Studies of a site-specific recombination system and analysis of new modulators of Notch signaling in Caenorhabditis elegans.
Marcus L. Vargas
Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences
COLUMBIA UNIVERSITY
2012
© 2012 Marcus L. Vargas
All Rights Reserved Abstract
Studies of a site-specific recombination system and analysis of new modulators of Notch signaling in C. elegans.
Marcus L. Vargas
The ability to make transgenic animals has been a great tool for biologists to study living organisms. In C. elegans, the way transgenes are generated makes them problematic in many circumstances, and there is no single, simple, reliable approach that circumvents all of the problems with current methods of introducing transgenes into C. elegans. In Chapter 2, I discuss my attempt to develop a transgenic system in C. elegans using the bacteriophage φC31 integrase system. I show evidence that φC31 integrase is active in C. elegans somatic tissue. I have successfully integrated a transgene into the C. elegans genome in single-copy using φC31 dependent recombination-mediated cassette exchange. However, attempts to repeat φC31-mediated integration has been unsuccessful.
In Chapter 3, I use genetic analysis to test many genes that were reported to be associated with the γ-secretase complex in a mammalian tissue culture system. The γ- secretase complex is an important component in the Notch signaling pathway. Not only is the γ-secretase complex essential in the Notch pathway, it is also implicated in the pathology of familial Alzeheimer’s disease (FAD). As γ-secretase complex components show a Notch loss-of-function phenotype in C. elegans, a reverse genetic approach, using genes encoding proteins that associate with Presenilin was used to identify putative new
Notch modulators. Several genes were identified that suppress a glp-1(gf) allele and one gene that suppress a gfp-1(lf) allele. These genes are unlikely to be core components of the Notch signaling pathway. Table of Contents:
Table of Contents ...... i
List of Figures ...... iv
List of Tables ...... v
Acknowledgements ...... vi
Chapter 1. General Introduction ...... 1
Notch signaling ...... 2
Notch signaling mechanism ...... 3
Notch signaling in C. elegans development ...... 5
Germline development and Notch ...... 5
Embryogenesis and inductive signaling by Notch ...... 7
The somatic gonad and lateral inhibition by Notch ...... 9
Vulval precursor cells and Notch mediated cell-fate decision ...... 11 Genetic approaches for Notch components ...... 13
Suppressors and enhancers of lin-12 (sel) ...... 14
Enhancers of glp-1(lf) (ego) ...... 14 Suppressors of glp-1(lf) (sog) ...... 15 Tumurous enhancers of glp-1(gf) (teg) ...... 16 γ-secretase complex in Notch transduction and APP processing ...... 16
Summary of results ...... 20
Chapter 1. Figures and Tables ...... 22
i Chapter 2. φC31 integration in C. elegans ...... 30
Abstract ...... 31
Introduction ...... 31
Materials and methods ...... 37
Results and discussion ...... 55
φC31 can mediate recombination in C. elegans ...... 55
φC31 can mediate recombination in the C. elegans germline ...... 56
Constructing suitable landing platforms in the C. elegans genome ...... 57
RMCE in the germline of C. elegans ...... 58
Conclusion ...... 61
Chapter 2. Figures and Tables ...... 63
Chapter 3. Modulation of Notch signaling pathway by Presenilin associated proteins .....80
Abstract ...... 81
Introduction ...... 81
Material and methods ...... 85
Results ...... 92
RNAi screen for positive modulators of Notch in C. elegans ...... 93
Positive modulators of GLP-1/Notch ...... 94
Negative regulators of GLP-1/Notch ...... 96
Discussion ...... 97
G0alpha ...... 99
CDC-48/p97 ...... 100
ii ERLIN ...... 102
SEC-22 ...... 102
Glucose Transporters ...... 103
RAB-11 ...... 104
Chapter 3. Figures and Tables ...... 106
Chapter 4: General Discussion ...... 119
Summary of Results ...... 120
Discussion ...... 120
φC31 potential uses and future prospects ...... 120 Genetics and potential issues ...... 121 Difference in assay types ...... 122 Difference in alleles ...... 123 Soma-to-germline interaction ...... 125 Assessing γ-secretase activity ...... 127
References ...... 131
iii List of Figures:
Chapter 1. Figures and Tables ...... 22 Figure 1: Domain organization of Notch receptors from C. elegans, D. melanogaster and H. sapiens ...... 24 Figure 2: Overview of LIN-12 signaling in C. elegans ...... 25 Figure 3: Germline development and proliferation maintenance ...... 26 Figure 4: Embryogenesis and inductive signaling ...... 27 Figure 5: AC specification and lateral inhibition ...... 28 Figure 6: VPC fate specification and LIN-12 ...... 29
Chapter 2. Figures and Tables ...... 63 Figure 1: Transgenes in C. elegans ...... 64 Figure 2: φC31 mediated cassette excision in C. elegans ...... 65 Figure 3: Evidence for φC31 mediated cassette excition in C. elegans ...... 66 Figure 4: φC31 mediated recombination in C. elegans ...... 67 Figure 5: Whole pladmid insertion of transgenes in C. elegans via φC31 ...... 69 Figure 6: Insertion of attP cassette into the genome via MosSCI ...... 70 Figure 7: The attP cassettes generated by MosSCI ...... 72 Figure 8: Overview of RMCE in C. elegans by φC31 ...... 73 Figure 9: Verification of RMCE by φC31 ...... 76 Figure 10: Vectors for RMCE ...... 78 Figure 11: Expression of heat-shock promoter ...... 79
Chapter 3. Figures and Tables ...... 106 Figure 1: Enhancement of lag-2(q420) ...... 110
iv List of Tables:
Chapter 1. Figures and Tables ...... 22
Table 1: Core components and modulators of Notch signaling ...... 23
Chapter 2. Figures and Tables ...... 63
Table 1: Insertion of transgenes via φC31 ...... 68
Table 2: Integration of attP cassette into the genome by MosSCI ...... 71
Table 3: RMCE attempts via direct injections ...... 74
Table 4: RMCE attempts via heat-shock driven φC31 ...... 75
Table 5: Integration of germline-expressing φC31 into the genome by MosSCI ...... 77
Chapter 3. Figures and Tables ...... 106
Table 1: Presenilin-associated proteins ...... 107
Table 2: C.elegans orthologues of Presenilin-associated proteins ...... 108
Table 3: RNAi screen for positive regulators of Notch/GLP-1 in C. elegans ...... 109
Table 4: Background suppression of glp-1(ar202) ...... 112
Table 5: Suppresion of glp-1(ar202) ...... 113
Table 6: RNAi for positive regulators of Notch/GLP-1 in C. elegans ...... 114
Table 7: Enhancement of glp-1(bn18) ...... 115
Table 8: Background Embryonic Lethality at 20 °C ...... 116
Table 9: Suppression of glp-1(bn18) ...... 117
Table 10: Summary of results and comparison with Wakabayashi List ...... 118
v
Acknowledgements:
As I have had an unusually long graduate career, I have a lot of people to thank.
