3581-3587. like the intensity of dialysis / diafiltration, the choice 13. Henrich WL. Principles and practices of dialysis, 3rd ed. Philadelphia: Lippincott Williams & Wilkins, 2004. of buffering agent, the patients’ ability to metabolize 14. Mehta RL. Fluid management in CRRT. Contrib lactate and the site of replacement fluid infusion (pre- Nephrol 2001; 132:335-348. filter or post-filter). CRRT is not useful in the primary 15. Paul M. Palevsky. Intensity of CRRT in acute kidney management of lactic acidosis per se and the underlying injury. Semin Dial 2009; 22:151-154. etiology for lactic acidosis should be addressed. 16. Rocktaschel J, Morimatsu H, Uchino S, Ronco C, Bellomo Bicarbonate based dialysis fluid and replacement R. Impact of continuous venovenous hemofiltration on fluids are preferred choice for CRRT, especially in acid base status. Int J Artif Organs 2003; 26:19-25. patients with liver failure and pre-existing lactic 17. Ponikvar R, Kandus A, Urbancic A, et al. Continuous acidosis. However where cost and availability poses renal replacement therapy and plasma exchange in newborns and infants. Artif Organs 2002; 26:163-168. 290 Metabolic Acidosis in the Critically Ill and Continuous Renal Replacement Therapy ... December 2013

18. Levraut, Jacques MD, Ciebiera, et al. Effect of continuous 26. Zimmerman D, Cotman P, Ting R, et al. Continuous venovenous hemofiltration with dialysis on lactate veno-venous haemodialysis with a novel bicarbonate clearance in critically ill patients. Crit Care Med 1997; dialysis solution: prospective cross-over comparison 25:58-62. with a lactate buffered solution. Nephrol Dial Transplant 19. Heering P, Ivensk, Thumer O, Bauser M, Grabensee 1999; 14:2387-2391. B. Acid base balance and substitution fluid during 27. Barenbrock M, Hausberg M, Matzkies F, et al. Effects of continuous hemofiltration. Kidney Int 1999; 56:37-40. bicarbonate- and lactate-buffered replacement fluids on 20. Morgera S, Heering P, Szentandrasi T, et al. Comparison cardiovascular outcome in CVVH patients. Kidney Int of a lactate-versus acetate-based hemofiltration 2000; 58:1751-1757. replacement fluid in patients with acute renal failure. 28. Thomas AN, Guy JM, Kishen R, et al. Comparison of Ren Fail 1997; 19:155-164. lactate and bicarbonate buffered haemofiltration fluids: 21. Rocktaeschel J, Morimatsu H, Uchino S, et al. Acid-base use in critically ill patients. Nephrol Dial Transplant status of critically ill patients with acute renal failure: 1997; 12:1212-1217. analysis based on Stewart-Figge methodology. Crit 29. Davenport A, Will EJ, Davison AM. The effect of lactate- Care 2003; 7:R60-R66. buffered solutions on the acid-base status of patients 22. Story DA, Morimatsu H, Bellomo R. Strong ions, weak with renal failure. Nephrol Dial Transplant 1989; 4:800- acids and base excess: a simplified Fencl-Stewart 804. approach to clinical acid-base disorders. Br J Anaesth 30. Heering P, Ivens K, Thümer O, et al. The use of different 2004; 92:54-60. buffers during continuous hemofiltration in critically ill 23. Cole L, Bellomo R, Baldwin I, Hayhoe M, Ronco C. The patients with acute renal failure. Intensive Care Med impact of lactate buffered high volume hemofiltration 1999; 25:1244-1251. on acid base balance. Intensive Care Med 2003; 29:1113- 31. Schetz M, Leblanc M, Murray PT. The Acute Dialysis 1120. Quality Initiative. Part VII: Fluid composition and 24. Uchino S., Cole L, Morismatu H, et al. Solute mass management in CRRT. Adv Ren Replace Ther 2002; balance during isovolemic high volume hemofiltration. 9:282-289. Intensive Care Med 2003; 29:1541-1546. 32. Nimmo GR, Mackenzie SJ, Walker S, et al. Acid-base 25. Bollmann MD, Revelly JP, Tappy L, et al. Effect of responses to high-volume haemofiltration in the bicarbonate and lactate buffer on glucose and lactate critically ill. Nephrol Dial Transplant 1993; 8:854-857. metabolism during hemodiafiltration in patients 33. Peter Heering, Katrin Ivens, Oliver Thumer, et al. Acid- with multiple organ failure. Intensive Care Med 2004; base balance and substitution fluid during continuous 30:1103-1110. hemofiltration. Kidney International 1999; 56:S37-S40. December 2013 KUWAIT MEDICAL JOURNAL 291

Original Article Association between Patients’ Sociodemographic Characteristics and their Satisfaction with Primary Health Care Services in Turkey

Davut Baltaci1, Recep Eroz2, Handan Ankarali3, Ozgur Erdem4, Ahmet Celer5, Yasemin Korkut5 1Department of Genetics, 2Department of Biostatistics, 4Department of Family Medicine, Duzce University, Faculty of Medicine, Duzce, Turkey 3Nolu Aile Saglıgı Merkezi (ASM), Kayapınar, Diyarbakir, Turkey 5Aile Sagligi Merkezi (ASM), Bursa, Turkey

Kuwait Medical Journal 2013; 45 (4): 291 - 299

ABSTRACT Objective: To investigate the influence of patient’s socio- married than unmarried patients, patients with high demographic features on patient’s satisfaction with primary income than low income, in employed and unemployed health care (PHC) services in the Turkish population than officers (p = 0.028, p = 0.043, p = 0.001, and p = 0.006, Design: Cross-sectional and population-based study respectively). The patients with high income level had Settings: Forty-five family health centers from 15 cities significantly higher level of satisfaction than those with low throughout Turkey income in all domains of patient satisfaction. Female patients Subjects: One thousand two hundred and ten patients were were more satisfied with communication, medical care, and randomly selected. The self-administered study survey was support and information domains. Married patients were applied. more satisfied with communication and medical care. The Main Outcome Measures: Association between patients’ officers were less satisfied than other status of occupation. sociodemographic features and patient satisfaction with The patients with university level of education were more primary care settings satisfied than those with middle and high school level of Results: The mean age of subjects was 37.4 ± 14.7 years. education. When mean total score for incisions of sociodemographic Conclusion: Income level, marital and occupational status of features was evaluated, it was observed that the patient patient’s sociodemographic features had significant influence satisfaction level was high in female than male patients, on satisfaction levels in the Turkish population

KEYWORDS: health care quality, patient satisfaction, primary care, socio-demographic factors

INTRODUCTION to see their primary care physician (PCP), have As the health care system in Turkey has evolved explicit expectations and priorities for their medical over the last few years, quality in health care appears consultation. Recognition of these expectations is an more difficult to achieve. In Turkey, transition health important step in organizing patient-oriented health care system has been provided, particularly, in care services. Patient expectations depend on a number primary health care (PHC) settings. Family medicine of factors: health problem and its severity, as well as implementation was initiated in and established since social and demographic characteristics of patient and 2005[1, 2]. physician[5]. Health care is an integrated multidisciplinary Patient satisfaction is a multidimensional service. Primary care is the most important and healthcare construct influenced by many factors. basic step. Therefore, family physicians have a great Health care quality affects patient satisfaction, in turn responsibility to provide PHC services. They are gate- influencing positive patient behavior, such as loyalty[6]. keeper physicians[3,4]. Most of the patients, coming The measurement of patient satisfaction with family

Address correspondence to: Davut Baltaci, MD, Assistant Professor, Department of Family Medicine, Duzce University School of Medicine, Konuralp, 81620, Duzce, Turkey. Tel: (+90) 380 5421390-5820, (+90) 532 7165619, [email protected] 292 Association between Patients’ Sociodemographic Characteristics and their Satisfaction ... December 2013

Fig. 1: 15 cities, representing overall Turkey in respect of socio-demographic cultural similarities, in which the study was conducted physician practice is an important determinant and January 2011 and September 2011 by the Department meets the patient’s need and expectations in terms of Family Medicine, School of Medicine, and Duzce of care and quality of health care[7]. Measurement of University (Fig. 1). The cities were chosen because patient satisfaction can be influenced by several factors, they were metropolitan areas, representing the overall such as patient expectations, questionnaires used and Turkish population in terms of cultural and socio- patient’s sociodemographic features[8,9]. It is important demographic similarities. A call for participation in to evaluate actual measurement reflecting patient the study was delivered to all family health centers satisfaction, although there are some difficulties. through local directors of the Health Ministry, but Among them, sociodemographic features have great only 45 centers responded. Patients between 18 and 80 value and constitute an important factor influencing years of age, admitted to their family medicine centers, patient satisfaction[10-12]. were enrolled into the study. Willingness to participate In Turkey, there are two comprehensive studies in the study and ability to read and understand the on patient satisfaction in the PHC setting. The first, study survey were the inclusion criteria. The study conducted by Aktürk et al[13] studied patient satisfaction was approved by the ethics committee of our institute levels before the implementation of the family medicine (Ethics number: 2011/148). An informed consent was model. The second, conducted by Baltaci et al[14] after obtained from all participants. the implementation reported that the overall level of patient satisfaction with the family medicine practice Study Survey and Data Collection in Turkey was higher. The Ministry of Health in Turkey A study survey including sociodemographic has tried to establish a standardized quality control features “EUROPEP” instrument was structured. system in health care services since the last decade. It is The questionnaire was tested in a pilot study in clear that it was achieved in hospital care, but scarcely Duzce Province, using a Turkish validated version in the PHC setting. of Europep instrument[14,15]. The self-administered To the best of our knowledge, the present study study surveys were distributed to participants, in the was the first study which investigated the influence of waiting room via handout by researchers rather than sociodemographic features on patient satisfaction in family physicians. They were collected in the boxes PHC setting. Hence, in this study, our objective was placed in family medicine centers. All survey sheets to investigate which of the patient’s sociodemographic were sent to the center conducting the study. The features have a significant effect on patient satisfaction study survey consisted of sociodemographic features in family medicine practice in terms of health care of participants (age groups, gender, marital status, throughout Turkey. education level, smoking status, occupation, income level and existence of chronic diseases) and patient SUBJECTS AND METHODS satisfaction with primary care (patient-physician Study Conduct and Patient Enrollment communication, accessibility of physicians, medical The study was conducted in 45 family medicine care provided by health professionals, health care centers from 15 cities throughout Turkey between organization and providing information and support December 2013 KUWAIT MEDICAL JOURNAL 293 to patients by their family physicians). Age groups were stratified as 18-24, 25-34, 35-60 and over 60 years- Table 1: Sociodemographic features of patients that participated in the study old. Questions related to patients’ sociodemographic features and patient satisfaction level were asked to be Sociodemographic features Number (%) filled. Patient-physician communication domain was (N = 1210) evaluated with six questions: 1) Making you feel you Age (years) 37.4 ± 14.7 (18-80) had time during consultations; 2) Taking an interest in Gender your personal situation; 3) Making it easy for you to Male 582 (48.1) tell him or her about your problems; 4) Involving you Female 628 (51.9) Income level in decisions about your medical care; 5) Listening to Low 496 (41.0) you; 6) Keeping your records and data confidential. High 714 (59.0) Satisfaction with medical care domain was evaluated Marital status with five questions: 1) Quick relief of symptoms; 2) Married 814 (67.3) Unmarried 396 (32.7) Helping you to feel well so that you can perform your Residency normal daily activities; 3) Thoroughness; 4) Physical Urban 687 (56.8) examination; 5) Offering you advice for preventing Rural 523 (43.2) diseases. Satisfaction with domain of information Chronic disease Yes 277 (22.9) and support for medical situation was evaluated with No 933 (77.1) four questions: 1) Explaining the purpose of tests and Education level treatments; 2) Telling you what you wanted to know Middle school 497 (41.1) about your symptoms and / or illness; 3) Helping you High school 350 (28.9) University 363 (30.0) deal with emotional problems related to your health Occupation status; 4) Helping you understand the importance of Employed 297 (24.5) following his or her advice. Satisfaction with health Officer 199 (16.5) organization was measured with two questions: 1) Self-employed 150 (12.4) Unemployed 564 (46.6) Knowing what he or she had done or told you during Age groups (years-old) contacts; 2) Preparing you for what to expect from 18 - 24 257 (21.2) specialist or hospital care. Satisfaction with accessibility 25 - 34 355 (29.3) to the physician was evaluated with six questions: 1) 35 - 60 471 (39.0) 60+ 127 (10.5) The helpfulness of the staff (other than doctor); 2) Getting an appointment to suit you; 3) Getting through to the practice on the phone; 4) Being able to speak to (SPSS version 18.0, Chicago IL). Patient population the general practitioner on the telephone; 5) Waiting was decided as target sample size for the study. time in the waiting room; 6) Providing quick services for urgent health problems. Likert scale (from 1 to 5 RESULTS points, meaning 1 point: poorest, 2: poor, 3: medium, Socio-demographic features of participants 4: good and 5: excellent) was used. Mean score for One thousand two hundred and ten patients (male: domains of patient satisfaction according to incisions 582, 48.1% and female: 628, 51.9 %) participated in the of sociodemographic features was calculated by study. Mean age of all subjects was 37.4 ± 14.7 (range adding points from all related questions. Meanwhile, 18 - 80 years old). Majority of them had a middle mean total score of overall patient satisfaction level school level education (n = 497, 41.1%). Among them, according to incisions of patient’s sociodemographic frequency of current smokers was found to be 27.3 % features was computed. (n = 330) (not shown in the table). 67.3% of subjects were married and 32.7% were unmarried. Frequency Statistics and data analysis of participants who had worked as an officer, a self- Descriptive statistics were calculated as frequencies employed or employee was 53.4%. Remaining 46.6% (count and percent) and mean ± standard error of were not working (e.g., retired persons, students, or mean (SEM) for mean score for overall and domains of housewife). Majority of the participants (n = 714, 59.0 patient satisfaction level. Normality of distribution for %) had an income level above subsistence wage. data was analyzed by Kolmogorov-Smirnov test. The Frequency of chronic diseases (diabetes mellitus, relationships between sociodemographic variables hypertension, cardiovascular disease and chronic and subtotal and total scale scores were analyzed by pulmonary disease) was detected in 22.9% patients (n using covariance analysis. A p-value of < 0.05 was = 212, Table 1). When mean total score of every incision considered statistically significant. All data were of income, morbidity, residency, occupation, gender, analyzed using statistical package for social sciences marital status, education level and age groups were 294 Association between Patients’ Socio-Demographic Characteristics and their Satisfaction ... December 2013

observed that the married patients were more satisfied Table 2: Comparison of mean total score of patient’s satisfaction than the unmarried ones (24.5 ± 0.6 versus 23.0 ± 0.6, p level for incisions of sociodemographic features = 0.006). The patients with university level education Total score of patient had higher satisfaction level, compared to middle and Sociodemographic satisfaction high school (24.6 ± 0.7, 23.3 ± 0.6, 23.4 ± 0.6, respectively; p-value* features (Mean ± SEM**) p = 0.048). The patient’s satisfaction level in subjects (95% CI***) who had high income level was significantly higher Gender 0.028 than those with low income level (24.0 ± 0.6 versus Male 84.5 ± 2.2 (80.3 - 88.8) 23.2 ± 0.6, p = 0.017). Status of occupation significantly Female 88.5 ± 2.4 (83.8 - 93.2) influenced patient satisfaction level, and the officers Income level 0.001 were significantly different from the unemployed, Low 83.0 ± 2.5 (78.2 - 87.6) High 90.1 ± 2.3 (85.7 - 94.4) employed and self-employed subjects (25.3 ± 0.7, 24.5 Marital status 0.043 ± 0.6, 24.7 ± 0.7 and 23.4 ± 0.7, respectively; p = 0.010). Married 88.8 ± 2.2 (84.4 - 93.1) Between patients with and without chronic disease, Unmarried 84.3 ± 2.5 (79.3 - 89.3) Residency 0.197 there was no significant difference for satisfaction Urban 84.3 ± 1.2 (86.3 - 91.4) level (p = 0.334). Rural 84.0 ± 3.8 (76.4 - 91.4) Chronic disease 0.137 Satisfaction with medical care provided by Yes 88.1 ± 2.5 (83.2 - 93.0) physicians No 84.9 ± 2.2 (80.6 - 89.2) Education level 0.224 The influence of patients’ sociodemographic Middle school 86.3 ± 2.3 (81.7 - 90.9) features on patient satisfaction level with medical care High school 84.6 ± 2.5 (79.6 - 89.5) is shown in Table 4. While the status of patients’ gender, University 88.7 ± 2.7 (83.5 - 93.8) Occupation 0.006 income level, marital status, residency and occupation Employed 90.0 ± 2.8 (84.5 - 95.5) significantly influenced patient satisfaction level, the Officer 81.1 ± 2.9 (75.4 - 86.9) Self-employed 85.3 ± 3.0 (79.5 - 94.1) Unemployed 90.1 ± 2.3 (85.1 - 94.1) Table 3: Influence of patient’s socio-demographic features Age groups (years-old) 0.979 on patient-physician communication domain of patient 18 - 24 86.2 ± 2.8 (80.8 - 91.6) satisfaction level 25 - 34 85.9 ± 2.5 (81 - 90.6) 35 - 60 86.7 ± 2.3 (81.8 - 91.6) Patient-physician 60+ 87.2 ± 3.6 (80.3 - 94.2) Sociodemographic communication p-value* features (Mean ± SEM**) *Significant, if p < 0.05, **SEM: Standard Error of Mean, (95% CI***) ***CI: Confidence interval Gender 0.037 compared, it was observed that patient satisfaction Male 23.3 ± 0.5 (22.2 - 24.4) Female 24.3 ± 0.6 (23.1 - 25.4) level was higher in female patients than male, married Income level 0.017 patients than unmarried, patients of higher income level Low 23.2 ± 0.6 (21.9 - 24.4) than low income, and the officers than the employed High 24.4 ± 0.6 (23.0 - 25.5) and unemployed (p = 0.028, p = 0.043, p = 0.001, and Marital status 0.006 Married 24.5 ± 0.6 (23.5 - 25.6) p = 0.006, respectively). Mean total score of every Unmarried 23.0 ± 0.6 (21.8 - 24.3) incision of education level, morbidity, residency and Residency 0.050 age group was not found to be significant (p = 0.224, p Urban 24.7 ± 0.3 (24.1 - 25.3) = 0.137, p = 0.197, and p = 0.979, respectively). Rural 22.8 ± 0.9 (20.9 - 24.7) Chronic disease 0.334 Yes 24.0 ± 0.6 (22.8 - 27.2) Satisfaction with patient-physician communication No 23.5 ± 0.6 (22.4 - 24.6) α The effects of patients’ sociodemographic features Education level 0.048 on patient satisfaction with patient-physicians Middle school 23.4 ± 0.6 (22.2 - 24.5) High school 23.3 ± 0.6 (22.1 - 24.6) communication are shown in Table 3. For satisfaction University 24.6 ± 0.7 (23.4 - 26.0) with patient-physician communication, statistically Occupation 0.010ß significant differences were observed in patients’ Employed 24.7 ± 0.7 (23.3 - 26.0) sociodemographic features such as marital status, Officer 25.3 ± 0.7 (21.1 - 24.0) Self-employed 23.4 ± 0.7 (22.0 - 24.8) education level, income level, and occupation but Unemployed 24.5 ± 0.6 (23.4 - 25.7) not existence of chronic diseases and age groups. Compared to male patients, satisfaction with patient- *Significant, if p < 0.05, **SEM: Standard Error of Mean, ***CI: Confidence interval. α The patients with university education level were more physician communication was significantly higher in satisfied than from high middle education level; ß Officers were less females (23.3 ± 0.5 versus 24.3 ± 0.6, p = 0.037). It was satisfied than the employed and unemployed. December 2013 KUWAIT MEDICAL JOURNAL 295

Table 4: Influence of patient’s sociodemographic features on Table 5: Influence of patient’s sociodemographic features on medical care domain of patient satisfaction level support and information domain of patient satisfaction level

Medical care provided Support and Sociodemographic by physicians Sociodemographic information p-value* p-value* features (Mean ± SEM**) features (Mean ± SEM**) (95% CI***) (95% CI***) Gender 0.020 Gender 0.022 Male 19.0 ± 0.5 (18.0 - 20.0) Male 15.3 ± 0.4 (14.4 - 16.1) Female 20.1 ± 0.5 (19.1 - 21.1) Female 16.1 ± 0.5 (15.1 - 17.0) Income level 0.021 Income level 0.002 Low 19.1 ± 0.6 (17.8 - 19.9) Low 15.0 ± 0.5 (14.1 - 16.0) High 20.0 ± 0.5 (19.1 - 21.0) High 16.3 ± 0.4 (15.4 - 17.1) Marital status 0.036 Marital status 0.083 Married 20.1 ± 0.5 (19.1 - 21.0) Married 16.0 ± 0.4 (15.2 - 16.8) Unmarried 19.0 ± 0.6 (17.8 - 20.0) Unmarried 15.3 ± 0.5 (14.3 - 16.2) Residency 0.050 Residency 0.537 Urban 20.2 ± 0.3 (19.7 - 20.8) Urban 15.8 ± 0.2 (15.4 - 16.3) Rural 18.6 ± 0.9 (18.1 - 20.3) Rural 15.4 ± 0.7 (14.0 - 17.1) Chronic disease 0.259 Chronic disease 0.079 Yes 19.7 ± 0.6 (18.6 - 20.8) Yes 16.0 ± 0.5 (15.1 - 17.0) No 19.1 ± 0.5 (18.2 - 20.1) No 15.3 ± 0.4 (14.5 - 16.1) Education level 0.271 Education level 0.304 Middle school 19.3 ± 0.5 (18.3 - 20.3) Middle school 19.3 ± 0.5 (18.3 - 20.3) High school 19.1 ± 0.6 (18.6 - 20.2) High school 19.1 ± 0.6 (18.6 - 20.2) University 20.1 ± 0.6 (19.1 - 21.1) University 20.1 ± 0.6 (19.1 - 21.1) Occupation 0.034α Occupation 0.000α Employed 20.2 ± 0.6 (19.0 - 21.4) Employed 16.4 ± 0.5 (15.4 - 17.5) Officer 18.4 ± 0.7 (17.1 - 19.7) Officer 14.3 ± 0.7 (13.2 - 15.4) Self-employed 19.2 ± 0.7 (17.9 - 20.5) Self-employed 15.6 ± 0.6 (14.4 - 16.7) Unemployed 20.0 ± 0.5 (19.1 - 21.0) Unemployed 16.3 ± 0.4 (15.4 - 17.1)

*Significant, if p < 0.05, **SEM: Standard Error of Mean, *Significant, if p < 0.05, **SEM: Standard Error of Mean, ***CI: Confidence interval, α Officers were less satisfied than ***CI: Confidence interval, α Officers were less satisfied than the employed and unemployed patients the employed and self-employed patients. level of education and existence of chronic diseases did patients, only income level, gender and status of not. Compared to male patients, female patients were occupation had a significanteffectonpatientsatisfaction more satisfied with medical care (20.1 ± 0.5 versus level with items of information and support about 19.0 ± 0.5, p = 0.020). The patients with low income their medical situation provided by physicians. Higher level were dissatisfied, while those with high income satisfaction level was observed in female patients than level were more satisfied with medical care provided male (16.1 ± 0.0 versus 15.3 ± 0.4, p = 0.022). The patients by their physicians (19.1 ± 0.6 versus 20.0 ± 0.5, p = with high income level were more satisfied, compared 0.021). The married patients were more satisfied with to those with low income level (24.4 ± 0.6 versus 23.2 medical care, compared to the unmarried ones (20.1 ± 0.6, p = 0.002). The officers among patients were ± 0.5 versus 19.0 ± 0.6, p = 0.036). The patients living dissatisfied with information and support provided in a rural area seemed to be more dissatisfied than in by their physicians about their medical situation than those from an urban area, but not significantly (18.6 all of the employed, unemployed and self-employed ± 0.9 versus 20.2 ± 0.3, p = 0.050). The lowest patient patients (14.3 ± 0.7, 16.4 ± 0.5, 16.3 ± 0.4, and 15.6 ± 0.6, satisfaction level among different occupation (the respectively; p = 0.000) (Table 5). employed, self-employed, unemployed patients and officers) was observed in the officers (20.2 ± 0.6, 19.2 Satisfaction with health care organization ± 0.7, 20.0 ± 0.5, and 18.4 ± 0.7, p = 0.034). Residency, Influence of sociodemographic features on patient education level and existence of morbid disease did satisfaction with health care organization is shown not significantly influence patient satisfaction level in Table 6. Here, mean patient satisfaction level was with medical care (p = 0.050, p = 0.271, p= 0.764, and observed as significantly different between low and p= 0.259, respectively). high income level. The patients with high income level were more satisfied with health care organization Satisfaction with support and information by (8.2 ± 0.3 versus 7.5 ± 0.3, p = 0.004). Education level physicians about their medical situation and occupation status of patients had no significant Among sociodemographic characteristics of influence on patient satisfaction level. 296 Association between Patients’ Sociodemographic Characteristics and their Satisfaction ... December 2013

Table 6: Influence of patient’s sociodemographic features on Table 7: Influence of patient’s sociodemographic features on health organization domain of patient satisfaction level accessibility domain of patient satisfaction level

Health organization Accessibility to Sociodemographic (Mean ± SEM**) p-value* Sociodemographic physicians features p-value* (95% CI***) features (Mean ± SEM**) (95% CI***) Gender 0.167 Male 7.7 ± 0.2 (7.2 - 8.2) Gender 0.117 Female 8.1 ± 0.3 (7.5 - 8.5) Male 19.3 ± 0.8 (17.8 - 20.9) Income level 0.004 Female 20.3 ± 0.9 (18.6 - 22.1) Low 7.5 ± 0.3 (7.1 - 8.1) Income level 0.000 High 8.2 ± 0.3 (7.6 - 8.7) Low 18.4 ± 0.9 (16.7 - 20.2) Marital status 0.291 High 21.2 ± 0.8 (19.6 - 22.8) Married 7.9 ± 0.3 (7.5 - 8.4) Marital status 0.243 Unmarried 7.7 ± 0.3 (7.2 - 8.3) Married 20.3 ± 0.8 (18.7 - 21.9) Residency 0.752 Unmarried 19.4 ± 0.9 (17.5 - 21.2) Urban 7.8 ± 0.1 (7.5 - 8.0) Residency 0.412 Rural 8.0 ± 0.4 (7.1 - 8.8) Urban 20.4 ± 0.4 (19.5 - 21.3) Chronic disease 0.084 Rural 19.3 ± 1.4 (16.5 - 22.0) Yes 8.1 ± 0.3 (7.5 - 8.6) Chronic disease 0.201 No 7.7 ± 0.3 (7.2 - 8.1) Yes 20.3 ± 0.9 (18.5 - 22.1) Education level 0.093 No 19.3 ± 0.8 (17.8 - 20.9) Middle school 8.1 ± 0.3 (7.6 - 8.6) Education level 0.416 High school 7.6 ± 0.3 (7.1 - 8.1) Middle school 20.2 ± 1.0 (18.2 - 22.1) University 8.0 ± 0.3 (7.4 - 8.5) High school 19.2 ± 0.9 (17.4 - 21.0) Occupation 0.125 University 20.1 ± 0.9 (18.2 - 22.0) Employed 8.1 ± 0.3 (7.5 - 8.7) Occupation 0.080 Officer 7.4 ± 0.3 (7.1 - 8.1) Employed 20.7 ± 1.0 (18.7 - 22.6) Self-employed 7.7 ± 0.3 (7.1 - 8.4) Officer 18.4 ± 1.1 (16.3 - 20.5) Unemployed 8.1 ± 0.3 (7.6 - 8.6) Self-employed 19.5 ± 1.1 (17.4 - 21.6) Unemployed 20.7 ± 0.9 (19.1 - 22.4) *Significant, if p < 0.05, **SEM: Standard Error of Mean, ***CI: Confidence interval *Significant, if p < 0.05, **SEM: Standard Error of Mean, ***CI: Confidence interval Satisfaction with accessibility to physician’s practice occupational status among sociodemographic features Compared to patients with low income level, had a significant influence on satisfaction level with those with high income level were more satisfied with almost all domains of health care. It was detected that accessibility domain of patient satisfaction (21.2 ± income level had the most significant influence on all 0.8 versus 18.4 ± 0.9, p = 0.000). However, there were domains of patient satisfaction level. In the study, total no significant differences for satisfaction level with score for patient satisfaction level was found to be accessibility domain among other sociodemographic significantly different in gender, residency, occupation, features of patients, including gender, marital income level and marital status. These factors had a status, education level, occupation and existence of significant influence on patient satisfaction. chronic diseases. On the other hand, the officers had We expected that sociodemographic features of significantly lower satisfaction level, compared to our patients have an effect on patient satisfaction level the unemployed and employed patients (18.4 ± 1.1 in primary care settings. In recent decades, Turkey versus 20.7 ± 0.9 and 20.7 ± 1.0, p = 0.041 and p = 0.015, has tried to establish new goods and gain European respectively) (Table 7). standards in health systems, especially in primary care settings. Therefore, the present study is the first study DISCUSSION conducted in Turkey that investigated the influence of The present study investigated the influence of sociodemographic features on patient satisfaction after patient’s sociodemographic features on satisfaction family medicine program was implemented[16]. level with primary care for the overall level and its five There are some theories describing patient domains (communication, medical care, information satisfaction: fulfillment theory, discrepancy theory, and support about the medical condition, health equity theory and social comparison theory, all organization and accessibility to family physician’s defining satisfaction as measurement between what is practice). The study demonstrated that patient’s socio- given to the patient and what patient received[17]. There demographic features had a considerable influence are many methods to measure quality in health care on patient satisfaction level with health care and its systems. Patient satisfaction is important and a good providers. Particularly, income level, marital and indicator for measuring quality in health care. Many December 2013 KUWAIT MEDICAL JOURNAL 297 validated instruments were used to measure patient In our study, income level was a major feature satisfaction level. The EUROPEP instrument was affecting the patient satisfaction level with primary widely used in many European countries, including care. Mean score for overall and all separate domains Turkey [18, 19]. of patient satisfaction measurement were observed in Female and male patients also have different the patients with high income level than those with low communication styles, with women tending to present income. Similarly, Fong et al[26] reported that patients more personal history and symptom information with high income level were more satisfied than those during a visit than their male counterparts. Female with low income. It was consistent with our results. In patients also value more time and explanations from contrast, Yan et al[27] reported that patients with high their physicians than male patients and in some settings; income level were more dissatisfied. receive more total time and communication from their In our study, living in rural area or urban area was physicians. Woods et al[20] studied the effect of gender found not having any significant influence on overall on patient satisfaction in hospital care and reported and the five domains of patient satisfaction level. In that women expressed significantly less satisfaction contrast, patients living in rural areas were found to be compared to men for some items related health care more satisfied than in urban area in China[27]. Geitona et provided by physicians, nurses and all health staff al[28] studied on medication use and patient satisfaction, members. Campbell et al[21] found that gender had no and reported that living in rural area was related with effect on overall patient satisfaction level in primary higher satisfaction. We found that officer patients were care. In our study, we found that female patients were less satisfied with primary care. Bu-Alayyan et al[23] more satisfied overall, and with three domains of the reported that working patients were more satisfied, but health care, compared to their male counterparts. The they did not classify occupation status into subclasses result might be due to cultural and national diversity. such as employed, self-employed and officer. Schmittdiel et al[22] reported that female patients place Many studies have found that younger patients a higher value than male patients on physicians’ were less satisfied than older almost regardless of other communication skills and personal manner. Female sociodemographic features; for example, in Norway[29] patients also appeared to value technical skills more and Sweden[30]. In the present study, we found no highly than male patients. We also found that female significant relationship between patient satisfaction patients were more satisfied with patient-physician level and age groups. We also found that patient communication domain of patient satisfaction. satisfaction level was not significantly related with In some studies, it was shown that education level increased age, based on covariant analysis (not shown of the patient could influence communication skills and in text). Jaipaul et al[31] reported that patient satisfaction styles. Patients with higher education level can easily level was positively correlated with increased age, but communicate with physicians. Bu-Alayyan et al[23] over 80 years old. reported that patients with high education level were The existence of a chronic disease increases more satisfied with primary care. In our study, patient frequency of patient’s visit to primary care settings. who graduated from the university had higher patient Among patients seeking primary care, those with a satisfaction level with the domain of patient-physician chronic disease use health care facilities more than communication, compared to those with a lower others. Therefore, it is very important to measure and education level. We also found that education level did compare their patient satisfaction level in comorbid not influence overall score of patient satisfaction level. situations. Jatrana et al[32] found that having no morbid On the other hand, Al-Sakkak et al[24] reported that the condition had a lower mean continuity care in primary patient with low education level was more satisfied. care (2.99, 95% CI: 2.97 - 3.01) than those reporting We found that there is no influence of marital two or more comorbid conditions (3.35, 95% CI: 3.32 status on total score of overall patient satisfaction - 3.38). In our study, there was no influence of a chronic level. However, married patients were more satisfied disease on five domains of patient satisfaction level. with patient-physician communication (p = 0.006) and Heje et al[33] reported that patients with chronic disease medical care (p = 0.036) domains of patient satisfaction, were more satisfied than patients without a chronic compared to unmarried patients. In contrast, Tucker condition. In this study, we did not report the number et al[25] reported that being married was negatively and type of morbid conditions. correlated with patient satisfaction level (single and One of the strengths of this study was its sample married, correlation coefficient = - 0.01). In this study, characteristics. The participants were randomly we classified marital status of our patients into two selected. Another strength of the study resulted from categories: married and unmarried. We assigned its methods. The study survey was selfadministered single and divorced patients into unmarried category, and applied by researchers rather than family because the number of divorced people in Turkish physicians. Thus, possible bias was avoided. There population is quite low. were some limitations for the study. Measurement of 298 Association between Patients’ Sociodemographic Characteristics and their Satisfaction ... December 2013 patient’s satisfaction level in illiterate patients was 9. Hall JA, Dornan MC. Patient sociodemographic not taken into consideration as they were excluded characteristics as predictors of satisfaction with from the study. Secondly, the patients in the waiting medical care: a meta-analysis. Erratum in Soc Sci Med room of family health center were enrolled. Out of 1990; 30:811-818. 10. Murphy-Cullen CL, Larsen LC. Interaction between these, the patients who had to wait for a long time the socio-demographic variables of physicians and might have given a low score. their patients: its impact upon patient satisfaction. Soc Sci Med 1984; 19:163-166. CONCLUSION 11. Van Ryn M, Burke J. The effect of patient race and Patient satisfaction level was significantly socio-economic status on physicians’ perceptions of influenced by their sociodemographic features, patients. Soc Sci Med 2000; 50:813-828. particularly income level, marital and occupational 12. Mold JW, Lawler F, Schauf KJ, Aspy CB. Does patient status and gender. Therefore, it is essential to assessment of the quality of the primary care they take into consideration potential factors that can receive predict subsequent outcomes? An Oklahoma Physicians Resource / Research Network (OKPRN) influence patient satisfaction level. The study results study. J Am Board Fam Med 2011; 24:511-523. can influence health ministry bureaucrats in Turkey 13. Dağdeviren N, Akturk Z. An evaluation of patient to develop new strategies and prioritized programs satisfaction in Turkey with the EUROPEP instrument. for improving health care systems, and aid health Yonsei Med J 2004; 45:23-28. Erratum in: Yonsei Med J providers to objectively measure patient satisfaction 2005; 46: following 447. and evaluate feedback. 14. Baltaci D, Kara IH, Bahcebasi T, Sayin S, Yilmaz A, Celer A. Determination of patients satisfaction from ACKNOWLEDGMENT family physicians and theirs offices in primary care We thank the family physicians for their response settings in Düzce; a pilot study. Konuralp Medical Journal 2011; 3:9-15. to our call for participation in this study. We 15. Akturk Z, Dagdeviren N, Sahin EM, et al. Patient appreciate the local directorates of the Ministry of evaluate physicians: The EUROPEP instrument. Health in Turkey for their cooperation. We also thank Journal of Eylul Medical Faculty 2002; 3:153-160. the researchers for all their contributions to our study. 16. Kisa A, Kavuncubasi S, Ersoy K. Is the Turkish health Moreover, we thank Dr. Serkan Ozturk, Mehmet care system ready to be a part of the European Union? Halis Tanriverdi, Aylin Yilmaz, Sultan Sayin and J Med Syst 2002; 26:89-95. Ismail Hamdi Kara for their valuable contributions. 17. Linder-Pelz S. Toward a theory of patient satisfaction. Soc Sci Med 1982; 16:577-582. Conflict of interest: There is no conflict of interest 18. Grol R, Wensing M, Mainz J, Jung HP, Ferreira P, Hearnshaw H, Hjortdahl P, Olesen F, Reis S, Ribacke between authors, and the study was not financially M, Szecsenyi J. European Task Force on Patient supported by any foundation or company. Evaluations of General Practice Care (EUROPEP) Patients in Europe evaluate general practice care: an REFERENCES international comparison. Br J Gen Pract. 2000; 50:882– 887. 1. Unluoglu I, Mazicioglu M. The establishment of 19. Wensing M, Vedsted P, Kersnik J, et al. Patient primary health care and transition period in Turkey. Srp satisfaction with availability of general practice: an Arh Celok Lek 2006; 134:359-362. international comparison. Int J Qual Health Care 2002; 2. Güneş ED, Yaman H. Transition to family practice in 14:111-118. Turkey. J Contin Educ Health Prof 2008; 28:106-112. 20. Woods SE, Heidari Z. The influence of gender on 3. Wall EM. Continuity of care and family medicine: patient satisfaction. J Gend Specif Med 2003; 6:30-35. definition, determinants, and relationship to outcome. 21. Campbell JL, Ramsay J, Green J. Age, gender, J Fam Pract 1981; 13:655-664. socioeconomic, and ethnic differences in patients’ 4. Kersnik J. An evaluation of patient satisfaction with assessments of primary health care. Qual Health Care family practice care in Slovenia. Int J Qual Health Care 2001; 10:90-95. 2000; 12:143-147. 22. Schmittdiel J, Grumbach K, Selby JV, Quesenberry CP 5. Zebiene E, Kairys J, Zokas I. Influence of patient’s Jr. Effect of physician and patient gender concordance social and demographic characteristics on patient’s on patient satisfaction and preventive care practices. J expectations for medical consultation. Medicina Gen Intern Med 2000; 15:761-769. (Kaunas) 2004; 40:467-474. 23. Bu-Alayyan S, Mostafa A, El-Etaibi B, Sorkhou E, Al- 6. Prakash B. Patient satisfaction. J Cutan Aesthet Surg Taher H, Al-Weqayyan A. Patient satisfaction level 2010; 3:151-155. with primary health care services in Kuwait. KMJ 7. Tucker JL. The moderators of patient satisfaction. J 2008; 40:25-30. Manag Med 2002; 16:48-66. 24. Al-Sakkak MA, Al-Nowaiser NA, Al-Khashan HI, Al- 8. Weiss GL. Patient satisfaction with primary medical care. Abdrabulnabi AA, Jaber RM Patient satisfaction with Evaluation of sociodemographic and predispositional primary health care services in Riyadh. Saudi Med J factors. Med Care 1988; 26:383-392. 2008; 29:432-436. December 2013 KUWAIT MEDICAL JOURNAL 299

25. Tucker JL 3rd, Kelley VA. The influence of patient 30. Brekke M, Hjortdahl P, Kvien TK. Involvement sociodemographic characteristics on patient’s and satisfaction: a Norwegian study of health care satisfaction. Mil Med 2000; 165:72-76. among 1,024 patients with rheumatoid arthritis 26. Fong RL, Bertakis KD, Franks P. Association between and 1,509 patients with chronic non-inflammatory obesity and patient satisfaction. Obesity (Silver Spring) musculoskeletal pain. Arthritis Rheum 2001; 45:8-15. 2006; 14:1402–1411. 31. Jaipaul CK, Rosenthal GE. Are older patients more 27. Yan Z, Wan D, Li L. Patient satisfaction in two Chinese satisfied with hospital care than younger patients? J provinces: rural and urban differences. Int J Qual Health Gen Intern Med 2003; 18:23-30. Care 2011; 23:384-389. 32. Jatrana S, Crampton P, Richardson K. Continuity of care 28. Geitona M, Kyriopoulos J, Zavras D, Theodoratou with general practitioners in New Zealand: results from T, Alexopoulos EC. Medication use and patient SoFIE-Primary Care. N Z Med J 2011; 124:16-25. satisfaction: a population-based survey. Fam Pract 2008; 33. Heje HN, Vedsted P, Sokolowski I, Olesen F. Patient 25:362-369. characteristics associated with differences in patients’ 29. Rahmqvist M. Patient satisfaction in relation to age, evaluation of their general practitioner. BMC Health health status and other background factors: a model for Serv Res 2008; 8:178. comparisons of care units. Int J Qual Health Care 2001; 13:385-390. 300 KUWAIT MEDICAL JOURNAL December 2013

Original Article Antenatal Ultrasound Diagnosis of Fetal Anomalies at a University Hospital

Naglaa Mostafa Elsayed1,2, Sondos Abuzenadah1 1Department of Diagnostic Radiology, Faculty of Applied Medical Sciences, King Abdulaziz University Hospital, Jeddah, KSA 2Department of Radiodiagnosis, Faculty of medicine, Cairo university , Egypt

Kuwait Medical Journal 2013; 45 (4): 300 -306

ABSTRACT

Background: Antenatal ultrasound is an essential tool for statistically analyzed using SPSS 10.0 program. Statistical detection of fetal anomalies. Early detection of congenital significance was accepted if p-value < 0.05. anomalies can reduce the expected morbidity and mortality. Main Outcome Measures: The incidence of congenital Objectives: To highlight the role of antenatal ultrasound anomalies in detection and characterization of fetal anomalies, and to Results: Cardiac and umbilical cord anomalies have study the incidence and distribution of congenital anomalies statistically significant relation with maternal age (p-value at King Abdulaziz University Hospital (KAUH), Jeddah, < 0.05). The most frequent abnormalities detected are Kingdom of Saudi Arabia (KSA) of the brain (40.6%), the urinary system (39.4%) and the Design: Cross-sectional observation study cardiovascular system (37.5%). Setting: Department of Diagnostic Radiology and Fetal Conclusions: The high prenatal detection rates for common Medicine Unit at KAUH, Jeddah, KSA during the period congenital anomalies of the CNS, cardiovascular and 2008 - 2011 urinary systems are similar to those found in previous Intervention: Antenatal ultrasound reports. Unexpectedly, abdominal anomalies were the fourth Subjects: Five thousand and thirty pregnant females were largest anomalies detected. By using more sophisticated, subjected to antenatal ultrasound (US) at KAUH diagnostic highly sensitive machines in addition to greater expertise, radiology department and fetal medicine unit from January well-trained radiologists and sonographers specialized 2008 to September 2011. The age of participating females in obstetrics, more specific and early detection of different ranged from 16 to 49 years. Data were collected and anomalies can be possible in the future.