First and foremost I would like to thank my graduate advisor, Dr. Iva Greenwald. After a tough beginning to my graduate career, she has given me a chance to complete my graduate studies under her tutelage and I am very grateful for this chance. I would not have been where I am today without her guidance and advice. I have very much enjoyed the scientific and non-scientific discussions we have had over the years. I appreciate that
Iva takes her mentorship role as a graduate advisor seriously, and as a result I feel like I have been able to grow and mature as a scientist during my time in her laboratory. I feel fortunate and honored to have studied in her lab for the past several years.
I am very grateful to members of the Greenwald lab. I thank Jiabin Chen, Min- sung Choi, Sophie Jarriault and Andrew Yoo for help and advice during my rotation in the lab. I would like to thank Claire de la Cova, Cory Dunn, Xantha Karp and Dan Shaye for making thoughtful and interesting comments and suggestions on my project. They have made lab meetings interesting and fun. I would like to thank Christina Chen, Ji Li,
Maria Sallee and Xinyong Zhang not only for their suggestions but also their support during my time in the lab and also in making the lab experience entertaining. I’ve had the privilege to mentor a couple of rotation students, Sudha Kumar and Dylan Rahe. I would like to thank them for their hard work and for helping improve my mentorship abilities. I would like to thank Richie Ruiz for the thousands of mini-preps he has done, Cindy Zhou for the thousands of injections she has done and Orquidia Cardenas for technical support.
vi
I would also thank Daniel Berg and Thomas McCord for the assistance they provided in strain construction.
The C. elegans community at Columbia has been an important asset, and I would like to express my gratitude to Drs. Oliver Hobert and Alla Grishok and their respective laboratories for comments, advice and insights. I would also like to thanks the 7th floor of HHSC; the Hobert and Johnston Labs. I would especially like to thank a few former members of the Johnston Lab who provided support and advice; Joseph Parker, Ricardo
Silva and Brent Wells.
I am appreciative to Drs. Alica Meléndez, Oliver Hobert, Richard Mann and Gary
Struhl for taking their time to be in my thesis committee. I would also like to thanks Drs.
Oliver Hobert, Richard Mann, Gary Struhl and Andrew Tomlinson for serving on the various committees during my graduate career, the Qualifying Examination Committee and the Thesis Research Advisory Committee. Their insight, suggestion and comments have been invaluable.
I would like to thank Drs. Ed Laufer, Laura Johnston and Iva Greenwald for giving me the opportunity to do my rotations in their labs and offer their guidance during my time spent there. I also would like to thank those lab members who gave me guidance and advice during the course of my rotations.
I would also like to thank the staff of the Department of the Genetics and
Development, especially Nina Steinberg, Jessica Sama and Stacey Warren, for their help with various administrative tasks.
vii
During my time at Columbia, I have made wonderful friends and I would like to thank them for their support and friendship. I would not have been able to make without them.
Finally, I would like to thank my family: my parents, Phyllis Lee Vargas and
Antonio Santos Vargas, my sisters, Marisa and Camilla, and my grandparents for their love and support. It has been great to know I could always turn to them when times were tough. I would also like to thank my nephews, Sebastian, Winston and Matteo and my newborn niece, Isabel. They have taught me a lot and I look forward to watching them grow.
viii
This thesis is dedicated to the memories of:
Marguerite Gruenhagen
Ronald Gruenhagen
and Marcia Gruenhagen
ix 1
Chapter 1: General Introduction. 2
Notch signaling:
During the evolution of metazoans, as organisms have undergone the transition
from unicellularity to multicellularity, mechanisms that allow cells to communicate with
other came into existence. These mechanisms allowed cells to organize and to coordinate
with each other to ensure the survival of multicellular organisms. There are a handful of
conserved signaling pathways, which are used iteratively and repetitively, that contributes
to the diversity seen in the metazoan lineage. One such signaling pathway is the Notch
pathway.
In metazoans, not only is Notch highly conserved, but the signaling transduction
pathway is conserved as well (Eve Gazave 2009). There are two C. elegans Notch
orthologues, LIN-12 and GLP-1, there is one D. melanogaster Notch and there are four
Notch orthologues in H. sapiens, Notch(1-4) (figure 1). Notch is a single pass
transmembrane protein. The extracellular domain contains a variable number of EGF
repeats, ranging from 13 in C. elegans GLP-1 to 36 in H. sapiens NOTCH1. There are
three LNR (Lin-12/Notch Repeats) domains following the EGF repeats. At the C-
terminal end of the extracellular domain of Notch, there is the Notch heterodimerization
domain, consisting of HD-N and HD-C domains. The intracellular domain contains a
RAM domain followed by six ankyrin repeats, a transactivation domain and a PEST domain. The function of these domains will be discussed below.