KEY WORDS: congenital anomalies, fetal, ultrasound

INTRODUCTION structural abnormalities such as the gestational period Routine ultrasound (US) fetal screening for in which the examination should be performed and congenital abnormalities has become an established severity and type of malformation[1]. practice for many years. US examination gives a A congenital anomaly is an abnormality of structure, great amount of information about the anatomical function or body metabolism that is present at birth structure and to some extent the physiological state and results in physical or mental disability, or is fatal. of fetus especially in the second trimester. US have Each year, eight million children are born worldwide a role in analyzing in detail the fetal anatomy to with congenital anomalies, out of which 3.3 million die detect or exclude structural abnormalities. There is before the age of five; 3.2 million of the survivors may no doubt that US examination is able to increase the be mentally and / or physically disabled[2]. Depending identification of malformations. US performance on their severity and the need for medical or surgical is based on technical and organizational variables intervention, fetal malformations are subdivided into including the number of exams performed, operator major and minor malformations following guidelines experience, type of equipment used, and the health set out by the European Registers of Congenital policy, and also on variables that are related to the Anomalies and Twins (EUROCAT)[3]. The morbidity

Address correspondence to: Naglaa Mostafa Elsayed, MD, Faculty of Applied Medical Sciences, King Abdulaziz University, Jeddah, KSA. Diagnostic Radiology department, Kasr Al-Aini University Hospital, Cairo University, Egypt. Tel: 00966564290544 (Mob), E-mail: [email protected], [email protected] December 2013 KUWAIT MEDICAL JOURNAL 301 and mortality of fetal anomalies increases with US at KAUH Department of Diagnostic Radiology and advancing gestation. Therefore, early detection of Fetal Medicine Unit from January 2008 to September such abnormalities will result in the reduction of such 2011. The inclusion criterion was to recruit all females complications. coming in the second trimester for US examination. The diagnostic ability of US is well established We excluded cases that came during the first trimester, by a number of studies[4,5]. US scan provides the next cases of abortion, and cases of stillbirth. The number best alternative to primary prevention of congenital of participating pregnant females was 5030. US were anomalies[2]. Early pregnancy US scanning at 11-14 performed on all patients at the diagnostic radiology weeks can detect certain fetal abnormalities. Detection department by a specialized radiologist and assistant rates are better after 13 weeks of gestation and is sonographer after obtaining verbal consent. Only 160 further improved with the use of transvaginal probe. females showed fetal anomalies, and were referred to Some women who are at risk of delivering a baby with the Fetal Medicine Unit for detailed anomaly scan. The congenital anomalies are offered a detailed scan at age of the participating females ranged from 16 to 49 around 24 to 28 weeks[2]. years with a mean age is 32.5 years. US imaging was The prevalence of birth defects depends upon the performed mainly by transabdominal high frequency population being scanned. However, it is comparable curvilinear probe (2 - 7 MHz) 2D, curvilinear (1 - 5 all over the world; about 3% in the United States[6], MHz) 2D – 3D – 4D). Transvaginal US was needed for 2.5% in India[7] and 2 - 3% in the United Kingdom[8]. some cases using high frequency endovaginal probe (5 In industrialized countries, structural abnormalities - 7.5 MHz) 2D – 3D – 4D. A Voluson 730 expert general represent the first cause of prenatal death (20 - 25%) and electric (GE) US machine was used for all cases. The are the most common cause of infant morbidity after types of birth defect and age of mother along with the prematurity[1,9]. EUROCAR (European surveillance detailed anatomical survey at the time of scan were of congenital anomalies) recorded a total prevalence entered in a database file and statistically analyzed of major congenital anomalies of 23.9 per 1000 births using Statistical Package for Social Sciences Version 10.0 for 2003 - 2007[10]. With more recent equipment and (SPSS Inc, Chicago, IL, USA) for data entry. Analyses application of 3D & 4D techniques, conditions such as included percentages. No incidence or prevalence was cleft lip / palate and congenital cardiac abnormalities included. The chi-square test was used to compare are more readily diagnosed and at an earlier gestational differences between groups. Statistical significance age[11]. Antenatal Doppler application has been proven was accepted at a p-value < 0.05. to be a valuable adjunct to fetal assessment because often Doppler flow abnormalities will precede RESULTS detectable fetal abnormalities of growth, amniotic fluid, The incidence of congenital anomalies in our study and placental insufficiency and can help assess the population was 3.18% where out of the 5030 pregnant severity of fetal compromise when these abnormalities females subjected to antenatal US, 160 showed are suspected. 3D US technology has helped in congenital anomalies of their fetuses. Ten percent redefining traditional methods of CT and MRI images. of patients had previous offspring with similar or The next and the most advanced technique is the 4D different congenital malformation. All females were US that adds the element of time to the 3D process[11]. classified according to their age into five groups: (< Although many anomalies can be detected on routine 20years) five patients, (20 - 35years) 109 patients, (35 prenatal US, there are some fetal anomalies that may - 40years) 27 patients, (40 -45 years) 14 patients, and not be apparent until 20 to 24 weeks of gestation and (45 - 49years) five patients. The largest percentage of are difficult to detect (e.g., some craniofacial anomalies females was in the fertility age group of 20 - 35 years, like microcephalus and some limb anomalies like which represented 68% of all cases. The prevalence of syndactyly)[12]. congenital anomalies detected in relation to different The aim of this work was to highlight the role of age groups is shown in Table 1. The distribution of antenatal US in detection of fetal anomalies with the total abnormalities detected among the study characterization of these anomalies, and to study the population is shown in Fig. 1. They were classified incidence and distribution of congenital anomalies according to the body system affected. It is to be detected by prenatal US at the King Abdulaziz mentioned that many cases had multiple anomalies University Hospital (KAUH), Jeddah, Kingdom of of different organs. The most frequent abnormality Saudi Arabia (KSA). detected were brain anomalies (40.6%). Fig. 2 shows the distribution of different brain anomalies wherein, SUBJECTS AND METHODS hydrocephalus is the most common abnormality In this cross-sectional observation study, we studied (68.4%). The least common brain abnormalities were the data of all pregnant females subjected to antenatal encephalocele and Dandy-Walker malformation (2.5% 302 Antenatal Ultrasound Diagnosis of Fetal Anomalies at a University Hospital December 2013

Fig.1: Distribution of congenital anomalies among the study group of each). Anomalies of the urinary system were the Abdominal anomalies represented 35% of all cases. second most frequently detected finding (39.4%). It This included; non-specific ascites (43%), omphalocele included hydronephrosis (58%), multicystic dysplastic (23%), intestinal obstruction (21%) and diaphragmatic kidney (25.4%), and infantile polycystic kidneys hernia which represented only 13% of cases. Chest (16.6%). The third most frequently detected anomaly anomalies represent 14.4% of our cases. It included was found in the cardiovascular system (37.5%). hypoplastic lung (66.4%), pleural effusion (26.6%)

Table 1: The spectrum of abnormalities in relation to the maternal age

Maternal age (in years)

Spectrum of abnormalities < 20 20 – 35 35 – 40 40 – 45 45 – 49 *N = 5 *N = 109 *N = 27 *N = 14 *N = 5 n % n % n % n % n %

Brain anomalies 2 40 40 36.4 14 51.9 7 50 2 50 Spinal anomalies 1 20 13 11.8 3 11.1 3 21.4 1 25 **Cardiovascular anomalies 2 40 42 38.2 6 22.2 6 42.9 4 100 Chest anomalies 0 0 16 14.5 3 11.1 2 14.3 2 50 Abdominal (GIT & LIVER) anomalies 3 60 39 35.5 9 33.3 3 21.4 2 50 Urinary system anomalies 2 40 46 41.8 9 33.3 6 42.9 0 0 Musculoskeletal anomalies 1 20 15 13.6 1 3.7 3 21.4 0 0 Soft tissue anomalies 0 0 5 4.5 1 3.7 0 0 0 0 Facial anomalies 1 20 11 10 1 3.7 2 14.3 0 0 Fetal growth retardation 1 20 14 12.7 5 18.5 3 21.4 1 25 Amniotic fluid abnormality 3 60 52 47.3 13 48.1 7 50 2 50 ***Umbilical cord abnormality 0 0 2 1.8 1 3.7 2 14.3 1 25 Generalized oedema 1 20 8 7.3 3 11.1 0 0 0 0

*N is the number of patients in each age group **cardiac anomalies have statistically significant relation with maternal age (p-value < 0.05). The ratio of anomalies increases in young ages (40% in 20 years or less) and in old ages (100% in 45 - 49 years). ***The percentage of associated umbilical cord abnormality (2 vessel cord) increases by increasing the maternal age. By using chi-square test we found significant relation between them (p-value < 0.05) which means that increased age of the mother is associated with the umbilical cord abnormality. December 2013 KUWAIT MEDICAL JOURNAL 303

anomalies are the leading cause for neonatal morbidity and mortality as mentioned by Copel et al who stated that “prenatal recognition of birth defects is generally regarded as being advantageous and desirable. For several disorders, including some cases of cardiac defects, prenatal detection has been shown to improve management and overall outcomes of the affected newborns”[14]. Differences in reported birth prevalence rates of congenital malformations over time and among countries, or even within the same country among regions, may be attributed to one or more factors such as design of the study (hospitalbased or populationbased, prospective or retrospective), definitions, classifications and inclusion criteria used, type of surveillance system, etiological differences of malformations, accuracy of diagnosis and gestational age at which the ultrasound was performed[15]. These make comparison of rates among studies difficult and Fig. 2: Distribution of brain anomalies among the study group probably not very informative. The actual prevalence of these anomalies is difficult to determine since and cystic lung malformation (7%). Spinal anomalies various classifications exist which are based on the represented 13.1% of cases, where meningomyelocele timing of diagnosis (natal or perinatal), the type of was the commonest. Anomalies of the musculoskeletal abnormality (major or minor), and on the kind of system represented 12.5% of the total anomalies. It registration that is used by the various centers. In included; skeletal hypoplasia (50%), Rocker bottom literature, the prevalence of structural abnormalities foot (18%), clenched hand (16%), club foot (10%), and in the perinatal period varies from 2 to 5%[16]. The osteogenesis imperfect (6%). Three D and 4D US is of incidence of congenital anomalies vary from low - as great help to detect these anomalies. Only 9.4% had reported by El-Shafei et al, (1·86%)[17], Naderi (1·66%)[18] facial anomalies in the form of cleft lip and palate and Harrison, from Nigeria (1·4% )[19] to high as found (53.2%), micrognathia (38%) and deficiency in the in Copenhagen (Villumsen AL, 1970 – 3.8%) and orbital region (8.8%). The least frequently detected Canada (Baird P et al, 1991 – 4.7%), respectively[20,21]. anomaly was of the soft tissue where 3.75% of fetuses As compared to some neighboring Arab countries, had cystic hygroma within the neck. Other different there is still a difference in the prevalence of congenital abnormalities detected in our study are fetal growth anomalies. Fetal anomalies represents 24.6 / 1000 retardation (15%) and generalized edema (7.5%). The births in Oman[22], 10.5 / 1000 births in Al-Ain, United placental position localization is an essential part of Arab Emirate (UAE)[23] and 16.6 / 1000 births in Abu- the examination. Half the cases had anterior placenta, Dhabi[24]. Even within Saudi Arabia, some regional 40% had posterior placenta, 7.5% had fundal placenta variations are present. The incidence of anomalies while placenta previa was found in only 2.5% of cases. detected in Al-Khobar, Eastern Saudi Arabia was 17 / Single umbilical artery was diagnosed by finding 1000[25], in Al-Qassim was 0.89 / 1000 births[26], in Al- only two vessels on a cross section of the cord, or a Hafuf was 17.4 / 1000 births[27] and in Jeddah was 16 / vessel seen on only one side of the fetal bladder. It 1000 births[28]. represented 4.4% of our cases in association with other In the current study, we included only antenatal anomalies. Most cases showed normal amniotic fluid cases. No postnatally detected anomaly cases, abortion volume (52%) while in 25% cases polyhydramnios was cases or chromosomal based anomalies were included. diagnosed. 16.5% of cases had anhydramnios, and This had an effect on our results. In a study done in only 6.5% had oligohydramnios. Spain in 1999 over 22 years, a total of 1006 malformed fetuses or neonates were identified at abortion or DISCUSSION delivery. The prevalence of fetal abnormalities was Second trimester US has proved to be an essential 3.03%. Fetal anomalies were diagnosed antenatally in tool for detection of various fetal anomalies. In our 788 (78.33%) cases which means that a considerable study, the percentage of detected anomalies was 3.18%. number of cases could not be diagnosed in the Although 50 - 60% of all structural abnormalities can antenatal scan[29]. We preferred to collect cases coming be detected as early as 11 - 14 weeks of gestation, in the second trimester for anomaly scan owing to the optimum timing for a full fetal structure survey their large number compared to those coming in the [13] appears to be around 20 weeks . Congenital first trimester. This had an effect on the incidence of 304 Antenatal Ultrasound Diagnosis of Fetal Anomalies at a University Hospital December 2013 anomalies detected. In a study by Carrera et al, in was the most prominent 68.4%, while Dandy-Walker 2003, 59.44% of the total cases were diagnosed before anomaly was the lowest (2.5%).This matches with the 22 weeks of gestation meaning that second trimester result of Alia et al, where hydrocephalus was the most detected cases could not be representative of the commonly encountered brain anomaly (36.1%)[2]. Also actual percentage of fetal anomalies[29]. It is important in a study by Al-Jama, CNS anomalies were the most to take the percentages of recent studies only into common conditions encountered (48·8%). Out of those consideration, because the rapid advancement of US CNS defects, hydrocephalus was the most common (54 techniques by time with implementation of 3D, 4D babies), followed by anencephaly (33) and meningocele techniques and advancement of the transducer strength (26)[25]. The most common renal anomaly detected was and resolution of images has had a great effect on the hydronephrosis (58% of all renal anomalies). This diagnostic accuracy and hence reported percentages. result is more or less similar to the result of Crane et al, In the study by Carrera et al, in 2003 the detection of where detection rate for hydronephrosis cases was the malformed fetuses increased from 19.75% in the first commonest (38.5%)[34] but is different from the study of phase of the study (1970 - 1974) to 96.33% in the last Alia et al, where polycystic kidney was the commonest phase (1990 -1991)[29]. anomaly (37.5%)[2]. In our study, polycystic kidneys Ultrasound detection of congenital anomalies when represent only 16.6% of all anomalies. correlated to the maternal age may add to the knowledge Cardiac anomalies represent 37.5% in our series. of physicians and parents to avoid getting pregnancy Cardiomegaly represents 33.2% of cases while in in the extremes of ages. It has come to the attention of only 16%, atrial or ventricular septal defects could researchers that the extremes of maternal age, meaning be definitely diagnosed. Unfortunately, chromosomal women over the age of 40 years and women who study results are not routinely done to confirm the are 20 years or less, may be related to chromosomal known relationship of some cardiac anomalies to and nonchromosomal structural abnormalities in the genetic disorders (e.g., atrial septal defect to Down’s fetus[30]. For mothers aged 35 – 39 years, the prevalence syndrome). The overall prenatal detection rate for of birth defects ranges from 32 - 44 per 1000 births. congenital heart diseases was 25% in the studies of In mothers 40 years and older, 24 - 50 per 1000 births Copel et al,[14] and of Bonnet et al,[35]. In another study are affected by nonchromosomal abnormalities. Some by Balakumar, cardiomegaly was the commonest specific abnormalities found to be associated with anomaly detected (21%)[36]. advanced maternal age include congenital heart Unexpectedly, many abdominal anomalies were defects, hypospadias, craniosynostosis, club foot, highly diagnosed in our study (35%) while in previous and diaphragmatic hernia. Women aged 35 – 39 years reports these anomalies were not ranked among the will deliver one to four additional cases of congenital commonest fetal anomalies. In a study of Csabay heart defects per 1000 births. In mothers aged 40 years et al, CNS abnormalities rank almost equally with and above, that number jumps to 30. There is also a cardiovascular abnormalities, musculoskeletal, and significant association with increased odds of birth renal abnormalities as among the most important group defects and maternal age less than 20 years. In mothers of fetal structural defects encountered[37]. In another younger than 15 years of age, the prevalence of these study by Dastigiri et al, the most frequent abnormalities abnormalities is from 37 to 46.9 per 1000 births[30]. In detected by US were of the kidney (19 / 20) followed by our study, cardiovascular system anomalies shows CNS (30 / 36)[5]. In our series, omphalocele represents a statistically significant correlation to the maternal 23% of cases, while the more serious diaphragmatic age where the p-value was < 0.05.These anomalies are hernia represents 13% which is a relatively high found to be about 40% in females less than 20 years of incidence. Birth prevalence of diaphragmatic hernia age, and jumps to 100% in those more than 45 years has been estimated at 1.7 - 5 .7 per 10,000 in a study old. Brain, urinary tract and cardiac anomalies are the by Skari et al[38]. Congenital diaphragmatic hernia most frequently detected respectively. This is to some is associated with a high mortality rate with a high extent similar to the results of Nasrat et al in Jeddah[31], percentage of survivors having longterm morbidity. where the major congenital anomalies observed were Currently, the exciting possibility of in utero repair of of the central nervous system (CNS), followed by fetal CDH is being investigated[38]. cardiovascular system (CVS) and then by chromosomal Chest, spinal and musculoskeletal anomalies are less anomalies. We noticed the preponderance of CNS frequently detected in our study. They represent about and CVS anomalies in many studies such as those by 14.4%, 13% and 12.5% respectively. The commonest Lin et al[32] who found that congenital heart disorders skeletal anomaly detected is skeletal hypoplasia (50%), were the most common, and Wen et al, where neural and the least is osteogenesis imperfecta (8%). Bone tube defects were the commonest[33]. In the current hypoplasia is a highly diagnosed anomaly in our study, brain anomalies represented 40.7% of the total study, while in other studies (e.g., Stoll et al,)[39], the anomalies. Among these anomalies, hydrocephalus percentages of limb reduction defects diagnosed on December 2013 KUWAIT MEDICAL JOURNAL 305 prenatal scan were (24.6%). Fetal growth monitoring 2. Alia N, Ahmed I, Mahais HA, Perveen N. Congenital is an important item in antenatal US. Fetal growth anomalies: prevalence of congenital anomalies in 2nd retardation represents 15% of the anomalies in our trimester of pregnancy in Madina teaching hospital, study which warrants close followup and Doppler Faisalabad on grey scale ultrasound. JUMDC 2010; 1:23-28. study of the umbilical cord to detect possible anomalies. 3. EUROCAT Report 7. Fifteen years of surveillance of In addition to screening for fetal anomalies, US has an congenital anomalies in Europe 1980-1994. Belgium: important role in detection of placental and amniotic Scientific Institute of Public Health Louis Pasteur; 1997. fluid abnormalities. Abnormal placental position was p. 110-149. found in 9.4% of cases. As far as we searched in the 4. Lee K, Kim SY, Choi SM, et al. Effectiveness of prenatal literature, no definite correlation was found between ultrasonography in detecting fetal anomalies and abnormal placental position and fetal anomalies. perinatal outcome of anomalous fetuses. Yonsei Med J Based on our study we can conclude that antenatal 1998; 39:372-382. US anomaly scan especially in the second trimester 5. Dastgiri S, Stone DH, Le-Ha C, Gilmour WH. Prevalence has been found to be a very essential tool in detection and secular trend of congenital anomalies in Glasgow, UK. Arch Dis Child 2002; 86:257-263. of possible fetal anomalies. Early detection of fetal 6. Canfield MA, Honein MA, Yuskiv N, et al. National anomalies may guide the physician to take special estimates and race / ethnic−specific variation of precautions and do careful followup of the mother and selected birth defects in the United States, 1999 - 2001. fetus during the rest of pregnancy. In addition, some Birth Defects Res A Clin Mol Teratol 2006; 76:747-756. minor anomalies can be corrected in utero, while major 7. Patel ZM, Adhia RA. Birth defects surveillance study. anomalies need extensive postnatal care. Routine Indian J Pediatr 2005; 72:489-491. antenatal US screening as compared to selective 8. Boyd PA, Armstrong B, Dolk H, et al. Congenital (high risk) screening has been found economically anomaly surveillance in England - ascertainment justifiable[40]. It helps for careful antenatal surveillance deficiencies in the national system. BMJ 2005; 330:27. 9. Rosano A, Botto LD, Botting B, Mastroiacovo P. Infant and judicious timing of delivery[41,42]. All this has mortality and congenital anomalies from 1950 to 1994: increased the responsibilities of doctors from just an international perspective. J Epidemiol Community delivering the baby to a state where he or she has to Health 2000; 54:660-666. cater from diagnosis to timing of delivery to future 10. Dolk, H, Loane M, Garne E. The prevalence of congenital planning of pregnancies[43]. anomalies in Europe. In Rare Diseases Epidemiology, 349-364: Springer, 2010. CONCLUSION 11. Hobbins JC, Grannum PA, Berkowitz RL, Silverman R, In summary, this study shows that the percentage Mahoney MJ. Ultrasound in the diagnosis of congenital of congenital anomalies detected (3.18%) is comparable anomalies. Am J Obstet Gynecol 1979; 134:331-345. 12. Ermito S, Dinatale A, Carrara S, Cavaliere A, Imbruglia with the internationally reported anomaly percentages. L, Recupero S. Prenatal diagnosis of limb abnormalities: High prenatal detection rates for common congenital role of fetal ultrasonography. J Prenat Med 2009; 3:18- anomalies such as CNS, cardiac and renal anomalies 22. were noticed as found in most studies. Unexpectedly, 13. Roberts N, Bhide A. Ultrasound prenatal diagnosis abdominal anomalies are the fourth most commonly of structural abnormalities. Obstet Gynaecol Reprod detected anomalies. Less detection rates for other Med 2007; 17:1-8. less common but important anomalies such as 14. Copel JA, Tan AS, Kleinman CS. Does a prenatal musculoskeletal, chest, spinal and facial anomalies is diagnosis of congenital heart disease alter shortterm noticed. By using more sophisticated, highly sensitive outcome? Ultrasound in Obstet Gynecol 2002; 4:237- machines in addition to high expertise, well-trained 241. 15. Lechat MF, Dolk H. Registries of congenital anomalies: sonographers specialized in obstetric US, more specific EUROCAT. Environ Health Perspect 1993; 101:153-157. and early detection of various anomalies will be 16. Stoll C, Tenconi R, Clementi M. Detection of congenital possible in the future. anomalies by fetal ultrasonographic examination across Europe. Community Genet 2001; 4:225-232. ACKNOWLEDGMENT 17. El-Shafei A, Rao PS, Sandhu AK. Congenital We would like to thank radiologists and malformations and consanguinity. Aust N Z J Obstet technologists of the Diagnostic Radiology Department, Gynaecol 1986; 26:168-172. as well as Fetal Medicine Unit staff members of KAUH 18. Naderi S. Congenital abnormalities in newborns of for their great support and help. consanguineous and non-consanguineous parents. Obstet Gynecol 1979; 53:195-199. 19. Harrison KA. Child-bearing, health and social priorities: REFERENCES a survey of 22,774 consecutive hospital births in Zaria, Northern Nigeria. Br J Obstet Gynaecol 1985; 92:1-119. 1. Verrotti C, Caforio E, Gramellini D, Nardelli GB. 20. Villumsen AL. Environmental factors in congenital Ultrasound screening in second and third trimester of malformations: a prospective study of 9,006 human pregnancy: an update. Acta Biomed 2007; 78:229-232. pregnancies: F.A.D.L.s Forlag; 1970. 306 Antenatal Ultrasound Diagnosis of Fetal Anomalies at a University Hospital December 2013

21. Baird PA, Sadovnick AD, Yee IM. Maternal age and malformations: changes in prevalence and birth status, birth defects: a population study. Lancet 1991; 337:527- 1972 - 1990. Am J Med Genet 1999; 84:102-110. 530. 33. Wen SW, Liu S, Joseph KS, Rouleau J, Allen A. Patterns of 22. Sawardekar KP. Profile of major congenital infant mortality caused by major congenital anomalies. malformations at Nizwa hospital, Oman: 10 − year Teratology 2000; 61:342-346. review. J Paediatr Child Health 2005; 41: 323-330. 34. Crane JP, LeFevre ML, Winborn RC, et al. A randomized 23. Al-Gazali LI, Dawodu AH, Sabarinathan K, Varghese trial of prenatal ultrasonographic screening: impact on M. The profile of major congenital abnormalities in the the detection, management, and outcome of anomalous United Arab Emirates (UAE) population. J Med Genet fetuses. The RADIUS Study Group. Am J Obstet 1995; 32:7-13. Gynecol 1994; 171:392-399. 24. Al Talabani J, Shubbar AI, Mustafa KE. Major congenital 35. Bonnet D, Coltri A, Butera G, et al. Detection of malformations in United Arab Emirates (UAE): need transposition of the great arteries in fetuses reduces for genetic counselling. Ann Hum Genet 1998; 62:411- neonatal morbidity and mortality. Circulation 1999; 418. 99:916-918. 25. Al-Jama F. Congenital malformations in newborns in 36. Balakumar K. Antenatal ultrasound screening for a teaching hospital in Eastern Saudi Arabia. J Obstet anomalies among singletons: result of a prospective Gynecol 2001; 21:595-598. study. Calicut Med J 2004; 2:1-10. 26. Hegazy IS, Al-Beyari TH, Al Amri AH, Qureshi NA, 37. Csabay L, Szabo I, Papp C, Toth-Pal E, Papp Z. Central Abdelgadir MH. Congenital malformations in primary nervous system anomalies. Ann N Y Acad Sci 1998; health care in Al-Qassim region. Ann Saudi Med 1995; 847:21-45. 15:48-53. 38. Skari H, Bjornland K, Haugen G, Egeland T, Emblem 27. Refat MY, Al-Moghanem M, McDonald P, Reyes L. R. Congenital diaphragmatic hernia: a meta-analysis of Major birth defects at King Fahd Hofuf Hospital: mortality factors. J Pediatr Surg 2000; 35:1187-1197. prevalence, risk factors and outcome. Ann Saudi Med 39. Stoll C, Wiesel A, Queisser-Luft A, Froster U, Bianca 1995; 15:339-343. S, Clementi M. Evaluation of the prenatal diagnosis of 28. Nasrat H. Prenatal diagnosis, its potential impact on the limb reduction deficiencies. EUROSCAN Study Group. prevalence and management of congenital anomalies. Prenat Diagn 2000; 20:811-818. Saudi Med J 1998; 19:130-135. 40. Long, G, Sprigg A. A comparative study of routine 29. Carrera JM, Torrents M, Mortera C, Cusi V, Munoz versus selective fetal anomaly ultrasound scanning. J A. Routine prenatal ultrasound screening for fetal Med Screen 1998; 5:6-10. abnormalities: 22 years’ experience. Ultrasound Obstet 41. Morimoto K, Yoshimine T, Hayakawa T, et al. Antenatal Gynecol 2003; 5:174-179. detection of developing nervous system abnormalities 30. Agarwal SS, Singh U, Singh PS, et al. Prevalence and and perinatal surgical management. No Shinkei Geka spectrum of congenital malformations in a prospective 1989; 17:965-971. study at a teaching hospital. Indian J Med Res 1991; 42. Lockwood CJ, Weiner S. Assessment of fetal growth. 94:413-419. Clin Perinatol 1986; 13:3-35. 31. Nasrat HA. Use of ultrasound longitudinal data in the 43. Romero R, Oyarzun E, Sirtori M, Hobbins JC. Detection diagnosis of abnormal fetal growth. J Matern Fetal Med and management of anatomic congenital anomalies. A 1997; 6:209-214. new obstetric challenge. Obstet Gynecol Clin North Am 32. Lin AE, Herring AH, Amstutz KS, et al. Cardiovascular 1988; 15:215-236. December 2013 KUWAIT MEDICAL JOURNAL 307

Original Article Electrophysiologic Effects of Statins in Patients with Ischemic Cardiomyopathy and Ventricular Tachyarrhythmia

Aleks Degirmencioglu1, Gultekin Karakus1, Ali Buturak1, Nazmiye Cakmak2, Ilke Sipahi1, Ahmet Akyol1 1Department of Cardiology, Acibadem University School of Medicine, Istanbul, Turkey 2Department of Cardiology, Dr Siyami Ersek Cardiovascular Surgery Training and Research Hospital, Istanbul, Turkey

Kuwait Medical Journal 2013; 45 (4): 307 - 312

ABSTRACT

Objectives: Statin therapy may be beneficial not only to time (SACT), atrio-ventricular node refractory period reduce the risk of vascular events but also to reduce the (AVNRP), atrio-ventricular Wenckebach period (AVWP), risk of ventricular arrhythmias and sudden cardiac death. ventricular refractory period (VRP), ventriculo-atrial We evaluated the effects of statins on electrophysiologic dissociation measurement, corrected QT (QTc) interval parameters in patients with ischemic cardiomyopathy and and QT dispersion were measured. Also, ventricular established ventricular tachyarrhythmia. arrhythmia inducibility was evaluated with various Design: Prospective study techniques. Subjects and Methods: Eleven patients (all male, mean Results: Although, QTc interval and QT dispersion decreased age 57.9 ± 6.64 years), with ischemic cardiomyopathy and significantly with statin treatment (p < 0.05), there were ventricular tachyarrhythmia on admission were included in no statistically significant differences in the measurements the study. of basic intervals, cSNRT, SACT, AVNRP, AVWP, VRP and Setting: Two academic tertiary care centers ventriculo-atrial dissociation compared to pretreatment Interventions: A baseline electrophysiologic study was measurements (p > 0.05). Additionally, while induction of performed before implantable-cardioverter defibrillator ventricular tachyarrhythmia occurred in 72.7% of patients (ICD) implantation. Forty milligram of atorvastatin was before statin therapy, this rate decreased to 36.4% with started and electrophysiologic study was repeated one treatment (p = 0.13). month later and results were compared. Conclusion: Statin treatment led to significant decreases in Main Outcome Measures: Basic intervals, corrected QTc interval and QT dispersion, but it did not change other sinus node recovery time (cSNRT), sino-atrial conduction electrophysiologic parameters significantly.

KEYWORDS: electrophysiologic parameters, electrophysiologic study, statins, ventricular tachyarrhythmia

INTRODUCTION electrophysiologic effects of statins have also been Ventricular tachyarrhythmia is one of the most demonstrated (i.e., increasing heart rate variability, common cause of the sudden cardiac death (SCD)[1] decreasing the ventricular late potentials and variability and accounts for more than 50% of the deaths in of QT dispersion and decreasing corrected QT (QTc) patients with heart disease. Many studies revealed interval)[13-17]. Although these findings support the that statins have been associated with a reduction in possible direct anti-arrhythmic action of statins, their mortality in patients with coronary artery disease[2,3]. effects on other electrophysiologic parameters have Two large secondary prevention trials have provided not been evaluated. The aim of this study was to evidence that statins also reduced SCD[2,3] and some investigate the effects of statins on electrophysiologic recent studies suggest that statins may have anti- parameters in patients with ischemic cardiomyopathy arrhythmic effects[4-8]. However, whether their effect and ventricular arrhythmia. of reducing arrhythmias is due to anti-ischemic effects[9-11] or direct anti-arrhythmic properties are SUBJECTS AND METHODS unknown. In addition to their well-known anti- Eleven patients (all male; mean age 57.91± 6.64 atherogenic and plaque stabilization effects[12], some years, range: 45 – 66 years) diagnosed with ischemic

Address correspondence to: Dr. Aleks Değirmencioğlu, MD, Adnan Kahveci Bulvarı Ataköy Konakları D2-1/12 Ataköy, Istanbul, Turkey. Tel: 00905324367716, E-mail: alexdegirm [email protected] 308 Electrophysiologic Effects of Statins in Patients with Ischemic Cardiomyopathy... December 2013 cardiomyopathy with New York Heart Association cycle length pacing (800 ms, 700 ms, 600 ms, 500 (NYHA) functional class I or II, left ventricular ejection ms, 450 ms, 400 ms, 350 ms) and the longest time fraction (LVEF) < 35%, and admitted to the hospital with was accepted as cSNRT. hemodynamically stable monomorphic ventricular 2. Sinoatrial conduction time (SACT), derived by tachyarrhythmia were prospectively enrolled in the Narula method: Eight atrial extra stimuli, which study. None of these patients were taking a statin or are faster than intrinsic heart rate, were given antiarrhythmic drug except a beta-blocker for at least after rest sinus cycle length was measured. First six months. Patients with baseline rhythm other than spontaneous beat after terminating the pacing sinus, acute coronary syndrome on presentation, was recorded and the time between the last pacing severe valvular heart disease, electrolyte abnormality and the first spontaneous beat was measured. This and other systemic disease were excluded. All patients measurement equals the sum of the 2 x SACT and were on standard heart failure medications including a sinus cycle length. SACT was derived from this beta-blocker. The medications of the patients were not equation. altered during the study period. The investigational 3. Atrial effective refractory period (AERP): Eight protocol described herein was approved by local ethics atrial stimuli (S1) with 600 ms cycle length followed committee and informed consent was obtained from by one extra stimulus (S2) were given. Coupling all patients. interval (S1 - S2) was gradually decreased. The Electrophysiologic study (EPS) was performed in all longest S1 - S2 interval, which S2 did not depolarize patients before implantable-cardioverter defibrillator the atrium, was accepted as AERP. (ICD) implantation and baseline measurements were 4. Atrioventricular node effective refractory period obtained. In patients who needed antiarrhythmic (AVNERP): Eight atrial stimuli (S1) with 600 ms cycle medication for terminating ventricular arrhythmia length followed by one extra stimulus (S2) were on admission, intravenous lidocaine was used and given. Coupling interval (S1 - S2) was gradually electrophysiologic study was performed at least one decreased. The longest S1 - S2 interval, which S2 week later in these patients. Amiodarone was never was not conducted to the ventricle via AV node, used. Forty milligram atorvastatin was added to the was accepted as AVNERP. routine treatment after the EPS because of ischemic 5. Atrio-ventricular Wenckebach cycle length heart disease. One month later, EPS was repeated with (AVWCL): Incremental atrial pacing (maximum same measurement and results were compared. 200 beats/min that equals 300 ms cycle length) Electrophysiologic study: Three diagnostic catheters was performed gradually until block occurred at were placed at the superior portion of the right atrium, the level of the AV node or infra-node and ceased bundle of His, and right ventricular apex via the right 1:1 conduction. The cycle length that caused femoral vein. The basic conduction intervals (PA: ceasing of 1:1 AV conduction was recorded as measured between earliest recorded atrial activity AVWCL. and the rapid deflection of the atrial electrogram on 6. Ventricular effective refractory period (VERP): the bundle of His catheter; AH: measured between Eight ventricular stimuli (S1) with 600 ms cycle the atrial electrogram recorded by the bundle of His length following by one extra stimulus (S2) were catheter and the beginning of the His electrogram itself; given. Coupling interval (S1 - S2) was gradually HV: measured between the His electrogram and the decreased. The longest S1 - S2 interval, which S2 earliest recorded ventricular activation; PR: duration did not depolarize the ventricle, was accepted as between the onset of atrial depolarization to the VERP. onset of ventricular depolarization; QRS: duration of 7. Ventriculoatrial dissociation cycle length (VDCL): ventricular activation; QT: combination of ventricular Incremental ventricular pacing was performed activation and repolarization; BCL: sinus cycle length) gradually until ventriculoatrial dissociation and the other electrophysiologic measurements were occurred. The cycle length that caused ventriculo- recorded. atrial dissociation was recorded as VDCL. 1. Corrected sinus node recovery time (cSNRT): 8. Corrected QT interval (QTc): QT interval Overdriving atrial pacing was performed for was calculated from continuous 12 lead 30 seconds and first spontaneous beat after electrocardiography (ECG) tracings that was terminating the pacing was recorded. The time recorded at a speed 100 mm/sec and QTc interval between the last pacing and the first spontaneous was derived according to formula. beat was measured. Because sinus node recovery 9. QT dispersion: It was recorded as time difference time (SNRT) depends on sinus rate, cSNRT was between leads that have longest and shortest QT derived by calculating the difference between SNRT interval, derived from continuous 12 lead ECG and sinus cycle length. To accurately determine the tracings that was recorded at a speed 100 mm/ cSNRT, measurements were repeated with various sec[18]. December 2013 KUWAIT MEDICAL JOURNAL 309

Finally, whether ventricular arrhythmia could be Table 2: Electrophysiologic parameters induced was evaluated by using various techniques Parameter Before treatment On treatment p-value (programmed extra stimulation, multiple extra Mean ± SD Mean ± SD stimulation, short-long-short sequence). Statistical Analysis: Results are expressed as mean ± cSNRT§ 216.09 ± 67.12 200.00 ± 59.29 0.450 &par standard deviation (SD). The paired sample t test was Narula SACT 103.59 ± 47.96 110.45 ± 61.59 0.690 AVNERP&ast 269.09 ± 66.40 270.91 ± 59.57 0.921 used for the comparison of quantitative data. The Mc AVWP† 363.64 ± 59.88 344.54 ± 50.47 0.309 Nemar test was used for the comparisons of qualitative VERP¶ 223.64 ± 16.89 230.91 ± 13.75 0.181 data. A p-value of < 0.05 was considered statistically VA# Dissociation 448.18 ± 108.52 450.00 ± 86.83 0.951 ‡ significant. QTc 444.18 ± 33.97 431.27 ± 34.92 0.018* QT Dispersion 36.00 ± 9.21 29.18 ± 8.11 0.028*

RESULTS § = corrected sinus node recovery time; &par = sinoatrial All patients had a history of significant coronary conduction time; &ast = atrio-ventricular node effective refractory stenosis (> 50%) at least in one coronary artery. The period; † = atrio-ventricular wenckebach period; ¶ = ventricular number of patients, who had one, two and three effective refractory period; # = ventriculo-atrial, * p < 0 = 05 , SD = standard deviation, ‡ = corrected QT vessel coronary disease, was 4, 3, and 4, respectively and five patients had a history of coronary artery bypass graft surgery. All patients had reduced LVEF other electrophysiologic parameters between pre and (< 35%) with segmental wall motion abnormality on post- treatment measurements. QTc interval and QT dispersion decreased statistically significantly with statin treatment (444.1 ms Vs 431.2 ms, p = 0.018; and Table 1: Basic intervals 36.0 ms Vs 29.1 ms, p = 0.028, respectively) (Table Interval Before treatment On treatment p-value 2). While induction of ventricular tachyarrhythmia Mean ± SD Mean ± SD occurred in 72.7% of patients before taking the AH 88.00 ± 21.43 88.00 ± 18.04 0.99 statin, this rate decreased to 36.4% with treatment. HV 60.91 ± 9.25 61.36 ± 12.03 0.833 Morphologies and hemodynamic consequences of PA 20.09 ± 7.15 21.45 ± 7.20 0.454 ventricular tachyarrhythmias, which were induced PR 158.73 ± 34.94 166.45 ± 32.47 0.078 during electrophysiologic study, were similar with QRS 111.82 ± 28.85 109.63 ± 28.32 0.540 QT 362.00 ± 34.52 354.63 ± 35.56 0.379 admission tachyarrhythmias. Even though there was a BCL 747.45 ± 153.86 751.63 ± 158.31 0.907 trend for a reduced rate of tachyarrhythmia induction after statin therapy, this was not statistically significant AH: measured between the atrial electrogram recorded by the His (p = 0.125) (Table 3). bundle catheter and the beginning of the His electrogram itself; HV: measured between the His electrogram and the earliest recorded ventricular activation; PA: measured between earliest recorded DISCUSSION atrial activity and the rapid deflection of the atrial electrogram on The principal results of this prospective study the His bundle catheter; PR: duration between the onset of atrial are (1) QTc interval shortens and QT dispersion depolarization to the onset of ventricular depolarization; QRS: duration of ventricular activation; QT: combination of ventricular decreases with statin treatment. (2) Statin treatment is activation and repolarization; BCL:sinus cycle length; SD: standard associated with a trend toward decreased ventricular deviation tachyarrhythmia induction. Many studies demonstrated that statins decrease echocardiography. the incidence of ventricular arrhythmias (VA)[4-8] and There was no significant difference in the basic this result may, at least in part, account for the statin- conduction intervals (PA, AH, HV, PR, QRS, QT, induced decrease in cardiovascular mortality. Statins BCL) of the patients at baseline and after statin significantly reduce the incidence of appropriate ICD therapy (Table 1). Except the QTc interval and QT shocks for life-threatening ventricular arrhythmias in dispersion, there were no significant differences in patients with coronary artery disease (CAD) and ICD

Table 3: Induction of ventricular tachyarrhythmia

Before treatment Induction of ventricular Yes No Total p-value tachyarrhythmia n (%) n (%) n (%) Yes 4 (36.4) 0 (0) 4 (36.4) On treatment No 4 (36.4) 3 (27.3) 7 (63.6) 0.125 Total 8 (72.7) 3 (27.3) 11(100)

310 Electrophysiologic Effects of Statins in Patients with Ischemic Cardiomyopathy... December 2013 implants[6-8]. It was also suggested that statin treatment statins, including modulation of autonomic nervous may have a beneficial effect on the incidence of VA tone and stabilization of ventricular repolarization[14]. in the setting of acute myocardial infarction[19]. Two Additionally, statin therapy may also result in large randomized studies suggest that statins might alterations in transmembrane ion channel properties exert a beneficial effect on the incidence of lethal VA by affecting ventricular conduction and excitability[12]. and reduce the relative risk of SCD[2,3]. In this regard, Vyas et al suggests an immediate effect of these drugs the recent guidelines of the American College of rather than a delayed effect related to a slowing of Cardiology (ACC) / American Heart Association the rate of progression of atherosclerosis[8]. All of (AHA) / European Society of Cardiology (ESC) for these studies supported that statins may have direct the management of VA recommend that statin therapy antiarhythmic effects independent of antiischemic could be beneficial in patients with CAD to reduce properties but the exact mechanism is unknown. the risk of vascular events, possibly VA and SCD[20]. However, a recent review concluded that an Although the definite mechanism of this effect is antiischemic rather than a primary antiarrhythmic unknown, there are several proposed mechanisms effect emerges as the likely mechanism of sudden including direct antiarrhythmic effect by affecting cardiac death reduction with statins[26] and some different electrophysiologic components and anti- studies did not show a beneficial effect of statins on ischemic effect by reducing ischemia-related ventricular life-threatening arrhythmias[27-29]. tachyarrhythmias. Statins can prevent progression and The heterogeneity of the conduction and promote regression of atherosclerotic plaques[9] and refractoriness are important features for reentrant may contribute to the plaque stabilization in high- tachyarrhythmias and increased QT dispersion is risk atherosclerotic lesions[10]. These effects lead to a associated with heterogeneity of the ventricular reduced risk of plaque rupture, thereby preventing refractoriness. Also it is well known that, ischemia-induced electrophysiological effects that increased QTc interval can promote ventricular predispose to VA[11]. tachyarrhythmia. Both QTc prolongation and It is known that some electrophysiologic changes increased QT dispersion are associated with can predispose to VA and statins are suggested to higher mortality rate in patients with moderate have beneficial effects on these electrophysiologic and severe left ventricular dysfunction[30]. Our parameters. Decreased heart rate variability is study demonstrated that statin therapy might associated with decreased parasympathetic tone and have beneficial effect on QT dispersion and QTc has been shown to be a predictor of arrhythmic events[21] interval and these findings are consistent with the and some clinical studies demonstrated that statins are findings of prior smaller studies[14,15,17]. However, associated with increased heart rate variability[13,14]. there was no significant effect of statins on the other Although exact mechanism of this effect is unknown, electrophysiologic parameters (e.g., refractoriness, it may be associated with decreasing caveolin-1 conduction time), which were not evaluated before. expression and facilitating nitric oxide synthase function with concurrent improvement of heart rate Study limitations variability[22]. Ventricular late potentials are considered This is a small study where each patient served as to originate from areas of slow and non-homogenous his own control, without a separate control group not conduction within the diseased myocardium and receiving statin therapy. The small number of patients are also thought to represent delayed activation of does not allow reliable conclusions regarding the effect damaged myocardium that serves as an anatomical of statins on the inducibility ventricular arrhythmias. substrate for repeated VA[23]. It has been shown that Additionally, the dose and duration of the statin early statin administration leads to a significant treatment was chosen arbitrarily. In electrophysiologic decrease in the incidence of ventricular late potentials studies, errors may occur due to differences in catheter and VA in patients with acute myocardial infarction[16]. placement sites. Presence of an ICD lead in the right Increased QT variability and QTc interval prolongation ventricle may have also affected measurements in the have been associated with heterogeneity in ventricular follow-up EPS, performed after the ICD implantation. repolarization and changes in autonomic nervous All patients were on beta-blocker treatment and this tone that predispose to the development of VA and may have affected measurements. sudden cardiac death[14,24,25]. It has been demonstrated that atorvastatin therapy decreases QT variability and CONCLUSION shortens QTc intervals in patients with advanced heart Statins seem to have beneficial effect against failure[14,17]. Treatment with fluvastatin for 12 months arrhythmias but definite mechanism of this led to a decreased variability of QT dispersion in antiarrhythmic effect is unknown. In this study, we another small study[15]. These statin-induced changes found favorable effects on QT dispersion and QTc may reflect multiple beneficial pleiotropic effects of interval with statin treatment, but we observed that December 2013 KUWAIT MEDICAL JOURNAL 311 the other electrophysiologic parameters did not change 12. Pound EM, Kang JX, Leaf A. Partitioning of significantly. polyunsaturated fatty acids, which prevent cardiac arrhythmias, into phospholipid cell membranes. J Lipid ACKNOWLEDGEMENTS Res 2001; 42:346-351. 13. Pehlivanidis AN, Athyros VG, Demitriadis DS, This study was executed and reported Papageorgiou AA, Bouloukos VJ, Kontopoulos AG. independently; no company or instution supported it Heart rate variability after long-term treatment with financially. atorvastatin in hypercholesterolaemic patients with or without coronary artery disease. Atherosclerosis Conflict of interest: None declared. 2001; 157:463-469. 14. Vrtovec B, Okrajsek R, Golicnik A, Ferjan M, Starc V, REFERENCES Radovancevic B. Atorvastatin therapy increases heart rate variability, decreases QT variability, and shortens 1. Podrid PJ, Myerburg RJ. Epidemiology and stratification QTc interval duration in patients with advanced of risk for sudden cardiac death. Clin Cardiol 2005; 28S: chronic heart failure. J Card Fail 2005; 11:684-690. I3-17. 15. Mark L, Katona A. Effect of fluvastatin on QT 2. Scandinavian Simvastatin Survival Study Group. dispersion: a new pleiotropic effect? Am J Cardiol Randomised trial of cholesterol lowering in 4444 2000; 85:919-920. patients with coronary disease: the Scandinavian 16. Kayikcioglu M, Can L, Evrengul H, Payzin S, Kultursay Simvastatin Survival Study (4S). Lancet 1994; 344:1383- H. The effect of statin therapy on ventricular late 1389. potentials in acute myocardial infarction. Int J Cardiol 3. The Long-Term Intervention with Pravastatin in 2003; 90:63-72. Ischemic Disease (LIPID) Study Group. Prevention of 17. Xie RQ, Cui W, Liu F, Yang C, Pei WN, Lu JC. Statin cardiovascular events and death with pravastatin in therapy shortens QTc, QTcd, and improves cardiac patients with coronary heart disease and a broad range function in patients with chronic heart failure. Int J of initial cholesterol levels. N Engl J Med 1998; 339:1349- Cardiol 2010; 140:255-257. 1357. 18. Bazett HC. An analysis of the time-relations of 4. De Sutter J, Tavernier R, De Buyzere M, Jordaens L, electrocardiograms. Heart 1920; 7: 353-370 De Backer G. Lipid lowering drugs and recurrences of 19. Fonarow GC, Wright RS, Spencer FA, et al. National life-threatening ventricular arrhythmias in high-risk registry of myocardial infarction 4 investigators: effect patients. J Am Coll Cardiol 2000; 36:766-772. of statin use within the first 24 hours of admission for 5. De Sutter J, Firsovaite V, Tavernier R. Prevention of acute myocardial infarction on early morbidity and sudden death in patients with coronary artery disease: mortality. Am J Cardiol 2005; 96:611-616. do lipid-lowering drugs play a role? Prev Cardiol 2002; 20. Zipes DP, Camm J, Borggrefe M, et al. ACC/AHA/ 5:177-182. ESC Guidelines for management of patients with 6. Chiu J, Abdelhadi R, Chung M, et al. Effect of statin ventricular arrhythmias and the prevention of sudden therapy on risk of ventricular arrhythmia among cardiac deathexecutive summary. Circulation 2006; patients with coronary artery disease and an implantable 114:1088-1132. cardioverter-defibrillator. Am J Cardiol 2005; 95:490- 21. Quintana M, Storck N, Lindblad LE, Lindvall K, 491. Ericson M. Heart rate variability as a means of 7. Mitchell L, Powell J, Gillis A, Kehl V, Hallstrom assessing prognosis after acute myocardial infarction. A, and the AVID Investigators. Are lipid-lowering A 3-year follow-up study. Eur Heart J 1997; 18:789- drugs also antiarrhythmic drugs? An analysis of the 797. Antiarrhythmics Versus Implantable Defibrillators 22. Pelat M, Dessy C, Massion P, Desager JP, Feron O, (AVID) trial. J Am Coll Cardiol 2003; 42:81-87. Balligand JL. Rosuvastatin decreases caveolin-1 and 8. Vyas AK, Guo H, Moss AJ, et al. MADIT-II Research improves nitric oxide-dependent heart rate and blood Group. Reduction in ventricular tachyarrhythmias pressure variability in apolipoprotein E-/- mice in with statins in the Multicenter Automatic Defibrillator vivo. Circulation 2003; 107:2480e-2486. Implantation Trial (MADIT)-II. J Am Coll Cardiol 2006; 23. Makijarvi M, Breithard G, Reinhardt L, Fetsch T, 47:769-773. Borggrefe M, Martinez-Rubio A. Signal averaged 9. Nissen SE, Nicholls SJ, Sipahi I, et al. ASTEROID electrocardiogram: update 1997. Ann Noninvasive Investigators. Effect of high-intensive statin therapy on Electrocardiol 1997; 2:384-394. regression of coronary atherosclerosis: the ASTEROID 24. Haigney MC, Zareba W, Gentlesk PJ, et al. trial. JAMA 2006; 295:1556-1565. Multicenter Automatic Defibrillator Implantation 10. Rosenson RS, Tangney CC. Antiatherothrombotic Trial II investigators. QT interval variability and properties of statins: implications for cardiovascular spontaneous ventricular tachycardia or fibrillation in event reduction. JAMA 1998; 279:1643-1650. the Multicenter Automatic Defibrillator Implantation 11. Cascio WE. Myocardial ischemia: what factors determine Trial (MADIT) II patients. J Am Coll Cardiol 2004; arrhythmogenesis? J Cardiovasc Electrophysiol 2001; 44:1481-1487. 12:726-729. 25. Berger RD. QT variability. J Electrocardiol 2003; 36:83- 87. 312 Electrophysiologic Effects of Statins in Patients with Ischemic Cardiomyopathy... December 2013

26. Beri A, Contractor T, Khasnis A, Thakur R. Statins and Study: A Randomised Controlled Trial. JAMA 2001; the reduction of sudden cardiac death: antiarrhythmic 285:1711-1718. or anti-ischemic effect? Am J Cardiovasc Drugs 2010; 29. Colhoun HM, Betteridge DJ, Durrington PN, et 10:155-164. al. CARDS Investigators. Primary prevention of 27. Riahi S, Schmidt EB, Christensen JH, et al. Statins, cardiovascular disease with atorvastatin in type 2 ventricular arrhythmias and heart rate variability in diabetes in the Collaborative Atorvastatin Diabetes patients with implantable cardioverter defibrillators Study (CARDS): multicentre randomized placebo- and coronary heart disease. Cardiology 2005; 104:210- controlled trial. Lancet 2004; 364:685-696. 214. 30. Padmanabhan S, Silvet H, Amin J, Pai RG. Prognostic 28. Schwartz GG, Olsson AG, Ezekowitz MD, et al. value of QT interval and QT dispersion in patients Myocardial Ischemia Reduction with Aggressive with left ventricular systolic dysfunction: Result from a Cholesterol Lowering (MIRACL) Study Investigators. cohort of 2265 patients with an ejection fraction of < or Effects of atorvastatin on early recurrent ischemic = %40. Am Heart J 2003; 145:132-138. events in acute coronary syndromes. The MIRACL December 2013 KUWAIT MEDICAL JOURNAL 313

Original Article Variant Analysis of the Sirtuin (SIRT1) Gene in Multiple Sclerosis

Tuba Gokdogan Edgunlu1, Sevim Karakas Celik2, Ufuk Emre3, Aysun Eroglu Unal4, Ahmet Dursun2 1Mugla School of Health Science, Mugla Sitki Kocman University Mugla, Turkey 2Department of Medical Genetic, Bulent Ecevit University Medical Faculty, Zonguldak, Turkey 3Department of Neurology, Bulent Ecevit University Medical Faculty, Zonguldak, Turkey 4Department of Neurology, Namik Kemal University Medical Faculty, Edirne, Turkey

Kuwait Medical Journal 2013; 45 (4): 313 - 318 ABSTRACT

Objective: Multiple sclerosis (MS) is an inflammatory Intervention: For genetic analysis, 5 ml of venous blood demyelinating disease affecting the central nervous was drawn from each patient into tubes containing system. Although the exact pathogenesis of MS is EDTA unknown, it is generally considered to be an autoimmune Main Outcome Measures: SIRT1 gene polymorphisms disease, with numerous genetic and environmental factors and recorded expanded disability status scale (EDSS) for determining disease susceptibility and severity. Sirtuin MS patients 1 (SIRT1) is a neuroprotective enzyme in MS patients. Results: We found a significant difference between the The aim of our study was to investigate the relationship rs2273773 polymorphism of the SIRT1 gene of MS and the between a genetic variant of SIRT1 and MS. control group (p = 0.011). We also found an association Design: Controlled prospective study between MS disease and the haplotypes of rs7895833, Setting: Department of Neurology, Bülent Ecevit rs7069102 and rs2273773 polymorphisms. University Medical Faculty, Zonguldak, Turkey Conclusion: We have shown that rs2273773 polymorphism Subjects and Methods: We determined SIRT1 genotypes of the SIRT1 gene might be a risk factor for MS disease by polymerase chain reaction (PCR) and confronting two- in the Turkish population. Also, additional studies pair primers (CTPP) methods in 93 MS patients and 100 are needed to clarify the role of the SIRT1 gene in the healthy controls pathogenesis of MS disease.

KEYWORDS: autoimmune disease, neurodegenerative disease

INTRODUCTION redox balance and increased oxidative stress in Multiple sclerosis (MS) is known as an autoimmune the pathogenesis of MS have been suggested as disease, with numerous genetic and environmental influencing factors[6,7]. Sirtuin 1 (SIRT1) is a member of factors determining disease susceptibility and severity. the sirtuin family of NAD +/- dependent deacetylases. Although the pathogenesis of MS is not clear, multiple Also, in mammals, yeast and higher organisms it sclerosis has also been considered a neurodegenerative deacetylates histones, which increase DNA stability disease because of the coexistence of permanent axonal and longterm survival[8-10]. SIRT1 controls numerous damage, neuronal loss and neurological disability[1-3]. physiologic processes and protects cells against Susceptibility to MS is thought to be conferred by a oxidative stress. Its activity is dependent on NAD, combination of genetic and environmental factors[4,5]. which affects electronic transmission of mitochondria The four clinical phenotypes of MS have been and cellular oxygen supply. A decrease in NAD and determined: relapsing-remitting MS (RR-MS), primary SIRT1 activity is responsible for high p53 acetylation progressive MS (PP-MS), progressive relapsing MS and c-Jun N-terminal kinase activation, which (PR-MS) and secondary progressive MS (SP-MS). are related to cell activation, inflammation and Virus infections of the CNS, vascular factors and/ atherosclerosis. These pathways can be prevented by or disturbed immune mechanisms are implicated the antioxidant resveratrol[11-14]. SIRT1 is located in the in the pathogenesis of MS. In recent studies, altered cytoplasm and the nucleus. Its targets are known as

Address correspondence to: Tuba Gokdogan Edgunlu, Mugla School of Health Science, Mugla Sitki Kocman University, Mugla, Turkey. Tel: 090 252 211 32 03 E-mail: [email protected] or [email protected] 314 Variant Analysis of the Sirtuin (SIRT1) Gene in Multiple Sclerosis December 2013

FOXO1, FOXO3, PGC-1a, p53, NF-kB, Notch, HIF1a, Vilnius, Lithuania) and 1U Taq DNA polymerase LXR, FXR and SREBP1c[15]. SIRT1 is associated with (Fermentas, Vilnius, Lithuania). Amplification was longevity, oncogenesis, metabolic regulation and performed on an automated thermal cycler (Techne neurodegenerative diseases[16,17]. It has been suggested Flexigene, Cambridge, UK). PCR conditions for that SIRT1 could play a protective role in MS patients[2]. SIRT1 gene polymorphisms were 3 min for initial For this purpose, this study investigated the potential denaturation at 95 ºC, 35 cycles, 45 s at 94 ºC for role that SIRT1 gene polymorphisms play in MS. The denaturation, 1 min at 64 ºC for annealing and 2 min SNP of rs7895833 in the promoter region, rs7069102 in at 72 ºC for extension, followed by 7 min at 72 ºC for intron 4, and rs2273773 in exon 5 were selected for this final extension. PCR products were directly analyzed study. These polymorphisms may affect the promoter by electrophoresis on 3% agarose gels, and each allele activity and change the activity of the SIRT1 gene[18]. was identified according to its size. We have genotyped the polymorphisms (rs7895833, rs7069102 and rs2273773) of the SIRT1 gene to Statistical Analysis determine their association with MS disease in the The Hardy–Weinberg equilibrium was verified Turkish population. using the chi-square test and by estimating the expected genotypic frequencies on the basis of the development SUBJECTS AND METHODS of the square of the binomial for these polymorphisms. Population of the Study Allelic and genotypic distributions among the different The protocol was approved by the regional ethical groups were compared using the likelihood-ratio chi- committee, and procedures were performed according square test or Fisher’s exact test. Haplotype analysis to the principles of The Helsinki Declaration. We was used to evaluate the effect of the genes. Platform analyzed 93 Turkish patients with MS diagnosed (http://analysis.bio-x.cn/myAnalysis.php) and SPSS according to the revised McDonald criteria[19]. Once 11.5 for Windows program were used to implement enrolled, a neurologist administered questionnaires, statistical analysis. and blood samplings were drawn at the same visit. In the questionnaire, the patients were asked to report RESULTS the onset time, character, and location, duration of the According to the data we obtained, 93 MS patients pain, associated symptoms, history and medications. (mean age 45 ± 2.0 years) and 100 (49.8 ± 0.8 years) We evaluated 93 MS patients (61 RR-MS, 29 SP-MS unrelated, age and sex-matched controls were and 3 PP-MS) (mean age 30.42 ± 10.33 years) from the compared. There were no significant differences in database of the Department of Neurology, Bulent Ecevit the distribution of age and gender between MS and University Faculty of Medicine. We recorded expanded control patients (p > 0.05) (Table 1). disability status scale (EDSS) for those patients. A total of 100 (32.61 ± 10.21 years) unrelated, age and sex- matched, healthy individuals were selected from the Table 1: Clinical parameters of subjects same geographic area as the control sample. Table 1 Group N Age (Yrs) EDSS *median shows the demographic characteristics of MS patients (Mean ± SE) (IQR) and healthy controls. Healthy controls 100 45 ± 2.0 Not applicable Multiple sclerosis Genotyping All 93 49.8 ± 0.8 5.12 (2.03 – 7.56) After written, informed consent was obtained, RR-MS 61 41.6 ± 0.2 1.22 (0.35 – 3.38) venous blood samples were collected into vacutainer SP-MS 29 50.2 ± 0.4 5.58 (3.18 – 7.80) plastic tubes containing sodium/potassium EDTA. PP-MS 3 55.4 ± 0.4 5.80 (4.70 – 8.02) Polymerase chain reaction (PCR) and confronting EDSS = Expanded disability status scale; MS = Multiple sclerosis; RR- two-pair primers (CTPP) methods for rs7895833, MS = relapsing-remitting MS; SP - MS = secondary progressive MS; PP rs7069102 and rs2273773 polymorphisms have been - Ms = primary progressive MS shown previously[18]. The SIRT1 gene polymorphism According to our results, a meaningful difference (rs7895833, rs7069102 and rs2273773) genotypes were was found between the rs2273773 polymorphism of determined by PCR and CTPP methods. DNA was the SIRT1 gene in the MS and the control groups. Also, extracted with a Genejet Genomic DNA purification kit logistic regression analysis showed that the C allele for (Thermo K0772). Primers, annealing temperatures and the rs2273773 polymorphism might be a risk factor for fragments of these polymorphisms are shown in Table MS disease (p = 0.011; OR = 1.686; 95% CI = 1.127-2.523). 2. PCR was performed in a 25 μl volume with 50 ng The RR-MS group C alleles of the SIRT1 gene rs2273773 DNA, 100 μM dNTPs, 20 pmol of each primer, 1.5 mM polymorphism were found to have a higher frequency MgCl2, 1 x PCR buffer with (NH4)2SO4 (Fermentas, December 2013 KUWAIT MEDICAL JOURNAL 315

Table 2: Primers and PCR conditions for rs7895833, rs7069102 and rs2273773 polymorphisms of SIRT1 gene.

Ann. Temp Gene Polymorphism Primers Sequence (ºC) Fragment Size (bp) 5’ - 3’

rs7895833 Forward primer 1: CCCAGGGTTCAACAAATCTATGTTG Forward primer 2: GGTGGTAAAAGGCCTACAGGAAA 64 AA; 320, 241 bp SIRT1 Reverse primer 1: GCTTCCTAATCTCCATTACGTTGAC AG; 320, 241,136 bp Reverse primer 2: CCTCCCAGTCAACGACTTTATC GG; 320, 136 bp rs7069102 Forward primer 1: GTAGCAGGAACTACAGGCCTG Forward primer 2: GAGAAGAAAGAAAGGCATAATCTCTGC 64 CC; 391, 277 bp Reverse primer 1: CTATCTGCAGAAATAATGGCTTTTCTC CG; 391, 277, 167 bp Reverse primer 2: GATCGAGACCATCCTGGCTAAG GG;391, 167 bp rs2273773 Forward primer 1: GTGTGTCGCATCCATCTAGATAC Forward primer 2: CTCTCTGTCACAAATTCATAGCCT 63 CC; 314, 228 bp Reverse primer 1: GTAGTTTTCCTTCCTTATCTGACAG CT; 314, 228, 135 bp Reverse primer 2: CTGAAGTTTACTAACCATGACACTG TT; 314, 135 bp

Table 3: Genotypes and alleles of rs7895833, rs7069102 and rs2273773 polymorphisms of SIRT1 gene and risk of developing in MS

Genotype Healthy Multiple sclerosis n (%) X2 All MS controls p - value OR All RR-MS SP-MS PP-MS n (%) (95% CI) rs7895833 G 93 (46.5) 96 (51.6) 63 (51.6) 30 (51.7) 3 (50) NS A 107 (53.5) 90 (48.4) 59 (48.4) 28 (48.3) 3 (50) NS GG 29 (29.0) 31 (33.3) 21 (34.4) 9 (31.0) 1 (33.3) NS Reference GA 35 (35.0) 34 (36.6) 21 (34.4) 12 (41.4) 1 (33.3) NS 0.90 (0.45 - 1.81) AA 36 (36.0) 28 (30.1) 19 (31.2) 8 (27.6) 1 (33.3) NS 0.72 (0.35 - 1.47) rs7069102 C 123 (61.5) 115 (62.5) 74 (61.7) 36 (62.1) 5 (83.3) NS G 77(38.5) 69 (37.5) 46 (38.3) 22 (37.9) 1 (16.7) NS CC 44 (44.0) 39 (41.9) 25(41.0) 12 (41.4) 2 (66.7) NS Reference CG 35 (35.0) 38 (40.9) 25 (41.0) 12 (41.4) 1 (33.3) NS 1.22 (0.65 - 2.29) GG 21 (21.0) 16 (17.2) 11 (18.0) 5 (17.2) 0 (0) NS 0.86 (0.39 - 1.87) rs2273773 T 112 (56.0) 80 (43.0) 48 (39.3) 30 (51.7) 2 (33.3) C 88 (44.0) 106 (57.0) 74 (60.7) 28 (48.3) 4 (66.7) 0.011(all MS) 0.004 (RR-MS) TT 32 (32.0) 23 (24.7) 13 (21.3) 10 (34.5) 0 (0) NS Reference TC 48 (48.0) 34 (36.6) 22 (36.1) 10 (34.5) 2 (66.7) NS 0.986 (0.49 - 1.97) CC 20 (20.0) 36 (38.7) 26 (42.6) 9 (31.0) 1 (33.3) 0.016 (all MS) 2.504 (1.16 - 5.38) 0.009 (RR-MS) NS = not significant; MS = Multiple sclerosis; RR-MS = relapsing-remitting MS; SP - MS = secondary progressive MS; PP - Ms = primary progressive MS

(p = 0.04; OR = 1.962; 95%CI = 1.241-3.102) compared Table 4: Haplotype analysis for rs7895833, rs7069102 and rs2273773 polymorphisms of SIRT1 gene and the risk of developing MS with the control group. Also, for the rs7895833 and rs7069102 polymorphisms of the SIRT1 gene, no All MS Controls (n = 100) significant relationship with MS disease was determined (N = 93) Haplotype n (%) OR ‡ 95% CI (p = 0.660 and p = 0.654 for all MS) (Table 3). n (%) Table 4 shows the haplotype analysis for rs7895833, GCT 25 (13.4) 49 (24.5) 1 (reference) rs7069102 and rs2273773 polymorphisms of the SIRT1 ACT 21 (11.3) 29 (14.5) 1.419 0.677-2.974 gene and the risk of developing MS. We determined GCC* 42 (22.6) 15 (7.5) 5.488 2.563-11.750 that GCC, AGT and GGC haplotypes for rs7895833, ACC 28 (15.1) 30 (15.0) 1.829 0.904-3.703 rs7069102 and rs2273773 polymorphisms of the SIRT1 GGT 10 (5.4) 18 (9.0) 1.089 0.438-2.707 AGT* 24 (12.9) 16 (8.0) 2.940 1.327-6.511 gene could be risk factors for all types of MS disease. GGC* 19 (10.2) 11 (5.5) 3.385 1.397-8.204 Also, no association with the EDSS score and haplotypes AGC 17 (9.1) 32 (16.0) 1.041 0.487-2.227 for all MS patients (p = 0.621) was shown. Fig. 1 shows the EDSS score compared with alleles and genotypes MS = Multiple sclerosis; OR = odds ratio, CI = confidence interval * These haplotypes mght be a risk factor for all MS types 316 Variant Analysis of the Sirtuin (SIRT1) Gene in Multiple Sclerosis December 2013

EDSS = Expanded disability status scale

Fig. 1: EDSS score compared with alleles (a) and genotypes (b) of rs7895833 rs7069102, and rs2273773 polymorphisms of SIRT1 gene of rs7895833, rs7069102 and rs2273773 polymorphisms DISCUSSION of the SIRT1 gene. The result of this analysis shows that In the present study, we identified that SNPs there is no association with EDSS score and rs7895833, within the SIRT1 gene were nominally associated rs7069102 and rs2273773 polymorphisms of the SIRT1 with susceptibility to MS disease. We also identified gene (p > 0.05). a haplotype consisting of the three SNPs in the SIRT1 December 2013 KUWAIT MEDICAL JOURNAL 317 gene. Also, we have found three haplotypes that had 2. Shindler KS, Ventura E, Dutt M, et al. Oral resveratrol a stronger association with MS disease. We analyzed reduces neuronal damage in a model of multiple for RR-MS, SP-MS, PP-MS and all MS with SIRT1 gene sclerosis. J Neuroophthalmol 2010; 30:328-339. rs7895833, rs7069102 and rs2273773 polymorphisms. 3. Pennisi G, Cornelius C, Cavallaro MM, et al. Redox regulation of cellular stress response in multiple We have shown that the rs2273773 polymorphism of the sclerosis. Biochem Pharmacol 2011; 82:1490-1499. SIRT1 gene might be important for MS disease. SIRT1 4. Compston A, Coles A. Multiple sclerosis. Lancet 2002; plays an important role not only in the regulation of 359:1221-1231. aging and longevity but also in the development and/ 5. Hoffjan S, Akkad DA. The genetics of multiple sclerosis: or progression of age-associated metabolic diseases, an update 2010, Molecular and Cellular Probes 2010; such as obesity, gastric cancers, diabetes, Parkinsonism 24:237-243. and MS[3,18,22-25]. 6. Witherick J, Wilkins A, Scolding N, Kemp K. It has been determined not only that axonal Mechanisms of oxidative damage in multiple sclerosis and a cell therapy approach to treatment. Autoimmune damage and neuronal loss are significant pathologic Dis 2010; 201:164608. components of MS and experimental autoimmune 7. Ziemann U, Wahl M, Hattingen E, Tumani H. encephalomyelitis (EAE) but that this neuronal Development of biomarkers for multiple sclerosis as damage is thought to cause the permanent neurologic a neurodegenerative disorder. Prog Neurobiol 2011; disability often seen in MS patients. Current treatments 95:670-685. for MS involve immunomodulation, which can reduce 8. Imai S, Armstrong CM, Kaeberlein M, Guarente L. the incidence of inflammatory relapses[26-29]. Recently, Transcriptional silencing and longevity protein Sir2 is it has been shown that the SIRT1 gene might be an NAD-dependent histone deacetylase. Nature 2000; 403:795-800. associated with MS pathogenesis. SIRT1 is emerging 9. Landry J, Sutton A, Tafrov ST, et al. The silencing as a promising target candidate for therapeutic protein SIR2 and its homologs are NAD-dependent interventions in metabolic and neurodegenerative protein deacetylases. Proc Natl Acad Sci USA 2000; [3] disorders . 97:5807-5811. Pennisi et al demonstrated an increase of Sirtuin-1 10. Smith JS, Brachmann CB, Celic I, et al. A phylogenetically (SIRT1) levels in plasma from MS patients. Therefore, conserved NAD+-dependent protein deacetylase they speculated on the protective role of this soluble activity in the Sir2 protein family. Proc Natl Acad Sci protein in MS[3]. Also, it was shown that SIRT1 USA 2000; 97:6658-6663. et al activation has great potential for preventing neuronal 11. Luo J, Nikolaev AY, Imai S, . Negative control of p53 by Sir2alpha promotes cell survival under stress. loss throughout the central nervous system in MS [30] Cell 2001; 137:137-148. disease . However, to the best of our knowledge, 12. Brunet A, Sweeney LB, Sturgill JF, et al. Stress- SIRT1 gene polymorphisms have not been investigated dependent regulation of FOXO transcription factors in MS patients. The results of our study support the by the SIRT1 deacetylase. Science 2004; 303:2011-2015. conclusions of Pennisi et al. In this situation, SIRT1 13. Kume S, Haneda M, Kanasaki K, et al. Silent information might be an effective component in battling MS regulator 2 (SIRT1) attenuates oxidative stress-induced disease. mesangial cell apoptosis via p53 deacetylation. Free Radic Biol Med 2006; 40:2175-2182. 14. de Kreutzenberg SV, Ceolotto G, Papparella I, et al. CONCLUSION Downregulation of the longevity-associated protein In this study, we found a relationship between the sirtuin 1 in insulin resistance and metabolic syndrome: rs2273773 polymorphism of the SIRT1 gene and MS potential biochemical mechanisms. Diabetes 2010; disease. In addition to this result, GCC, AGT and GGC 59:1006-1015. haplotypes for rs7895833, rs7069102 and rs2273773 15. Morris BJ. Seven sirtuins for seven deadly diseases of polymorphisms of the SIRT1 gene could be risk factors aging. Free Radic Biol Med 2013; 56:133 - 171 for all types of MS disease in the Turkish population 16. Tang BL, Chua CE. SIRT1 and neuronal diseases. Mol (Table 4). An association between SIRT1 gene Aspects Med 2008; 29:187-200. 17. Shindler KS, Ventura E, Rex TS, Elliott P, Rostami polymorphisms and MS had not been shown before A. SIRT1 activation confers neuroprotection in this study. In further studies, SIRT1 gene expression experimental optic neuritis. Invest Ophthalmol Vis Sci may be analyzed in a larger group of MS patients. Also, 2007; 48:3602-3609. additional studies are needed to clarify the role of the 18. Shimoyama Y, Mitsuda Y, Tsuruta Y, et al. Sırtuın-1 SIRT1 gene in the pathogenesis of MS disease. gene polymorphisms are associated with cholesterol metabolism and coronary artery calcification in REFERENCES Japanese hemodialysis patients. J Ren Nutr 2012; 22:114-119. 1. Lassmann H. Pathophysiology of inflammation and 19. McDonald WI, Compston A, Edan G, et al. tissue injury in multiple sclerosis: what are the targets Recommended diagnostic criteria for multiple for therapy. J Neurol Sci 2011; 306:167-169. sclerosis: guidelines from the International Panel on 318 Variant Analysis of the Sirtuin (SIRT1) Gene in Multiple Sclerosis December 2013

the diagnosis of multiple sclerosis. Ann Neurol 2001; of SIRT1 gene promoter in sporadic Parkinson’s disease. 50:121-127. Biochem Biophys Res Commun 2012; 422:693-696. 20. Calabrese V, Cornelius C, Dinkova-Kostova AT, 25. Kim YR, Kim SS, Yoo NJ, Lee SH. Frameshift mutation Calabrese EJ, Mattson MP. Cellular stress responses, of SIRT1 gene in gastric and colorectal carcinomas with the hormesis paradigm, and vitagenes: novel targets microsatellite instability. APMIS 2010; 118:81-82. for therapeutic intervention in neurodegenerative 26. Arnold AC. Evolving management of optic neuritis and disorders. Antioxid Redox Signal 2010; 13:1763-1811. multiple sclerosis. Am J Ophthalmol 2005; 139:1101- 21. Calabrese V, Cornelius C, Stella AM, Calabrese EJ. 1108. Cellular stress responses, mitostress and carnitine 27. Noseworthy JH, Lucchinetti C, Rodriguez M, insufficiencies as critical determinants in aging and Weinshenker BG. Multiple sclerosis. N Engl J Med 2000; neurodegenerative disorders: role of hormesis and 343:938-952. vitagenes. Neurochem Res 2010; 35:1880-1915. 28. Peterson JW, Bo L, Mork S, Chang A, Trapp BD. 22. Maeda S, Koya D, Araki S, et al. Association between Transected neuritis, apoptotic neurons, and reduced single nucleotide polymorphisms within genes inflammation in cortical multiple sclerosis lesions. Ann encoding sirtuin families and diabetic nephropathy Neurol 2001; 50:389-400. in Japanese subjects with type 2 diabetes. Clin Exp 29. Kornek B, Storch MK, Weissert R, et al. Multiple Nephrol 2011; 15:381-390. sclerosis and chronic autoimmune encephalomyelitis. 23. Rai E, Sharma S, Kaul S, et al. The interactive effect Am J Pathol 2000; 157:267-276. of SIRT1 promoter region polymorphism on type 2 30. Shindler KS, Ventura E, Rex TS, Elliott P, Rostami diabetes susceptibility in the North Indian population. A. SIRT1 activation confers neuroprotection in PLoS One 2012; 7:e48621. doi: 10.1371. experimental optic neuritis. Invest Ophthalmol Vis Sci 24. Zhang A, Wang H, Qin X, Pang S, Yan B. Genetic analysis 2007; 48:3602-3609. December 2013 KUWAIT MEDICAL JOURNAL 319

Original Article Acquired Multiple Clotting Factor Inhibitors in Children

Adekunle Adekile1,2, Asmaa Farag Azab1, Rajaa Marouf3,4, Sundus Al-Sharida1, Hanan Al-Abboh1 1Pediatric Hematology Unit, Department of Pediatrics, Mubarak Al-Kabeer Hospital, Kuwait 2Faculty of Medicine, Kuwait University, Kuwait 3Hematology Laboratory, Department of Pathology, Mubarak Al-Kabeer Hospital,Kuwait 4Faculty of Medicine, Kuwait University, Kuwait

Kuwait Medical Journal 2013; 45 (4): 319 - 323

ABSTRACT

Background: Acquired childhood multiple clotting factor factor deficiencies. inhibitors are rare especially in the absence of lupus Intervention: Prothrombin time (PT) and APTT assay anticoagulants. They may represent multiple specific Main Outcome Measures: Control of bleeding and inhibitors or may be non-specific, resulting from molecular normalization of coagulation factors and APTT mimicry or cross-reacting antibodies. Their exact nature and Results: The patients were aged 6 months to 8 years; three natural history are not well known. presented with mild to moderate bleeding and five had Objective: To report our experience with seven children preceding viral infections. Factor IX was decreased in all presenting with prolonged activated partial thromboplastin cases in addition to deficiencies of factors VIII, X and / or time (APTT), with or without bleeding, not corrected by XI in various combinations. There was spontaneous recovery mixing, and showing deficiency of > one clotting factor. in five patients in whom the factors and APTT normalized Design: Prospective review within two to five months. One patient died from massive Setting: Mubarak Hospital, Kuwait pulmonary hemorrhage and another with nephropathy Subjects: Patients referred to the pediatric hematology unit remains the same after two years. between 2010 and 2012 with deranged coagulation profiles Conclusion: Multiple acquired inhibitors are not uncommon with or without bleeding, without a previous or family in children, tend to follow viral infections, and are usually history of a bleeding disorder. They all had multiple clotting transient and not associated with severe bleeding.

KEY WORDS: acquired clotting factor inhibitors

INTRODUCTION that are anti-phospholipid antibodies which, although The interpretation of screening tests for coagulation they cause prolonged APTT, are not associated with disorders is not always straightforward in the pediatric bleeding, but may, in fact, cause thrombosis[6-8]. age group. This is because prothrombin time (PT) Acquired inhibitors are differentiated from inherited and activated partial thromboplastin time (APTT) factor deficiencies by the mixing study in which are usually prolonged, even in normal children and normal plasma normalizes the screening test when a reference values are not always available[1,2]. Children true deficiency exists, but fails to do so if an inhibitor may also develop clotting factor inhibitors following is present[3,5,9,10]. Appropriate factor assays are then viral infections, immunizations, autoimmune diseases carried out to identify which factor is deficient. or malignancies[3-5]. These inhibitors may be specific In the unusual situation of multiple factor (i.e., directed against a single factor) occurring either deficiencies, in the absence of lupus anticoagulant, spontaneously as in acquired hemophilia or secondary unraveling the pathogenesis is not easy and there are to previous replacement therapy (as alloantibodies). different possibilities. Some specific factor inhibitors However, they may be non-specific, in which case can cause artifactual decreases in the in-vitro levels of they are associated with multiple factor inactivation. other clotting factors[11], but on the other hand, there Quite often, this is caused by lupus anticoagulants may, indeed, be multiple specific inhibitors. Cross-

Address Correspondence to: Prof. Adekunle Adekile, Department of Pediatrics, Faculty of Medicine, Kuwait University. P O Box 24923, Safat, Kuwait 13110. Tel: +965 2 531-9486; Fax: +965 2 533-8940, E-mail: [email protected] 320 Acquired Multiple Clotting Factor Inhibitors in Children December 2013 reacting antibodies involving clotting factors sharing Coagulation factors VIII, IX, XI and XII activity were homologous epitopes may also occur. Reports of such determined by performing a modified APTT assay. multiple clotting factor deficiencies are rare in the Correction of the clotting time of the deficient plasma literature and several questions are left unanswered. is proportional to the concentration of that factor in the In particular, what are the predisposing factors? Are patient plasma. This was determined on an automated they associated with prolonged bleeding? How often coagulometer ACL 9000 (Instrumentation Laboratory and how fast do they resolve spontaneously? In the SpA - V.le Monza 338 - 20128 Milano, Italy)[12]. Normal present report we document our experience with seven values of factors VIII and XII are 50 - 150%, IX and XI patients referred to the pediatric hematology clinic of are 65 - 150%. Mubarak Al-Kabeer Hospital, Kuwait over a two-year Lupus anticoagulant (LA) was detected using two period (June 2010 – July 2012). methods - the Russell’s Viper Venom Time (American Diagnostica Inc, CT, USA) followed by automated PATIENTS AND METHODS confirmatory test on the ACL 9000 (International The Pediatric Hematology Unit of Mubarak Al- Laboratory Company, Italy, IL Test LA Screen and IL Kabeer Hospital receives referrals from the Hawalli, Test LA Confirm tests). LA Screen and LA Confirm are Adan and Capital governorates of Kuwait with a total therefore unaffected by contact factor abnormalities, population of about one million. The inclusion criteria factor VII, VIII and IX deficiencies or inhibitors[13]. for this report were: prolonged APTT, with or without All the patients had complete blood count. prolonged bleeding, that did not correct to the normal Bacteriological tests including blood cultures and range on mixing study, and with more than one virology were done in those who presented with febrile clotting factor deficiency. Patients with a significant illness. Other appropriate routine investigations were past or family history of bleeding disorder or in whom done depending on the presentation. The patients lupus anticoagulants were identified were excluded. have been followed as out-patients for varying lengths For coagulation studies, venous blood samples of time with regular monitoring of the PT and APTT. were collected in trisodium citrate. Samples were centrifuged at 2500 rpm for 15 minutes at 4 °C; platelet- RESULTS poor plasma was separated and kept frozen at -70 ºC Tables 1 and 2 summarize the presentation and until analyzed. PT and APTT were performed on an findings in the patients. automated coagulometer ACL 9000 (Instrumentation Laboratory SpA - V. le Monza 338 - 20128 Milano, Italy); Table 1: Demographics and presentation the methodology utilizes spectrophotometry, which is based on the change of light scatter associated with Patient Age Sex Bleeding at Preceding the formation of a fibrin clot[12]. According to reference (yrs) presentation illness ranges established in the local population, the normal I 0.5 F None Viremia value of PT is 10 - 13 seconds and for APTT 24 - 35 II 6.0 F None Chest infection III 2.5 F None URTI seconds. IV 0.5 M None* Viral infection In patients with prolonged PT / APTT, mixing V 0.75 F Hematoma URTI studies were performed, in which an aliquot of VI 6.0 F Ecchymoses URTI abnormal patient plasma is mixed with an equal VII 8.0 F Epistaxis None amount of normal plasma. The new mixture is retested * Patient developed massive pulmonary hemorrage as a terminal for PT / APTT. Results that were originally prolonged event due to low coagulation factor concentrations should CASE HISTORIES correct. If an inhibitor is present there will be no Patient I: A 5-month-old Egyptian female infant correction in the assay, and the PT or APTT will remain was born at 26 weeks’ gestation with a birth weight of prolonged.