The Notch ligands are not as well conserved as Notch across species. They are more diverse in structure (reviewed in D'Souza et al. 2010). However, there are a few structural similarities among the canonical DSL ligands. They share an N-terminal (NT) 3
domain, followed by a DSL (Delta/Serrate/Lag-2) domain and multiple EGF-like domains (Tax et al. 1994). As with the Notch receptor, the number of EGF repeats are variable. The intracellular portion is very divergent and there are no recognizable conserved domains across different species.
Notch signaling mechanism:
Notch mediates cell-cell interactions during the development of metazoan organisms. These interactions occur between a cell, that sends the signal, the signal- sending cell, and a cell, that receives the signal, the signal-receiving cell (see figure 2).
The Notch receptor is present on the plasma membrane of the signal-receiving cell, while the DSL ligands are present on the plasma membrane of the signal-sending cell.
In vertebrates, maturation of Notch receptors requires a proteolytic cleavage by the Furin protease at the extracellular domain (site 1 or S1) during the secretory pathway
(Blaumueller et al. 1997; Logeat et al. 1998). As a result of this cleavage event, the vertebrate Notch is present at the cell surface as a heterodimer (Blaumueller et al. 1997;
Logeat et al. 1998). However, in D. melanogaster the Furin-like enzymes and S1 processing does not appear to be required for Notch function. Drosophila Notch is present at the plasma membrane as a full-length protein, and the predicted Furin processing site is dispensable for Notch activity (Kidd 2002). Although, the role for Furin processing in C. elegans GLP-1 and LIN-12 has not been characterized, there is evidence that suggests that S1 cleavage does take place. The C. elegans Notch receptor GLP-1 is not present predominately as a full-length protein product in wild-type animals, suggesting that it is processed (Crittenden et al. 1994). 4
Activation of the Notch receptor occurs when a DSL ligand binds to the EGF repeats on the extracellular domain of Notch. This binding triggers a series of proteolytic cleavage events. The first proteolytic event, at the site 2 or S2, occurs on the extracellular domain, and it is mediated by a conserved family of metalloproteases including SUP-
17/Kuzbanian and ADM-4/TACE (Wen et al. 1997; Brou et al. 2000; Jarriault &
Greenwald 2005). This cleavage step is an important event in the Notch signal transduction cascade. The S2 site is normally concealed from the ADAM proteases by being buried within the Notch Negative Regulatory Region (NRR), which includes the
LNRs and the heterodimerization domains (Sanchez-Irizarry et al. 2004; Gordon et al.
2009). Binding of the DSL ligands to Notch exposes the S2 cleavage site to proteolytic cleavage by the ADAM proteases.
Furthermore, mutations that disrupt the NRR can lead to ligand-independent activation of Notch. These active mutations have been isolated in C. elegans lin-12 and glp-1, as well as oncogenic mutations in human NOTCH1 present in patients with T-ALL
(Greenwald & Seydoux 1990; Berry et al. 1997; Pepper et al. 2003; Weng et al. 2004).
The second cleavage step occurs within the transmembrane domain of Notch, referred to as site 3 or S3, which releases the Notch intracellular domain from the membrane. The S3 cleavage is mediated by the presenilin containing γ-secretase complex
(Levitan & Greenwald 1995; X. Li & Greenwald 1997; Yu et al. 2000; Struhl &
Greenwald 1999; Struhl & Greenwald 2001; Francis et al. 2002). The remaining protein stub is cleared away from the membrane by the γ-secretase complex at the S4 cleavage site, through its ε-secretase activity (Okochi et al. 2002; Chandu et al. 2006). 5
The Notch intracellular domain (NICD) translocates to the nucleus and forms a tripartite complex with the sequence-specific DNA binding protein CBF1/Su(H)/LAG-1
(CSL) and the co-activator SEL-8/MAM to activate transcription of target genes (Struhl et al. 1993; Christensen et al. 1996; Roehl et al. 1996; Wu et al. 2000; Petcherski &
Kimble 2000). The trimeric complex CSL-NICD-MAM recruits co-activators such as histone acetyltransferases, chromatin remodeling factors and the mediator complex (Fryer et al. 2004; reviewed in Bray 2006).
Notch signaling in C. elegans development:
The glp-1 and lin-12 genes are involved in several cell fate decisions in C. elegans development. I will highlight a few of the well-studied cellular context where glp-1 and lin-12 are required for development in C. elegans.
Germline development and Notch:
The C. elegans adult gonad is composed of two U-shaped tubular structures emanating from the body midline, with one tube extending anteriorly and the other extending posteriorly. At the distal end of each tube resides a somatic gonadal cell, the distal tip cell (DTC). The distal germ cells undergo proliferative mitotic cell division to maintain its population (Kimble & White 1981). As the germ cells migrate away from the distal end, they enter meiosis and undergo oocyte differentiation (Kimble & White 1981).
Surrounding the germline are auxiliary cells from the somatic gonad called the sheath cells (Kimble & Hirsh 1979; Hall et al. 1999). 6
The germline arises from the P lineage during embryogenesis; the descendants of this cell, Z2 and Z3, will give rise to the germline cells of the hermaphrodite. Germline specification requires the pie-1 gene and the mes genes for proper development (Mello et al. 1996). As the organism hatches from embryogenesis, the gonad primordium contains
4 cells, Z1 through Z4 (Kimble & Hirsh 1979). Z1 and Z4 will develop into the somatic gonad (see below), while the Z2 and Z3 cells will generate the entire germline. From the
L1 through the L4 stage of development, the germline proliferates exponentially undergoing several rounds of mitotic division. During the L3 stage, proximal germ cells enter meiosis and then proceed to differentiate into sperm cells at L4 stage. In the late L4, meiotic cells make a switch from sperm differentiation to oocyte formation (figure 3;
(Lints & Hall 2009).
The germline requires inputs from the somatic gonad for its development and maintenance. The distal tip cells are located at the distal end of either gonadal arm (figure
3). Experiments where the distal tip cells, or its progenitors, are ablated show a reduction of proliferation of the germ line and the germ cells prematurely enter meiosis (Kimble &
White 1981).
Screens for mutants in germline proliferation recovered the Notch gene glp-1
(Austin & Kimble 1987). glp-1 is required in the germ cells for initiation and maintenance of mitotic cells in the distal gonad (Austin & Kimble 1987; Austin et al.
1989). Subsequent experiments showed that the DSL ligand lag-2 is expressed in the distal tip cell and signals to the germline to activate glp-1 (Lambie & Kimble 1991;
Henderson et al. 1994). 7
In strong glp-1(gf) mutants, the germline fails to exit mitosis, thus fails to enter
meiosis and therefore the hermaphrodites are sterile with a germline tumorous phenotype
(Berry et al. 1997). In weak glp-1(gf) alleles, such as glp-1(ar202), a proximal tumor
develops first and a late-onset tumor develops after the animals reach adulthood (Pepper
et al. 2003).
In the germline, FBF-2, an RNA binding protein, appears to be a direct target of
GLP-1 (Lamont et al. 2004). FBF-2 along with FBF-1 control the extent of the distal
mitotic region (Crittenden et al. 2002; Lamont et al. 2004). The activity of FBF-1 and
FBF-2 is to inhibit the activities of GLD-1 and GLD-2 in the distal mitotic zone (Hansen
et al. 2004). GLD-1 and GLD-2 functions in redundant pathways to promote meiotic progression (Francis et al. 1995; Kadyk & Kimble 1998; Hansen et al. 2004; Eckmann et al. 2004). GLD-1 is part of RNA binding complex with NOS-3, that negatively regulates translation of mRNAs involved in proliferation, including that of glp-1 (Marin & Evans
2003). GLD-2, a poly(A) polymerase, is also involved in meiotic progression, it acts in
part to promote GLD-1 translation (Kadyk & Kimble 1998; Wang et al. 2002; Suh et al.
2006).
It appears that the function of GLP-1 in the germline is to suppress the activities
of GLD-1 and GLD-2 in the distal germline, thus preventing entry into meiosis (Kadyk &
Kimble 1998). It is likely that glp-1 has other downstream targets, either directly or
through the FBFs, which play a role in the maintenance of proliferation or inhibition of
meiotic entry (see Hansen & Schedl 2006).
8
Embryogenesis and inductive signaling by Notch:
There are many decisions during embryogenesis that are imparted by the Notch receptors glp-1 and lin-12 (Priess et al. 1987; Mello et al. 1994; Moskowitz & Rothman
1996; Mickey et al. 1996; Neves & Priess 2005). The first such decision occurs at the 4- cell stage of embryogenesis. The descendants of the AB cell express the Notch receptor glp-1 (Evans et al. 1994). The DSL ligand apx-1 is expressed in the P2 cell and signals to
the glp-1 expressing ABp cell (Mello et al. 1994; Mango et al. 1994; Moskowitz et al.
1994; Mickey et al. 1996). Activation of the Notch pathway in the ABp cell leads to the
transcriptional activation of ref-1 in the ABp descendants (Neves & Priess 2005).
Activation of ref-1 inhibits Notch activation in the ABp descendants during the second
Notch decision (Neves & Priess 2005). Another outcome of the first Notch decision is
that it establishes embryonic asymmetry, for example, the asymmetry between the
gustatory neurons ASEL and ASER (Poole & Hobert 2006).
The second Notch decision determines the cell fate of ABalp and ABara during
the 12-cell stage (Hutter & Schnabel 1994; Mango et al. 1994). This fate is mediated by
glp-1 in the receiving cell and an unknown ligand in the sending cell, though it is clear
that the signal is coming from the MS cell (Hutter & Schnabel 1994). If the first Notch
signal is inhibited, while the second signal is allowed, such as in an apx-1 mutant or by
ablating the P2 cell, the ABp descendants are able to receive the glp-1 signal from the MS
cell and lead them into an ABa-like lineage (Mango et al. 1994; Mickey et al. 1996). The
outcome of loss of Notch signaling in the first Notch mediated decision is a production of
an excess of pharyngeal cells (Mango et al. 1994). 9
The first two Notch decisions are mediated by the maternally provided glp-1 gene
(Priess et al. 1987; Austin & Kimble 1987). The activation of glp-1 in these decisions leads to the transcription of the other C. elegans Notch receptor lin-12 in the embryo
(Moskowitz & Rothman 1996). Together, glp-1 and lin-12 are involved in the third and fourth Notch mediated decisions during embryogenesis (Moskowitz & Rothman 1996).
The third Notch mediated decision specifies the left side of the C. elegans head.
Without Notch signaling at this step the head develops asymmetrically. The cell that contributes to the left head is the ABplaaa cell, while ABarpap cell contributes to the right head (Sulston et al. 1983). The Notch receptor lin-12 is expressed in the ABplaaa cell, and it is dependent on glp-1 activity in early embryogenesis (Moskowitz & Rothman
1996). The DSL ligand lag-2 is expressed in neighboring cells and presumably signals to the ABplaaa cell, specifying the left head cell fate (Moskowitz & Rothman 1996). Loss of components of the Notch pathways such as the glp-1(lf) lin-12(lf) double mutant, lag-
1(lf) or lag-2(lf) single mutants have morphological defects that are associated with the loss left head specification (Moskowitz & Rothman 1996).
The fourth Notch mediated decision specifies the excretory cell, which is absent in a lin-12 glp-1 double mutant (Lambie & Kimble 1991; Abdus-Saboor et al. 2011).
There are other cell fate decisions mediated by Notch during embryogenesis, as observed in the various pleiotropies in glp-1 lin-12 double mutants which lead to the Lag phenotype (Lambie & Kimble 1991; Rasmussen et al. 2008). 10
The somatic gonad and lateral inhibition mediated by Notch:
During the development of the hermaphrodite gonad, the anchor cell (AC) serves
as a signaling center to coordinate cell fate specification and morphology of the
developing vulva and uterus (Sternberg 2005; Sulston & White 1980; Kimble 1981). The
AC and the rest of the somatic gonad are derived from the MS blastomere during
embryogenesis (Sulston et al. 1983). After six rounds of divisions, the descendants of the
MS blastomere, MSpppaap and MSappaap give rise to the Z1 and Z4 cells respectively
(Sulston et al. 1983). These cells will contribute to the maintenance and development of
the germline, as the distal tip cell and sheath cells are derived from Z1 and Z4 (see
above). The remainder of the cells derived from Z1 and Z4 will contribute to the rest of
the somatic gonad.