Table 2: PT, APTT and clotting factor assay

Patient PT (sec) APTT (sec) APTT after mixing F VIII (%) F IX (%) F XI (%) F XII (%)

I 14.3 91.9 67.4 Normal 18.4 30.6 Normal II 14 59 53 Normal 13.9 21.3 Normal III 13.6 >180 95 10 2.2 Normal Normal IV 12 62 62 Normal 33 39 18 V 12.9 56 52 Normal 45 51 29 VI 14.7 81.9 69 1 0.79 23.5 Normal VII 15.7 96.6 90 14 9 Normal Normal

PT = prothrombin time; APTT = activated partial thromboplastin time; F = factor December 2013 KUWAIT MEDICAL JOURNAL 321

890 gm. She received mechanical ventilation because She had an uneventful neonatal period and there was of hyaline membrane disease and subsequently no previous history of prolonged bleeding. However, developed broncho-pulmonary dysplasia, one week before presentation she developed cough intraventricular hemorrhage (IVH) and retinopathy and fever. There was no family history of a bleeding of prematurity grade 2. She made good progress and disorder. recovered from the acute problems and was discharged On physical examination she looked well with no after eight weeks. However, at the age of four months, petechiae or ecchymoses or localized swelling. She she was re-admitted for lobar pneumonia with severe had unilateral subconjunctival hemorrhage. The liver respiratory distress and required ventilation. She and spleen were not palpable. Her blood counts were developed anemia and required multiple packed RBC normal with platelets of 496 x 109/l and blood film was transfusions and it was at this time that she developed normal. Serum immunoglobulins and complements deranged coagulation profile with a PT of 14.3 sec and were normal and ANA was negative. Liver profile was APTT of 91.9 sec which came down to 67.4 after mixing. normal. Virology screening was negative. PT was 13 Platelet count (259 x 109/l) and D-dimers were normal. sec, but APTT was > 3 min and on mixing was 95 sec. Clotting factor assay showed factor IX 18.4%, and Factor VIII was 10% and factor IX 2.2%. No specific XI 30.6% while the others were in the normal range. treatment was given and by the 3rd month of follow- Liver profile was normal. Serial blood cultures were up, the coagulation profile and factors were back to negative, but virology was positive for EBV and herpes normal. simplex II (blood and CSF PCR). LA was negative. Her coagulation profile normalized and by the third month, Patient IV: A 5-month-old Kuwaiti boy, a product her factor assays were back in the normal range except of preterm CS at the 35th week of gestation because of for factor IX which was marginally low at 40.7%. At the maternal eclampsia, had a birth weight of 1.750 kg. last clinic visit one year after initial presentation she He was discharged from the special care baby unit was doing well, with normal coagulation and factor (SCBU) after one month. At the age of four months, values. he was noticed to be jaundiced and severely pale. There were no dysmorphic features, no skin rash or Patient II: A 6-year-old Iraqi girl was being followed peripheral lymphadenopathy; the liver and spleen in general pediatrics since the age of two years because were not palpable. His Hb was 2.8 g/dl, reticulocytes of failure to thrive, generalized muscle wasting and of 0.4%, WBC 10.7 x 109/l and platelets 284 x 109/l. hypotonia. She had marked hepatosplenomegaly, digital The RBC morphology was normal and the blood clubbing and nephropathy. About the same time she film showed activated lymphocytes. Direct Coomb’s developed persistent coagulation profile derangement. test was negative and G6PD was not deficient. Apart Serum immunoglobulins and complements were from elevated alkaline phosphatase and conjugated normal except for elevated IgG. Autoimmune markers moderate hyperbilirubinemia, the liver transaminases – ANA, ANCA, anti-phospholipid antibodies, anti SS were not elevated. Abdominal ultrasonography was A and B were all negative. Total B cell number was low, essentially normal; skeletal survey did not show any T cell suppressor was elevated, but T cell helper was bone abnormalities. Urine organic acids and lysosomal normal. Her response to diphtheria, tetanus and PCP study were negative. A diagnosis of probable viral toxins were normal. Her serum creatinine varied from infection with reticulocytopenia was made. TORCH 80 – 100 μmol/l (normal range 35 - 62 μmol/l) and urea screening was negative. The PT was 12.2 sec, while ~9 mmol/l (normal 1.8 - 6 mmol/l). Her liver profile APTT was 62.1 without correction on mixing. Factor was normal. assay showed factor VIII of 152%, IX 33%, XI 39% Her PT was 14 sec but APTT was 58.6 sec and after and XII of 18%. He was transfused with packed mixing it came to 53 sec. Factor assay showed factor IX RBCs on several occasions. There were no petechiae, 13.9% and XI 21.3%. Von Willebrand and other clotting ecchymoses or mucosal bleeding. He was stabilized factors were normal. There was no bleeding and no and discharged from the hospital. However, after two specific treatment was given. The coagulation profile weeks, his APTT was found to be >180 sec. He was and factor assay have remained essentially unchanged readmitted and given fresh frozen plasma. However, in over two years follow-up. he developed massive acute pulmonary hemorrhage, which he did not survive. Patient III: A 21⁄2-year-old Egyptian girl developed spontaneous sub-conjunctival hemorrhage and one Patient V: A 6-month-old Filipino girl admitted episode of epistaxis for which she was referred to the with a 10-day history of coryzal symptoms and pediatric hematology clinic for investigations. She cough with respiratory distress and was diagnosed was a product of full-term pregnancy delivered by as acute bronchiolitis. While in the hospital, she had elective caesarian section (CS) because of previous CS. one episode of hematemesis. There was no previous 322 Acquired Multiple Clotting Factor Inhibitors in Children December 2013 history of bleeding and the family history was not with LA which are antiphospholipid antibodies acting contributory. She was the first child of unrelated as non-specific clotting factor inhibitors causing parents and the pregnancy and delivery were prolonged APTT, but more likely to be associated with uneventful. On examination there were no pertinent thrombosis rather than bleeding[7,8]. However, they findings, no petechiae or ecchymoses. The liver and may be specific inhibitors resulting in the reduced spleen were not palpable and there was no peripheral plasma activity of more than one coagulation factor. lymphadenopathy. Her CBC was normal with a platelet The seven patients in the present report did count of 466 x 109/l. Her PT was 13.1 sec and APTT not have a family or previous significant history was 55.7 sec and 52 sec after mixing. Factors were as of bleeding. They did not have LA and most had a follows: VIII 68%, IX 45%, XI 51% and XII 29%. LA was preceding acute illness, especially upper respiratory negative. She did not have any more bleeding and her tract infection. They were all young children with four coagulation profile normalized by the fifth month of below the age of one year and interestingly all except follow up. one were female. None presented with severe bleeding although four had mild to moderate episodes including Patient VI: A 6-year-old previously-healthy Kuwaiti epistaxis, subconjunctival hemorrhage, ecchymoses girl presented with large ecchymotic patches on both and hematemesis. None required any special measures lower limbs of three days’ duration with no associated to achieve hemostasis. However, patient no. 4 had mucous membrane bleeding or hemarthroses. There massive pulmonary hemorrhage as a terminal event. was no previous history of bleeding and the family He was the only mortality in the series. Unfortunately history was not contributory. On examination she was an autopsy was not obtained and the nature of the not ill-looking or toxic. Apart from the ecchymotic underlying problem was undetermined. patches, there were no other pertinent findings. CBC Although the number is quite small, the female was normal with platelet count of 352 x 109/l. Her preponderance in this report may be significant.Gender PT was 14.7 sec and APTT 81.9 sec and 68.2 sec after differences have long been recognized in human innate mixing. Clotting factors were: VIII 1%, IX 0.79 %, XI and adaptive immunity with females having a more 23.5%. By the 9th week of presentation the coagulation heightened response[16-19]. For this reason, females are profile and factor assays were back to normal. more prone to autoimmune diseases and this is thought to be due to genetic, hormonal and environmental Patient VII: A 71⁄2-year-old Kuwaiti girl presented factors. Since the patients in this report are mostly with one episode of epistaxis lasting for three hours infants and young children, it would appear that genes that stopped spontaneously. She developed flu-like located on the X chromosome and not sex hormones symptoms with fever four days before presentation. might be contributing to this phenomenon. She had such previous episodes but those were short Four patients had some form of infection preceding lasting. Otherwise there was no other significant past the presentation; in two patients this was a possible medical or family history. On examination, she was viral upper respiratory tract infection, while one had not ill-looking or toxic. There were no petechiae or viremia (EBV and herpes) and one had recurrent ecchymoses. The liver and spleen were not palpable. chest infection. One patient had a nephropathy of CBC was normal, with platelet count of 353 x 109/l. PT undetermined etiology. It was only two patients was 13.6 sec and APTT 95.6 sec. There was no correction who had no history of preceding infection and no on mixing and factor VIII was 14% and IX 9%. By the underlying chronic medical issues. This is consistent fourth week of presentation, the clotting factors were with previous reports that acquired clotting factor back to normal although the APTT was only marginally inhibitors, while rare, are more likely to be associated prolonged (44 sec). She has not required any treatment with infections. Common viral infections are often and is still being followed as an outpatient. associated with low-titer, polyspecific autoantibodies. These tend to be transient as in our patients, but while DISCUSSION progression to an established autoimmune disease Multiple clotting factor deficiencies are usually is possible, it is rare[20]. The underlying mechanism encountered as part of extensive acquired coagulopathy appears to be molecular mimicry between viral nuclear as in liver disease, disseminated intravascular antigens and target autoantigens especially when they coagulopathy (DIC), vitamin K deficiency or during share homologous amino acid sequences[21]. treatment with oral anticoagulants. Familial multiple The APTT ranged from 56 sec to > 3 min while the coagulation factor deficiencies are extremely rare, but PT was essentially normal in all the patients. The APTT some have been reported, usually involving factor VIII did not show any significant correction on mixing with in combination with factor V or IX[14,15]. When seen in normal plasma. Compared to the normal values for the an otherwise previously-healthy individual, it is more clotting factors in our laboratory, all the patients had likely due to non-specific inhibitors in association > 1 factor deficiency (see Table 1). The most commonly December 2013 KUWAIT MEDICAL JOURNAL 323 affected was factor IX in seven patients, XI in five,VIII in 6. Finazzi G. The epidemiology of the antiphospholipid three and XII in two patients. There was only one patient syndrome: who is at risk? Curr Rheumatol Rep in whom factor activity was ≤ 1% (0.79% for factor IX 2001;3:271-276. and 1.0% for factor VIII). In five patients, there was at 7. Galli M, Dlott J, Norbis F, et al. Lupus anticoagulants and thrombosis: clinical association of different coagulation least one factor with < 20% activity. The presentation and immunologic tests. Thromb Haemost 2000; 84:1012- was usually mild without any significant prolonged 1016. bleeding requiring active intervention. Unfortunately 8. Singh AK, Rao KP, Kizer J, et al. Lupus anticoagulants in one patient had massive pulmonary hemorrhage and children. Ann Clin Lab Sci 1988; 18:384-387. died. The contribution of his underlying illness to this 9. Chng WJ, Sum C, Kuperan P. Causes of isolated process was undetermined. The degree of deficiency in prolonged activated partial thromboplastin time in the affected factors would, indeed, suggest that we are an acute care general hospital. Singapore Med J 2005; probably dealing with multiple specific inhibitors. 46:450-456. The coagulation profile normalized in five out of 10. Ryan BR, Arkel Y, Walters TR, et al. Acquired symptomatic inhibitors of plasma clotting factors in seven patients within a few weeks to months. Two nonhemophilic children. Am J Pediatr Hematol Oncol patients still have prolonged APTT more than six 1986; 8:144-148. months after presentation, although there have been no 11. Brown BA. Hematology: Principles and Procedures. 6th bleeding episodes. They continue to be followed and ed. Philadelphia: Lea and Febiger, 1993. their antinuclear antibody status is being monitored 12. NCCLS, Document. Collection, Transport and because they may, indeed, be candidates for an Preparation of Blood Specimens for Coagulation Testing established autoimmune disease. and Performance of Coagulation Assays, 1991. 13. Thiagarajan P, Pengo V, Shapiro SS. The use of the dilute CONCLUSION Russell viper venom time for the diagnosis of lupus anticoagulants. Blood 1986; 68:869-874. Acquired multiple clotting factor inhibitors are not 14. Napolitano M, Mariani G, Lapecorella M. Hereditary uncommon in children. It affects girls more than boys, combined deficiency of the vitamin K-dependent tends to follow viral infections, is not usually associated clotting factors. Orphanet J Rare Dis 2010; 5:21. with severe bleeding and is usually transient. More 15. Robson PJ, Mumford AD. Familial multiple coagulation studies are required to understand the nature and factor deficiencies - chance associations and distinct concentration of the inhibitors and their pathogenesis. clinical disorders. Haemophilia 2009; 15:11-19. 16. Amur S, Parekh A, Mummaneni P. Sex differences and REFERENCES genomics in autoimmune diseases. J Autoimmun 2012; 38:J254-265. 1. Gallistl S, Muntean W, Leschnik B, et al. Longer aPTT 17. Pennell LM, Galligan CL, Fish EN. Sex affects immunity. values in healthy children than in adults: no single J Autoimmun 2012; 38:J282-291. cause. Thromb Res 1997; 88:355-359. 18. Pollard KM. Gender differences in autoimmunity 2. Li J, Lai X, Yan C, et al. Age-associated developmental associated with exposure to environmental factors. J changes in the activated partial thromboplastin time Autoimmun 2012; 38:J177-186. (APTT) and causes of prolonged APTT values in 19. Quintero OL, Amador-Patarroyo MJ, Montoya- et al healthy Chinese children. Clin Chem Lab Med 2009; Ortiz G, . Autoimmune disease and gender: 47:1531-1537. plausible mechanisms for the female predominance of 3. Franchini M, Lippi G, Favaloro EJ. Acquired Inhibitors autoimmunity. J Autoimmun 2012; 38:J109-119. of coagulation factors: Part II. Semin Thromb Hemost 20. Hansen KE, Arnason J, Bridges AJ. Autoantibodies and 2012; 38:447-453. common viral illnesses. Semin Arthritis Rheum 1998; 4. Moulis G, Pugnet G, Bagheri H, et al. Acquired factor 27:263-271. VIII haemophilia following influenza vaccination. Eur 21. Bazilai O, Ram M, Shoenfeld Y. Viral infection can J Clin Pharmacol 2010; 66:1069-1070. induce the production of autoantibodies. Curr Opin 5. Desposito F, Arkel Y. Inhibitors of coagulation in Rheumatol 2007; 19:636-643. children. Crit Rev Oncol Hematol 1987; 7:53-69. 324 KUWAIT MEDICAL JOURNAL December 2013

Original Article Predictors of Quality of Life in Renal Transplant Recipients

Rizna Abdul Cader, Rozita Mohd, Halim Abdul Gafor, Rafidah Mamat, Norhayati Arrifin Nephrology Unit, Department of Internal Medicine, Universiti Kebangsaan Malaysia Medical Centre, Kuala Lumpur, Malaysia

Kuwait Medical Journal 2013; 45 (4): 324 - 328

ABSTRACT

Introduction: The presence of end stage renal disease Results: Thirty nine patients (29 male, 10 female) were (ESRD) has a negative impact on patients’ quality of life enrolled. The SF-36 scores were physical functioning (47.85 (QOL). Renal transplantation is well-recognized to provide ± 6.93), role physical functioning (49.51 ± 11.08), general a better QOL than other modalities of renal replacement health (51.43 ± 6.22), vitality (60.53 ± 6.61), social functioning therapy. (50.85 ± 9.26), mental health (55.74 ± 7.16), bodily pain (58.55 Objectives: To evaluate the QOL in our renal transplant ± 7.51), role emotional functioning (49.09 ± 12.01), physical recipients and to determine the factors that influences it at component summary (49.37 ± 6.87) and mental component our institution summary (55.23 ± 6.66). Predictors of QOL were education Design: Cross-sectional observational study (p < 0.001), serum albumin (p = 0.017) and hemoglobin Setting: Universiti Kebangsaan Hospital, Malaysia (p = 0.02). Increasing age negatively impacted physical Subjects: Renal transplant recipients between 18 and 75 functioning (p = 0.029). We also found those who received a years who have been transplanted more than one year commercial transplant had a lower mental health compared Main Outcome Measure(s): QOL was assessed using the to those done locally (p = 0.031). Short Form-36 questionnaire that has been validated in the Conclusion: Predictors of QOL in our renal transplant cohort Malay language were age, education, serum albumin and hemoglobin.

KEYWORDS: albumin, education, QOL, Short Form Health Survey SF-36

INTRODUCTION type of renal transplant, serum hemoglobin and kidney The presence of end stage renal disease (ESRD) has function[4,5]. Studies have shown that Asian patients have a negative impact on patients’ quality of life (QOL). a lower QOL than their European counterparts[6,7]. It also affects their general well-being and personal There are no studies that have assessed the QOL in relationships and reduces a patients’ lifespan. One transplant patients in our local setting. QOL has been of the key features in treating patients with ESRD is shown to improve after kidney transplantation but optimising general health and well-being. It is well- kidney disease continues to impact QOL because of recognized that kidney transplantation not only offers co- morbidities and side-effects of immunosuppressive the best long term outcome but is also associated medications. The purpose of this study was to determine with a better QOL compared to dialysis[1-3]. However, the QOL in our renal transplant (RTx) patients and the kidney transplantation is not suitable for everyone and factors affecting QOL like education level, age, type of is limited by the lack of available donors. transplant, serum hemoglobin and albumin. QOL is assessed using health-related QOL questionnaires. These health-related questionnaires SUBJECTS AND METHODS measure a patients functioning and general health All RTx patients followed up at our institution were perception in three major domains: physical, screened when they attended their routine outpatient psychological and social domains. Factors affecting clinic visit. Patients were enrolled if they met the QOL in renal transplant patients include age, gender, inclusion and exclusion criteria during the three month socio-economic and educational status, co-morbidities, screening period.

Address correspondence to: Dr Rizna Abdul Cader, Nephrology Unit, Department of Internal Medicine, Universiti Kebangsaan Malaysia Medical Centre, Jalan Yaacob Latif, Bandar Tun Razak, Cheras, Kuala Lumpur 56000, Malaysia. E-mail: [email protected] December 2013 KUWAIT MEDICAL JOURNAL 325

Patients correlation coefficient was used for the association All RTx patients under follow-up at our center between QOL and clinical / laboratory variables. A p- were screened for eligibility criteria. Patients >18 and value < 0.05 was considered statistically significant. < 75 years of age and able to understand either English or Malay language were enrolled. Patients with Table 1: Socio-demographics of renal transplant recipients amputations were excluded as we could not assess Demographics Number (%) p-value their physical ability on the questionnaire. Patients Mean ± SD with malignancy, prolonged or multiple admissions to hospital were excluded. RTx patients had to be Gender 0.004 Male 29 (74.4) >1 year post-transplantation. The risk of rejection is Female 10 (25.6) highest in the first six months, they are on higher doses Race < 0.001 of steroids and most problems with infections occur Malay 8 (20.5) early on. All these would negatively impact on QOL. Chinese 25 (64.1) Indian 4 (10.3) Others 2 (5.1) Demographics and Laboratory Parameters Marital status 0.004 Demographics collected included age, gender, race, Single / Divorced 10 (25.6) socioeconomic status, co-morbidities, type of renal Married 29 (74.4) Education 0.104 transplant and laboratory parameters. All transplant Primary 5 (12.8) patients are reviewed at least on a two monthly basis Secondary 12 (30.8) and routine blood investigations are done on each Tertiary 22 (56.4) clinic visit. We took the mean of three results of serum Employment < 0.001 Employed 26 (66.7) urea and creatinine, albumin and hemoglobin (Hb) in Unemployed 2 (5.1) the preceding six months. Retired 5 (12.8) Housewife 4 (10.3) Quality of Life Student 2 (5.1) Co-morbidities QOL was evaluated using the Medical Outcomes Diabetes 5 (12.8) < 0.001 Study 36-item Short Form Health Survey (SF-36) Hypertension 18 (46.5) < 0.001 questionnaire in either English or Malay language. Transplant Type 0.337 Patients were given a choice of the language they Living related/unrelated 16 (41.0) Commercial (living /cadaveric) 23 (59.0) preferred to fill in the questionnaire which was done Age (years) 41.46 ± 11.56 when they attended their clinic visit. SF-36 was done Duration (months) 67.16 ± 35.17 once and all questions had to be answered for the Albumin (g/l) 43.85 ± 3.30 questionnaire to be valid. SF-36 contains 36 questions Urea (mmol/l) 5.14 ±1.58 Creatinine(umol/l) 103.85 ± 25.29 that are subdivided into eight dimensions: physical MDRD GFR (ml/min/1.73 m2) 71.49 ± 15.75 functioning, role limitations because of physical health Hemoglobin (g/dl ) 13.04 ± 1.31 problems, bodily pain, general health perceptions, vitality, social functioning, role limitations because MDRD GFR = Modification of diet in renal disease glomerular filtration of emotional problems and general health. These rate eight dimensions are summarized into two scales: RESULTS Physical Component Summary (PCS) score derived A total of 39 patients were enrolled. Their from physical functioning, role functioning physical, demographics are shown in Table 1. Fifty-nine vitality, bodily pain and general health perceptions percent of our transplant patients had a commercial and Mental Component Summary (MCS) score which living unrelated renal transplant. We found patients includes social functioning, role function emotional, with a living related / spousal transplants to have a mental health, vitality and general health. Scores are shorter transplant duration than the commercial living added up and range from 0 to 100 with higher scores unrelated transplants (52.99 ± 25.76 Vs 77.01 ± 37.90, denoting a better QOL. p = 0.031). There was no difference in terms of serum creatinine, MDRD GFR, albumin and hemoglobin Statistical analysis between the living related / unrelated transplants Statistical analysis was done using SPSS software compared to the commercial transplants. version 20 (SPSS Inc, Chicago, IL, USA). All numerical The SF-36 scores are shown in Table 2. There was no data were subjected to normality testing and normally difference in QOL between men and women. However, distributed data are expressed as mean ± standard we did find a significantly higher serum creatinine in deviation (SD). One way analysis of variance (ANOVA) men compared to women (109.2 ± 21.8 Vs 88.3 ± 29.3, p was used for multiple categories. Pearson’s rank = 0.022). We found no differences in QOL in those who 326 Predictors of Quality of Life in Renal Transplant Recipients December 2013

between hemoglobin and social functioning (p = 0.002), Table 2: QOL scores in renal transplant recipients role emotion (p = 0.034) and a positive trend towards QOL domain SF 36 scores mental component summary (p = 0.077), physical component summary (p = 0.075) and general health Physical functioning 47.85 ± 6.93 (p = 0.093). There was no relationship with serum Role physical functioning 49.51 ± 11.08 creatinine or MDRD GFR with any parameters of QOL Bodily pain 58.55 ± 7.51 in our study. General health 51.43 ± 6.22 Vitality 60.53 ± 6.61 DISCUSSION Social functioning 50.85 ± 9.26 QOL can be measured in several ways and we Role emotional functioning 49.09 ± 12.01 chose SF-36 as it is comprehensive and has been Mental health 55.74 ± 7.16 validated in Malay language. Renal transplantation is Physical Component Summary (PCS) 49.37 ± 6.87 associated with a better QOL and our findings concur Mental Component Summary (MCS) 55.23 ± 6.66 with others[3,8,9]. The RTx patients had higher scores in most dimensions on the SF-36 score compared to were single or married. The living related / spousal hemodialysis and peritoneal dialysis patients but transplant patients had a higher mental health score lower than the healthy Malaysian population[10-12]. RTx compared to the commercial renal transplants (58.68 ± improves QOL for several reasons including better 5.64 Vs 53.69 ± 7.50, p = 0.034). physical ability, freedom from dialysis (mentally and All the eight dimensions in QOL correlated with time saved not doing dialysis). The higher serum each other positively as expected. Age correlated hemoglobin and albumin as a result of transplantation, inversely with physical function (p = 0.029) and is better kidney function and reduced protein loss from shown in Fig. 1. Older patients had a trend towards dialysis also affect physical and mental abilities, lower physical component summary (p = 0.058). The thereby improving QOL. level of education positively correlated with physical There were more male patients in both the functioning (p < 0.001), social functioning (p = 0.024), cadaveric and live related RTx group (p = 0.004). mental health (p = 0.039), general health (p = 0.018), It is well-recognized that most live kidney donors vitality (p = 0.019) and mental component summary (p are female[13,14]. Females are more likely to donate a < 0.001). There was a correlation with type of transplant kidney than men. At least half of the RTx were done (commercial or non-commercial) and mental health (p overseas due to the low cadaveric rate of transplants = 0.031). in Malaysia and greater availability of commercial donors in certain parts of the world. The male patients had the financial ability to afford a commercial donor p = 0.029 as they were working and earning an income. Our study revealed no differences in QOL between men and women and this may be because of a significantly higher number of male transplant patients (p = 0.004). However, some studies have shown men to have a lower QOL than women[15,16]. This has been attributed to the men not being able to adapt easily to the chronic illness. Although the predominant ethnic population and dialysis population are Malays in Malaysia, we found that a higher number of Chinese patients were transplanted. This may be because of cultural reasons. Furthermore, there may be financial barriers to transplantation. Indeed when we analyzed the proportion of patients transplanted overseas, this was again predominantly Chinese. This may be because the Chinese patients went to China due to the availability Fig. 1: Inverse relationship between age and physical functioning of organs and their ability to communicate in their own Serum albumin positively correlated with general dialect. This was prior to the tightening of legislation health (p = 0.046), social function (p = 0.011) and mental for commercial transplantation. We found no effect component summary (p = 0.017) with a trend towards of marital status on QOL. Others have demonstrated role emotion (p = 0.095). There was positive correlation married patients had better QOL than single December 2013 KUWAIT MEDICAL JOURNAL 327 patients[17,18]. This can be explained by the emotional Our study has consistency, reliability and validity support received within the family environment and as all the variables correlated with each other. The this has been described as an important predictor of other strength is the homogeneity of our sample as it mental QOL especially among ESRD patients[19]. was a single center, thereby eliminating bias in terms Our study demonstrated a bias in demographics of immunosuppressive regimen. as very few diabetics received a RTx. Diabetes is the There are some limitations to our study. It was a leading cause for ESRD in Malaysia. Many diabetics cross-sectional study, therefore the QOL score was at have severe end organ damage by the time they a particular moment in time. Ideally, checking over a seek nephrology services treatment and may not be period of time is more reflective as QOLvaries with time medically suitable for a transplant especially due to and with the development of treatment complications. cardiovascular disease. We did not look at the household income as it was The living related RTx patients had a shorter difficult to get a true estimate. Not everyone wants to duration of follow-up than the commercial transplants. divulge this information and whatever is revealed is This is because our institution started doing RTx nine not truly reflective of their total household income. years ago. The association between socio-economic status and CONCLUSION health has been well documented[20-22]. We found those RTx patients had a good QOL and this was predicted with a higher education have a better QOL. One would by age, education, serum albumin and hemoglobin. expect with a higher level of education, they would be However, RTx is not easily accessible to all due to the more likely to be employed and have better paid jobs shortage of donors and excessive demand. and hence higher income. We did not assess income as many patients were not willing to divulge their REFERENCES accurate income. Our study demonstrated a strong inverse correlation 1. Al-Jumaih A, Al-Onazi K, Binsalih S, Hejaili F, Al- of age with physical function. Several studies have Sayyari A. A study of quality of life and its determinants shown that as one gets older, their QOL reduces due among hemodialysis patients using the KDQOL- to general frailty and reduced physical strength[23]. SF instrument in one center in Saudi Arabia. Arab J Nephrol Transplant 2011; 4:125-130. This holds true for transplant patients although the 2. Balaska A, Moustafellos P, Gourgiotis S, et al. Changes decrement would be lower in RTx patients than dialysis in health-related quality of life in Greek adult patients patients. Age correlated inversely with PCS and Sayin one year after successful renal transplantation. Exp et al found older age and male gender to be negative Clin Transplant 2006; 4:521-524. predictors of QOL[15]. We should therefore pay more 3. Overbeck I, Bartels M, Decker O, Harms J, Hauss J, attention to older patients and routinely offer them Fangmann J. Changes in quality of life after renal physiotherapy to build up their physical strength. transplantation. Transplant Proc 2005; 37:1618-1621. We found albumin to correlate positively 4. Politi P, Piccinelli M, Fusar-Poli P, et al. Ten years with general health and this has been previously of “extended” life: quality of life among heart transplantation survivors. Transplantation 2004; demonstrated[11]. Higher albumin levels correlated [24] 78:257-263. with higher SF-36 scores . Mingardi et al found that 5. Griva K, Ziegelmann JP, Thompson D, et al. Quality both age and albumin were independently associated of life and emotional responses in cadaver and living with physical function[23]. Albeit being the best marker, related renal transplant recipients. Nephrol Dial albumin has been used as a surrogate marker for Transplant 2002; 17:2204-2211. nutritional status, morbidity and mortality. 6. Bakewell AB, Higgins RM, Edmunds ME. Does Serum hemoglobin has been associated with ethnicity influence perceived quality of life of patients a better QOL. One would expect that with better on dialysis and following renal transplant? Nephrol hemoglobin, there would be better strength, memory Dial Transplant 2001; 16:1395-1401. 7. Sun A, Wong-Kim E, Stearman S, Chow EA. Quality of and attention[25]. Our study also demonstrated this [23] life in Chinese patients with breast cancer. Cancer 2005; fact and is in keeping with other studies . Serum 104:2952-2954. hemoglobin is also a modifiable factor which we can 8. Ogutmen B, Yildirim A, Sever MS, et al. Health- address to improve patients QOL. related quality of life after kidney transplantation in We found no differences in QOL between comparison to intermittent hemodialysis, peritoneal transplants done overseas and locally but we noticed dialysis, and normal controls. Transplant Proc 2006; that the commercial cadaveric transplants recipients 38:419-421. had a lower mental health. We believe this is due to the 9. Landreneau K, Lee K, Landreneau MD. Quality of fact that there was a trend towards them being older life in patients undergoing hemodialysis and renal transplantation - a meta-analytic review. Nephrol Nurs (p = 0.065). J 2010; 37:37-44. 328 Predictors of Quality of Life in Renal Transplant Recipients December 2013

10. Sararaks S, Azman AB, Low LL, et al. Validity and 18. Bohlke M, Nunes DL, Marini SS, Kitamura C, Andrade reliability of the SF-36: the Malaysian context. Med J M, Von-Gysel MP. Predictors of quality of life among Malaysia 2005; 60:163-179. patients on dialysis in southern Brazil. Sao Paulo Med J 11. Kalantar-Zadeh K, Kopple JD, Block G, Humphreys 2008; 126:252-256. MH. Association among SF36 quality of life measures 19. Maor Y, King M, Olmer L, Mozes B. A comparison of and nutrition, hospitalization, and mortality in three measures: the time trade-off technique, global hemodialysis. J Am Soc Nephrol 2001; 12:2797-2806. health-related quality of life and the SF-36 in dialysis 12. Guney I, Solak Y, Atalay H, et al. Comparison of effects patients. J Clin Epidemiol 2001; 54:565-570. of automated peritoneal dialysis and continuous 20. Chisholm MA, Spivey CA, Nus AV. Influence of ambulatory peritoneal dialysis on health-related economic and demographic factors on quality of life quality of life, sleep quality and depression. Haem Int in renal transplant recipients. Clin Transplant 2007; 2010; 14:515-522. 21:285-293. 13. Ghods AJ, Nasrollahzadeh D. Gender disparity in a live 21. Lordan G, Soto EJ, Brown RP, Correa-Valez I. donor renal transplantation program: assessing from Socioeconomic status and health outcomes in a cultural perspectives. Transplant Proc 2003; 35:2559- developing country. Health Econ 2012; 21:178-186. 2560. 22. Kington RS, Smith JP. Socioeconomic status and racial 14. Prasad S, Russ G, Faull R. Live donor renal and ethnic differences in functional status associated transplantation in Australia 1964-1999: an evolving with chronic diseases. Am J Public Health 1997; 87:805- practice. Intern Med J 2002; 32:569-574. 810. 15. Sayin A, Mutluay R, Sindel S. Quality of life in 23. Mingardi G, Cornalba L, Cortinovis E, Ruggiata R, hemodialysis, peritoneal dialysis, and transplantation Mosconi P, Apolone G. Health-related quality of life in patients. Transplant Proc 2007; 39:3047-3053. dialysis patients. A report from an Italian study using 16. Bakewell AB, Higgins RM, Edmunds ME. Quality of the SF-36 Health Survey. DIA-QOL Group. Nephrol life in peritoneal dialysis patients: decline over time Dial Transplant 1999; 14:1503-1510. and association with clinical outcomes. Kidney Int 24. Park HC, Lee H, Lee JP, et al. Lower residual renal 2002; 61:239-248. function is a risk factor for depression and impaired 17. Kusek JW, Greene P, Wang SR, et al. Cross-sectional health-related quality of life in Korean peritoneal study of health-related quality of life in African dialysis patients. J Korean Med Sci 2012; 27:64-71. Americans with chronic renal insufficiency: the African 25. Drueke TB, Locatelli F, Clyne N, et al. Normalization American Study of Kidney Disease and Hypertension of hemoglobin level in patients with chronic kidney Trial. Am J Kidney Dis 2002; 39:513-524. disease and anemia. N Engl J Med 2006; 355:2071-2084. December 2013 KUWAIT MEDICAL JOURNAL 329

Case Report Extraperitoneal Presentation of Pseudomyxoma Peritonei as a Pleural Effusion: A Case Report

Mohamad Abdulrahman Tayeb, Ersan Al- Zamel Hematology and Oncology Center, North West Armed Forces Hospitals, Tabuk, Kingdom of Saudi Arabia

Kuwait Medical Journal 2013; 45 (4): 329 - 331

ABSTRACT

Pseudomyxoma peritonei (PMP) can occur in the pleural differentiated mucinous adenocarcinoma of the lung who cavity presenting as pleural effusion, either as a primary progressed and developed a pleural effusion that proved to be disease of mucin producing adenocarcinomas of the lung or hemorrhagic pseudomyxoma in the pleura in the absence of as a metastasis from PMP originating in the peritoneum. We abdominal manifestations. report the case of a 64-year-old male with metastatic poorly

KEY WORDS: adenocarcinoma, lung neoplasms, peritoneal metastasis

INTRODUCTION CK20 -, CEA +, CDX2 -, PSA -, PGP9.5 -, p63 -). Work- Pseudomyxoma peritonei (PMP) is an unusual up staging was done in November 2007 that showed condition in which gelatinous fluid collections are evidence of extensive bony and suprarenal gland associated with mucinous implants on the peritoneal metastases. Patient received first line of palliative surfaces and omentum. PMP can occur in the pleural chemotherapy (cisplatin + gemcitabine), on which cavity presenting as pleural effusion, either as a he had disease progression. Subsequently, he was primary disease or metastasis from PMP[1,2]. PMP started on the second line chemotherapy (single agent, is a rare clinical manifestation of mucin producing thrice weekly docetaxel) and monthly zoledronic acid adenocarcinomas. An extensively metastasized injection. The patient achieved good partial response adenocarcinoma developed a PMP that affected not and was referred to palliative care clinic for further only the peritoneal cavity but also the pleura[1]. Extra- follow-up. On 26 March 2009, the patient was reviewed peritoneal presentations of PMP are exceedingly in ER with generalized body pain and shortness of rare[3] although there are rare cases in which the breath. On examination, the patient was alert, well adenocarcinoma of the lung is considered the origin of oriented, and apprehensive. He was not in obvious the PMP[4]. We report a case of primary pseudomyxoma distress. His vital signs were stable with an oxygen in the pleura in the absence of abdominal manifestation saturation > 95% on room air. The only significant because of its rarity and to highlight the presentation finding on examination of the chest was reduced of such cases. breath sound at the left lung field and mild abdominal distension. Blood results were acceptable. Chest Xray CASE REPORT (CXR) revealed complete left lung opacification. He A 64-year-old male, ex-smoker, a known case of was put on morphine sulphate 2.5 mg/ SC/4 hourly, COPD, and IHD, presented with hemoptysis for which and prophylactic low molecular weight heparin, and he underwent bronchoscopy with multiple biopsies other supportive measures. A couple of days later, the taken. Histopathology suggested the diagnosis of poorly patient showed face puffiness and rapid deterioration differentiated mucinous adenocarcinoma of the lung, in his chest condition manifested by gradual decrease which was confirmed by immunostains (TTF-1 +, CK7 +, in saturation and increase in shortness of breath.

Address correspondence to: Dr. Ersan Al- Zamel, MD, MSc. Registrar Clinical Oncologist , Hematology & Oncology Center, NWAFH, P O Box 100, Tabuk, Kingdom of Saudi Arabia. Tel: +966-553113285, Fax +966- 4412628, Email:[email protected] 330 Extraperitoneal Presentation of Pseudomyxoma Peritonei as a Pleural Effusion: A Case Report December 2013

Fig. 1: H and E stain of lung biopsy showing clusters of malignant Fig. 2: CT chest with contrast revealing massive left pleural effusion, cells focally forming acinar structures, and abundant extracellular left lung collapse, contralateral mediastinal shift, mild compression mucin (arrows) of the right lung and mild right pleural effusion

Fig. 3: Chest X-ray showing left hemithorax opacification deviating Fig. 4: H and E stain showing areas of abundant mucous, hemorrhagic the cardio-mediastinal complex towards the right, chest tube in situ areas, inflammatory cells, and very few malignant cells and right basal opacity

Urgent CT-CAP was done which showed massive DISCUSSION left sided pleural effusion with underlying collapse, PMP is a unique condition characterized by diffuse mediastinal shift to the right side, multiple right lung collections of gelatinous material in the abdomen and subpleural metastases and pulmonary artery and pelvis and mucinous implants on the peritoneal obstruction (tumoral thrombotic occlusion). Due to surfaces. The term PMP was originally applied to significant disease progression and patient’s poor intraperitoneal mucinous spread originating from performance status, he was considered a candidate a cystadenoma of the appendix[5] but also peritoneal for ‘do not resuscitate’ (DNR) orders. The patient’s dissemination of mucus producing adenocarcinomas status and palliative goals of the management at of the appendix, large and small bowel, lung, breast, this stage were explained fully to his family. Trial pancreas, stomach, bile ducts, gallbladder, and for thoracocentesis and chest tube insertion were fallopian tubes / ovary[6]. It may represent a pathologic done but no fluid was drained. The surgeon injected diagnostic term to both benign and malignant mucinous normal saline and thrombolytic agents (streptokinase neoplasms that produce abundant extracellular 5000 U) to dissolve any possible clots but failed to get mucin[7]. In our case, malignant process represented any drainage. The patient’s condition continued to by extracellular mucin secreting adenocarcinomas, deteriorate with low oxygen saturation (70%) till he the lung as a primary origin of pseudomyxoma was passed away. During removal of the chest tube, a huge confirmed clinically and radiologically. The lung as hemorrhagic gelatinous mass, blocking the tube, was an origin was reported in the literature but it was detected. The specimen was sent for histopathology proved to be rare process[4]. PMP is a rare clinical and was reported as PMP. manifestation of mucin producing adenocarcinomas. December 2013 KUWAIT MEDICAL JOURNAL 331

An extensively metastased adenocarcinoma developed 2. Peek DF, Beets GL. Pseudomyxoma peritonei in the a pseudomyxoma that affected not only the peritoneal pleural cavity; report of a case. Dis Colon Rectum 1999; cavity but also the pleura[1,2,8,9]. It manifests similar 42:113-115. to other pleural effusion cases but dyspnea may be 3. Al-Bozom IA. Extraperitoneal presentation of pseudomyxoma peritonei as a scrotal mass: case report the most common symptom[10]. There are no specific and review of the literature. Ann Saudi Med 2000; 298- laboratory findings to establish diagnosis but it is not 299. 20 : 297 - 299 uncommon to detect elevation of some tumor markers 4. Masahiro Kurita, Hiroshi Komatsu, Yasuo Hata, et al. [4,10] (CEA, CA 125, CA 19-9) . This finding is compatible Pseudomyxoma peritonei due to adenocarcinoma with the blood result of our patient since there was of the lung: Case report. World J Gastroenterol 1994; an elevation of CEA = 16, 6 (0 – 0.5 ng/ml), which 29:344-348. reflects the status post-disease progression as well as 5. Sugarbaker, PH, Ronnett, BM, Archer, A. Pseudomyxoma the development of PMP in the pleura. In CT imaging, peritonei syndrome. Adv Surg 1996; 30:233. the mucinous material has a similar density to fat and 6. Smith JW, Kemeny N, Caldwell C, Banner P, Sigurdson E, Huvos A. Pseudomyxoma peritonei of appendiceal has a heterogeneous appearance. Also, there was a big origin. The Memorial Sloan-Kettering Cancer Center difference in the CT density number (HU) = 23 in our experience. Cancer 1992; 70:396-401. case and the fat density (-50 to – 100). This was attributed 7. Chin-Fan Chen, Che-Jen Huang, Wan-Yi Kang, Jan- to the heterogeneity of the pleural fluid, particularly its Sing. Experience with adjuvant chemotherapy for hemorrhagic nature that is an expected consequence pseudomyxoma peritonei secondary to mucinous of malignancy and pulmonary thromboembolism. adenocarcinoma of the appendix with oxaliplatin/ Sometimes, progressive punctuate calcification can be fluorouracil/leucovorin (FOLFOX4). World J Surg found in the abdomen[11]. In our case, there were no Oncol 2008; 6:118. obvious calcifications in the CT findings; this may be 8. Maheswari S, Harrison LE. Simultaneous bicavitary hyperthermic chemo perfusion in the management of explained by the rapid growth and aggressiveness of pseudomyxoma peritonei with synchronous pleural the tumor. Involvement of the pleural cavity by PMP extension arch. Surg 2009; 144:970-972. carries an unfavorable prognosis. The age-adjusted 9. Mets T, Van Hove W, Louis H. Pseudomyxoma peritonei. five-yearsurvivalforpatientswithperitonealmucinous Report of a case with extra peritoneal metastasis and carcinomatosis is seven percent[12]. Whenever possible, invasion of the spleen. Chest 1977; 72:792-794. the same guidelines for intraabdominal disease should 10. Shuichi S, Tetsuro M, Takeshi H, et al. A case of be followed: i.e., extensive cytoreductive procedures pseudomyxoma peritonei with bilateral pleural with local and/or systemic chemotherapy[2, 8,13]. metastases. Jpn J Clin Oncol 1982; 12:117-122. 11. Jacquemin G, Laloux P. Pseudomyxoma Peritonei : Review on a cluster of peritoneal mucinous diseases. CONCLUSION Acta Chir Belg 2005; 105: 127-133. Extraperitoneal presentation of PMP as a pleural 12. Terence CC, Tristan DY, Zhu LY, Matthew DH, Gary effusion without any abdominal manifestations is very GF, David LM. Thoracic cytoreductive surgery rare. Treatment is mainly cytoreductive surgery. This and intraoperative hyperthermic intrathoracic cannot be done in many cases due to the advanced stage chemotherapy for pseudomyxoma peritonei. World J at presentation and the poor prognosis of intrathoracic Surg Oncol 2009; 99:292-295. malignancies. Overall, the prognosis is poor and the 13. Ronnett BM, Zahn CM, Kurman RJ, Kass ME, main goal of treatment is palliation. Sugarbaker PH, Shmookler BM. Disseminated peritoneal adenomucinosis and peritoneal mucinous carcinomatosis. A clinicopathologic analysis of 109 REFERENCES cases with emphasis on distinguishing pathologic features, site of origin, prognosis, and relationship to 1. Radosavljevic G, Nedeljkovic B, Kacar V. Pseudomyxoma “pseudomyxoma peritonei”. Am J Surg Pathol 1995; of the pleural and peritoneal cavities. Thorax 1993; 19:1390-1408. 48:94. 332 KUWAIT MEDICAL JOURNAL December 2013

Case Report Colobronchial Fistula as a Complication of Advanced Colorectal Cancer: A Case Report

Mohamad AbdulrahmanTayeb1, Yassin Mustafa2, Ersan Al- Zamel3 Departments of 1Hematology, 2Radiology and 3Clinical Oncology North West Armed Forces Hospitals, Tabuk, Kingdom of Saudi Arabia

Kuwait Medical Journal 2013; 45 (4): 332 -334

ABSTRACT

Colo-bronchial fistulae due to colon cancer are extremely rare fistula and severe pneumonia in a patient with advanced and associated with significant morbidity and mortality. The colorectal cancer. The aim is to add conservative therapy as treatment is surgical. We describe a case of colo-bronchial an option in cases with poor prognosis.