In a rare case of lineage variance in C. elegans the AC fate is chosen by one of two equivalent cells, Z1.ppp and Z4.aaa. One cell will become the AC and the other cell will become a ventral uterine precursor cell (VU). In 50% of wild-type animals, Z1.aaa will become the AC and in the other 50% of wild-type animals, Z1.ppp will become the
AC (Kimble & Hirsh 1979). The choice between the AC and the ventral uterine precursor
(VU) is mediated by Notch signaling and it is termed the AC/VU decision (Greenwald et al. 1983; Seydoux & Greenwald 1989).
The role of Notch in the AC/VU decision has been elucidated by a series of genetic experiments (Greenwald et al. 1983; Seydoux & Greenwald 1989; Wilkinson et al. 1994; Karp & Greenwald 2003). The default state of the pre-AC/pre-VU pair seems to be the AC fate, as in lin-12(0) or lag-2(lf) animals, there are two ACs and one less VU. In contrast, gain-of-function lin-12 alleles do not have an AC (Greenwald et al. 1983). Both 11
LIN-12 and LAG-2 are present in Z1.ppp and Z4.aaa prior to commitment. LIN-12
activation by LAG-2 in the pre-VU cell increases or maintains lin-12 mRNA levels and
down-regulates lag-2 transcription (Wilkinson et al. 1994). This creates a feedback
mechanism, where the cell that has more LIN-12 activity is inhibited from adopting the
AC fate.
The role of LIN-12 signaling in the AC/VU is analogous to the role of Notch
signaling in sense organ precursor (SOP) specification in D. melanogaster. In C. elegans
the role hlh-2 plays in the AC/VU is similar to the orthologous hlh-2 genes in D.
melanogaster and vertebrates, Daughterless and E2A respectively (reviewed in Tanigaki
& Honjo 2010). The bHLH gene hlh-2 plays two roles in the AC/VU decision: one is to establish competence of pre-AC/pre-VU pair, and the other is to establish AC fate specification (Karp & Greenwald 2003; Karp & Greenwald 2004). These roles are very similar to the role of the pro-neural genes Acute-Scute/Daughterless in SOP specification
(Heitzler & Simpson 1991; Heitzler et al. 1996). However, there is no evidence of a gene or genes performing the analogous role of the E(spl)-C/HES genes in the AC/VU decision, although in embryogenesis the ref-1 family of bHLH transcription factors seems to play an analogous role to the E(spl)-C/HES genes (Karp 2004; Neves & Priess 2005).
Vulval precursor cells and Notch mediated cell-fate decision:
The C. elegans vulva arises from a group of ventral epidermal cells, the vulval
precursor cells (VPCs). There are six cells, P3.p-P8.p, which are born in the L1 stage and
are fated to become the VPCs (Sulston & Horvitz 1977). These are a group of equipotent
cells that have the potential to give rise to the adult vulva (Sulston & White 1980).
During the L2 stage, the proximal most VPC, the P3.p fuses with the hypodermal 12
syncytium, hyp7 in 50% of wild-type worms (Sulston & Horvitz 1977). It is during the
L3 stage that the VPCs adopt distinct fates. The P6.p is instructed to adopt the 1° cell, while P5.p and P7.p adopt the 2° fate. P3.p, P4.p and P8.p adopt the 3° fate, which is a non-vulval fate (Sulston & White 1980; Sternberg & Horvitz 1986). The 3° cells divide once and fuse with hyp7. The 1° and 2° cells will give rise to the adult vulva.
To establish and maintain VPC competence requires a set of transcription and signaling events (Clark et al. 1993; Eisenmann et al. 1998; Myers & Greenwald 2007).
The Hox gene lin-39 is necessary for establishing and maintaining VPC identity (Clark et al. 1993; Maloof & Kenyon 1998). Both the WNT signaling pathways and the EGFR signaling pathway are required for maintaining VPC competence (Eisenmann et al. 1998;
Myers & Greenwald 2007). Although, components of LIN-12 and EGFR signaling are present during the L2 stage, the VPCs do not adopt their fates until the L3 fates. The heterochronic genes lin-4, lin-14 and lin-28 play a role in the temporal control of VPC specification (Ambros & Horvitz 1984; Euling & Ambros 1996; J. Li & Greenwald
2010).
During the L3, coordination between two signaling pathways, the Notch and
EGFR pathways, instruct the VPCs to adopt their fates (see Sternberg 2005). A signal emanating from the AC in the somatic gonad instructs P6.p to adopt a 1° fate. In the absence of an AC, the VPCs fail to receive the inductive signal and they adopt a 3° fate and fuse with hyp7 (Kimble 1981). The EGFR signaling pathway was found to be required for the P6.p cell specification and vulval induction (Horvitz & Sulston 1980;
Sulston & Horvitz 1981; Ferguson & Horvitz 1985; Ferguson et al. 1987; Hill &
Sternberg 1992). The EGF-like ligand lin-3 is expressed in the AC and signals to P6.p 13
(Hill & Sternberg 1992). Mutants in lin-3 and the EGFR let-23 show a defect in vulval
induction (Vul) (Ferguson et al. 1987).
A consequence of receiving EGFR signaling in P6.p is the transcriptional
activation of the DSL ligands lag-2 and apx-1 (Chen & Greenwald 2004; Zhang &
Greenwald 2011). P6.p sends a signal to both its neighbors, P5.p and P7.p, via Notch
signaling to specify the 2° fate. In lin-12(lf) mutants, P5.p and P7.p fail to adopt the 2°
fate, while in lin-12(gf) mutants all VPCs adopt 2° fate characteristics in the absence of
the AC (Greenwald et al. 1983).
There is extensive, mutual inhibitory regulation between EGFR signaling and
LIN-12/Notch signaling in the presumptive VPCs. Not only does EGFR signaling
activate the transcription of the DSL ligands in P6.p, but it also down-regulates LIN-12
protein levels in P6.p (Levitan & Greenwald 1998; Shaye & Greenwald 2002; Shaye &
Greenwald 2005). In addition, when a constitutive active form of LIN-12, either LIN-
12(ΔEΔDTS) or LIN-12(INTRA) is expressed in the VPCs, where the AC is present, the
transcriptional activity of LIN-12 in P6.p is blocked by an unknown mechanism (Shaye
& Greenwald 2002; J. Li & Greenwald 2010).
The activation of lin-12 in 2° VPCs induces the expression of several genes called
the lateral signal target (lst) genes (Yoo et al. 2004; Yoo & Greenwald 2005; Choi 2010).
Many of these lst genes play a role in the down-regulation and attenuation of EGFR signaling (Berset et al. 2001; Yoo et al. 2004; Yoo & Greenwald 2005). The extensive feedback mechanisms between EGFR and LIN-12/Notch ensure robustness and precision in VPC specification. 14
Genetic approaches for Notch components:
Genetic screens have been very successful at uncovering novel Notch components, in C. elegans and in Drosophila melanogaster. In C. elegans a number of screens were done that identified components of the Notch pathway. Some of these screens were done on the basis of phenotypes, such as the Glp, Lag and Lin screens.
Although these resulted in the identification of a few members of the Notch pathway, specifically; glp-1, lin-12, lag-1 and lag-2 (Ferguson & Horvitz 1985; Austin & Kimble
1987; Lambie & Kimble 1991). Suppression and enhancement screens have been more effective in identifying Notch pathway components in C. elegans. I will highlight some of the screens in search of mutations that suppress or enhance of lin-12 or glp-1 associated phenotypes below.
Suppressors and enhancers of lin-12 (sel):
Several screens for suppressors and enhancers of lin-12 have been attempted to identify regulators of Notch signaling (Sundaram & Greenwald 1993; Levitan &
Greenwald 1995; Tax et al. 1997; Katic et al. 2005). These screens have been immensely successful in identifying components of the Notch signaling pathway in C. elegans (see
Greenwald 2005). Most of these screens attempted to suppress the egg-laying defective phenotype of lin-12(gf) alleles. I will not be discussing these in detail, although below I will discuss the identification of sel-12, a component of the γ-secretase complex, in a sel screen. 15
Enhancers of glp-1(lf) (ego):
A screen for enhancers of a loss-of-function allele of glp-1 identified several potential Notch interactors (Qiao et al. 1995). The allele used in the screen was the temperature-sensitive mutant glp-1(bn18) at the non-permissive temperature, 25 °C, these mutants display a Glp phenotype. At 15 °C and 20 °C the glp-1(bn18) mutant has normal germ-line proliferation. The genes identified enhanced the loss-of-function phenotype of glp-1(bn18), such that the double mutants displayed a Glp phenotype at 20 °C.
The screen recovered mutations in two previously identified genes, lag-1 and glp-
4. The gene lag-1 had been identified in a screen for the Lag phenotype, which is a Notch loss-of-function phenotype (Lambie & Kimble 1991). glp-4 originally was identified in a screen for under-proliferating germline and is a tRNA synthetase (Schedl, T; personal communication). The screen also identified five new ego genes. Out of the five ego genes only two have been cloned. EGO-1 is RNA-directed RNA polymerase, which is critical for RNAi in the germline (Smardon et al. 2000; Maine et al. 2005). It is likely that it is not involved in Notch signaling per se.
The other cloned gene, ego-2 appears to be a bona-vide Notch interactor (Liu &
Maine 2007). It enhances several loss-of-function phenotypes in the embryo, during larval development and during germline development. ego-2 functions in somatic tissue to promote glp-1 signaling in the germline, thus, it is likely that ego-2 functions to promote the ligand activity in the DTC (Liu & Maine 2007). EGO-2 is homologous to yeast Bro1p, which is involved in the endocytic pathway, specifically in the multivesicular endosome-sorting pathway. 16
The C. elegans Epsin orthologue, epn-1, is required for the function of the DTC ligand to promote glp-1 dependent germ-line proliferation (Tian et al. 2004). As Epsin is a component of the endocytic pathway, it is tempting to speculate that ego-2 and epn-1 function in a similar pathway to promote ligand function. Interesting, the other Bro1p orthologue in C. elegans, ALX-1 has been implicated in the downregulation of the LIN-
12 in the primary VPC (Shaye & Greenwald 2005). ego-2 and alx-1 function antagonistically to each other in respect to certain Notch functions (Liu & Maine 2007).
Suppressors of glp-1(lf) (sog):
A screen for suppression of a loss-of-function allele of glp-1 identified several potential Notch interactors. There were two temperature-sensitive alleles used in the screen, glp-1(q224) and glp-1(q231) (Kodoyianni et al. 1992). These two mutations show a loss-of-function a Glp phenotype, at 20 °C and 25 °C and are viable and fertile at 15 °C.
The genes identified suppress the loss-of-function phenotype of glp-1(q224) and/or glp-
1(q231), such that the double mutants were viable and fertile at 20 °C (Maine & Kimble
1993).
Six genes were identified to suppress the loss-of-function phenotypes of glp-1.
These genes were identified as sog genes. All of the identified sog genes were able to suppress both the germline phenotype and the embryonic phenotypes associated with glp-
1(lf). However, the sog genes did not have phenotypes on their own and thus were not pursued any further (see Kimble & Crittenden 2005).
17
Tumorous enhancers of glp-1(gf) (teg):
A screen for enhancers of a weak gain-of-function glp-1 mutant identified four teg genes. The screen was performed on a glp-1(oz112oz120) double mutant that has a weak over-proliferation of the germline phenotype (Berry et al. 1997). The mutants recovered in the screen enhanced tumorous phenotype of glp-1(oz112oz120), reminiscent of glp-
1(oz112) . Two of the four genes were mapped and cloned; teg-1 and teg-4 encode mRNA splicing factors. It appears that teg-4 is not involved in Notch signaling, but it is involved in meiotic entry of the germline (Mantina et al. 2009).