KEY WORDS: adenocarcinoma, bronchial fistula, colon cancer, malignancy

INTRODUCTION October 2010 to the Pulmonology clinic with a five- Colorectal cancer is a common malignancy month history of cough and left chest wall and upper throughout the world in both men and women. It abdominal pain. Clinically, there was decreased air was the most common cancer diagnosed in men and entry in the left lower lung and mild crepitations. the third most common in women in Saudi Arabia Blood work showed mild anemia with a Hb of 9.8 g / dl in 2006[1]. Several complications may arise from and elevated tumor markers (CA19 – 9 > 700 u/ml and colorectal cancer. Most of these complications arise CEA > 100 ng/ml). A chest X-ray revealed an elevated in advanced disease. The complications are bowel left diaphragm, density at the lower third of left lung obstruction, perforation, bleeding, intractable pain fieldobliteratingtheleftcostophrenicangle,clearright and rarely fistulae. pulmonary field, and distended bowels. Computed Gastrointestinal (GI) fistulae are abnormal duct tomography (CT) of the chest, abdomen and pelvis like communications between the gut and another with contrast revealed a large irregular lobulated / epithelial lined surface. It can arise from a variety multiloculated hypodense mass in the colon (splenic of etiologies including inflammatory bowel disease, flexure) invading the colon, left hemidiaphragm and surgery, radiation, trauma, and malignancy. the left lung (Fig.1, 2). It continued with thick cystic Colobronchial fistulae belong to the aforementioned wall like lesion containing small air fluid level in the group. It is a lifethreatening complication of advanced periphery of left mid-zone and some surrounding colon cancer. Surgery is the backbone of treatment as atelectasis and infiltration, left pleural reaction and soon as the diagnosis is established, but colostomy pleural thickening and small left paratracheal lymph and antibiotics may be an alternative in advanced nodes. Also seen were multiple pulmonary nodules and poor prognosis cases. of small size bilaterally (metastasis), multiple focal We report the relevant radiological and clinical lesion in the liver (metastasis) and lytic lesions in the findings in a case of colobronchial fistula as a result right side of L5 vertebral body and right iliac crest of advanced colon cancer. (metastasis). The patient underwent colonoscopy which CASE REPORT showed large growth at the splenic flexure. Multiple A 65-year-old male, ex-smoker, who was not biopsies were taken and histologic examination known to have any medical problems presented in revealed a well-differentiated adenocarcinoma.

Address correspondence to: Dr. Ersan Al- Zamel, MD, MSc, Department of Clinical Oncology, NWAFH, P O Box 100, Tabuk, Kingdom of Saudi Arabia. Tel: +966-553113285, Fax +966- 4412628, E-mail: [email protected] December 2013 KUWAIT MEDICAL JOURNAL 333

Fig. 1, and 2: Coronal view contrast enhanced CT chest and abdomen with lung and tissue windows respectively demonstrating thickening of diaphragm, splenic flexure of the colon, and continuation between colon, left pleural cavity and left lower lobe bronchus

The patient was reviewed in oncology clinic evacuated and filled with air instead (opened into as an established case of metastatic colonic bronchial tree). Patchy consolidation in the left lower adenocarcinoma (liver, lung and bone). He received lobe, right upper lobe, and the apical segment of right three cycles of palliative chemotherapy XELOX lower lobe (bronchial spread of the cavity contents) (oxaliplatin and capecitabin) regimen. Two weeks was seen. after the third cycle of chemotherapy, the patient was The patient was treated with metronidazole reviewed in emergency department with fever, loss (500 milligram three times a day), pipracillin and of appetite, constipation, dyspnea and cough with tazobactam (4.5 g three times a day) and moxifloxacin brown, malodorous sputum. On admission, physical (400 mg once a day). He was scheduled to undergo examination revealed mild pallor, cachexia, fever ileostomy, but unfortunately, the patient’s general (39.4 ºC), low breath sounds at the left lung base condition deteriorated. A chest X-ray showed diffuse and occasional rales. The general visceral systems air space consolidation in both lungs, mainly in the review, other than pulmonary was unremarkable. perihilar area consistent with aspiration pneumonia No pleural rub or wheeze was heard. The cardiac and ARDS. He became desaturated and comatosed examination was otherwise normal. There were no and succumbed two days later. palpable lymph nodes and no skeletal tenderness. The abdomen appeared unremarkable as did the DISCUSSION neurological and extremity examinations. Blood The development of a fistulabetweenthebronchial oxygen saturation on room air was 98% and an tree and abdominal organs is an uncommon event[2]. arterial blood gas analysis revealed a pH of 7.53, Abdomino-bronchial fistulae include bronchobiliary, paCO2 39 mmHg, HCO3 32 mmol/l, and pO2 of gastrobronchial, enterobronchial, colobronchial, and 100 mmHg. A chest X-ray revealed left basal lung splenobronchial fistulae[3]. Colobronchial fistulae are consolidation and distended bowels. Sputum analysis likely the rarest ones within this group[2]. showed fecal materials along with the identification Subdiaphragmatic abscesses, Crohn’s disease, of mixed colic bacterial flora and abundant presence large bowel carcinoma, appendicitis and previous of Trichomonas. CT chest, abdomen and pelvis colon surgery are the clinical conditions most often revealed the following changes in comparison to the associated with colobronchial fistulae[2]. Other previous CT study: The transverse and descending medical literature reported colobronchial fistulae as colon appeared more distended with air and fecal a consequence of rare etiology like radiotherapy[4], matter. The coronal reconstruction showed lateral peritonectomy and hyperthermic intraperitoneal defect of the left hemidiaphragm measuring 9.1 mm. chemotherapy (HIPEC)[2], tuberculosis, and after The pleuroperitoneal mass in the left lower chest and intrahepatic iridium implants for hebatoblastoma upper abdomen showed central cavitation with air- pediatric patient[5]. In most cases of colobronchial fluid levels connected to the bronchial tree. There fistula, there is a long history of chronic abdominal were no appreciable changes in the lung, bone and sepsis with a proved or suspected subphrenic liver metastases. The loculated fluid collection was abscess[6]. 334 Colobronchial Fistula as a Complication of Advanced Colorectal Cancer: Case Report December 2013

Like in our case, the splenic flexure is the most stage and poor prognosis. However, conservative frequently involved colon segment due to its cranial therapy with antibiotic administration and total location, the direct contact with diaphragm and parenteral nutrition seldom obtains spontaneous the absence of the liver that plays a protective role resolution of the fistula[2]. towards the right hemidiaphragm[2]. The clinical picture is characterized by recurrent CONCLUSION pulmonary infections, respiratory failure and cough Colobronchial fistula with underlying advanced with dark and feculent sputum. The symptom of colon cancer markedly increases patient morbidity fecoptysis may be the presenting feature of colonic and mortality. Unlike other fistulae etiologies, carcinoma[7]. This was the case with our patient. majority of cases which do not respond to systemic The diagnosis of colobronchial fistula is often therapy may not be fit for aggressive interventions. insidious. Physical and microbiological analyses of the expectorated sputa may be of help[2].The diagnosis REFERENCES is usually, but not always, confirmed by barium enema, although this may be dangerous: in two 1. Saudi Cancer Registry/ Cancer Incidence Report patients rapid deterioration followed reflux of fecal Saudi Arabia 2006. matter into the lungs and this may have contributed 2. Laterza B, Baratti D, Cozzi G, et al. Colobronchial to the deaths of two others. Bronchography might be fistula: An unusual complication after peritonectomy [6] and hyperthermic intra-peritoneal chemotherapy considered as alternative diagnostic procedure . A (HIPEC). In Vivo 2009; 23:151-153. double-lumen tube (DLT) and isolated single-lung 3. Heitmiller RF, Yeo CJ. Duodenobronchial fistula. ventilation causing abdominal distension can assist Surgery 1991; 110:546-548. in the diagnosis and localization of the fistula[5]. None 4. MacKay GC, Howells J, Poon FW. Colobronchial of these procedures were done since the condition fistula: a late complication of childhood radiotherapy. of the patient was unstable and the CT findings Br J Radiol 2006; 79:170-172. demonstrated the fistula. Contrast-enhanced CT may 5. Eltzschig HK, Palmer G, Brustowicz R. Colobronchial be considered a surrogate to barium enema when it fistula in a pediatric patient: diagnostic value of reveals a clear communication between the colon and isolated single-lung ventilation and intraoperative [8] use of high frequency oscillatory ventilation. Anesth the bronchial space . Analg 2002; 95:621-623. Colobronchial fistula often requires surgical 6. Ashley S, Corlett SK, Windle R, Cookson JB. treatment with resection of the involved colic segment Colobronchial fistula: a late complication of and sometimes pulmonary lobectomy[2]. In some appendicitis. Thorax 1988; 43:420-421. cases fecal diversion may be required[6]. Anesthesia 7. Winocour PH, Wilson LM, Breckon K, Reeve RS, for patients with colobronchial fistulae represents Moriarty KJ. Faecoptysis as the presenting symptom an indication for endobronchial intubation and one- of colonic carcinoma. J R Soc Med 1989; 82:441. lung anesthesia[9]. 8. Alameel T, MacLean DA, Macdougall R. Colobronchial In treating this condition, our patient was fistula presenting with persistent pneumonia in a patient with Crohn’s disease: a case report. Cases J considered unfit for such procedures and was 2009; 2:9114. prepared for ileostomy diversion only along with 9. Swerdlow B, Jenkins JG. Anaesthesia for colobronchial antibiotic coverage because of the advanced tumor fistula: a case report. Anaesthesia 1985; 40:42-44. December 2013 KUWAIT MEDICAL JOURNAL 335

Case Report Gamma Knife Radiosurgery for Recurrent Anaplastic Ependymoma with Intracranial Disseminations: A Case Report

Aftab A Khan, Hasan Khajah, Yousef Al Awadi Kuwait Gamma Knife Center, Department of Neurological Surgery, Ibn Sina Hospital, Kuwait

Kuwait Medical Journal 2013; 45 (4): 335 - 338

ABSTRACT

Intracranial ependymomas are relatively rare type of dissemination. Clinically, the patient was asymptomatic. We gliomas which have high recurrence rates after multimodal managed her with gamma knife radiosurgery at our center. therapy with surgery, fractionated radiation therapy and The recurrent ependymoma along with four intracranial chemotherapy. We report the case of a 15-year-old girl disseminations were defined with gamma plan and a with recurrent anaplastic ependymoma (WHO grade III) prescription dose of 16 Gy was delivered to the mean target who underwent multiple surgical excisions for a right volume of 1.56 ml (range 0.159 - 5.7 ml) with a mean isodose temporoparietal tumor in 1998, followed by fractionated line of 54.3% (range 50 - 65%). Images on post-radiosurgery radiation therapy and chemotherapy. Eleven years follow-up at 21 months revealed complete remission of the after initial treatment, follow-up imaging of the brain recurrent ependymoma and significant decrease in size of demonstrated tumor recurrence with multiple intracranial all disseminations.

KEY WORDS: cerebrospinal dissemination, ependymoma, stereotactic radiosurgery

INTRODUCTION in 40 - 70% of patients. The extent of tumor resection Ependymomas represent 5 - 6% of primary and control of local recurrences are the main factors intracranial neoplasms developing in adults and 8 - 13% affecting the treatment outcome[6]. Cerebrospinal of all pediatric brain tumors[1,2]. Ependymomas have dissemination occurs in approximately 13% of patients aggressive behavior, regardless of their histological and high grade anaplastic ependymomas have more grade according to World Health Organization (WHO) propensity to disseminate few years after the initial classification[3]. The standard treatment strategy diagnosis[1,7]. Stereotactic radiosurgery (SRS) is a non- for ependymomas comprises of complete surgical invasive technique that may be helpful for controlling resection, fractionated radiation therapy (RT) and the ependymoma involving the crucial structures chemotherapy. Surgery often results in subtotal removal and SRS may minimize the number of direct surgical because of their critical locations. Ependymomas interventions required for controlling the lesion. Our are considered to be relatively radiosensitive and case report appraises the literature on the efficacy of various types of radiation therapy such as fractionated this technique for the treatment of recurrent anaplastic RT, fractionated stereotactic RT and cranio-spinal ependymoma with intracranial dissemination. irradiation have been used and seem to increase the survival period and delay recurrence for several CASE REPORT years[4]. Chemotherapy has not yielded a significant History: A 14-year-old girl presented to pediatric role in survival of patients but children with subtotal emergency with severe headaches and persistent resected ependymomas have been treated in attempt to vomiting 12 years ago in 1998. After initial avoid deleterious effects of RT and have shown good management, magnetic resonance imaging (MRI) of results[5]. Recurrent disease develops within five years the brain demonstrated a large enhancing lesion in

Address correspondence to: Dr. Aftab Khan, MD, Kuwait Gamma Knife Center, Ibn Sina Hospital, P O Box, 25427, Safat 13115, Kuwait. Tel: (965) 6583 0441, Fax: (965) 243 80319, E-mail: [email protected] 336 Gamma Knife Radiosurgery for Recurrent Anaplastic Ependymoma with Intracranial ... December 2013

Fig. 1: Axial T1- weighted, MR images of a 14-year-old girl showing recurrent ependymoma in the right temporoparietal region at three sites and intracranial disseminations at four sites. The prescription dose of 16 Gy was delivered to the margin of mean target volumes of 1.56 ml to mean isodose line of 54.3%. the right temporoparietal region with mass effect. The with stereotactic radiosurgery. We advised the patient underwent total surgical excision of the tumor. patient to repeat biopsy of the tumor for appropriate Histopathology revealed anaplastic ependymoma management of the disease but the patient refused for (WHO grade III). Cerebrospinal fluid (CSF) cytology any invasive intervention. So we decided to treat her was negative on the onset of disease. After surgery, the with gamma knife radiosurgery on the basis of previous patient received fractionated RT and chemotherapy. histopathology report. Clinically, she was alert and The patient had unremarkable status in the following oriented. Karnofsky Performance Score (KPS) was 100. years. After seven years of initial management, at the All intracranial nerves were intact. Motor and sensory age of 11 years, she was brought again to emergency systems were normal. There were no cerebellar signs. with same complaints. A MRI brain discovered tumor All other systems were unremarkable. recurrence with marked surrounding edema. She underwent radiosurgery and was advised to repeat Treatment: After admission in gamma suit, the fractionated RT which she refused. Serial follow-up procedure started with an application of Leksell images showed no residual lesion except localized stereotactic frame under local anesthesia and focal gliosis and necrosis and diffuse deep white intravenous conscious sedation. The patient matter chronic radiation sequelae. Positron Emission underwent high resolution 3-dimensional MRI brain Tomography (PET) scan demonstrated findings that with gadolinium enhancement and the fiducials were were highly suspicious for local recurrence in the checked. Images were exported to the gamma knife right posterior parietal lobe at the surgical bed. After computer for dose planning through Dicom software four years of repeat-surgical-excision of the tumor, a system. A gamma plan was prepared after defining follow-up MRI brain revealed tumor recurrence with the target areas on MR images of the brain using the multiple intracranial disseminations. There was no Leksell gamma plan (LGP®) software). The targets evidence of seedings in the spinal cord. Clinically, were an enhancing recurrent ependymoma with four the patient was asymptomatic and was advised to small disseminations in different locations of the brain undergo fractionated RT and chemotherapy which (Fig. 1): one in the right frontal horn of the lateral she refused and was referred to us for management ventricle, one in the left frontal horn; one in the mid

Fig. 2: Axial T1- weighted, post-radio surgery follow-up images of the same patient at 6 and 18 month intervals, showing complete remission of recurrent ependymoma and significant reduction in sizes of all intracranial disseminations. December 2013 KUWAIT MEDICAL JOURNAL 337 part of the 3rd ventricle and one at the left aspect of and 23% patients had spinal seedings. Follow-up the 4th ventricle. The mean target volume was 1.56 ml results showed the overall survival rates of 60%, 36% (range 0.159 - 5.7 ml). The mean prescription dose was and 32% at 1, 3 and 5 years after gamma knife and the 16 Gy with a mean isodose line of 54.3% (range 50 - progression-free survival rates of 81.6%, 45.8%, and 65%). The mean number of isocenters was 3.3 (range 45.8% respectively. 1 - 8), used to formulate a conformal radiosurgery dose Stafford et al[11] reported a series of patients with 17 plan. Stereotactic radiosurgery was performed with recurrent ependymomas at Mayo clinic, treated with 201 sources of cobalt-60, using Leksell Gamma Knife, radiosurgery after primary management with surgery Model 4-C (Elekta Instruments AB). After completion and fractionated RT. The median overall survival of the procedure, stereotactic frame was removed and rate was 3.4 years (range, 1.4 - 5 years) at the median the patient was given intravenous methylprednisolone follow-up of 22.5 months (range, 2.5 - 60 months). to avoid any acute adverse radiation effect. The patient In our case, the patient was initially managed with was discharged from the hospital on the same day. multiple surgical excisions of the tumor, fractionated RT and chemotherapy and after seven years of initial Follow-up: The follow-up period of this patient was management, she had recurrence and underwent redo 20 months. Imaging was achieved at 6 and 18 month surgery but refused for fractionated RT. Four years intervals after radiosurgery which revealed complete later, she had a recurrence again with intracranial remission of the recurrent tumor and significant disseminations. Endo et al[12] reported two cases of reduction in size of all the disseminations (Fig. 2). The intracranial anaplastic ependymomas with nodular patient is in a good clinical condition. disseminations managed by repeated gamma knife radiosurgery that resulted in tumor control over 21 DISCUSSION months. We have managed this case with gamma Complete surgical excision is still the basis knife radiosurgery as an adjuvant therapy for of treatment for intracranial ependymomas as recurrent ependymoma and primary mode for small an initial mode of management[8]. Residual or disseminations. Post-radiosurgery follow-up images recurrent ependymomas can be managed with demonstrated very good results for the earlier treated adjuvant therapies like cranio-spinal fractionated targets with gamma knife but new disseminations RT, chemotherapy and stereotactic radiosurgery. appeared beyond the previous radiosurgery fields. In spite of the development of all these techniques, It indicates that despite relatively good local control recurrence is still a big issue. Subtotal resection, of recurrent ependymoma after radiosurgery, the young age of the patient, location, and high grade incidence of disseminations is high and shows the anaplastic ependymomas are the factors responsible failure in primary management. Radiosurgery as for recurrence and cerebrospinal disseminations[4,7]. a boost, in combination with surgery, fractionated The extent of the resection is the key prognostic factor RT and chemotherapy would prevent local failure and location of the tumor determines the extent to and therefore, prevent the need for any salvage or which tumor removal is possible. Local field RT may palliative strategies. be more effective than whole brain radiation therapy (WBRT). After failed initial treatment, stereotactic CONCLUSIONS radiosurgery may be the only potentially effective Total surgical excision, followed by postoperative management strategy that remains. Although few fractionated RT and chemotherapy is the standard reports have been published on the management therapeutic approach in ependymoma treatment of recurrent ependymomas with radiosurgery, yet but stereotactic radiosurgery has proved to be an results are encouraging. Stereotactic radiosurgery can effective and safe treatment in combination with also be used as a boost after surgical excision and post- other multimodal therapies. A longer follow-up and operative fractionated RT and has shown excellent additional experience with more number of patients is results of progression-free survival as compared to necessary to evaluate the total survival and progression- the patients who were treated with radiosurgery as free survival rates. a salvage mode after failure of all other treatment modalities[9]. Kano et al[10] published a series of 39 REFERENCES patients with 56 intracranial ependymomas of different grades treated with gamma knife radiosurgery at the 1. Duffner PK, Cohen ME, Freeman AI. Pediatric brain University of Pittsburgh. All patients had undergone tumors: an overview. Cancer 1985; 35:287-301. surgery and fractionated RT while 14 patients had an 2. Wiestler OD, Schiffer D, Coons SW, Prayson RA, Rosenblum MK. Ependymoma. In Kleihues P, Cavenee additional treatment with chemotherapy. Thirty six WK, editors: Tumors of the Nervous System. Lyon, percent of the patients had intracranial disseminations IARC 2000; 72-76. 338 Gamma Knife Radiosurgery for Recurrent Anaplastic Ependymoma with Intracranial ... December 2013

3. Ernestus RI, Schröder R, Stützer H, Klug N. The reoperation, and outcome. Childs Nerv Syst 2005; clinical and prognostic relevance of grading in 21:221-226. intracranial ependymomas. Br J Neurosurg 1997; 9. Lo SS, Abdulrahman R, Desrosiers PM, et al. The role 11:421-428. of Gamma Knife Radiosurgery in the management of 4. Sanford RA, Gajjar A. Ependymomas. Clin Neurosurg unresectable gross disease or gross residual disease after 1997; 44: 559-570. surgery in ependymoma. J Neurooncol 2006; 79:51-56. 5. Evans AE, Anderson JR, Lefkowitz-Boudreaux IB, Finlay 10. Kano H, Niranjan A, Kondziolka D, Flickinger JC, JL. Adjuvant chemotherapy of childhood posterior Lunsford LD: Outcome predictors for intracranial fossa ependymoma: cranio-spinal irradiation with or ependymoma radiosurgery. Neurosurgery 2009; 64:279- without adjuvant CCNU, vincristine, and prednisone: 287. Children’s Cancer Group study. Med Pediatr Oncol 11. Stafford SL, Pollock BE, Foote RL, Gorman DA, Nelson 1996; 27:8-14. DF, Schomberg PJ. Stereotactic radiosurgery for 6. Pollack IF, Gerszten PC, Martinez AJ, et al. Intracranial recurrent ependymoma. Cancer 2000; 88:870-875. ependymomas of childhood: Long term outcome and 12. Endo H, Kumabe T, Jokura H, Shirane R, Tominaga T. prognostic factors. Neurosurgery1995; 37:655-667. Stereotactic radiosurgery for nodular dissemination of 7. Rezai AR, Woo HH, Lee M, Cohen H, Zagzag D, Epstein anaplastic ependymoma. Acta Neurochir (Wien) 2004; FJ. Disseminated ependymoma of the central nervous 146:291-298. system. J Neurosurg 1996; 85:618-624. 8. Vinchon M, Leblond P, Noudel R, Dhellemmes P. Intracranial ependymomas in childhood: Recurrence, December 2013 KUWAIT MEDICAL JOURNAL 339

Case Report Isolated Pancreatic Tuberculosis: A Medical Disease Causing Surgical Dilemmas: Case Report and Review of Literature

Mohammed Nabil Y M Riyad, Mohammed Alaa Sallam, Mohammed Sulaiman Hana Department of Surgery, Al-Jahra Hospital, Kuwait

Kuwait Medical Journal 2013; 45 (4): 339 - 343

ABSTRACT

Tuberculosis (TB) affecting the pancreas is rare even in thus obviating the need for unnecessary surgery (laparotomy endemic countries for tuberculosis. The occurrence may pose / laparoscopy) with its accompanying morbidity. The a diagnostic problem in differentiating it from carcinoma patient’s response to antituberculous drugs (quadruple of the pancreas. Clinical examination, laboratory data therapy) was excellent. TB should be considered in the and imaging are all non-specific. Diagnosis is frequently differential diagnosis of a pancreatic mass and most patients misguided towards neoplasia requiring surgical intervention. have an excellent response to standard antituberculous We present one case of isolated pancreatic tuberculosis that regimen. Thus, maintaining a high index of suspicion can was diagnosed by CT guided fine needle aspiration cytology assist in avoiding unnecessary laparotomies. We report this (FNAC) illustrating the value of FNAC in such a situation, case as it is rare along with review of relevant literature.

KEY WORDS: antituberculous regimen, fine needle aspiration, Mycobacterium tuberculosis

INTRODUCTION patients, originating mostly from developing Tuberculosis (TB) is a major health problem with countries[3]. In a large proportion of these cases there an increasing case load of both its pulmonary and is neither concomitant disease elsewhere, nor evidence extra-pulmonary forms worldwide[1,2]. TB is common of miliary dissemination[3 - 5]. in developing countries but that affecting the intra- We report here a case of isolated primary pancreatic abdominal organs is relatively uncommon[1,2]. TB in a 28-year-old man from Kuwait and also review The incidence varies from country to country[1,2]. the relevant literature. In general hospital admissions, the percentage of patients admitted for abdominal tuberculosis has been CASE REPORT reported as a 0.8% in Delhi, and 0.28% in Beirut[3]. A 28-year-old male citizen of Kuwait was admitted Abdominal TB commonly affects the spleen, liver, to our department with acute upper abdominal pain, ileococeal region, peritoneum and lymph nodes[4]. vomiting and jaundice of few days duration. There Pancreatic and peripancreatic TB seem to be rare was a history of weight loss of around 10 kg over the and poses diagnostic dilemma to the attending previous three months without fever, respiratory or physicians[3-5]. Most published papers are in the form abdominal symptoms. His past medical history was of case reports[5]. TB of the pancreas is considered a unremarkable for chronic disease or hospitalization. rare entity in developed countries mostly in the setting He denied any foreign travel and had no risk factors of acquired immune deficiency syndrome (AIDS) for human immunodeficiency virus (HIV) infection. epidemic or immunosuppression for transplantation His physical examination revealed jaundice and mild with wide spread use of immunosuppressant drugs[4]. tenderness in the right hypochondrium, but otherwise Nevertheless there has been an increase in the number was unremarkable with clear chest and no palpable of cases reported involving immunocompetent abdominal masses. He was afebrile with normal vital

Address correspondence to: Dr.Mohamed Nabil YM Riyad, MBChB, MSc, FRCSEd, FICS, ISS, RSM. Specialist, Department of Surgery, Al-Jahra Hospital, Kuwait. P O Box 40295, Al-Qasr 01753, Al-Jahra, Kuwait. Tel: 00965 99549778, Fax: 00965 24556220, E-mail: [email protected] 340 Isolated Pancreatic Tuberculosis: A Medical Disease Causing Surgical Dilemmas... December 2013

Fig. 1: US abdomen showing a hypoechoic irregular mass 40 x 33 Fig. 2: CT of abdomen showing a heterogeneous mass in the head mm in the head of pancreas with compression of the distal end of of pancreas CBD as well as dilatation of the CHD and IHBD. transpeptidase (GGT) 390 IU/l. He showed a normal kidney function and normal coagulation profile. His X- ray chest was normal. Abdominal ultrasound showed a hypoechoic irregular mass 40 x 33 mm in the head of the pancreas with compression of the distal third of the common bile duct (CBD) as well as dilatation of the common hepatic duct (CHD) and intra-hepatic bile duct (IHBD) (Fig. 1). His gall bladder (GB) was normal with no calculi. Computed tomography (CT) scan of the abdomen (Fig. 2) confirmed the presence of a necrotizing mass in the head of pancreas with tiny retropancreatic lymph nodes. Tumor markers CA19-9, CEA and AFP were normal. An endoscopic retrograde cholangio pancreatography (ERCP) (Fig. 3) done, showed a stricture of the distal CBD with dilatation of the biliary tree above it. A papillotomy done with brush cytology was reported as benign. Percutaneous CT guided fine needle aspiration

Fig. 3: ERCP showing a stricture of the distal common bile duct with dilatation of the biliary tree. No stones were detected and gall bladder was normal. signs. Stigmata of hepatic insufficiency were not seen. His hemoglobin was 120 g/l, his white blood cell count was 7.5 x 109/l and erythrocyte sedimentation rate (ESR) was 120 mm/hr for the first hour. He had a biochemical picture of obstructive jaundice with raised alkaline phosphatase (ALP) 160 IU/l, total bilirubin 58 Fig. 4: Percutaneous CT guided FNAC of the pancreatic mass ummol/l, direct bilirubin 36 umol/l, total protein 70 g/ revealed multiple granulomas with areas of caseating necrosis l, albumin 36 g/l, alanine transaminase (ALT) 252 IU/l, and clusters of multinucleated giant cells, lymphocytes and aspartate transaminase (AST) 144 IU/l and gammaglutaryl polymorphs. December 2013 KUWAIT MEDICAL JOURNAL 341

case of pancreatic TB[8]. Franco-Paredes et al reported two cases of pancreatic TB and reviewed the current literature involving pancreatic TB among non-immune suppressed individuals[9]. The authors documented 50 cases of pancreatic TB between 1980 and 2002[10]. Eric and colleagues identified 25 additional cases of pancreatic TB that presented as pancreatic masses[10]. In the Chinese language literature there are more than 70 cases of pancreatic TB described[5]. Abdominal TB in its diverse forms still affects the indigenous as well as expatriate population of Kuwait[11-12]. The pathogenesis of pancreatic tuberculosis is inconclusive because most cases are in the absence of any detectable lesions in other parts of the body[13]. It is speculated that the tubercle bacilli reach the pancreas through: 1) pancreatic Fig. 5: Follow-up CT scan of the abdomen was done six years later involvement during miliary disease, 2) hematogenic showing total resolution of the pancreatic lesion dissemination from an occult site elsewhere (possibly the lungs) and 3) direct spread from contiguous lymph nodes[14]. Stock et al in 1981 conceived of the cytology (FNAC) (Fig. 4) was done which showed a toxic allergic reaction to generalized tuberculosis as granulomatous inflammation with necrosis, necrotic a theoretical mechanism[15]. However, there is little in debris, clusters of epithilioid cells, multinucleated the literature to support this view[16]. Pancreatic TB giant cells, lymphocytes and polymorphs. Smear for could present with protean clinical manifestations, acid fast bacilli (AFB) were negative for Mycobacterium including upper abdominal pain, pyrexia of unknown tuberculosis. Cultures sent for six weeks confirmed the origin, ascites, abdominal mass, obstructive jaundice, diagnosis of Mycobacterium tuberculosis. A tubercle acute or chronic pancreatitis, upper gastrointestinal skin test was carried out and was strongly positive. hemorrhage due to splenic vein thrombosis, diarrhea, In view of the previous findings, antituberculous weight loss and colonic perforation[17-18]. Our patient, treatment in the form of pyrazinamide 0.5 g three presented with vague upper abdominal pain, vomiting, times daily, rifampicin 600 mg once daily , ethambutol obstructive jaundice and weight loss. The nonspecific 400 mg three times daily, isoniazid 300 g once daily for clinical and laboratory investigations in combination two months was prescribed and further therapy with with pancreatic mass on CT scan frequently lead ten additional months of isoniazid and rifampicin at to an erroneous primary diagnosis of a carcinoma, the previous doses was recommended. The patient did cystadenocarcinoma, or pseudocyst[3,10]. In china, Feng well and his symptoms were relieved. Five months Xia et al[5] reviewed literature and revealed several later, a repeat CT scan of the abdomen revealed a characteristics of pancreatic TB as follows: 1) pancreatic complete resolution of the pancreatic lesion (Fig. 5). At TB is mostly found in young people, especially females a six-year follow-up, the patient is living a normal life (our patient was a young male) while pancreatic tumor free of symptoms and has regained his lost weight. is most common in old person, 2) some patients have a history of TB in the past and most often come from DISCUSSION areas having high incidence of active TB (our patient Although TB often occurs in the lungs, primary had no history of tuberculosis in past and also did not abdominal TB is not uncommon. However, the travel to an endemic zone, as well, he was a citizen prevalence of abdominal TB in developing countries of Kuwait which is a non-endemic area for TB), 3) the has been estimated to be as high as 12%[1-2]. The patients often present with epigastric pain, fever and development of abdominal TB is independent of weight loss, (our patient presented with epigastric pulmonary disease in most patients[3], with the pain, vomiting, weight loss and obstructive jaundice) repeated incidence of coexisting disease varying from and 4) ultrasound and CT scan show pancreatic 5% to 38%[4]. However, the involvement of pancreas is mass and peripancreatic nodules (as was seen in our rare[5]. Auerbach reported in 1944 a rate of pancreatic patient), some with calcifications. Sinan et al reviewed involvement in only 4.7% of 297 autopsies on patients the CT characteristics of abdominal TB and the most with miliary tuberculosis[6]. Paraf et al reported a 2.1% common features were peritoneal involvement and rate of pancreatic involvement in 256 patients with lymphadenopathy[14]. In contrast to noninvasive miliary tuberculosis[7]. Bhansali reviewed 300 cases techniques, invasive diagnostic techniques can be used of abdominal TB in India over 12 years and found no to obtain tissue for microbiological and pathological 342 Isolated Pancreatic Tuberculosis: A Medical Disease Causing Surgical Dilemmas... December 2013 examination[19]. Techniques for biopsy include of more diagnostic modalities such as endoscopic endoscopic ultrasound guided biopsy, CT / ultrasound ultrasonography guided, or percutaneous CT / guided percutaneous FNAC[19-20] and surgical biopsy ultrasonography guided FNAC of the pancreatic (laparotomy or laparoscopy)[21]. Unfortunately, in lesion can confirm the diagnosis. Thus, unnecessary most cases in the literature, the diagnosis of pancreatic exploratory laparotomy or pancreatic resection can TB was made only after exploratory laparotomy[3] or be avoided. In addition, the disease can be effectively at necropsy[6]. Fine needle aspiration of the mass to treated with antituberculous drugs. obtain a proof for tubercle bacilli by Ziehl-Neelsen stain showed to be positive only in 33 - 41% of cases REFERENCES of abdominal TB[19]. (It was negative in our case). That is why, prolonged culture for 4 – 6 weeks is required 1. Raviglione MC, Snider DE Jr, Kochi A. Global and is positive in 60 - 70% of cases[21](It was positive in epidemiology of tuberculosis: morbidity and mortality our case in six weeks). For those in whom the bacterial of a worldwide epidemic. JAMA 995; 273:220-226. cultures were negative, the polymerase chain reaction 2. Frieden TR, Sterling TR, Munsiff SS, Watt CJ, Dye C. [12] Tuberculosis. Lancet 2003; 362:1887-1889. (PCR) was reported sometimes useful . Even in a 3. Felekouras E, Karavokyros JG, Griniatos J, Kouraklis nonendemic region like Kuwait, pancreatic TB should G, Diamantis T, Bastonis E. Pancreatic tuberculosis: A be considered in the differential diagnosis of a mass in medical disease posing surgical dilemmas. Int Surg J the head of pancreas causing obstructive jaundice[12], 2006; 91:168-173. especially in the young[5]. Once the diagnosis has been 4. Jaber B, Gleckman R. Tuberculous pancreatic abscess as made, the management rests on the medical treatment[3- an initial AIDS-defining disorder in a patient infected 5,10-12,22]. In most literature, medical management of with the human immunodeficiency virus: case report pancreatic TB generally consists of isoniazide and and review of literature. Clin infect Dis 1995; 20:890- rifampicin with pyrizinamide and ethambutol[3- 894. 5,10-12,22] 5. Xia F, Poon RT, Wang SG, Bie P, Huang XQ, Dong JH. . The response to therapy is predictable and Tuberculosis of pancreas and peripancreatic lymph complete. The recommended duration of therapy is 6 nodes in immunocomptent patients: experience from [22] - 12 months . Our patient received treatment in the China. World J Gastroenterol 2003; 9:1361-1364. form of pyrizinamide, rifampicin, ethambutol, and 6. Auerbach O. Acute generalized military tuberculosis. isoniazid for two months and completed therapy with Am J Pathol 1944; 20:121-136. ten additional months of isoniazid and rifampicin. He 7. Paraf A, Menager C, Toxier J. Tuberculosis of the did well, with relief of symptoms. Five months later, pancreas and tuberculosis of the lymph nodes of the a repeat CT scan of the abdomen revealed a complete upper region of the abdomen. Rev Med Chir Mal Foie resolution of the pancreatic lesion. In one series, the 1966; 41:101-126. [5] 8. Bhansali SK. Abdominal tuberculosis: experience with mean time to radiologic resolution was 132 days . 300 cases. Am J Gastroenterol 1977; 67:324-327. Longer duration of treatment results in higher costs 9. Franco-Pareds C, Leonardo M,Jurado R, Blumberg [22] and exposes patients to more side effects . Usually HM, Smith RM. Tuberculosis of the pancreas: report of no surgical intervention is necessary and recurrences two cases and review of the literature. Am J Med Sci are rare[22]. Even after six years our patient was doing 2003; 323:54-58. well, living a normal life, free of symptom and has 10. Eric S, Walter HK, Charles Y. Peripancreatic tuberculosis regained lost weight. However, patients with evidence mimicking pancreatic neoplasia.J Gastrointest Surg of biliary obstruction would need either endoscopic or 2005; 9:254-262. surgical intervention to relieve the obstruction as the 11. Walia HS, Khafagy AR, Al-Sayer HM, Walia HK, Al-Nakib B, Sivanadan R. Unusual presentation of ductal narrowing might persist despite treatment with [3-16] abdominal tuberculosis. Can J Surg 1994; 37:300-306. antituberculous drugs . Our patient had endoscopic 12. Riad ARA, Azfar M, Al-Jar Allah MA. Isolated retrograde cholangio-pancreatography (ERCP) with pancreatic tuberculosis: a case report. KMJ 2004; 36:290- sphincterotomy to relieve the obstruction and a brush 292. cytology that was benign. This case report adds one 13. Pombo F, Diaz Candamio MJ, Rodriguez E, Pombo S. more to the small number of cases of isolated pancreatic Pancreatic tuberculosis: CT findings. Abdom Imaging TB diagnosed by percutaneous CT guided FNAC and 1998; 23:394-397. treated effectively with antituberculous drugs without 14. Sinan T, Sheikh M, Ramadan S. CT features in any recurrence after six years. abdominal tuberculosis: 20 years experience. BMC Med Imaging 2002; 2:3-10. 15. Stock KP, Reimann JF, Stadler W, Rosch. Tuberculosis CONCLUSION of the pancreas. Endoscopy 1981; 13:178-180. Isolated pancreatic TB is rare and the diagnosis 16. Lo SF, Ahchong AK, Tang CN, Anda A, Yip WC. is challenging. However, the clinician’s high index Pancreatic tuberculosis: case reports and review of the of suspicion, its clinical feature and the conduct literature. J R Coll Surg Edinb 1998; 43:65-69. December 2013 KUWAIT MEDICAL JOURNAL 343

17. Veerabadran P, Sansur P, Subramarian S, Subramarian 20. Song TJ, Lee SS, Park DH, et al. Yield of EUS-guided M. Pancreatic tuberculosis: abdominal tuberculosis FNA on the diagnosis of pancreatic / peripancreatic presenting as pancreatic abscess and colonic perforation. tuberculosis. Gastrointest Endosc 2009; 69:484-491. China World J Gastroenterol 2007; 21:478-479. 21. Rai S, Thomas WM. Diagnosis of abdominal 18. Fan ST, Yan KW, Lau WY, Wong KK. Tuberculosis of the tuberculosis: the importance of laparoscopy. J R Soc pancreas: a rare cause of massive gastrointestinal bleed. Med 2003; 96:586-588. Br J Surgery 1986; 73:373. 22. Standardized treatment regimens: treatment of 19. Mallery JS, Centeno BA, Hahn PF, Chang Y, Warshaw tuberculosis: guidelines for national programs. 3rd AL, Brigge WR. Pancreatic tissue sampling guided by edition. Geneva: World Health Organisation; 2003:27- EUS, CT / US and surgery: a comparison of sensitivity 38. and specificity. Gastrointest Endosc 2002; 56:218-224. 344 KUWAIT MEDICAL JOURNAL December 2013

Case Report Twin Pregnancy with a Complete Hydatidiform Mole and Surviving Co-Existent Fetus: A Case Report

Naorem Gopendro Singh1, Shirien Raj Shahed2, Amre Ahmed Rifaat1 1Department of Pathology and 2Department of Obstetrics & Gynecology, Al-Jahra Hospital, Kuwait

Kuwait Medical Journal 2013; 45 (4): 344 - 347

ABSTRACT

A 27-year-old woman conceived following six cycles of was normal and the other placenta was composed of vesicles ovulation induction with clomiphene citrate. Successive of various sizes. Microscopic examination of the abnormal ultrasound (US) examinations documented a normally placenta documented complete hydatidiform mole (HM). growing live fetus with a normal placenta and an additional The baby was well and serial maternal serum β-hCG levels intrauterine echogenic mass with features of molar showed a declining trend and were undetectable by 8 weeks pregnancy. Follow-up serum β-hCG estimation and genetic after delivery. The prenatal diagnosis of twin pregnancy amniocentesis was done. Fetus revealed normal female 46XX with complete HM and coexistent fetus was based on US karyotype. The pregnancy was continued till 28th weeks. findings, abnormally elevated β-hCG levels and normal Labor was induced at 28 week gestation due to vaginal fetal karyotype (46XX). The pregnancy should be continued bleeding, which resulted in the delivery of a live normal with close follow-up to detect potential maternal and fetal female infant and two adjoining placentas. One placenta complications.