γ-secretase complex in Notch transduction and APP processing:
The γ-secretase complex contains a presenilin, SEL-12 or HOP-1, and includes other components as well: APH-1, a seven transmembrane domain protein; APH-2, a type I integral membrane protein thought to be the substrate receptor for γ-secretase; and
PEN-2, a small protein with two transmembrane domains (Kimberly et al. 2003; Edbauer et al. 2003; reviewed in Jorissen & Strooper 2010). The presenilins provide the catalytic activity of the complex (Wolfe et al. 1999). It is thought that the presenilins are mainly involved in ectodomain shedding, as the γ-secretase complex only cleaves small extracellular stubs without sequence specificity (Struhl & Adachi 2000). It appears as though the γ-secretase complex has been co-opted by the Notch pathway as mutations in the presenilin catalytic subunits, sel-12 and hop-1, phenocopies loss of Notch signaling in
C. elegans (X. Li & Greenwald 1997; Westlund et al. 1999). This is also true in mice and flies where the loss of the Presenilin subunit has phenotypes associated with loss of 18
Notch signaling in those organisms (Donoviel et al. 1999; Herreman et al. 1999; Struhl &
Greenwald 1999; Ye et al. 1999).
Genetic analysis identified many of the core components of the γ-secretase complex. In humans, the Presenilin locus was first identified in genetic linkage studies for Familial Alzheirmer’s Disease (FAD) families (Schellenberg et al. 1992; Van
Broeckhoven et al. 1992; St George Hyslop et al. 1992; Sherrington et al. 1995). In C. elegans, a genetic screen for suppression of a gain-of-function lin-12 allele, the worm orthologue, sel-12 was identified as a Notch pathway component (Levitan & Greenwald
1995).
Biochemical studies identified Nicastrin as a presenilin interactor in mammalian cell lines (Yu et al. 2000). Although a genetic locus which contains Nicastrin was identified in genetic linkage studies of FAD families, it is unclear whether polymorphisms in Nicastrin correlate with AD pathlogies (Zubenko et al. 1998; Kehoe et al. 1999; Orlacchio et al. 2002; Confaloni et al. 2003). In C. elegans, a screen for genes involved in the development of the anterior pharynx found APH-2, the C. elegans
Nicastin orthologue (Goutte et al. 2000). The aph-2 gene was subsequently found to genetically interact with lin-12 in various cell fate decisions (Levitan et al. 2001).
The other core components of the γ-secretase complex were identified in C. elegans using genetic analysis. In the same screen that identified aph-2, another γ- secretase component APH-1 was uncovered (Goutte et al. 2002). In a screen for enhancement of a sel-12 loss-of-function mutation in C. elegans, yet another component of the γ-secretase was found, PEN-2 (Francis et al. 2002). APH-1 and PEN-2 were found 19
to be required for γ-secretase activity in conjunction with Presenilin and Nicastrin
(Kimberly et al. 2003; Edbauer et al. 2003).
Null mutations in the three auxiliary components of γ-secretase complex, aph-1,
aph-2 and pen-2, display phenotypes which are associated with the loss of Notch
signaling in C. elegans; mainly, they have a maternal-effect lethal (Mel) phenotype and a
loss of the anterior pharynx (Aph) phenotype (Goutte et al. 2000; Levitan et al. 2001;
Francis et al. 2002; Goutte et al. 2002). They also interact with components of the Notch
pathway (Levitan et al. 2001; Francis et al. 2002). This suggests that in C. elegans the
main function of the γ-secretase complex is to promote Notch signaling. Studies in mice
also provide evidence that the components of the γ-secretase complex are mostly
involved in promoting Notch signaling (Shen et al. 1997; Donoviel et al. 1999; Herreman
et al. 2003; T. Li et al. 2003; Ma et al. 2005; Serneels et al. 2005).
Although it appears that the main function of the γ-secretase complex is to
promote Notch signaling, there have been other γ-secretase substrates identified
(reviewed in Parks & Curtis 2007). The most important, medically and historically, is the
protein APP, whose processing by γ-secretase complex leads to the accumulation of Aβ
peptides, which are found in amyloid plaques of patients suffering from Alzheimer’s
disease (Kang et al. 1987; Goate et al. 1991; Scheuner et al. 1996). Like Notch, the
extracellular domain of APP undergoes two rounds of proteolytic cleavages; in neurons
these cleavages of APP occur at the S2 site by the BACE protease and then at the S3 site
by the γ-secretase complex (De Strooper et al. 1998; Vassar et al. 1999). Normally, the γ-
secretase complex generates a 40 amino acid peptide known as Aβ40 and also a minor larger peptide species, Aβ42. Mutations in PS1 found in some FAD patients cause a shift 20
in the processing of the extracellular domain of APP towards the production of the larger
Aβ42 peptide; the two extra amino acids in the Aβ42 peptide cause a propensity of the Aβ peptides to aggregate; thought to be the cause of plaque formation and progression of
Alzheimer’s disease (Scheuner et al. 1996).
There has been an interest in the γ-secretase complex not only in its relation to
Notch signaling but also APP processing. In an attempt to better understand the γ- secretase complex, Wakabayashi et al. pulled down the γ-secretase complex and identified proteins that were associated with γ-secretase by mass-spectrophotometry
(Wakabayashi et al. 2009). They were successful in identifying the tetraspanins CD81 and CD9 as facilitating the γ-secretase ability to process the APP type I integral membrane protein. In a separate study, originating with genetic analysis of tetraspanins in
C. elegans, the mammalian tetraspanins TSPAN33 and TSPAN5 were found to facilitate
Notch signaling at the level of γ-secretase activity, while reduction in CD81 did not affect
Notch processing (Dunn et al. 2010). This leads to an intriguing possibility that there might be accessory proteins that differentially promote the processing of γ-secretase substrates.