KEY WORDS: hydatidiform mole, ovulation induction; serum β-hCG

INTRODUCTION trophoblastic disease (PTD). Delivery of a viable Hydatidiform mole (HM) co-existing with a fetus normal infant from this combination is even rarer[2]. is an extremely rare phenomenon. Frequency rates Here we present a case of CHMCF because of its rarity. have been reported to be between 1 in 22,000 to This is the first documented case in Kuwait and the 100,000 pregnancies[1]. Traditionally, when a placenta second in the Middle-East succeeding a case reported displaying a live fetus and molar degeneration is by Piura et al[3] in Israel. seen, three possible conditions may be considered: (1) Partial molar pregnancy with triploid fetus (69 CASE REPORT chromosomes; 46 paternal and 23 maternal), (2) The patient was a 27-year-old woman, gravida Dichorionic twin pregnancy with normal fetus (46 3, para 0, with previous two spontaneous abortions. chromosomes, 23 maternal and 23 paternal) and The present pregnancy was achieved following six complete molar pregnancy (46 chromosomes, all are cycles of ovulation induction with clomiphene citrate. paternal), that is, complete HM and co-existent live Successive ultrasound (US) examinations at 12 and 16 fetus (CHMCF) and (3) Twin pregnancies, partial week gestation demonstrated a live fetus matching the molar (69 chromosomes, 46 paternal and 23 maternal) age of gestation alongside a normal-looking placenta with normal fetus (46 chromosomes, 23 maternal located at the anterior uterine wall and an additional and 23 paternal) combination, which is extremely echogenic mass which could be a cystic degenerated rare. Most cases suffer severe complications such as mass or HM located posteriorly adjacent to the normal spontaneous abortion, preterm delivery, intrauterine looking placenta. Serum β-hCG level at 16 week fetal death, bleeding, preeclampsia and persistent gestation was >1000 IU/l. Tentative diagnosis of a

Address correspondence to: Dr Naorem Gopendro Singh, MD, Department of Pathology, Al-Jahra Hospital, P O Box 62276, Jahra 02153, Kuwait. Tel: + 965-97128990 Fax: + 965-24575473, E-mail: [email protected] December 2013 KUWAIT MEDICAL JOURNAL 345

Fig. 1: Ultrasonographic picture revealing fetus (arrow), normal Fig. 2: A power Doppler image showing normal placenta, molar placenta and co-existent, degenerated placental (mass) with placenta and a normal fetus at 25 weeks of gestation. It exhibits sonographic characteristics of hydatidiform mole umbilical artery Doppler wave form showing RI = 0.55 (normal)

The normal placenta weighed 220 gm and measured 14 x 11 x 2 cm (Fig. 4A).The molar placenta was composed of vesicles of varying sizes (0.3 - 1.5 cm), measuring 15 x 11 x 6 cm and weighed 390 gm (Fig. 4B). On microscopy, the normal placenta showed well-developed chorionic villi with normal vascularization compatible with an early third trimester placenta. The molar vesicular soft tissue showed circumferential trophoblastic proliferation. The stroma was extensively edematous with cistern formation. Vessels were scanty or absent in the stroma. The features were consistent with complete HM (Fig. 4C and 4D). Maternal serum β-hCG level decreased from >1000 IU/l to 775 IU/l and 489 IU/l on 8th and 9th Fig. 3: Ultrasounographic picture at 25 week exhibiting the normal day after delivery respectively. Further measurements placenta, molar placenta and buttock of fetus. The side note shows β other vital data of the fetus. of maternal serum -hCG level demonstrated a steady fall and remained undetectable, eight weeks after delivery. twin pregnancy with CHMCF was made at this stage. The patient party was explained about the possible DISCUSSION complications. However, they wished to continue There are, overall, about 200 cases of twin the pregnancy. At 20 week gestation, a detailed US pregnancy with CHMCF documented to date in the examination revealed a normal live female fetus with a literature. It is speculated that recent widespread use normal-looking placenta and co-existent degenerated of ovulation induction in the treatment of infertility placenta with sonographic characteristics of a HM (Fig. may increase the incidence of twin pregnancies 1). The subsequent follow-up Doppler (Fig. 2) and US with CHMCF[3-5]. However, there are only 57 cases (Fig. 3) at 25 week of gestation exhibited the normal (including the current case) documented in the fetal umbilical artery blood flow and well-grown fetal literature of twin pregnancy with CHMCF resulting parts. Genetic amniocentesis at 20 week gestation in a live birth[6]. Recent advances in US have enabled was performed which showed normal female 46XX diagnosis of a HM and co-existent fetus in the first karyotype. Other laboratory investigations for thyroid trimester[7]. Prenatal fetal karyotyping plays a major function, blood pressure, proteinuria and chest X-ray role in deciding the continuation and prognosis were unremarkable. At 28 week gestation, labor was of the pregnancy. A triploid karyotype indicates a induced because of complicated vaginal bleeding, triploid fetus which invariably would be severely breech presentation and preterm uterine contractions. malformed and therefore, termination of pregnancy An 850 gm normal female infant, with Apgar score is highly recommended. A diploid fetal karyotype of 6 and 7 at one and five minutes respectively, was [46 chromosomes, 46XX or 46XY], on the other hand, delivered. Both normal and molar placentas were indicates a viable fetus with a normal placenta co- separated manually from the uterus. existing alongside a twin molar placenta. Continuation 346 Twin Pregnancy with a Complete Hydatidiform Mole and Surviving Co-Existent Fetus... December 2013

Fig. 4: (A) The normal placenta weighing 220 gm and (B) hydatidiform mole showing multiple vesicles of varying sizes. (C and D) Photomicrograph of the complete hydatidiform mole exhibiting the markedly enlarged and hydropic villi with absence of vessels and proliferation of the trophoblastic cells (H&E stain x 40) of pregnancy is recommended in such cases, since 33%. The prevalence rates of associated complications literature documented about 30 - 35% chances to like preeclampsia and PTD were shown to be about 31% result in a normal live neonate[6]. However, the parents and 30% in these cases[6]. All the PTD in the reported should be explained of the possible complications like series attained complete recovery with chemotherapy. hyperemesis grvidarum, early-onset pre-eclampsia, There was no maternal loss. As seen in the present hyperthyroidism, vaginal bleeding, anemia, case too, most of the cases were found to have been development of theca lutein ovarian cysts, respiratory subjected for ovulation induction (43% of the cases)[6]. distress because of trophoblastic embolization to the The optimal treatment for CHMCF pregnancies lungs, and PTD. Rare cases with complicated metastatic is unclear. Formerly, most of them were terminated trophoblastic disease have been documented before the with or without exact diagnosis. However, with the maturation or delivery of the live fetus[8]. In our present availability of recent advances in US and karyotyping, case there was no complication except for the vaginal the treatment protocol has been changed. Continuation bleeding which leads to induction of vaginal delivery of pregnancy is recommended in case of a normal fetal at 28th week of gestation. The prenatal diagnosis karyotype, no fetal anomalies, no early preeclampsia of a twin pregnancy with CHMCF was made in our and observance of declining trend of β-hCG. Inspite case by US and demonstrating a normal fetal 46XX of all the aforementioned facts, the parents should be karyotype by amniocentesis in the second trimester of informed that the rate of having a chance of live delivery the pregnancy. Later, after the delivery, the complete is about 33% and the risk of receiving chemotherapy HM was confirmed microscopically by examination of due to PTD may rise to about 30%[6]. the vesicular degenerated placenta. Dolapcioglu et al documented live deliveries in 56 CONCLUSION (35%) of a total of 159 CHMCF cases in literature[6]. The prenatal diagnosis of twin pregnancy with The chances of a live birth for parents who desire to CHMCF was based on US, abnormally elevated continue the pregnancy had been estimated to about β-hCG levels and normal fetal karyotype (46XX). The December 2013 KUWAIT MEDICAL JOURNAL 347 pregnancy should be continued with close follow-up 4. Vaisbuch E, Ben-Arie A, Dgani R, Perlman S, Sokolovsky to detect potential maternal and fetal complications. N, Hagay Z. Twin pregnancy consisting of a complete hydatidiform mole and co-existent fetus: report of two REFERENCES cases and review of literature. Gynecol Oncol 2005; 98:19-23.

5. Wee L, Jauniaux E. Prenatal diagnosis and management 1. Vaisbuch E, Ben-Arie A, Dgani R, Perlman S, Sokolovsky of twin pregnancies complicated by a co-existing molar N, Hagay Z. Twin pregnancy consisting of a complete pregnancy. Prenat Diagn 2005; 25:772-776. hydatidiform mole and co-existent fetus: report of two 6. Dolapcioglu K, Gungoren A, Hakverdi S, Hakverdi cases and review of literature. Gynecol Oncol 2006; AU, Egilmez E. Twin pregnancy with a complete 100:218-219. hydatidiform mole and co-existent live fetus: two case 2. Steller MA, Genest DR, Bernstein MR, Lage JM, reports and review of the literature. Arch Gynecol Goldstein DP, Berkowitz RS. Clinical features of Obstet 2009; 279:431-436. multiple conceptions with partial or complete molar 7. Chen FP. Molar pregnancy and living normal fetus pregnancy and coexisting fetuses. J Reprod Med 1994; coexisting until term: prenatal biochemical and 39 :147-154. sonographic diagnosis. Hum Reprod 1997; 12:853-856. 3. Piura B, Rabinovich A, Hershkovitz R, Maor E, Mazor 8. Kauffman DE, Sutkin G, Heine RP, Watt-Morse M, Price M. Twin pregnancy with a complete hydatidiform mole FV. Metastatic complete hydatidiform mole with a and surviving co-existent fetus. Arch Gynecol Obstet surviving coexistent twin. A case report. J Reprod Med 2008; 278:377-382. 1999; 44:131-134. 348 KUWAIT MEDICAL JOURNAL December 2013

Case Report Colpocephaly, a Wide Clinical Spectrum for One Cephalic Disorder: Three New Cases from Kuwait

Tarek M M Seoudi, Abeer Ahmed Al-Tararwa, Irene Yousef Aziz Department of Pediatrics, Farwaniya Hospital, Ministry of Health, Kuwait

Kuwait Medical Journal 2013; 45 (4): 348 - 352

ABSTRACT

Colpocephaly is an abnormal enlargement of the occipital various degrees of mental retardation, seizures, and motor horns of both lateral ventricles; it is also described as and visual abnormalities. Approximately 50 cases have persistence of the fetal configuration of the lateral ventricles. been described in children. Herein we report three new Since it was first described, colpocephaly has been found cases of colpocephaly. One of the cases was associated with in association with several abnormalities of the brain. The CHARGE syndrome. To the best of our knowledge, this is the spectrum of clinical presentation is wide, including mainly first publication to report such an association.

KEY WORDS: CHARGE syndrome, lateral ventricles, occipital horns

INTRODUCTION Colpocephaly has been associated with diverse Colpocephaly is a congenital brain abnormality factors including intrauterine infection (e.g., in which the occipital horns of the lateral ventricles gestational exposure to Toxoplasma gondii), perinatal of brain are larger than normal with normal frontal anoxic-ischemic encephalopathy[4], chromosomal poles. anomalies such as trisomy 8 mosaic, trisomy 9 mosaic[5] Colpocephaly is considered part of a global and deletion of 1p36.3[6] and maternal gestational impairment in brain development with aberrant or ingestion of ethanol, oral contraceptive medications, arrested migration of the neuroblasts between one corticosteroids, salbutamol and theophylline[4]. and four months of gestation, causing diminished This cephalic disorder has been described in thickness of the cerebral white matter in the posterior conjunction with different syndromes like Pierre- part with subsequent dilatation of the occipital horns Robin syndrome[7], Zellweger syndrome[8], Larsen of the lateral ventricles[1]. Therefore, any process that syndrome[9], and Aicardi syndrome[10] but not with inhibits the normal neuronal migration from within CHARGE syndrome. the ventricle, and likewise the normal genesis of the A familial occurrence of colpocephaly has been corpus callosum, may result in this entity. However, noted in few reports. Cerullo et al. described familial not all patients with agenesis of the corpus callosum colpocephaly in two siblings from different fathers[11]. manifest isolated ventriculomegaly of the occipital In addition, there is a report of colpocephaly in non- horns[2]. identical twins[12] and another one in identical twins[13], Colpocephaly may also develop in later fetal life suggesting a possible genetic cause. as a result of infarction and cystic degeneration of A number of central nervous system malformations deep white matter of the posterior third of cerebral have been found in association with colpocephaly hemispheres rather than as a developmental disorder including agenesis of the corpus callosum, neuronal of neuroblast migration[3]. migration disorders (lissencephaly, pachygyria), No single etiologic agent has been implicated, and schizencephaly, hemimegalencephaly, microcephaly, there may be many causative factors. The essential meningomyelocele, and hydrocephalus[5,7]. Agenesis of element is perhaps the time rather than the type of the corpus callosum is the most frequently associated insult to the nervous system[1]. malformation[7].

Address correspondence to: Dr. Tarek M M Seoudi, MRCPCH (UK), Department of Pediatrics, Farwaniya Hospital, Kuwait. P O Box 1940 Al Ardiya 92400, Kuwait. Tel: + 965 66092925, Fax: +965 24893318, E-mail: [email protected] December 2013 KUWAIT MEDICAL JOURNAL 349

Other associations like cleft palate, hypoplastic spontaneously. This was preceded by headache and nails, simian creases, periventricular leukomalacia, vomiting. He was admitted to the ward one month later enlargement of the cisterna magna and cerebellar because of a generalized atonic episode. The patient was hypoplasia[7] were also reported. commenced on sodium valproate that controlled his Colpocephaly may be diagnosed late in pregnancy, fits. No obvious dysmorphic features were noted and although it is often misdiagnosed as hydrocephalus. his chest, heart, abdominal and neurodevelopmental It may be more accurately diagnosed after birth when examination were unremarkable. signs of mental retardation, microcephaly, and seizures An EEG revealed markedly abnormal record on are present[3]. The clinical spectrum of the disease is so account of repetitive giant-like short wave complexes varied ranging from being asymptomatic to be severely over both occipital leads, more pronounced over the handicapped[7]. left one that is consistent with some form of benign occipital epilepsy of childhood. CASE PRESENTATION An MRI brain showed colpocephaly, more Case 1 pronounced in the right occipital horn. Multiple areas of This six-year-old boy was born after uneventful small gray matter were also seen in the subependymal pregnancy and delivery and his birth weight was 3 kg. region of the occipital horns of both lateral ventricles, There was no maternal risk factor reported and no suggestive of nodular heterotopia (Fig. 1A &B). The family history of epilepsy or febrile convulsions. He child is still on sodium valproate with good control of was first admitted to the hospital at the age of four his fits after 18 months of follow-up. years for the first attack of convulsions associated with fever and upper respiratory tract infection. Case 2 His family reported that the child had recurrent This female child was first seen in the pediatric 1 attacks of abnormal movement occurring during sleep outpatient department at the age of 7 /2 months few months back and these abnormal movements because of delayed psychomotor development and lack were affecting his left side of the body only and each of eye to eye contact. She was still unable to recognize lasted few seconds. These did not awaken him from her mother, did not show a social smile and was not sleep and were not accompanied by abnormal voice or able to sit with support or support herself on her lower facial affection. One week after discharge he developed limbs. Her parents reported that hearing was normal. afebrile convulsions associated with up rolling of She was born at term after uneventful pregnancy and the eyes that lasted for five minutes and aborted delivery and her birth weight was 3.2 kg. She was the

Fig. 1 (A): MRI, T2 WI, Axial and Coronal views, of Case1 showing colpocephaly of the occipital horns of both lateral ventricles, more seen on the right side. Multiple small gray matters in the subependymal region in both occipital horns of both lateral ventricles, suggestive of nodular heterotopias (Block arrows). (B) MRI, Coronal view T2 WI, colpocephaly is well appreciated (arrow heads). 350 Colpocephaly, Wide Clinical Spectrum for one Cephalic Disorder: Three New Cases from Kuwait December 2013

She was universally mild to moderately hypotonic with normal deep tendon reflexes. The Babiniski reflex was flexor and no clonus could be detected. Systemic examination was otherwise unremarkable. The ophthalmologist reported normal eye media and fundus examination. Liver, renal and bone profiles as well as her blood picture were normal. Cerebral MRI showed colpocephaly and corpus callosum agenesis (Fig. 2). No evidence of neuronal migration defect could be detected. Chromosomal karyotyping reported normal 46, XX pattern.

Case 3 A nine-month-old male infant was born vaginally after uneventful pregnancy at 32 weeks of gestation to related parents. His birth weight was 1.6 kg. The Apgar score was 7, 8 at 1 and 5 minutes respectively. He developed respiratory distress soon after birth. He was admitted to the neonatal intensive care unit and connected to mechanical ventilation. He received two doses of surfactant as the chest X-ray showed hyaline membrane disease grade II. Extubation failed several times as the baby developed respiratory distress after Fig. 2: MRI, T1 WI, Sagittal view, of Case 2 showing colpocephaly (Block arrow), corpus callosum agenesis (arrow heads) each trial of weaning. A right-sided choanal atresia was confirmed by CT scan. He was operated upon 1 first baby to first-cousin parents with unremarkable twice for that reason at 1 /2 and 4 months of age due family history. On examination she appeared not to be to restenosis of the choana. The baby was extubated interested in the surroundings with very brief eye to eye finally after the second operation. Echocardiography contact. Her weight was 7.1 kg (25th percentile), height showed a small patent ductus arteriosus (PDA) and 66 cm (25th percentile) and head circumference 45 cm a small atrial septal defect (ASD). Other congenital (90th percentile). The cranial nerves appeared intact. anomalies included bilateral microophthalmia, low set

Fig. 3 (A): MRI, Axial view FLAIR, of Case 3 showing colpocephaly (Block arrows). (B) colpocephaly and agenesis of corpus callosum (arrow head) December 2013 KUWAIT MEDICAL JOURNAL 351 abnormal ears, micrognathia, bilateral simian creases, Colpocephaly typically has been reported in right foot syndactly of 2nd, 3th, and 4th toes, and bilateral association with various degrees of mental retardation, undescended testes. He was sucking fairly well but seizures, and motor and visual abnormalities. This is not developed recurrent attacks of choking and aspiration surprising as some authors considered colpocephaly pneumonia due to swallowing dysfunction (consistent to represent the end result of diverse insults to the with cranial nerves IX and X palsy); the baby was fed developing brain[4]. through a nasogastric tube. Radioisotope milk scan In a review of 36 cases reported in the literature, 13 revealed gastroesophageal reflux. An MRI brain at two patients had seizures, 12 were noted to have mental weeks of age showed colpocephaly and agenesis of retardation and 13 were affected by mild to moderate corpus callosum. (Fig. 3 A & B). movement disorders. Other reported deficits included At the age of four months, the baby developed poor vision, speech and language difficulties, deafness recurrent attacks of generalized tonic convulsions that and chorioretinitis. Three of the 36 cases reviewed were controlled with phenobarbitone. At nine months had completely normal neurologic and motor of age he was severely failing to thrive (weight 4.9 development[4]. kg) with severe global developmental delay. He was Epilepsy is reported in 30% of cases and it might inattentive and in a rather vegetative state. He had be severe and refractory to treatment. In children with generalized hypertonia and hyperreflexia. colpocephaly, the age of onset of epilepsy is usually less The baby remained in morbid condition on oxygen than one year, and the frequency of seizures is higher therapy due to partial restenosis of choana and in early-onset cases. The type of epilepsy is usually recurrent aspiration pneumonia. He passed away due occipital with prominent autonomic symptoms such as to pneumonia and sepsis at the age of nine months. nausea, vomiting, pallor, mydriasis, urinary and fecal CHARGE syndrome was diagnosed clinically in incontinence, eye deviation, versive seizures, and focal this case according to the major and minor criteria of motor seizures[16]. CHARGE syndrome as described by Blake et al[14]. Children have been described with colpocephaly and nearly normal or borderline intelligence. However, DISCUSSION mental retardation of varying severity, ranging from The clinical spectrum of colpocephaly is broad and mild to severe degree, is more common[13]. that is reflected in our reported cases; while one patient Motor abnormalities, such as hemiparesis, diparesis, presented with convulsion and no developmental and dyskinesias, may be present. Patients may be delay, the second one presented with marked global hypotonic or hypertonic[17]. Visual abnormalities developmental delay and no convulsion. On the other include chorioretinal coloboma, optic nerve atrophy, hand, the third case was associated with CHARGE congenital fibrosis of extraocular muscles and a Marcus syndrome and there was convulsion, neurological Gunn jaw phenomenon[18]. symptoms and developmental delay as well. This is in Colpocephaly may sometimes be detected by accordance with the available literature[2-4,7,11-13]. ultrasonography in the fetus in late gestation or in Colpocephaly has been reported with different the neonatal period. An MRI scan may also reveal chromosomal disorders and syndromes[7-10], but not to associated cerebral anomalies further disclosing the best of our knowledge, with CHARGE syndrome. the periventricular white matter abnormalities that In 1998, the revised diagnostic criteria for indicate a perinatal etiology[19]. CHARGE syndrome were set. Individuals with all four Prenatal cerebral MRI may confirm colpocephaly, major characteristics or three major and three minor if ultrasound findings are non-specific. It may also characteristics are highly likely to have CHARGE be useful in suggesting specific pathologies, if syndrome[14]. there is abnormal morphology of the ventricles and Our patient had all the four major characteristics demonstrating some additional cerebral anomalies (coloboma or microphthalmia, choanal atresia, such as late sulcation, migrational pathological characteristic ears and cranial nerve anomalies) and conditions, and heterotopia[19]. four of the minor characteristics that include cardiac Prenatal diagnosis should prompt search for malformation, genital hypoplasia, cleft lip / palate or associated anomalies, karyotypic abnormality, trachea-esophageal fistula, distinctive CHARGE facies, gestational viral exposure, and maternal toxin growth deficiency and developmental delay. ingestion[2]. Currently, definitive treatment options for In 2004, mutations on the CHD7 gene (located on colpocephaly do not exist and it is mostly symptomatic. chromosome 8) were found, making CHARGE an Anticonvulsant medications like sodium valproate official “syndrome”. The test is very expensive and can be taken to control seizures and some cases of available only in two centers in USA. The diagnosis is refractory epilepsy may respond to oral antiepileptics still largely clinical[15]. such as clobazam and clorazepate[20]. 352 Colpocephaly, Wide Clinical Spectrum for one Cephalic Disorder: Three New Cases from Kuwait December 2013

Physiotherapy may help in preventing contractures. of intrauterine and perinatal brain damage. Brain Dev Some children may benefit from special education 1989; 11:313-316. while associated conditions may require more specific 6. Campeau PM, Ah Mew N, Cartier L, et al. Prenatal treatments[3]. diagnosis of monosomy 1p36: a focus on brain abnormalities and a review of the literature. Am J Med The prognosis for individuals with colpocephaly Genet A 2008; 146:3062-3069. depends on the severity of the associated conditions 7. Noorani PA, Bodensteiner JB, Barnes PD. Colpocephaly: and the level of abnormal brain development. Some frequency and associated findings. J Child Neurol 1988; patients have mild disability and can have an almost 3:100-104. normal life; others have profound one, resulting in total 8. Nakai A, Shigematsu Y, Nishida K, Kikawa Y, Konishi Y. lifelong disability, vastly reduced functional capacity, MRI findings of Zelleweger syndrome. Pediatr Neurol and sometimes death[21]. 1995; 13:346-348. 9. Shih JC, Peng SS, Hsiao SM, et al. Three-dimensional CONCLUSION ultrasound diagnosis of Larsen syndrome with further characterization of neurological sequelae. Ultrasound We suggest that the term colpocephaly should be Obstet Gynecol 2004; 24: 89-93. used as a descriptive term rather than a specific disease 10. Carney SH, Brodsky MC, Good WV. Aicardi syndrome: entity of the central nervous system as it represent the more than meets the eye. Surv Ophthalmol 1993; 37:419- end result of diverse insults to the developing brain 424. and is part of many other diseases. Diagnosis of 11. Cerullo A, Marini C, Cevoli S, Carelli V, Montagna colpocephaly should prompt a search for underlying P, Tinuper P. Colpocephaly in two siblings: further associations. More research needs to be done to evidence of a genetic transmission. Dev Med Child detect, if there is any genetic basis for transmission of Neurol 2000; 42:280-282. colpocephaly, as some cases are familial or with history 12. Y Kang, J Kim, M Park. Colpocephaly in non-identical twin following IVF-ET: a case report. Ultrasound in of consanguinity. Obstet & Gynecol 2010; 36: 187 13. Nigro MA, Wishnow R, Maher L. Colpocephaly in ACKNOWLEDGEMENT identical twins. Brain Dev 1991; 13:187-189. We are greatly indebted to Dr. Essam A Ismail, 14. Blake KD, Davenport SLH, Hall BD, et al. CHARGE consultant pediatrician in Farwaniya hospital, for his association: an update and review for the primary help in preparing the manuscript and allowing us to pediatrician. Clin Pediatr (Phila) 1998; 37:59-173. publish this material. We are also thankful to Dr. Ahmed 15. Zentner GE, Layman WS, Martin DM, Scacheri PC. Hassan Ahmed, Radiology specialist in Farwaniya Molecular and phenotypic aspects of CHD7 mutation hospital, for commenting on the radiological pictures in CHARGE syndrome. Am J Med Genet Part A 2010; 152:674-686. of our patients. 16. Yalcin AD, Toydemir HE, Celebi LG, Forta H. Panayiotopoulos syndrome with coincidental brain REFERRANCES lesions. Epileptic Disord 2009; 11: 270-276. 17. Garg BP. Colpocephaly: an error of morphogenesis? 1. Bodensteiner J, Gay CT. Colpocephaly: pitfalls in the Arch Neurol 1982; 39:243-246. diagnosis of a pathologic entity utilizing neuroimaging 18. Pieh C, Goebel HH, Engle EC, Gottlob I. Congenital techniques. J Child Neurol 1990; 5:166-168. fibrosis syndrome associated with central nervous 2. Gary M. Joffe, Gerardo O Del Valle, Luis A. Izquierdo, system abnormalities. Graefes Archi Clin Exp Opht Luis B Curet. Colpocephaly. The Fetus. net, (accessed 2003; 241:546-553. August 1992 at http://www.sonoworld.com/ 19. Levine D, Trop I, Mehta TS, Barnes P. MR Imaging TheFetus/page.aspx?id=100). appearance of fetal cerebral ventricular morphology. 3. Sambasivan M, Sanalkumar P, Abeed Basheer. Radiology 2002; 223:652-660. Colpocephaly. Kerala Med J 2008; 3:27-28. 20. Ito Y, Oguni H, Funatsuka M, Osawa M. Clinical and 4. Surasak Puvabanditsin, Eugene Garrow, Yuliya Ostrerov, EEG studies of symptomatic focal epilepsy in 7 patients Dumitru Trucanu, Maja Ilic, John V. Cholenkeril. with colpocephaly. No To Hattatsu 2008; 40:244-248. Colpocephaly: A case report. Am J Perinatol 2006; 21. Juliet Cohen. Complete Information on Colpocephaly. 23:295-298. Muscle Relaxants, (accessed February 18th, 2011 at 5. Landman J, Weitz R, Dulitzki F. Radiological http://www.musclerelaxant.org/archives/2226). colpocephaly: a congenital malformation or the result December 2013 KUWAIT MEDICAL JOURNAL 353

Case Report Cuff Herniation with Laryngeal Mask Airway

Fawzy Mohamed, Mohamed Al-Khashty, Svetlana Konioukhova Department of Anesthesia, Intensive Care and Pain Management, Kuwait Cancer Control Center, Ministry of Health, Kuwait

Kuwait Medical Journal 2013; 45 (4): 353 - 355

ABSTRACT

The laryngeal mask airway (LMA) is being widely used for 40 ml of air. A few moments after insertion of the LMA, an securing the airway in patients undergoing elective surface audible leak was noted. The cuff was inflated with a further surgery under general anesthesia. However, use of LMA 5 ml of air. The audible leak decreased, but did not disappear may involve some medical problems associated with its completely. Anesthesia was maintained but after 20 minutes technical performance as an airway device. We encountered the audible leak increased and ventilation became difficult. an unusual and potentially serious problem. A 47-year-old, The LMA was removed and another LMA size 4 was inserted female patient diagnosed as breast cancer underwent wide again. At the end of the procedure the patient was allowed to local excision and sentinel lymph node biopsy under general recover and the LMA was removed. After 45 minutes patient anesthesia. After induction of anesthesia, a size 4 reusable was discharged from recovery room. An examination of the classic LMA was inserted and the cuff was inflated with device showed that there was a LMA cuff herniation.

KEYWORDS: cuff herniation, laryngeal mask airway, sterilization

INTRODUCTION was inflated with the recommended volume of air and Since Brain’s publication about the laryngeal the position was secured with tape and bite block. mask airway (LMA) in 1983[1], the device has made a Anesthesia was maintained with nitrous oxide 66%, significant contribution to airway control. The LMA oxygen 33% and sevoflurane 1,5 to 2,0%. The patient is popular because it is easy to position, it provides a was breathing spontaneously. A few moments later secure airway for spontaneously breathing patients, an audible leak was noted. A diagnosis of either LMA and affords effective assisted ventilation in elective and displacement and / or inadequate cuff inflation was emergency situations without requiring endotracheal made. The cuff was inflated with a further 5 ml of air. intubation or visualization of the glottis. Complications The audible leak decreased, but did not disappear associated with the LMA have been reported to occur completely. Vital signs of the patient remained stable (BP at insertion, during anesthesia, and upon emergence; 130 – 110 / 80 – 60 mmHg, HR 70 - 80 beats per minute, however, the difficulties are rare and usually minor[2]. oxygen saturation 100%), and peak airway pressure

did not exceed more than 25 cm H2O. After 20 minutes CASE REPORT the audible leak increased and ventilation became A 47-year-old female patient diagnosed as breast difficult. The oxygen saturation decreased to 85%. cancer, with body weight 84 kg, ASA III, not expected Misplacement of the LMA was diagnosed. The LMA difficult airway (Mallampati II, mouth opening 7 cm, was removed. The depth of anesthesia was increased thyromental distance 10 cm) underwent wide local with propofol; another LMA size 4 was inserted. This excision of the breast mass and axillary sentinel lymph resulted in restoration of a patent airway and a normal node biopsy under general anesthesia. The patient was respiratory pattern. The patient was paralyzed with preoxygenated for three minutes before intravenous cisatracurium 8 mg and ventilated mechanically. The induction with fentanyl 100 mcg and propofol 180 mg. A operation proceeded uneventfully. At the completion reusable size 4 LMA (Silicone laryngeal mask tube LMT of the procedure, the inhaled anesthetic agent was - Standard, Fortune Medical instrument Corporation, discontinued and the patient was allowed to recover. Spain) was inserted without any difficulties. The mask When the patient opened his mouth on command,

Address correspondence to: Dr. Fawzy Mohamed, PhD, Senior Registrar, Anesthesia, Intensive Care Unit and Pain Management, Kuwait Cancer Control Center, Ministry of Health, Kuwait. Tel: 97812651, Fax: 24810453, E-mail: [email protected] 354 Cuff Herniation with Laryngeal Mask Airway December 2013

Fig. 1: The LMA cuff is herniated from one side after inflation with Fig. 2: The LMA cuff is depressed from one side after partial 45 ml of air deflation. the oral cavity was gently suctioned and the LMA introduction, or to the fact that there is no potential risk was removed, partially deflated. After 45 minutes the for damage to materials during repeated sterilization. patient was discharged from the recovery room with There have been a number of case reports related to no apparent complications. mechanical problems with re-usable LMA including After surgery close examination of the first LMA separation[5], transection[6,7] and shattering[7] of LMAs. showed that there was a cuff herniation that had Repeated sterilization was thought to have caused not been detected at pre-use check. The revision of degradation of the silicone, resulting in brittleness, sterilization, autoclaving and pre-use check protocols cracking, and in one case “the friability of cheddar found two serious problems; first that there was no cheese”[8]. Christelis and Doolan[9] reported a case with record sheet about sterilization and autoclaving of the complete airway obstruction caused by cuff herniation device and second, during pre-use check the LMA was of an overused laryngeal mask airway. not inflated with a volume of air 50% greater than the LMATM North America warrants reusable LMATM maximum inflation value recommended for this size. products against manufacturing defects for 40 uses or If this is not done, a cuff herniation might be missed a period of one year from date of invoice, whichever during inspection (Fig. 1, 2). comes first. At each instance a reusable airway is considered for use, it must be visually inspected DISCUSSION for discoloration and breakage, blockage, aperture Problems associated with the use of LMA in breakage, crazing and tested for elasticity[10,11]. The operating room are infrequent and may be divided integrity of the cuff ought to be verified by inflating into three main types: mechanical, traumatic, and with a volume of air 50% greater than the recommended pathophysiological. Mechanical problems relate maximum inflation volume. In order to obtain the best to its technical performance as an airway device, performance from LMA the recommendations of the traumatic problems relate to local tissue damage, manufacturer of the device as regards tracking, cleaning and pathophysiological problems relate to its effects and sterilization procedures should be implemented in on the body’s systems. The most common problems clinical practice[12]. encountered include inability to position the LMA correctly, coughing and gagging during placement and CONCLUSION removal, laryngospasm, and postoperative sore throat. The continued use of an LMA beyond 40 insertions Brimacombe’s[3] analysis of 1500 LMA uses revealed increases the probability of device malfunction. In order that on two occasions (0.13%) the LMA cuff slowly to prevent the above discussed problem, we decided to deflated during the operation secondary to a small implement the following measures; track the number leak. Verghese and Brimacombe[4] found that only 44 of times an LMA has been used and autoclaved, and critical incidents were documented with the use of limit the number to recommended 40 uses; perform LMA in 11, 910 anesthetics (0.37%), and only 18 (0.15%) manufacturers' recommended pre-use tests prior out of these incidents were related to the airway. to each use; use the standard insertion and fixation To date, there have been fewer reported problems technique and bite-block; provide availability of back- with disposable devices. This may be due to their recent up equipment in case of failure; increase awareness December 2013 KUWAIT MEDICAL JOURNAL 355 about the single-use (disposable) LMA as a low- 5. Khoo ST. The laryngeal mask airway - an unusual cost alternative or supplement to reusable laryngeal complication (Letter to the editor). Anaesth Intensive devices, in order to reduce risk of nosocomial infection. Care 1993; 21:249-250. We decided to carry out training and education for 6. Kramer-Kilper OT. Removal of laryngeal mask airway during light anaesthesia (Letter to the editor). medical staff involved in LMA use to further reduce Anaesthesia 1992; 47:816. the likelihood of adverse events. 7. Crawford M, Davidson G. A problem with a laryngeal mask airway (Letter to the editor). Anaesthesia 1992; REFERENCES 47:76. 8. Squires SJ. Fragmented laryngeal mask airway (Letter 1. Brain AIJ. The laryngeal masks - a new concept in to the editor). Anaesthesia 1992; 47:274. airway management. Br J Anaesth 1983; 55:801-805. 9. Christelis ND, Doolan GK. Complete airway obstruction 2. Spielman FJ. Complete separation of the tube from the caused by cuff herniation of an overused laryngeal mask during removal of a disposable laryngeal mask mask airway. Anaesth Intensive Care 2008;36:274–275. airway. Can J Anaesth 2002; 49:990-992. 10. LMATM 40 use program. LMA North America, Inc, 2004. 3. Brimacombe J. Analysis of 1500 laryngeal mask uses www.gasshead.com/content/TutorACTc.pdf by one anaesthetist in adults undergoing routine 11. Brimacombe J. Laryngeal Mask Anesthesia, Principles anaesthesia. Anaesthesia 1996; 51:76-80. and Practice, 2nd ed. London: WB Saunders Co., 2004. 4. Verghese C, Brimacombe JR. Survey of laryngeal mask 12. Brimacombe J, Laupu W, Keller C. Time to dispose of airway usage in 11,910 patients: safety and efficacy the non-disposable LMAs. Anesth Analg 2005; 100:897. for conventional and non-conventional usage. Anesth Analg 1996; 82:129-133. 356 KUWAIT MEDICAL JOURNAL December 2013

Letter to the Editor Neutropenia Induced by Ceftriaxone Sodium

Husrev Diktas1, Murat Velioglu2 1Department of Infectious Diseases, Girne Military Hospital, Girne, TRNC 2Department of Radiology, Girne Military Hospital, Girne, TRNC

Kuwait Medical Journal 2013; 45 (4): 356 - 357

Ceftriaxone sodium is a third-generation diagnosis of lobar pneumonia. No colonization cephalosporin antibiotic, which is used for a wide was present in the sputum culture and direct spectrum of infectious diseases. Neutropenia is a microscopy for tuberculosis and bacterial infections. rare life-threatening, adverse reaction associated Treatment was started with ceftriaxone sodium 2 with more than 100 different drugs except for g/day intravenously. Ceftriaxone therapy was well- anticancer ones. The most common causes of tolerated with normal hematological indices until neutropenia in adults are acquired and they are day four, when the WBC count declined to 2000/ due to either decreased granulocyte production mm3 and granulocyte count to 45%. There was no or increased destruction. The usual definition of concurrent therapy prescribed, or over-the-counter drug-induced neutropenia or agranulocytosis medication exposure. Diagnostic tests for other excludes the use of known cytotoxic agents (e. g., possible causes of neutropenia, including viral tests cyclophosphamide, doxorubicin) or diseases (e. g., for common respiratory pathogens, blood cultures vitamin B12 deficiency, chronic liver disease) that and throat swabs for bacterial culture, Epstein–Barr can cause neutropenia, and requires that the drug virus, cytomegalovirus and HIV serology, were must have been administered within four weeks of negative. As a result of these negative findings, the onset of neutropenia[1]. Discontinuation of the the possibility of an undiagnosed infectious cause drug generally results in correction of the neutrophil for neutropenia was considered highly unlikely. count within 30 days. We report the case of a patient Ceftriaxone was considered the probable cause with ceftriaxone-associated neutropenia due to a of neutropenia. Ceftriaxone sodium was stopped standard dose parenteral antibiotic therapy. immediately and 400 mg of levofloxacin daily A 21-year-old patient was admitted to the prescribed. On the seventh day of levofloxacin emergency department with complaints of malaise, therapy the patient remained well with complete purulent discharge of sputum, cough and fever. resolution of his symptoms and a normal WBC He was having these symptoms for four days. On count. physical examination, the blood pressure was 120/ Drug-induced neutropenia occurs as an 80 mmHg, pulse was 92/min and body temperature adverse idiosyncratic reaction and is the second was 38 °C. On auscultation, he had fine crackles and most common cause of neutropenia. The true expiratory rhonchi at the lower left lung. All other incidence of drug-induced neutropenia is not systemic findings were normal. Laboratory results known. Extensive data from randomized clinical at admission revealed a total WBC count of 11,000 trials confirm the efficacy of ceftriaxone in cells/μl with a differential of 90% neutrophils, 7% serious and difficult-to-treat community-acquired lymphocytes and 1% monocytes, 1% basophils and infections including meningitis, pneumonia and 1% eosinophils. The rest of the routine blood analyses nonresponsive acute otitis media[2]. Unfortunately, and urine analyses were within the normal limits. the frequency of reported ceftriaxone-induced On chest X-ray there were reticulonodular opacities adverse events has been increasing over the last on the left lower zones compatible with broncho- decade, but the frequency severe neutropenia is not pneumonia. The patient was hospitalized with a known. In a systematic review of 980 case reports

Address correspondence to: Hüsrev Diktas, Department of Infectious Diseases and Clinical Microbiology, Girne Military Hospital, 34668 Girne, TRNC. Tel: +90 533 826 0 169, Fax: +90 392 815 6367, E-mail: [email protected] December 2013 KUWAIT MEDICAL JOURNAL 357 of drug-induced agranulocytosis from 1966 - 2006, REFERENCES ceftriaxone was identified as a probable cause in five case reports[3]. This case reveals an extremely 1. Andres E, Maloisel F. Idiosyncratic drug-induced rare but serious potential complication arising agranulocytosis or acute neutropenia. Curr Opin from the use of a standard dose and duration of Hematol 2008; 15:15-21. parenteral ceftriaxone in community acquired 2. Lamb HM, Ormrod D, Scott LJ, Figgitt DP. Ceftriaxone: an update of its use in the management infection. In conclusion, medical professionals of community-acquired and nosocomial infections. should be aware of hematological adverse events Drugs 2002; 62:1041-1089. like neutropenia during ceftriaxone treatment and 3. Andersohn F, Konzen C, Garbe E. Systematic review: close follow-up of blood tests must be done for an agranulocytosis induced by non-chemotherapy early diagnosis. drugs. Ann Intern Med 2007; 146:657-665. 358 KUWAIT MEDICAL JOURNAL December 2013

Letter to the Editor A Mechanism Hypothesis for NMDA Receptor Antagonists Induces Schizophrenia

Chao-Jin Xu Department of Histology and Embryology, Wenzhou Medical University, Wenzhou, China

Kuwait Medical Journal 2013; 45 (4): 358

Schizophrenia is one of the most severe psychiatric and autism. Thus, it is reasonable to hypothesize that diseases noted for its chronic and often debilitating positive or negative symptom of NMDAR antagonists processes, distinguished by a set of symptoms[1], inducing schizophrenia may be related to the changes which is characterized by hallucinations and of the ProSAP1 / Shank2 protein level at the synapse delusions (positive symptoms), deficits in learning and modification of the dendritic spines plasticity, and memory (cognitive symptoms), depression and finally producing schizophrenia symptom. social isolation (negative symptoms)[2]. In addition, blockade of N-methyl-D-aspartate (NMDA)-type ACKNOWLEDGMENT glutamate receptors (NMDARs) in normal people will This project was supported by Zhejiang Provincial induce behavior which is similar to the symptoms and Natural Science Foundation of China (LY13H090007). cognitive deficits of schizophrenia and administration of non-competitive NMDAR antagonists could also REFERENCES increase positive, negative and cognitive deficits in schizophrenic patients[3]. Therefore, the glutamate 1. Kato TA, Monji A, Mizoguchi Y, et al. Anti-Inflammatory hypothesis is a robust model of schizophrenia. properties of antipsychotics via microglia modulations: Additionally, a loss of dendritic spines, particularly are antipsychotics a ‘fire extinguisher’ in the brain of from cortical pyramidal neurons, could be consistent schizophrenia? Mini Rev Med Chem 2011; 11:565- 574. with the glutamate hypothesis of schizophrenia, as 2. Matosin N, Newell KA. Metabotropic glutamate the NMDA subtype of glutamate receptor is present receptor 5 in the pathology and treatment of on their dendrites and probably dendritic spines. schizophrenia. Neurosci Biobehav Rev 2013; 37:256- This is also verified by spine density measurements 268. in schizophrenics or in the cortical area in normal 3. Weickert C, Fung S, Catts V, et al. Molecular evidence people[4]. Recently, a very interesting study shows that of N-methyl-D-aspartate receptor hypofunction in NMDAR dysfunction is more closely implicated in schizophrenia. Mol Psychiatry 2012. 2;doi:10.1038/ autism than in schizophrenia, which has deficits in all mp.2012.137 core domains of autism symptoms. Multiple abnormal 4. Garey L. When cortical development goes wrong: schizophrenia as a neurodevelopmental disease of behaviors have largely been interpreted in the context [5] microcircuits. J Anat 2010; 217:324-333. of schizophrenia . Mice lacking ProSAP1 / Shank2 5. Gandal MJ, Anderson RL, Billingslea EN, et al. Mice show autistic-like behaviors and hyperactivity as well with reduced NMDA receptor expression: more as up-regulation of ionotropic glutamate receptors, consistent with autism than schizophrenia? Genes such as NMDARs, at the synapse and exhibit fewer Brain Behav 2012; 11:740-750. dendritic spines[6]. 6. Schmeisser MJ, Ey E, Wegener S, et al. Autistic- From the above mentioned facts, we know that like behaviours and hyperactivity in mice lacking some behaviors could be shared by schizophrenia ProSAP1/Shank2. Nature 2012; 486:256-226.

Address correspondence to: Chao-Jin Xu, PhD, Department of Histology and Embryology, Wenzhou Medical University, Cha Shan, university town, Zhejiang 325035, China. Tel: +86-577-86689976, Fax: +86-577-86689976, E-mail: [email protected] December 2013 KUWAIT MEDICAL JOURNAL 359 Selected Abstracts of Articles Published Elsewhere by Authors in Kuwait

Kuwait Medical Journal 2013, 45 (4): 359 - 360

Immunocytochemical Detection of Raf Kinase Inhibitor Protein and Human Papillomavirus Profiling of Normal and Abnormal Cervical Thinprep Samples

Al-Awadhi R, Husain S, Chehadeh W, Al-Jassar W, Kapila K, Al-Mulla F Department of Medical Laboratory Sciences, Faculty of Allied Health Sciences, Kuwait University, Kuwait City, Kuwait. E-mail: [email protected]

Acta Cytol 2013; 57:259-265

Objectives: This study investigates the potential value of Raf kinase inhibitor protein (RKIP) as a marker of normal squamous cells in ThinPrep slides. RKIP was evaluated for its ability to distinguish between normal and abnormal cervical samples in the context of human papillomavirus (HPV) infections. Study Design: A total of 316 ThinPrep samples were taken from women with normal and abnormal cervices. ThinPrep slides were Papanicolaou stained and reported. Residual samples were used for RKIP immunostaining and HPV PCR-based sequencing. Results: RKIP expression was seen in both nuclei and cytoplasm in 83.7% of samples. RKIP expression was highest (84.6%) in samples with a diagnosis of high-grade squamous intraepithelial lesion (HSIL) or worse; expression was lower in low-grade squamous intraepithelial lesions (73%) and was lowest in samples with normal cytology (p = 0.0023). A total of 74% of HPV-infected ThinPrep samples were immunopositive, and 67% of samples that did not harbor HPV were also immunopositive (p = 0.414). Sensitivity and specificity of RKIP were 84.6 and 34.6%, respectively, for the detection of samples with HSIL or worse. Conclusions: This study showed that RKIP expression may be of some value as a marker for abnormal cervical cells. Combined RKIP expression and HPV testing could improve the identification of samples with abnormal cytology.

Genetic and Immunohistochemical Characterization of Epstein-Barr Virus-Associated Diffuse Large B-Cell Lymphoma

Al-Humood S, Alqallaf A, Al-Shemmari S, Al-Faris L, Al-Ayadhy B Department of Pathology, Faculty of Medicine, Kuwait University, Safat, Kuwait

Acta Haematol 2013; 131:1-10

Epstein-Barr virus (EBV) has a pathogenic role in several lymphomas, including diffuse large B-cell lymphoma (DLBCL). EBV-associated genetic aberrations in DLBCL have not been fully characterized. The aim of this study was to investigate the prevalence of EBV infection in sporadic DLBCL cases in Kuwait and to evaluate their EBV status in relation to demographic data, the anatomical disease site, immunophenotypic features, particularly pertaining to the Choi’s DLBCL prognostic classification,and chromosomal aberrations. Using immunohistochemistry (IHC), in situ hybridization (ISH), nested polymerase chain reaction (nPCR) and comparative genomic hybridization techniques, formalin-fixed paraffin-embedded blocks of archived DLBCL cases were included and evaluated in the study. EBV was detected in 6.9, 18.2 and 25% of the studied cases using IHC, ISH and nPCR, respectively, indicating that nPCR is more sensitive in detecting EBV than IHC and ISH. EBV- DLBCL cases showed BCL6 protein expression more frequently than EBV+ DLBCL cases. The reported prevalence of EBV+ DLBCL cases in this study is similar to that reported in the literature using ISH results and higher using nPCR results. There was a significant inverse correlation between BCL6 protein expression and the presence of EBV (p = 0.01). 360 Selected Abstracts of Articles Published Elsewhere by Authors in Kuwait December 2013

Increasing Prevalence and Incidence Rates of Multiple Sclerosis in Kuwait

Alroughani R, Ahmed S, Behbahani R, Khan R, Thussu A, Alexander K, Ashkanani A, Nagarajan V, Al-Hashel J Division of Neurology, Department of Medicine, Amiri Hospital, Kuwait

Mult Scler 2013 Sep 24 [Epub ahead of print]

Background: Kuwait was considered as low to intermediate risk area for MS. Objectives: To determine the prevalence and incidence rates of MS among Kuwaiti nationals based on 2011 population census. Methods: This cross-sectional study was conducted between October 2010 and April 2013 using the newly developed national MS registry in Kuwait. Patients with a diagnosis of MS according to 2010 revised McDonald criteria were identified. The crude, age- and sex-specific prevalence and incidence rates among Kuwaiti patients were calculated. Results: 1176 MS patients were identified of which 927 (78.8%) were Kuwaitis and 249 (21.2%) were expatriates. Among Kuwaiti patients, female to male ratio was 1.8:1 with a mean age of 35.40 ± 10.99 years. The prevalence rate of MS was 85.05 per 100,000 persons (95% CI: 82.80 - 87.04). There was a peak in prevalence among patients aged 30-39 years. The incidence of MS was 6.88 per 100,000 persons (95% CI 5.52 - 8.55). Between 2003 and 2011, the incidence increased 3.22 and 2.54 times in women and men respectively. Conclusion: Kuwait is considered a high-risk area for MS. The significant increase in prevalence and incidence rates may represent a true increase despite the improvement in case ascertainment and case definition.

Transcranial Doppler and Brain MRI in Children With Sickle Cell Disease and High Hemoglobin F Levels

Asbeutah A, Gupta R, Al-Saeid O, Ashebu S, Al-Sharida S, Mullah-Ali A, Mustafa NY, Adekile A Faculty of Allied Health Sciences, Department of Radiologic Sciences, Kuwait University, Safat, Kuwait

Pediatr Blood Cancer 2013 Sep 9. doi: 10.1002/pbc.24758 [Epub ahead of print]

Background/Objective: While overt stroke and silent brain infarcts (SBI) are uncommon among Kuwaiti patients with sickle cell disease (SCD), there have been no previous transcranial Doppler (TCD) studies in this population. The main objective of this study is to determine TCD velocities in a group of Kuwaiti children with SCD and correlate same with brain magnetic resonance imaging (MRI) and angiography (MRA) findings. Materials And Methods: Forty-three steady-state, pediatric patients with SCD aged 10.1 ± 3.9 years (21 SS, 19 Sβ0 Thal, and 3 SD) were studied. Twenty-six age-matched, normal siblings of the patients served as controls. TCD was performed using a General Electric (GE), Vivid 3 equipment and MRI/MRA with a GE Signa Excite HD 1.5 Tesla magnet. Complete blood count was with an electronic counter and Hb quantitation with cation-exchange high performance liquid chromatography (HPLC). Results: The mean time-averaged mean of the maximum velocity (TAMV) was significantly higher in the SCD group than the controls, but was normal (<170 cm/second) in all. The mean values were comparable among the SS and Sβ0 thal groups. Five (11.1%) patients had SBI and all were between 12 and 16 years of age. There was no significant difference of TAMV in this group compared to those without infarcts. No patient showed evidence of stenosis or any other abnormalities in the circle of Willis vessels. Conclusion: The mild phenotype among Kuwaiti patients with SCD is reflected in normal TCD velocities and a low prevalence of SBI in children with the disease. December 2013 KUWAIT MEDICAL JOURNAL 361 Forthcoming Conferences and Meetings

Compiled and edited by Babichan K Chandy

Kuwait Medical Journal 2013; 45 (4): 361 - 370

After All the Treatment: Delayed Effects of Disease & 2014 Progress and Controversies in Gynecologic Treatment on Individuals Who Have Had Head & Neck Oncology Conference Cancer Jan 24 – 25, 2014 Jan 20, 2014 Spain / Barcelona United Kingdom / London Contact: prIME Oncology Contact: Education and Conference Centre, Royal Email: [email protected] Marsden Phone: 011-44-20-7808-2921 or 2924 22nd Brussels Hand/Upper Limb Symposium: Tendon Email: [email protected] Disorder & Injuries at the Upper Limb: Basic Knowledge, Advances in Diagnosis & Treatment Orbital, Lacrimal & Ophthalmic Plastic Surgery Jan 24 - 25, 2014 Jan 20 - 24, 2014 Belgium / Brussels Malta / Valletta Contact: Mrs L Ectors, Congress Secretariat, King Contact: European School for Advanced Studies in Conventions Ophthalmology Phone: 011-32-9-235-2295, Fax: 011-32-9-233-8597 Phone: 011-41-91-921-1154 Email: [email protected]

16th International Conference on Dialysis: Advances in Transoral Laser Microsurgery for the Management of Chronic Kidney Disease Tumours of the Upper Aerodigestive Tract Jan 22 - 24, 2014 Jan 25 -27, 2014 United States / Nevada / Las Vegas United Kingdom / Liverpool Contact: Ingrid Adelsberger, Renal Research Institute Contact: Royal College of Surgeons of England Phone: 646-672-4059, Fax: 646-672-4174 Phone: 011-44-20-7869-6300 Email: [email protected] Email: [email protected]

9th International Conference on Cell Therapy for 15th International Colorectal Forum Cardiovascular Disease Jan 26 - 28, 2014 Jan 22 - 24, 2014 Switzerland / Verbier United States / New York / New York Contact: Congress Organizer , M&S Event Services SA Contact: Cardiovascular Research Foundation Phone: 011-41-27-771-8585, Fax: 011-41-27-771-8586 Phone: 646-434-4386 Email: [email protected]

1st World Congress on Controversies in Multiple Musculosketal MR Imaging Myeloma Jan 26 - 28, 2014 Jan 23 - 25, 2014 United States / California / Rancho Mirage Thailand / Bangkok Contact: Office of Continuing Medical Education, Contact: Congress Secretariat, ComtecMed University of California San Francisco Phone: 011-972-3-566-6166, Fax: 011-972-3-566-6177 Phone: 415-476-4251, Fax: 415-476-0318 Email: [email protected] Email: [email protected]

2014 Controversies and Updates in Vascular Surgery MRI of the Joints (CACVS) Congress Jan 27 - 31, 2014 Jan 23 - 25, 2014 Austria / Vienna France / Paris Contact: Walter Rijsselaere, Department of Radiology, Contact: divine [id] UZ Brussel Phone: 011-33-4-9157-1960, Fax: 011-33-4-9157-1961 Phone: 011-32-2-477-5322, Fax: 011-32-2-477-5622 Email: [email protected] Email: [email protected] 362 Forthcoming Conferences and Meetings December 2013

Update in General Internal Medicine for Specialists USICON 2014: National Conference of Urological Jan 27 - 31, 2014 Society of India (USI) United States / Massachusetts Jan 30 - Feb 2, 2014 Contact: Department of Continuing Education, Harvard India / New Delhi Medical School Contact: Prof. Dr. D. Ramesh, Honorary Secretary, USI Phone: 617-384-8600 Phone: 011-91-80-2218-3065 Email: [email protected] Email: [email protected]

2014 Better Breathing Conference 33rd Annual Advanced Nephrology: Nephrology for the Jan 30 - Feb 1, 2014 Consultant Canada / Ontario / Toronto Jan 31 - Feb 2, 2014 Contact: John Chenery, Communications Manager , United States / California / San Diego Nephrology Ontario Lung Association Contact: Kevin Bentz, Meeting Planner , UC San Diego Phone: 416-864-9911 ext. 292, Fax: 416-864-9916 Continuing Medical Education Email: [email protected] Phone: 619-543-7602, Fax: 619-543-7610 Email: [email protected] 2014 Rome Cardiology Forum Jan 30 - Feb 1, 2014 Hot Topics and Practical Approaches in Mental Health Italy / Rome Jan 31, 2014 Contact: Cristiana Tugnoli, Organizing Secretariat , Canada / British Columbia / Vancouver Devital Service S.p.A. Contact: University of British Columbia Phone: 011-39-2-4331-9223, Fax: 011-39-2-4851-3353 Phone: 604-875-5101, Fax: 604-875-5078 Email: [email protected] Email: [email protected]

2nd International Conference on Nutrition and Growth Radiology Errors Jan 30 - Feb 1, 2014 Jan 31, 2014 United Kingdom / London Spain / Barcelona Contact: Education Events, British Institute of Contact: Vanessa Fisher, APM , Kenes International Radiology Phone: 011-41-22-908-0488, Fax: 011-41-22-906-9140 Phone: 011-44-20-3668-2220, Fax: 011-44-20-3411-6354 Email: [email protected] Email: [email protected] 2nd International Science Symposium on HIV & Innovations in Advanced Therapeutic Endoscopy & Infectious Diseases (HIV Science 2014) Endoscopic Resection Techniques Jan 30 - Feb 1, 2014 Feb 1 - 3, 2014 India United States / Florida Contact: HIV Science 2014 Organizing Secretary, YRG Contact: Christopher Black, Continuing Medical Care Education , University of Florida Phone: 011-914-4-3910-6802 Phone: 352-273-9475 Email: [email protected] Email: [email protected]fl.edu

Angiogenesis and Leukocytes in Atherosclerosis 5th Advanced Course in Knee Surgery Jan 30 - 31, 2014 Feb 2 - 7, 2014 Switzerland / Geneva France / Val d’Isère Contact: Abcam Events Team Contact: Frédéric Cretin / Gaëlle Busi , Centre de Phone: 011-44-12-2369-6000 Congres et de Seminaires Henri Oreiller Email: [email protected] Phone: 011-33-4-7906-2123, Fax: 011-33-4-7906-1904 Email: [email protected] Endoscopic Ultrasound in the Diagnosing & Staging of Lung Cancer Neurology and Pain Management Australia & New Jan 30 - Feb 1, 2014 Zealand Cruise Denmark / Copenhagen Feb 2 - 16, 2014 Contact: European Respiratory Society Australia / Sydney Fax: 011-41-21-213-0100 Contact: University at Sea, Continuing Education, Inc. Email: [email protected] Phone: 800-422-0711, 2014 December 2013 KUWAIT MEDICAL JOURNAL 363

34th Annual Meeting of Society for Maternal-Fetal 7th International Conference on Advanced Technologies Medicine (SMFM) & Treatments for Diabetes Feb 3 - 8, 2014 Feb 5 - 8, 2014 United States / Louisiana / New Orleans Austria / Vienna Contact: SMFM Contact: Tammy Lessick , Kenes International Phone: 202-863-2476, Fax: 202-554-1132 Phone: 011-41-22-908-0488, Fax: 011-41-22-906-9140 Email: [email protected] Email: [email protected]

Geriatrics and Rheumatology: Practical Topics in 3rd Systemic Sclerosis World Congress Overlapping Specialties Feb 6 – 8, 2014 Feb 3 - 7, 2014 Italy / Rome United States / Florida / Sarasota Contact: Organizing Secretariat , AIM Congress – Rome Contact: Tara Esteves , Live CME Administrator , Office American Medical Seminars, Inc. Phone: 011-39-6-330-531, Fax: 011-39-6-330-532-49 Phone: 866-267-4263 (TOLL FREE) or 941-388-1766, Fax: Email: [email protected] 941-365-7073 Email: [email protected] 72nd All India Ophthalmological Conference Feb 6 – 9, 2014 Head & Neck MRI India / Agra Feb 3 – 7, 2014 Contact: Prof. S.K. Satsangi, Chief Organizing Secretary, Belgium / Brugge AIOC-2014 , Sarojini Naidu Medical College Contact: Mrs. Valérie Schotte, Department of Radiology, Phone: 011-91-562-645-0597 A.Z. St.- Jan Brugge Email: [email protected] Fax: 011-32-50-452-146 Email: [email protected] Endovascular Aneurysm Repair (EVAR) Planning for Endovascular Surgeons Medical Retina Feb 6 - 7, 2014 Feb 3 - 7, 2014 United Kingdom / Edinburgh Switzerland / Lugano Contact: Education Section , Royal College of Surgeons Contact:, European School for Advanced Studies in of Edinburgh Ophthalmology Phone: 011-44-13-1527-1600 Phone: 011-41-91-921-1154 Email: [email protected] Musculoskeletal MRI of the Joints Thromboprophylaxis in General Medicine and Feb 3 - 7, 2014 Obstetrics Austria / Vienna Contact: H. Fischer, I. Fischer, Chr. Arnecker Feb 6, 2014 Fax: 011-43-1-40-400-4898 United Kingdom / Leeds Email: [email protected] Contact: Hartley Taylor Medical Communications Ltd Phone: 011-44-15-6562-1967 Short Course on Abdominal Ultrasound in Infectious Email: offi[email protected]

Diseases & Tropical Medicine th Feb 3 - 14, 2014 11 International Winter Arrhythmia School Italy / Pavia Feb 7 – 9, 2014 Contact: Silvia Bensi, Ms, University of Pavia Canada / Ontario / Collingwood Fax: 011-39-3-8250-2296 Contact: Linda Liu, Organizer, University of Toronto Email: [email protected] Phone: 416-480-6100 ext. 7537 Email: [email protected] 25th International Congress on Anti-Cancer Treatment Feb 4 - 6, 2014 2014 Electives in Hand Surgery France / Paris Feb 7 - 8, 2014 Contact: Valérie Caillon, Organisation Committee , United States / Louisiana / New Orleans International Medical Events Contact: American Society for Surgery of the Hand Phone: 011-33-1-4743-5084, Fax: 011-33-1-4743-2226 Phone: 312-880-1900, Fax: 847-384-1435 Email: [email protected] Email: [email protected] 364 Forthcoming Conferences and Meetings December 2013

Rheumatology and Musculoskeletal Medicine for 10th Asia Pacific Congress of Hypertension Primary Care Feb 12 - 15, 2014 Feb 7 - 9, 2014 Philippines / Cebu City United States / California / Palm Springs Contact: Shidah Isa, APM, Kenes Asia Contact: Medical Education Resources, Inc. Phone: 011-65-6292-4710, Fax: 011-65-6292-4721 Phone: 800-421-3756 or 303-798-9682, Fax: 303-798-5731 Email: [email protected] Email: [email protected] 37th Annual Advanced Ultrasound Seminar: Obs/Gyn Diagnosis & Treatment of Myofascial Pain Syndromes: Feb 12 - 15, 2014 An Introductory Course United States / Florida / Orlando Feb 8 - 9, 2014 United States / New Mexico / Albuquerque Contact: American Institute of Ultrasound in Medicine Contact: Continuing Medical Education, University of Phone: 800-638-5352 or 301-498-4100, Fax: 301-498-4450 New Mexico Email: [email protected] Phone: 505-272-3942, Fax: 505-272-8604 Email: [email protected] Asian American MultiSpecialty Summit VI: Laparoscopy & Minimally Invasive Surgery Hand and Upper Extremity Update Feb 12 - 15, 2014 Feb 8, 2014 United States / Hawaii / Honolulu Canada / Ontario / Toronto Contact: Society of Laparoendoscopic Surgeons Contact: Continuing Education & Professional Phone: 305-665-9959, Fax: 305-667-4123 Development , University of Toronto Email: [email protected] Phone: 888-512-8173 or 416-978-2719 Email: [email protected] 26th Lorne Cancer Conference

th Feb 13 - 15, 2014 11 International Symposium on GnRH: Hypothalamic- Australia / Lorne Pituitary-Gonadal Axis in Cancer & Reproduction Contact: ASN Events Pty Ltd Feb 9 - 11, 2014 Phone: 011-61-3-9329-6600 Austria / Salzburg Contact: Ronit Eisenbach, APM , Kenes International Fax: 011-61-3-9329-1777 Phone: 011-41-22-908-0488, Fax: 011-41-22-906-9140 nd Email: [email protected] 2 Scientific Meeting of Canadian Retina Society (CRS) Current Concepts in Neuro and Musculoskeletal Feb 13 - 16, 2014 Imaging Canada / British Columbia / Whistler Feb 9 - 14, 2014 Contact: Rita Afeltra , CRS United States / Hawaii / Kohala Coast Phone: 613-729-6779 ext. 300 Contact: Office of Continuing Medical Education, Email: [email protected] University of California San Francisco Phone: 415-476-4251, Fax: 415-476-0318 3rd Global Congress for Consensus in Pediatrics & Child Email: [email protected] Health Feb 13 - 16, 2014 2014 Neuro/ENT at the Beach Thailand / Bangkok Feb 10 - 13, 2014 Contact: Karen Davidson, Conference secretariat , Florida / Palm Beach Paragon Conventions Contact: Wendy Ryals, Office Manager, IICME Phone: 011-41-22-533-0948, Fax: 011-41-22-580-2953 Phone: 205-467-0290, Fax: 205-467-0195 Email: [email protected] Email: [email protected]

th 25th Jagelman / 35th Turnbull International Colorectal 20 Annual Advances in Diagnosis & Treatment of Disease Symposium Sleep Apnea & Snoring Feb 11 - 16, 2014 Feb 14 – 15, 2014 United States / Florida / Fort Lauderdale United States / California / San Francisco Contact: Sandy Ronnenberg, CME Project Manager , Contact: Office of Continuing Medical Education, Cleveland Clinic Florida, CME Department University of California, San Francisco Phone: 954-659-5490, Fax: 954-659-5491 Phone: 415-476-4251; Fax: 415-476-0318 Email: [email protected] Email: [email protected] December 2013 KUWAIT MEDICAL JOURNAL 365

27th Annual State-of-the-Art Echocardiography Internal Derangements of Joints: Advanced & Intensive Feb 14 – 18, 2014 MR Imaging Course United States / Arizona / Scottsdale Feb 16 – 20, 2014 Contact: American Society of Echocardiography United States / California / San Diego Phone: 919–861-5574, Fax: 919-882-9900 Contact: Wendy Ryals, Office Manager, IICME Email: [email protected] Phone: 205-467-0290, Fax: 205-467-0195 Email: [email protected] 14th Annual International Symposium on Congenital Heart Disease Medical CBT: Ten-Minute Techniques for Real Doctors Feb 15 – 18, 2014 (cognitive behavior therapy) United States / Florida / St. Petersburg Feb 17 – 19, 2014 Contact: Allison Madden, CME Coordinator , All United States / Hawaii / Honolulu Children’s Hospital Contact: Greg Dubord, MD, CME Director, CBT Phone: 727-767-2525 Canada Email: [email protected] Phone: 877-466-8228 Email: [email protected] 2014 Advances in Abdominal, Cardiothoracic, Musculoskeletal & Neuro Imaging th 10 Annual Update in Nuclear Cardiology Feb 15 – 18, 2014 Feb 18, 2014 Bahamas / Paradise Island United States / Pennsylvania / Philadelphia Contact: Department of Radiology, Duke University Contact: Cardiovascular Institute of Philadelphia School of Medicine Phone: 215-389-2300, Fax: 215-389-5450 Phone: 919-684-2711 Email: [email protected] 2014 Clinical Hematology and Oncology Feb 15 – 18, 2014 2014 Sarcoma and GIST United States / California / San Diego Feb 18 – 19, 2014 Contact: Scripps Conference Services Italy / Milan Phone: 858-652-5400 Contact: Nicole Bullo, Conference Secretariat , European Email: [email protected] Society for Medical Oncology Phone: 011-41-91-973-1939, Fax: 011-41-91-973-1918 American College of Surgeons Thyroid & Parathyroid th Ultrasound Skills-Oriented Course 13 Genoa Meeting on Hypertension, Diabetes and Feb 15 – 16, 2014 Renal Diseases United States / Hawaii / Honolulu Feb 20 – 22, 2014 Contact: Office of Continuing Medical Education, Italy / Genoa University of California San Francisco Contact: Organizing Secretariat, aristea Phone: 415-476-4251, Fax: 415-476-0318 Phone: 011-39-10-55-3591, Fax: 011-39-10 55-35970 Email: [email protected] Email: [email protected]

2014 Lorne Genome Conference 19th World Congress on Controversies in Obstetrics, Feb 16 – 19, 2014 Gynecology & Infertility (COGI) Australia / Lorne Feb 20 – 23, 2014 Contact: ASN Events Pty Ltd China / Macau Phone: 011-61-3-5983-2400 Contact: Ruthi Yahav, Secretariat, CongressMed Email: [email protected] Phone: 011-972-73-706-6950, Fax: 011-972-73-706-6959 Email: [email protected] Infectious Diseases in Clinical Practice: Update on Inpatient & Outpatient Infectious Diseases 2014 Kyoto Breast Cancer Consensus Conference Feb 16 – 21, 2014 (KBCCC) United States / Hawaii / Kauai Feb 20 – 22, 2014 Contact: Office of Continuing Medical Education , Japan / Kyoto University of California San Francisco Contact: David Graham, Secretariat, KBCCC Phone: 415-476-4251, Fax: 415-476-0318 Phone: 011-81-75-761-5751, Fax: 011-81-75-761-5718 Email: [email protected] Email: [email protected] 366 Forthcoming Conferences and Meetings December 2013

3rd International Meeting on Cardiac Problems in Primary Care Geriatrics Review Hawaiian Islands Pregnancy Cruise Feb 20 – 23, 2014 Feb 22 - Mar 1, 2014 Italy / Venice United States / Hawaii / Honolulu Contact: Shirley Dinenson, Conference Secretariat, Contact: Continuing Education, Inc. , Meeting Planner , Paragon Conventions Continuing Education, Inc. Phone: 011-41-22-533-0948, Fax: 011-41-22-580-2953 Phone: 800-422-0711, Fax: 727-522-8304 Email: [email protected] Email: [email protected]

th 17 Annual Conference of Indian Association of th Cardiovascular Thoracic Anaesthesiologists 11 Annual Critical Care Conference Feb 21 – 23, 2014 Feb 25 – 28, 2014 India / Mumbai Canada / British Columbia Contact: Dr. Uday Gandhe, Organising Secretary, Contact: Zena Davidson, Conference Coordinator Variance Conference and Events Private Limited Phone: 604-834-9362 Phone: 011-91-22-2494-0518, 011-91-77-3879-6785, Fax: Email: [email protected] 011-91-22-2494-0517 Email: [email protected] 2014 Combined Spine Conference of Canadian Spine Society (CSS), New Zealand Orthopaedic Spine Society 17th Annual Women’s Imaging: Advances in & Spine Society of Australia Gynaecologic Imaging & First Trimester Ultrasound Feb 25 - Mar 1, 2014 Feb 21 – 23, 2014 Canada / Alberta / Lake Louise Canada / Ontario / Toronto Contact: Jennifer Edwards , CSS Contact: Elizabeth Gan, CME Administrative Course Phone: 519-986-1459 Director, Dept. of Ob/Gyn, University of Toronto - Dept. Email: [email protected] of Ob/Gyn and the Dept. of Medical Imaging Phone: 416-586-4800 ext. 2489, Fax: 416-586-5958 9th Annual Biomarkers Congress Email: [email protected] Feb 25 – 26, 2014 19th ESRA Cadaver Workshop United Kingdom / Manchester Feb 21 – 22, 2014 Contact: Danielle Dalby, Marketing Executive, Oxford Austria Global Contact: Rachel Zablow Katzir, APM, Kenes Email: [email protected] International Phone: 011-41-22-908-0488, Fax: 011-41-22-906-9140 2014 Blood and Marrow Transplantation (BMT) Email: [email protected] Tandem Meetings Feb 26 - Mar 2, 2014 2014 Pathology Update United States / Texas / Grapevine Feb 21 – 23, 2014 Contact: BMT Tandem Meetings Australia / Melbourne Email: [email protected] Contact: Eve Propper, Events and Sponsorship Manager , Royal College of Pathologists of Australasia 9th International Breast Cancer Congress Phone: 011-61-2-8356-5806 Feb 26 – 28, 2014 Email: [email protected] Iran / Tehran th Active Surveillance for Low Risk Prostate Cancer Contact: 9 International Breast Cancer Congress , Feb 21 – 22, 2014 Breast Cancer Congress , Shahid Beheshti University of Netherlands / Amsterdam Medical Sciences Tehran, Iran Contact: European School of Oncology Phone: 011-98-21-2274-8001 ext. 2 Phone: 011-39-2-854-6451 Fax: 011-98-21-2272-4090 Fax: 011-39-2-8546-4545 Email: [email protected] Email: [email protected] Cellular Heterogeneity in the Tumor Neurology/Psychiatry for Primary Care Microenvironment Feb 21 – 23, 2014 Feb 26 - Mar 1, 2014 United States / Nevada / Las Vegas United States / California / San Diego Contact: Medical Education Resources, Inc. Contact: American Association for Cancer Research Phone: 800-421-3756 or 303-798-9682, Fax: 303-798-5731 Phone: 215-440-9300, Fax: 215-351-9165 Email: [email protected] Email: [email protected] December 2013 KUWAIT MEDICAL JOURNAL 367

Infant, Child and Adolescent Medicine Cool Topics in Neonatology Feb 26 - Mar 1, 2014 Feb 28 - Mar 2, 2014 United States / California / Indian Wells United States / California / San Diego Contact: American Academy of Family Physicians Contact: Office of Continuing Medical Education, Phone: 800-274-2237 or 913-906-6000 UCLA Fax: 913-906-6075 Phone: 310-794-2620, Fax: 310-794-2624 2014 Chronic Total Occlusion and Left Main Summit Multi-parametric MRI of the Prostate: Paradigm Shift in Feb 27 - Mar 1, 2014 United States / New York / New York the Management of Prostate Cancer Contact: Cardiovascular Research Foundation Feb 28 , 2014 Phone: 646-434-4386 United Kingdom / London Contact: Education Events, British Institute of 2nd International Conference on Heart & Brain Radiology Feb 27 - Mar 1, 2014 Phone: 011-44-20-3668-2220, Fax: 011-44-20-3411-6354 France / Paris Email: [email protected] Contact: Ronit Eisenbach , APM , Kenes International Phone: 011-41-22-908-0488 Treating the Addictions Psychiatry Fax: 011-41-22-906-9140 Feb 28 - Mar 1, 2014 Email: [email protected] United States / Massachusetts / Boston Contact: Department of Continuing Education, Harvard 6th Advances Against Aspergillosis Feb 27 - Mar 1, 2014 Medical School Spain / Madrid Phone: 617-384-8600, Fax: 617-384-8686 Contact: Hartley Taylor Medical Communications Ltd Email: [email protected] Phone: 011-44-15-6562-1967 Email: [email protected] Beyond LDL Cholesterol: Risk Assessment & Biomarkers in Special Populations Non - Melanoma Skin Cancer Meeting Mar 1, 2014 Feb 27, 2014 United States / Illinois / Chicago United Kingdom / London Contact: Blair Parker, Center for Continuing Medical Contact: Conference and Event Services , British Education, University of Chicago Association of Dermatologists Phone: 773-834-5418 Email: [email protected] Email: [email protected] Sexuality and Learning Disabilities Feb 27, 2014 Orthopaedic Thromboembolic Day United Kingdom / Bristol Mar 4, 2014 Contact: Association for Child & Adolescent Mental United Kingdom / London Health Contact: Hartley Taylor Medical Communications Ltd Phone: 011-44-20-7403-7458 Phone: 011-44-15-6562-1967 Email: [email protected] Email: [email protected]

2014 Excellence in Diabetes 2014 Diabetes UK Professional Conference Feb 28 - Mar 2, 2014 Mar 5 – 7, 2014 Qatar / Doha United Kingdom / Liverpool Contact: Patrizia Schmid, Account Manager, EI Contact: Conference Team, Diabetes UK Congresses & Communications UK Ltd Phone: 011-44-20-7424-1000, Fax: 011-44-20-7424-1080 Phone: 011-44-20-3384-0657, Fax: 011-44-20-8326-5726 Email: [email protected] Email: [email protected]

2014 Masters Experience Knee: Patellofemoral 2014 Faculty of Forensic Psychiatry Annual Conference Feb 28 - Mar 1, 2014 Mar 5 – 7, 2014 United States / Illinois / Rosemont United Kingdom / Belfast Contact: Arthroscopy Association of North America Contact: Royal College of Psychiatrists Phone: 847-292-2262, Fax: 847-292-2268 Phone: 011-44-20-7977-6657 Email: [email protected] Email: [email protected]

368 Forthcoming Conferences and Meetings December 2013

6th UK Thromboprophylaxis Forum Annual Meeting 2014 Asian Pacific Association for the Study of the Mar 5, 2014 Liver United Kingdom / London Mar 12 – 15, 2014 Contact: Hartley Taylor Medical Communications Ltd Australia / Brisbane Phone: 011-44-15-6562-1967 Contact: Sarah Perrott, Gastroeterological Society of Australia Email: [email protected] Email: [email protected]

Essential Medical Dermatology 2014 Gulf Thoracic Congress Mar 5 – 7, 2014 Mar 13 – 15, 2014 United Kingdom / London United Arab Emirates / Dubai Contact: Conference and Event Services, British Contact: Hassan S. Alorainy BsRC, RRT, FAARC , Association of Dermatologists Executive Director , GulfThoracic Congress Email: [email protected] Phone: 011-966-5-199-4114 Email: [email protected] Targeted Anticancer Therapies 2014 UK Chronic Lymphocytic Leukaemia Forum Mar 5 – 7, 2014 Annual Scientific Day United States / District of Columbia / Washington Mar 14, 2014 Contact: Monique de Brabander, Project Manager, United Kingdom / London Congress by design Contact: Hartley Taylor Medical Communications Ltd Phone: 011-31-88-089-8101 Phone: 011-44-15-6562-1967 Email: [email protected] Email: offi[email protected]

2nd International Symposium of Probiotics & Prebiotics 4th Macula & Retina Congress in Pediatrics Mar 14 – 15, 2014 Mar 7 - 9, 2014 United States / Florida / Miami Turkey / Antalya Contact: Josephine Gordon and Hannah Duncan, EuroLam Secretariat Contact: IS3P Organizing Secretariat, Serenas Group Phone: 011-44-78-3022-1032, Fax: 011-44-70-9287-7237 Phone: 011-90-312-440-5011, Fax: 011-90-312-441-4562 Email: [email protected] Email: [email protected] 2014 Nephrology 9th International Symposium on Pneumococci and Mar 16 – 21, 2014 Pneumococcal Diseases United States / Massachusetts / Boston Mar 9 – 13, 2014 Contact: Department of Continuing Education , India / Hyderabad Harvard Medical School Contact: Alizah Davis, APM , Kenes International Phone: 617-384-8600 Phone: 011-41-22-908-0488, Fax: 011-41-22-906-9140 Fax: 617-384-8686 Email: [email protected] Email: [email protected] th st 16 Annual Conference of the International Society for 21 Annual Echocardiographic Workshop on 2-D & Bipolar Disorders Doppler Echocardiography at Vail Mar 18 – 21, 2014 Mar 10 – 13, 2014 South Korea / Seoul United States / Colorado / Vail Contact: Raquel Louis, APM, Kenes International Contact: CV CME, Education, Mayo Clinic Phone: 011-41-22-908-0488 Phone: 507-266-6703, Fax: 507-266-7403 Fax: 011-41-22-906-9140 Email: [email protected] Email: [email protected] 34th International Symposium on Intensive Care & 1st Immunotherapy of Cancer Conference Emergency Medicine Mar 12 – 14, 2014 Mar 18 – 21, 2014 Germany / Munich Belgium / Brussels Contact: Riitta Kettunen, Registrations Coordinator, Contact: Intensive Care Department, Erasme University European Cancer Organisation Hospital, Université Libre de Bruxelles Phone: 011-32-2-775-0205 Fax: 011-32-2-555-4555 Email: [email protected] Email: [email protected] December 2013 KUWAIT MEDICAL JOURNAL 369

10th World Congress on Brain Injury 3rd International Conference on Prehypertension & Mar 19 - 23, 2014 Cardio Metabolic Syndrome United States / California / San Francisco Mar 27 – 30, 2014 Contact: Margaret Roberts, MCC Association Mgt. Poland / Warsaw Phone: 703-960-0027, Fax: 703-960-6603 Contact: Gail Tito, Paragon Group Email: [email protected] Phone: 011-41-22-533-0948 Website: http://www.internationalbrain.org/congress- Email: [email protected] page-tenth-world-congress-on-brain-injury/ 1st International Workshop Intensive Care of the 30th International Congress on Clinical Newborn Neurophysiology Mar 28, 2014 Mar 19 – 23, 2014 Italy Germany / Berlin / Verona Contact: Conventus Congress Management Contact: Organizing Secretariat, AIM Group Phone: 011-49-3641-311-6110, Fax: 011-49-3641-311-6241 International – Florence Office Phone: 011-39-55-233-881, Fax: 011-39-55-390-6908 5th World Congress on Controversies in Ophthalmology Email: [email protected] Mar 20 – 23, 2014 Portugal / Lisbon 40th Annual Meeting of the European Society for Blood Contact: Congress Secretariat, ComtecMed & Marrow Transplantation Email: [email protected] Mar 30 - Apr 2, 2014 Italy / Milan 9th Tuberculosis Symposium Contact: Congress Organizer, MCI Suisse S.A. Mar 20 – 21, 2014 Phone: 011-41-22-339-9581, Fax: 011-41-22-339-9631 United States / Alberta / Edmonton Email: [email protected] Contact: Norma Jean Olivier, Event Coordinator, TB Symposium 2014 5th New Directions in Leukaemia Research Phone: 780-988-0707 Mar 30 - Apr 2, 2014 Email: [email protected] Australia / Noosa Contact: Secretariat, SAPRO Conference Management 2014 CHEST World Congress Phone: 011-61-8-8274-6054, Fax: 011-61-8-8274-6000 Mar 21 – 24, 2014 Spain / Madrid Email: [email protected] Contact: American College of Chest Physicians Phone: 847-498-1400, Fax: 847-498-5460 Cleft & Paediatric Plastic Surgery: Series 3, Course 2 Mar 31 Apr 1, 2014 11th World Congress of International Hepato-Pancreato- United Kingdom / Manchester Biliary Association: IHPBA World Congress 2014 Contact: British Association of Plastic, Reconstructive Mar 22 – 27, 2014 and Aesthetic Surgeons South Korea / Seoul Phone: 011-44-20-7831-5161, Fax: 011-44-20-7831-4041 Contact: IHPBA 2014 Seoul Secretariat , InSession Website: International Convention Services Phone: 011-82-2-3452-7260, Fax: 011-82-2-521-8683 Endoscopic Surgery of the Sinuses & Eustachian Tube Email: [email protected] Mar 31 Apr 2, 2014 United States / Massachusetts / Boston Football Medicine Strategies for Joint & Ligament Contact: Department of Continuing Education, Harvard Injuries Medical School Mar 22 - 23, 2014 Phone: 617-384-8600, Fax: 617-384-8686 Italy / Milan Email: [email protected] Contact: Bologna Isokinetic Srl Email: [email protected] 16th International Congress on Infectious Diseases nd Apr 2 - 5, 2014 2 Asian Congress on Pain Mar 27 – 30, 2014 South Africa / Cape Town Taiwan / Taipei Contact: International Society for Infectious Diseases Contact: Debbie Tang, APM, Kenes Asia Phone: 617-277-0551 Phone: 011-65-6393-0235, Fax: 011-65-6292-7577 Fax: 617-278-9113 Email: [email protected] Email: [email protected] 370 Forthcoming Conferences and Meetings December 2013

10th Australasian Lymphology Association Conference Interstitial Lung Diseases Apr 3 - 5 Apr 3 – 5, 2014 New Zealand / Auckland Germany / Heidelberg Contact: Conference Office, Think Business Events Contact: European Respiratory Society Phone: 011-61-3-9417-1350, Fax: 011-61-3-8610-2170 Fax: 011-41-21-213-0100 Email: [email protected] Email: [email protected]

th 12 Anti-Aging Medicine World Congress Palliative Care for Hospitalists and Intensivists Apr 3 – 5 Apr 3 – 5, 2014 Canada / Monaco / Monte Carlo United States / Massachusetts / Boston Contact: EuroMediCom Contact: Department of Continuing Education, Phone: 011-33-1-5683-7800, Fax: 011-33-1-5683-7805 Harvard Medical School

th Phone: 617-384-8600, Fax: 617-384-8686 2014 39 Annual Meeting of Society for Sex Therapy & Email: [email protected] Research (SSTAR) Apr 3 – 5, 2014 5th Congress of the Asia Pacific Initiative on United States / Pennsylvania / Pittsburgh Reproduction Contact: SSTAR Apr 4 – 6, 2014 Phone: 847-647-8832 Australia / Brisbane Email: [email protected] Contact: Malou Guevarra, APM , Kenes Asia Phone: 011-65-6292-4710, Fax: 011-65-6292-4721 2014 Pediatric Rheumatology Symposium Email: [email protected] Apr 3 – 6, 2014

United States / Florida / Orlando th Contact: American College of Rheumatology 36 Charing Cross Symposium Phone: 404-633-3777, Fax: 404-633-1870 Apr 5 – 8, 2014 Email: [email protected] United Kingdom / London Contact: BIBA? Medical Ltd. 2014 Peptides Congress Phone: 011-44-20-7736-8788, Fax: 011-44-20-7736-8283 Apr 3 – 4, 2014 Email: [email protected] United Kingdom / London th Contact: Ross McIvor, Senior Marketing Manager , 9 Annual Musculoskeletal Ultrasound Oxford Global Apr 5 – 9, 2014 Email: [email protected] United States / California / San Diego Contact: Wendy Ryals, Office Manager, IICME 3rd International Congress on Epilepsy, Brain and Mind Phone: 205-467-0290, Fax: 205-467-0195 Apr 3 – 5, 2014 Email: [email protected] Czech Republic / Brno Contact: Congress Secretariat, GUARANT 5th International Congress on Physical Activity and International Public Health Phone: 011-420-284-001-444 Apr 8 – 11, 2014 Email: [email protected] Brazil / Rio de Janeiro Contact: CCM Worldwide Medical Congresses 6th International Conference on Advances in Diabetes & Phone: 011-55-51-3028-3878, Fax: 011-55-51-3028-3879 Insulin Therapy Apr 3 - 5, 2014 8th World Congress for NeuroRehabilitation Serbia / Belgrade Apr 8 – 12, 2014 Contact: etouches European Headquarters Turkey / Istanbul Phone: 011-44-84-5077-2804 Contact: Serenas Tourism Phone: 011-90-312-440-5011, Fax: 011-90-312-441-4563 th 7 Annual Proteins & Antibodies Congress Email: [email protected] Apr 3 – 4, 2014 United Kingdom / London Contact: Danielle Dalby, Marketing Manager, Oxford Global Phone: 011-44-18-6524-8455, Fax: 011-44-18-6525-0985 Email: [email protected] December 2013 KUWAIT MEDICAL JOURNAL 371

WHO-Facts Sheet

1. Rabies 2. Echinococcosis 3. Dengue and Severe Dengue

Compiled and edited by Babichan K Chandy

Kuwait Medical Journal 2013, 45 (4): 371 - 376

1. RABIES • Every year, more than 15 million people worldwide receive a post-exposure vaccination to prevent the Overview disease– this is estimated to prevent hundreds of Rabies is a zoonotic disease (a disease that is thousands of rabies deaths annually. transmitted to humans from animals) that is caused by a virus. The disease affects domestic and wild Symptoms animals, and is spread to people through close contact The incubation period for rabies is typically 1 – 3 with infectious material, usually saliva, via bites or months, but may vary from <1 week to >1 year. The scratches. initial symptoms of rabies are fever and often pain Rabies is present on all continents with the or an unusual or unexplained tingling, pricking or exception of Antartica, but more than 95% of human burning sensation (paraesthesia) at the wound site. deaths occur in Asia and Africa. Once symptoms of the As the virus spreads through the central nervous disease develop, rabies is nearly always fatal. system, progressive, fatal inflammation of the brain Rabies is a neglected disease of poor and vulnerable and spinal cord develops. populations whose deaths are rarely reported. It occurs Two forms of the disease can follow. People with mainly in remote rural communities where measures furious rabies exhibit signs of hyperactivity, excited to prevent dog to human transmission have not been behaviour, hydrophobia and sometimes aerophobia. implemented. Under-reporting of rabies also prevents After a few days, death occurs by cardio-respiratory mobilization of resources from the international arrest. community for the elimination of human dog-mediated Paralytic rabies accounts for about 30% of the total rabies. number of human cases. This form of rabies runs a less dramatic and usually longer course than the furious KEY FACTS form. The muscles gradually become paralyzed, • Rabies occurs in more than 150 countries and starting at the site of the bite or scratch. A coma slowly territories. develops, and eventually death occurs. The paralytic • More than 55,000 people die of rabies every year form of rabies is often misdiagnosed, contributing to mostly in Asia and Africa. the under-reporting of the disease. • 40% of people who are bitten by suspect rabid animals are children under 15 years of age. Diagnosis • Dogs are the source of the vast majority of human No tests are available to diagnose rabies infection in rabies deaths. humans before the onset of clinical disease, and unless • Wound cleansing and immunization within a few the rabies-specific signs of hydrophobia or aerophobia hours after contact with a suspect rabid animal can are present, the clinical diagnosis may be difficult. prevent the onset of rabies and death. Human rabies can be confirmed intra-vitam and post

Address correspondence to: Office of the Spokesperson, WHO, Geneva. Tel.: (+41 22) 791 2599; Fax (+41 22) 791 4858; Email: [email protected]; Web site: http://www.who.int/ 372 WHO-Facts Sheet December 2013 mortem by various diagnostic techniques aimed at flushing and washing of the wound for a minimum of detecting whole virus, viral antigens or nucleic acids 15 minutes with soap and water, detergent, povidone in infected tissues (brain, skin, urine or saliva). iodine or other substances that kill the rabies virus.

Transmission Recommended PEP People are usually infected following a deep bite PEP depends on the type of contact with the or scratch by an infected animal. Dogs are the main suspected rabid animal (see table below). host and transmitter of rabies. They are the source of infection in all of the estimated 50,000 human rabies All category II and III exposures assessed as deaths annually in Asia and Africa. carrying a risk of developing rabies require PEP. This Bats are the source of most human rabies deaths in risk is increased if: the Americas. Bat rabies has also recently emerged as a • the biting mammal is a known rabies reservoir or public health threat in Australia and western Europe. vector species; Human deaths following exposure to foxes, raccoons, • the animal looks sick or has an abnormal skunks, jackals, mongooses and other wild carnivore behaviour; host species are very rare. • a wound or mucous membrane was contaminated Transmission can also occur when infectious by the animal’s saliva; material – usually saliva – comes into direct contact • the bite was unprovoked; and with human mucosa or fresh skin wounds. Human- • the animal has not been vaccinated. to-human transmission by bite is theoretically possible In developing countries, the vaccination status of but has never been confirmed. the suspected animal alone should not be considered Rarely, rabies may be contracted by inhalation of when deciding whether to initiate prophylaxis or not. virus-containing aerosol or via transplantation of an infected organ. Ingestion of raw meat or other tissues Who is most at risk? from animals infected with rabies is not a source of Dog rabies potentially threatens over 3 billion human infection. people in Asia and Africa. People most at risk live in rural areas where human vaccines and immunoglobulin Post-exposure prophylaxis (PEP) are not readily available or accessible. Post-exposure prophylaxis (PEP) consists of: Poor people are at a higher risk, as the average cost • local treatment of the wound, initiated as soon as of rabies post-exposure prophylaxis after contact with possible after exposure; a suspected rabid animal is US$ 40 in Africa and US$ • a course of potent and effective rabies vaccine that 49 in Asia, where the average daily income is about meets WHO recommendations; and US$ 1–2 per person. • the administration of rabies immunoglobulin, if Although all age groups are susceptible, rabies indicated. is most common in children aged under 15. On an average, 40 % of post-exposure prophylaxis regimens Effective treatment soon after exposure to rabies are given to children aged 5–14 years, and the majority can prevent the onset of symptoms and death. are male. Anyone in continual, frequent or increased danger Local treatment of the wound of exposure to rabies virus – either by nature of their Removing the rabies virus at the site of the infection residence or occupation – is also at risk. Travellers with by chemical or physical means is an effective means extensive outdoor exposure in rural, high-risk areas of protection. Therefore, prompt local treatment of all where immediate access to appropriate medical care bite wounds and scratches that may be contaminated may be limited should be considered at risk regardless with rabies virus is important. Recommended first- of the duration of their stay. Children living in or aid procedures include immediate and thorough visiting rabies-affected areas are at particular risk.

Table: Categories of contact and recommended post-exposure prophylaxis (PEP)

Categories of contact with suspect rabid animal Post-exposure prophylaxis measures Category I – touching or feeding animals, licks on intact skin None Category II – nibbling of uncovered skin, minor scratches or abrasions Immediate vaccination and local treatment of the wound without bleeding Category III – single or multiple transdermal bites or scratches, licks Immediate vaccination and administration of rabies on broken skin; contamination of mucous membrane with saliva from immunoglobulin; local treatment of the wound licks, contacts with bats December 2013 KUWAIT MEDICAL JOURNAL 373

Prevention and public health relevance in humans, are cystic Eliminating rabies in dogs: Rabies is a vaccine- echinococcosis and alveolar echinococcosis. preventable disease. The most cost-effective strategy for preventing rabies in people is by eliminating rabies KEY FACTS in dogs through vaccination. Vaccination of animals • Human echinococcosis is a parasitic disease caused (mostly dogs) has reduced the number of human (and by tapeworms of the genus Echinococcus. animal) rabies cases in several countries, particularly • The two most important forms of the disease in in Latin America. However, recent increases in human humans are cystic echinococcosis (hydatidosis) and rabies deaths in parts of Africa, Asia and Latin America alveolar echinococcosis. suggest that rabies is re-emerging as a serious public • Humans are infected through ingestion of parasite health issue. Preventing human rabies through control eggs in contaminated food, water or soil, or through of domestic dog rabies is a realistic goal for large direct contact with animal hosts. parts of Africa and Asia, and is justified financially • Echinococcosis is often expensive and complicated by the future savings of discontinuing post-exposure to treat, and may require extensive surgery and/or prophylaxis for people. prolonged drug therapy. • Prevention programs involve deworming of Preventive immunization in people: Safe, effective dogs, improved slaughterhouse hygiene, and vaccines can be used for pre-exposure immunization. public education campaigns; vaccination of lambs This is recommended for travellers spending a lot of is currently being evaluated as an additional time outdoors, especially in rural areas, involved in intervention. activities such as bicycling, camping, or hiking as well • WHO is working towards the validation of effective as for long-term travellers and expatriates living in cystic echinococcosis control strategies by 2018. areas with a significant risk of exposure. Pre-exposure immunization is also recommended for people in Transmission certain high-risk occupations such as laboratory The life-cycle of Echinococcus granulosus occurs workers dealing with live rabies virus and other rabies- between domestic or wild carnivores, such as dogs, related viruses (lyssaviruses), and people involved in foxes, wolves, jackals, hyenas and cats (definitive any activities that might bring them professionally or hosts), and sheep, goats, cattle, pigs, yaks or other farm otherwise into direct contact with bats, carnivores, and animals (intermediate hosts). Cystic echinococcosis is other mammals in rabies-affected areas. As children principally maintained in a dog–sheep–dog cycle. are considered at higher risk because they tend to play Humans are accidental intermediate hosts and become with animals, may receive more severe bites, or may not infected through the ingestion of soil, water or food report bites, their immunization could be considered if (e.g. vegetables) contaminated with the parasite’s eggs living in or visiting high risk areas. shed in the faeces of the carnivores. Humans can also be infected by hand-to-mouth transfer of eggs after contact with the contaminated fur of a carnivore (most commonly, a dog). 2. ECHINOCOCCOSIS Carnivores become infected when they ingest the Overview organs of intermediate hosts that harbour the larval Human echinococcosis is a zoonotic disease (a stages of the parasite (hydatids, or hydatid cysts). In disease that is transmitted to humans from animals) the carnivore, the cysts develop into adult worms and that is caused by parasites, namely tapeworms of the live in the intestines where they produce eggs that genus Echinococcus. Echinococcosis occurs in four are passed in the faeces, contaminating the ground. forms: Intermediate hosts ingest eggs in the contaminated • cystic echinococcosis, also known as hydatid ground, the eggs develop into cysts, and the cycle disease or hydatidosis, caused by infection with continues. Echinococcus granulosus; Transmission of E. multilocularis to humans occurs • alveolar echinococcosis, caused by infection with E. through ingestion of soil, food or water contaminated multilocularis; with the parasite’s eggs shed in the faeces of foxes and • polycystic echinococcosis, caused by infection with other canids, including domestic dogs and, to a lesser E. vogeli; extent, cats. Humans may also become infected by • unicystic echinococcosis, caused by infection with hand-to-mouth transfer of eggs after contact with the E. oligarthrus. contaminated fur of foxes, dogs or cats. Intermediate The two most important forms, which are of medical hosts are small mammals (rodents and lagomorphs). 374 WHO-Facts Sheet December 2013

Signs and symptoms (CT) and/or magnetic resonance imaging (MRI) Human infection with E. granulosus leads to the scans. development of one or more hydatids located mainly Sometimes, cysts can be incidentally discovered in the liver and lungs, and less frequently in the bones, by radiography. Specific antibodies are detected by kidneys, spleen, muscles, central nervous system, and different serological tests and can support diagnosis. eyes. Biopsies and ultrasound-guided punctures may also The asymptomatic incubation period of the disease be performed for differential diagnosis of cysts from can last many years until hydatid cysts grow to an tumours and abscesses. extent that triggers clinical signs. Non-specific signs include anorexia, weight loss and weakness. Other Treatment signs depend on the location of the hydatid(s) and the Both cystic echinococcosis and alveolar pressure exerted on the surrounding tissues. echinococcosis are often expensive and complicated to Abdominal pain, nausea and vomiting are treat, sometimes requiring extensive surgery and/or commonly seen when hydatids occur in the liver. If the prolonged drug therapy. lung is affected, clinical signs include chronic cough, Four options exist for the treatment of cystic chest pain and shortness of breath. echinococcosis: Alveolar echinococcosis is characterized by an • percutaneous treatment of the hydatid cysts with asymptomatic incubation period of 5 - 15 years and the PAIR (Puncture, Aspiration, Injection, Re- the slow development of a primary tumour-like lesion aspiration) technique; which is usually located in the liver. Clinical signs • surgery; include weight loss, abdominal pain, general malaise • anti-infective drug treatment; and signs of hepatic failure. • ‘watch and wait’. Larval metastases may spread either to organs The choice must primarily be based on the adjacent to the liver (e.g. the spleen) or distant locations ultrasound images of the cyst, following a stage-specific (lungs, brain) following dissemination of the parasite approach, and also on the medical infrastructure and via the blood and lymphatic system. If left untreated, human resources available. alveolar echinococcosis is progressive and fatal. For alveolar echinococcosis, early diagnosis and radical (tumour-like) surgery followed by anti- Distribution infective prophylaxis with albendazole remain the key Cystic echinococcosis is globally distributed and elements. If the lesion is confined, radical surgery offers found in every continent except Antarctica. Alveolar cure. Unfortunately, in many patients the disease is echinococcosis is confined to the northern hemisphere, diagnosed at an advanced stage, and palliative surgery, in particular to regions of China, the Russian if carried out without or with incomplete anti-infective Federation and countries in continental Europe and treatment, frequently results in relapses. North America. In endemic regions, human incidence rates for cystic Health and economic burden echinococcosis can reach greater than 50 per 100,000 Both cystic echinococcosis and alveolar person-years, and prevalence levels as high as 5 - 10% echinococcosis represent a substantial disease burden. may occur in parts of Argentina, Peru, east Africa, Worldwide, there may be in excess of one million central Asia, and China. In livestock, the prevalence people living with these diseases at any one time. Many of cystic echinococcosis found in slaughterhouses in of these people will be experiencing severe clinical hyperendemic areas of South America varies from 20 syndromes which are life-threatening if left untreated. - 95% of slaughtered animals. The highest prevalences Even with treatment, people often face reduced quality are found in rural areas where older animals are of life. slaughtered. Depending on the infected species For cystic echinococcosis, there is an average 2.2% involved, livestock production losses attributable to postoperative death rate for surgical patients and about cystic echinococcosis stem from liver condemnation, 6.5% of cases relapsing after intervention that require reduction in carcass weight, decrease in hide value, prolonged recovery time. Present estimates suggest decrease of milk production, and reduced fertility. that cystic echinococcosis results in the loss of at least one million DALYs (One DALY [disability-adjusted life Diagnosis year] can be thought of as one lost year of “healthy” life. Ultrasonography is the imaging technique of The sum of these DALYs across the population, or the choice for the diagnosis of both cystic echinococcosis burden of disease, can be thought of as a measurement and alveolar echinococcosis. This technique is usually of the gap between current health status and an ideal complemented or validated by computed tomography health situation where the entire population lives to an December 2013 KUWAIT MEDICAL JOURNAL 375 advanced age, free of disease and disability) annually Thailand. Today, severe dengue affects most Asian and and possibly up to three million. Latin American countries and has become a leading Annual costs associated with cystic echinococcosis cause of hospitalization and death among children in are estimated to be 3 billion US dollars for treating these regions. cases and losses to the livestock industry. There are four distinct, but closely related, serotypes Alveolar echinococcosis results in the loss of about of the virus that cause dengue (DEN-1, DEN-2, DEN-3 650,000 DALYs annually, with most of the disease and DEN-4). Recovery from infection by one provides burden concentrated in western China. lifelong immunity against that particular serotype. However, cross-immunity to the other serotypes after Prevention and control recovery is only partial and temporary. Subsequent Cystic echinococcosis is a preventable disease as infections by other serotypes increase the risk of it involves domestic animal species as definitive and developing severe dengue. intermediate hosts. Periodic deworming of dogs, improved hygiene in the slaughtering of livestock KEY FACTS (including proper destruction of infected offal), and • Dengue is a mosquito-borne viral infection. public education campaigns have been found to lower • The infection causes flu-likeillness,andoccasionally and, in high income countries, prevent transmission develops into a potentially lethal complication and alleviate the burden of human disease. called severe dengue. Vaccination of sheep with an E. granulosus • The global incidence of dengue has grown recombinant antigen (EG95) offers encouraging dramatically in recent decades. prospects for prevention and control. Small-scale EG95 • About half of the world’s population is now at risk vaccine trials in sheep indicate high efficacy and safety • Dengue is found in tropical and sub-tropical with vaccinated lambs not becoming infected with E. climates worldwide, mostly in urban and semi- granulosus. urban areas. A program combining vaccination of lambs, • Severe dengue is a leading cause of serious illness deworming of dogs and culling of older sheep could and death among children in some Asian and Latin lead to elimination of cystic echinococcosis disease in American countries. humans in less than 10 years. • There is no specific treatment for dengue/ severe Alveolar echinococcosis prevention and control dengue, but early detection and access to proper is more complex as the cycle involves wild animal medical care lowers fatality rates below 1%. species as both definitive and intermediate hosts. • Dengue prevention and control solely depends on Regular deworming of domestic carnivores that have effective vector control measures. access to wild rodents should help to reduce the risk of infection in humans. Global burden of dengue Culling of foxes and unowned free-roaming dogs The incidence of dengue has grown dramatically is applicable but appears to be highly inefficient. around the world in recent decades. Over 2.5 billion Deworming of wild and stray definitive hosts with people – over 40% of the world’s population – are now anthelminthic baits resulted in significant reductions at risk from dengue. WHO currently estimates there in alveolar echinococcosis prevalence in European may be 50 - 100 million dengue infections worldwide and Japanese studies. Sustainability and cost– every year. benefit effectiveness of such campaigns are however Before 1970, only nine countries had experienced controversial. severe dengue epidemics. The disease is now endemic in more than 100 countries in Africa, the Americas, the Eastern Mediterranean, South-east Asia and the 3. DENGUE AND SEVERE DENGUE Western Pacific. The American, South-east Asia and the Western Pacific regions are the most seriously Overview affected. Dengue is a mosquito-borne infection found in Cases across the Americas, South-east Asia and tropical and sub-tropical regions around the world. In Western Pacific have exceeded 1.2 million cases in recent years, transmission has increased predominantly 2008 and over 2.3 million in 2010 (based on official in urban and semi-urban areas and has become a major data submitted by Member States). Recently the international public health concern. number of reported cases has continued to increase. Severe dengue (previously known as Dengue In 2010, 1.6 million cases of dengue were reported in Hemorrhagic Fever) was first recognized in the 1950s the Americas alone, of which 49 000 cases were severe during dengue epidemics in the Philippines and dengue. 376 WHO-Facts Sheet December 2013

Not only is the number of cases increasing as the 38 °C/ 100 °F) and include: severe abdominal pain, disease spreads to new areas, but explosive outbreaks persistent vomiting, rapid breathing, bleeding gums, are occurring. The threat of a possible outbreak fatigue, restlessness, blood in vomit. The next 24 - 48 of dengue fever now exists in Europe and local hours of the critical stage can be lethal; proper medical transmission of dengue was reported for the first time care is needed to avoid complications and risk of in France and Croatia in 2010 and imported cases were death. detected in three other European countries. An estimated 500,000 people with severe dengue Treatment require hospitalization each year, a large proportion of There is no specific treatment for dengue fever. whom are children. About 2.5% of those affected die. For severe dengue, medical care by physicians and nurses experienced with the effects and progression of WHO/TDR/Stammers the disease can save lives – decreasing mortality rates The Aedes aegypti mosquito is the primary vector of from more than 20% to less than 1%. Maintenance of dengue. The virus is transmitted to humans through the patient’s body fluid volume is critical to severe the bites of infected female mosquitoes. After virus dengue care. incubation for 4 – 10 days, an infected mosquito is capable of transmitting the virus for the rest of its life. Immunization Infected humans are the main carriers and There is no vaccine to protect against dengue. multipliers of the virus, serving as a source of the Developing a vaccine against dengue/severe dengue virus for uninfected mosquitoes. Patients who are has been challenging although there has been recent already infected with the dengue virus can transmit progress in vaccine development. WHO provides the infection (for 4 - 5 days; maximum 12) via Aedes technical advice and guidance to countries and private mosquitoes after their first symptoms appear. partners to support vaccine research and evaluation. The Aedes aegypti mosquito lives in urban habitats Several candidate vaccines are in various phases of and breeds mostly in man-made containers. Unlike trials. other mosquitoes Ae. aegypti is a daytime feeder; its peak biting periods are early in the morning and in the WHO/TDR/Crump evening before dusk. Female Ae. aegypti bites multiple At present, the only method to control or prevent people during each feeding period. the transmission of dengue virus is to combat vector Aedes albopictus, a secondary dengue vector in Asia, mosquitoes through: has spread to North America and Europe largely due • preventing mosquitoes from accessing egg-laying to the international trade in used tyres (a breeding habitats by environmental management and habitat) and other goods (e.g. lucky bamboo). Ae. modification; albopictus is highly adaptive and therefore, can survive • disposing of solid waste properly and removing in cooler temperate regions of Europe. Its spread is artificial man-made habitats; due to its tolerance to temperatures below freezing, • covering, emptying and cleaning of domestic water hibernation, and ability to shelter in microhabitats. storage containers on a weekly basis; • applying appropriate insecticides to water storage Characteristics outdoor containers; Dengue fever is a severe, flu-like illness that affects • using of personal household protection such as infants, young children and adults, but seldom causes window screens, long-sleeved clothes, insecticide death. treated materials, coils and vaporizers; Dengue should be suspected when a high fever • improving community participation and (40 °C/ 104 °F) is accompanied by two of the following mobilization for sustained vector control; symptoms: severe headache, pain behind the eyes, • applying insecticides as space spraying during muscle and joint pains, nausea, vomiting, swollen outbreaks as one of the emergency vector control glands or rash. Symptoms usually last for 2 - 7 days, measures; after an incubation period of 4 - 10 days after the bite • active monitoring and surveillance of vectors from an infected mosquito. should be carried out to determine effectiveness of Severe dengue is a potentially deadly complication control interventions. due to plasma leaking, fluid accumulation, respiratory distress, severe bleeding, or organ impairment. Warning signs occur 3 - 7 days after the first symptoms For more information contact: WHO Media centre; in conjunction with a decrease in temperature (below Telephone: +41 22 791 2222. December 2013 KUWAIT MEDICAL JOURNAL 377

Yearly Title Index Kuwait Medical Journal (KMJ) 2013; Volume 44

Kuwait Medical Journal 2013, 45 (4): 377 - 378

A 25-Years-Old Woman with Petechial Rash and Acute Colpocephaly, Wide Clinical Spectrum for one Cephalic Hepatitis Following a Febrile Illness. 45(2) 143-145 Disorder: Three New Cases from Kuwait. 45(4) 348-352

A Mechanism Hypothesis for NMDA Receptor Antagonists Comparison of Ectopic Pregnancy Treatment Modalities: Induces Schizophrenia. 45(4) 358-358 Experience from a Tertiary Center. 45(1) 41-46

Acquired Multiple Clotting Factor Inhibitors in Children. Comparison of Laparoscopic Vessel Sealing Devices in a 45(4) 319-323 Porcine Model; Turkurolap Group Study. 45(3) 219-225

Acute Acalculous Cholecystitis due to Leptospirosis. 45(1) Congenital Plasmodium Falciparum in a Neonate in Kuwait. 74-75 45(2) 141-142

Alcoholism Correlates with Increased Risk of Parkinson’s Counseling and Educating Diabetic Patients about HbA1C Disease in Taiwan: A Population-based Cohort Study. Lab Test. 45(3) 250 45(3) 253-254 Cuff Herniation with Laryngeal Mask Airway. 45(4) 353-355 Alkaptonuria in 17 Month-Old Female Child: A Case Report. 45(2) 138-140 Diabetes, Antidiabetic Drugs, and Cancer: Separating Background Risk from Iatrogenesis. 45(4) 283-285 All Great Truths Begin as Blasphemies. 45 (1) 1-3 Early and Late Ovarian Hyperstimulation Syndrome: Antenatal Ultrasound Diagnosis of Fetal Anomalies at a Two Distinct Clinical Entities. 45(1) 21-25 University Hospital. 45(4) 300-306 Electrophysiologic Effects of the Statins in Patients Appendiceal Mucocele: A Case Report and Review of the with Ischemic Cardiomyopathy and Ventricular Literature. 45(3) 240-242 Tachyarrhythmia. 45(4) 307-312

Association between Patients’ Sociodemographic Evaluation of Glucose Metabolism in Hepatitis Serology Characteristics and Their Satisfaction with PrimaryHealth Negative Beta Thalassemia Major Patients. 45(2) 113-117 Care Services in Turkey. 45(4) 291-299 Extraperitoneal Presentation of Pseudomyxoma Peritonei Calciphylaxis in a Renal Allograft Recipient –An as a Pleural Effusion: A Case Report. 45(4) 329-331 Uncommon Entity, Need for Vigilance: A Case Report. 45(2) 149-151 F-18 FDG PET/CT Imaging of Tuberculous Lymphadenopathy Mimicking Lymphoma: A Case Cardiovascular Disease and Colorectal Cancer: A Report. 45(1) 71-73 Population-Based Observation in Taiwan. 45(1) 31-36 Fibrothorax: A Preventable Condition. 45(2) 95-96 Causes of Rehospitalization of Patients with Peripheral Arteriosclerosis. 45(3) 203-206 Gamma Knife Radiosurgery for Recurrent Anaplastic Ependymoma with Intracranial Disseminations: A Case Cerebrovascular Accident following Carotid Arterial Report. 45(4) 335-338 Dissection in a Child Abuse Case. 45(3) 230 - 233 Hypernatremia among In-Patients in Intensive Care Unit Chronic Osteomyelitis and Hepatocellular Carcinoma: An and Medical wards of a General Hospital in Kuwait. 45(2) Observation in Taiwan. 45(2) 159-160 130-133

Colobronchial Fistula as a Complication of Advanced In Vitro Flow Visualization of the Pulmonary Circulation. Colorectal Cancer: Case Report. 45(4) 332-334 45(3) 192-198 378 Yearly Title Index December 2013

Infantile Nephropathic Cystinosis: Case Series and Review Prognostic Value of Initial Arterial Lactate Levels in of Literature. 45(1) 55-59 Childhood Acute Carbon Monoxide Poisoning. 45(2) 134- 137 Insulin Resistance Causing Post-Transplant Diabetes Late after Successful Kidney-Pancreas Transplant: Insights Pseudo-Aneurysm of the Internal Maxillary Artery: A Relevant to the Pathogenesis of Type 2 Diabetes. 45(3) Case Report. 45(3) 234-236 245-249 Quadricuspid Aortic Valve - A Case Report. 45(2) 155-157 Isolated Pancreatic Tuberculosis: A Medical Disease Causing Surgical Dilemmas: Case Report and Review of Questioning Keeps Science Alive!. 45(3) 189-191 Literature. 45(4) 339-343 Rare Case of Streptococcal Toxic Shock Syndrome in Knowledge and Perception of Breast Cancer and Practice Kuwait. 45(2) 152-154 of Breast Self-Examination among Female.Patients Attending Primary Health Care Centers in Al Khobar Rare Clinical Presentation of Intestinal Fixation Anomaly City, Saudi Arabia. 45(2) 123-129 with Traumatic Caecal Perforation. 45(2) 146-148

Laboratory-Acquired Brucellosis. 45(3) 237-239 Schwannoma of the Penis: A Rare Tumor with Rare Presentation. 45(3) 243-244 Late Onset Takayasu Arteritis: A Case Report and Literature Review. 45(1) 51-54 Significance of First Thyroglobulin Level at the Time of Remnant Ablation in Predicting Clinical Course in Patients Leiomyoma of the Epididymis - Case Report and Review with Differentiated Thyroid Carcinoma. 45(2) 108-112 of the Literature. 45(1) 63-65 Solitary Mucormycosis in Renal Allograft: A Case Report. Malignant Granular Cell Tumor Manifesting as Exophytic 45(1) 60-62 Skin Lesion: Report of a Case. 45(1) 47-50 Statins Use and Risk of Lung Cancer in Males: A Case- Mesenteric Cystic Lymphangioma [MCL] Complicated Control Study in Taiwan. 45(3) 207-210 by Intestinal Volvulus: A Case Report. 45(3) 226-229 Surgical Repair of Penile Fracture. 45 (1) 37-40 Metabolic Acidosis in the Critically Ill and Continuous Renal Replacement Therapy – A Review. 45(4) 286-290 The Effect of Lornoxicam with Intravenous Regional Anesthesia on Intraoperative and Post Operative Neutropenia Induced by Ceftriaxone Sodium. 45(4) 356- Analgesia for Forearm Surgery. 45 (1) 26-30 357 The Importance of Serum Prostate Specific Antigen Levels New Perspectives in Klinefelter Syndrome. 45(2) 97-107 in Demonstration of Potency between the Extent and the Degree of Aggressiveness of Inflammation in Patients No Association between Statins Use and Pancreatic with Asymptomatic Chronic Prostatitis. 45(3) 214-218 Cancer Risk in Taiwan. 45(3) 251-252 Time to Stop. 45(2) 161-162 Non-culture-Based Diagnostic Methods for the Diagnosis of Invasive Candidiasis: Are They Helpful to Clinicians?. Twin Pregnancy with a Complete Hydatidiform Mole and 45 (1) 4-14 Surviving Co-Existent Fetus: Report of a Case. 45(4) 344- 347 Nutritional Knowledge, Attitude and Practice of High Urine Xanthine Oxidase and Myeloperoxidase Activities School Girls Living in Kuwait: A Pilot Study. 45(2) 118- in Pediatric Urinary Tract Infections. 45(3) 199-202 122 Variant Analysis of the Sirtuin (SIRT1) Gene in Multiple PirB may be a New Approach Targets for Nogo-Related Sclerosis. 45(4) 313-318 Genes with Schizophrenia. 45(2) 158 Varicella-Zoster Infection in Adult Males: Risk Factors for Predictors of Quality of Life in Renal Transplant Recipients. Varicella-Zoster Virus Pneumonia. 45(1) 15-20 45(4) 324-328 Walker-Warburg Syndrome Features and Gene Study: A Prevalence of Hepatitis C Virus Antibodies in Blood Report of Two Cases. 45(1) 66-70 Samples Received at the Virology Laboratory of Mubarak Al-Kabeer Hospital, Kuwait. 45(3) 211-213 December 2013 KUWAIT MEDICAL JOURNAL 379

Yearly Author Index Kuwait Medical Journal (KMJ) 2013; Volume 45

Kuwait Medical Journal 2013, 45 (4): 379-380

A Al-Qattan SA ...... 118 Arslan M...... 219 AbdulSalam S...... 141 Assefa B...... 234 Abdulwahab MO...... 130 Ates M...... 219 Abraham VT...... 130 Atli Y...... 199 Abuzenadah S ...... 300 Ayaz C...... 237 Adekile A ...... 319 Ayed AK...... 95 Aggarwal RS...... 21 Azab AF ...... 319 Ahmad S ...... 4 Aziz IY ...... 348 Ahmed I ...... 283 Balcı YI...... 113 AI-fadhli M...... 141, 143 Baltaci D ...... 291 Akgun A...... 108 Baytok O...... 214 Akin Y...... 219 Bertoglio C...... 240 Akyol A ...... 307 Biyik I...... 41 Al Ali J ...... 230 Brandao RM...... 203 Al Amassi MZ...... 63 Buturak A ...... 307 Al Awadi Y ...... 335 Cader RA ...... 324 Al Jarrallah M...... 155 Caglar M...... 113 Al Qattan S...... 230 Cakmak N ...... 307 Al Shammari A...... 130 Ceifo W...... 37 Al Shammari SM...... 130 Celen MK...... 237 Al Turki YA...... 250 Celer A ...... 291 Al-Abboh H ...... 319 Celik SK ...... 313 Al-Ansari S A...... 245 Ceylan C...... 214 Al-Banwan K...... 152 Chen PC...... 31 Albayrak M...... 41 Dagogo-Jack S ...... 283 Al-Dhafiri SS...... 118 Dashti R...... 155 Ali FE ...... 97 Davutoglu M...... 199 Al-Khashty M ...... 353 de Godoy JMP...... 203 Al-Mulla FA ...... 97 de Oliveira ALC ...... 203 Al-Mutairi AA...... 118 Degirmencioglu A ...... 307 Al-Mutairi H...... 243 Devi AD...... 21 Al-Rajhi M...... 152 Diktas H ...... 74, 356 Al-Refaee FA...... 118 Dursun A ...... 313 Al-Sharida S ...... 319 Ecemıs O ...... 74 Al-Shemmeri M...... 51 Edgunlu TG ...... 313 Al-Sherbini M...... 37 El Deriny MA...... 226 Al-Sowielem LS ...... 123 El-Dein SZ...... 15 Al-Tararwa AA ...... 348 El-Hashash OA ...... 66 Altawalah H...... 211 Elsayed NM ...... 300 Al-Tawheed A...... 37 El-Tantawy A...... 55 Alwael A...... 234 Emre U ...... 313 Al-Zamel E ...... 329, 332 Erdem O ...... 291 Al-Zanki S...... 152 Erdim O ...... 108 Ankarali H ...... 291 Eroz R ...... 291 Arrifin N ...... 324 Gafor HA ...... 324 380 Yearly Author Index December 2013

Gawish M ...... 37 Odabas O...... 214 Gozen AS...... 219 Olgar S...... 199 Guler E...... 199 Omur O ...... 108 Guven S...... 219 Ozcan Z...... 108 H Khafagy AH...... 63 Ozkılıc H...... 108 Hamed I...... 243 Pai SA...... 146 Hamed IMA...... 37 Patel HV...... 149 Hanafi MS ...... 339 Patel RD...... 60 Hegde BM...... 1, 189 Prasad KYM...... 130 Hsieh DPH...... 251 Rasheed P...... 123 Hussin MM...... 97 Raway TS...... 66 Jaber SM...... 118 Redha F...... 51 Jain SH...... 149 Ribeiro A...... 203 Jasani AF...... 21 Rifaat A...... 243 Jessa S...... 245 Rifaat AA ...... 344 Juma TH...... 63 Riyad MNYM ...... 339 Kahvic M ...... 47 Roscio F...... 240 Kamal AM...... 226 Rosinha MY...... 203 Karabiber H...... 199 Sadek SA...... 55 Karaca A...... 113 Sadeq H...... 230 Karakus G ...... 307 Sahin S...... 134 Karatas A...... 41 Sainarersh VV...... 149 Kedlaya PG ...... 286 Saleh K...... 51 Kehinde EO...... 37 Sallam MA ...... 339 Keklik TT...... 214 Saraya M...... 141, 143 Keskin F...... 41 Scandroglio I...... 240 Khabsa M...... 234 Semiz S...... 113 Khadadah F...... 161 Senior PA...... 245 Khadadah S...... 161 Seoudi TMM ...... 348 Khajah H ...... 335 Sevinc O...... 113 Khalil HRA...... 226 Shahed SR ...... 344 Khan AA ...... 335 Shalaan YA ...... 66 Khan Z...... 4 Shenoy S...... 146 Khurana SA...... 21 Siddiqui AK ...... 26 Konioukhova S ...... 353 Singh NG ...... 47, 344 Korkut Y ...... 291 Sipahi I ...... 307 Kucuktascı K...... 113 Su LT...... 253 Kurutas EB...... 199 Sung FC...... 31, 207, 253 Lai HC...... 31, 207 Taha KMH...... 15 Lai SW...... 31, 159, 207, 251, 253 Tatar CA...... 214 Li FI...... 71 Tayeb MA ...... 329,332 Li YI...... 71 Thakkar UG...... 138 Liao KF...... 31, 159, 207, 251, 253 Trivedi HL...... 60, 138 Lin CL...... 207 Tsai PY...... 31 Liu JC...... 159 Tseng CH...... 159 Makboul G...... 15 Tunc L...... 219 Mamat R ...... 324 Ulug M...... 237 Marouf R ...... 319 Unal AE ...... 313 Mishra VV...... 21 Vachhani MV...... 21 Mohamed F ...... 353 Vanikar AV ...... 60, 138 Mohd R ...... 324 Velioglu M ...... 356 Muo CH...... 159, 251 Xu CJ ...... 158, 358 Mustafa HE...... 155 Yazıcı B ...... 108 Mustafa Y ...... 332 Yılmaz S...... 74 Nasr M...... 55 Yuan SM...... 192 Nassar MF...... 118 Zhao Z...... 71