Summary of Results:
Here, I present my studies performed during my graduate career. In Chapter 2, I discuss the attempt to develop a transgenic system using the bacteriophage φC31 integrase system. The introduction and discussion of transgenesis in C. elegans will be discussed in Chapter 2 itself. I show evidence that φC31 integrase functions in C. elegans somatic tissue. I have been able to use φC31 integrase to mediate single-copy insertion of 21
a transgenes in the C. elegans germline, however I have not been able to repeat that
result.
In Chapter 3, I use genetic analysis to test many genes that were reported to be
associated with the γ-secretase complex in a mammalian tissue culture system
(Wakabayashi et al. 2009) to assess whether they are modulators of Notch in C. elegans. I
have identified several genes that suppress a glp-1(gf) allele and one gene that suppress a glp-1(lf) allele. I discuss why these genes are unlikely to be bona fide Notch interactors in
Chapter 3 and the General Discussion.
22
Chapter 1: Figures and Tables. 23
Table 1: Notch Pathway Core Components and Modulators of Activity Function Class C. elegans D. melanogaster H. sapiens LIN-12 NOTCH NOTCH1 GLP-1 NOTCH2 Receptors Notch NOTCH3 NOTCH4 LAG-2 DELTA DLL1 APX-1 SERRATE JAGGED1 DSL Ligand ARG-2 JAGGED2 Ligands DSL(1-7) DOS(1-3) DLK-1 DOS Co-ligands OSM-7 DLK-2 OSM-11 Nuclear CSL -DNA Binding LAG-1 SU(H) RBP-J Co-activator SEL-8 MAM MAML(1-3) Complex Co-Repressor SMRTR NCOR/SMRT Furin KPC-1* FURIN 1 FURIN (site 1 cleavage) BLI-4* FURIN 2 Proteases Metalloproteases SUP-17 KUZ ADAM10 KUL (site 2 cleavage) ADM-4 TACE ADAM17 SEL-12 PSN PS1 Presenilin HOP-1 PS2 γ-secretase Nicastrin APH-2 NCT NCSTN complex Presenilin Enhancer PEN-2 PEN-2 PSENEN APH-1 APH-1 APH1A APH1 APH1B EPN-1 LQF EPN1 RSD-3* EPSIN-LIKE* EPN2 Ligand Activation Epsin EPN3 ENTHD1* CLINT1* Deltex - DELTEX DELTEX(1-4) NUM-1* NUMB NUMB Numb NUMBL Sel-10/FBW-7 SEL-10 AGO FBW-7 E3 Ligases ITCH/WWP WWP-1 Su-Dx ITCH WWP1 WWP2 Mib - MIB(1-2) MIB(1-2) Neuralized F10D7.5* NEUR NEURL1B Pofut C15C7.7* NEUROTIC POFUT1 Sugar Poglut - RUMI POGLUT1 - FRINGE RADICAL FRINGE modifications Fringe - MANIC FRINGE - LUNATIC FRINGE Numb-associated SEL-5 NAK AAK1 kinase BMP2K-203 KIN-3* CKIIALPHA* CSNK2A(1-2) Casein Kinase II Kinases KIN-10* CKIIBETA* CSNK2B Nemo-like Kinase LIT-1* NMO* NLK CDK8 CDK-8* CDK8* CDK8 GSK3* SSG GSK3A GSK3β GSKT GSK3B Core components and modulators of Notch signaling in C. elegans, D. melanogaster and H. sapiens. *Interactions of the genes marked with an asterisk in these organisms with the Notch pathway have not been tested. 24
EGF Repeats LNR Repeats Heterodimerization Domains Transmembrane Domain Ankyrin Repeats PEST
Extracellular
Intracellular
200 AA
0 AA
LIN-12 GLP-1 NOTCH NOTCH1 NOTCH2 NOTCH3 NOTCH4
C. elegans D. melanogaster H. sapiens Figure 1: Domain organization of Notch from C. elegans, D. melanogaster and H. sapiens. 25
LAG-2/ APX-1 Signal Sending Cell
S2 Cleavage (SUP-17/ADM-4)
LIN-12/ GLP-1 S3 Cleavage (SEL-12/HOP-1)
Signal Receiving Cell
LIN-12/GLP-1 (INTRA)
S1 Cleavage LAG-1 (BLI-4/KPC-1?)
LIN-12/GLP-1(INTRA) SEL-8 LAG-1 O-fucosylation (C15C7.7?) Figure 2: Overview of LIN-12 signaling in C. elegans, showing the core components of the signaling pathway. 26
A. B. Meiotic Entry Z2, Z3 Distal Tip Proliferative Zone Transition Zone L1 Cell
DTCs
29 L2 9 10 19 20 30 39 40 40 40 40 Mitotic germ cell Somatic Gonad
21 28 38 41 2 8 11 18 31 41 41 L3 32 1 3 7 12 17 22 27 37 42 42 42 Meiotic germ cell 26 Mid L4 4 6 13 16 23 33 36 43 43 43 43
5 14 15 24 25 34 35 44 44 44 44 Initiation of meiosis
GLP-1 expressing cells Meiotic Cells Late L4
DTC Meiotic Prophase Sperm development Adult Proliferative Cells Intermediate Cells
Oogenesis Oocytes Uterus Sperm C.
Meiosis GLD-1 NOS-3 Mitosis LAG-2 GLP-1 FBF-2 Meiosis GLD-2 GLD-3 Mitosis
Figure 3: Germline development and proliferation maintenance:
A. Schematic of germline development. (Adapted from Lints and Hall, 2009)
B. Schematic of distal germline. The LAG-2 expressing DTC sends filopodia proximally in the germline. GLP-1 is expressed in the distal germline maintain those cells in a proliferate mitotic state. As GLP-1 activity decreases cells enter Meiosis.
C. Genetic circuit in the distal germline. See text for description. 27
2 Cell-Stage
AB P1
4 Cell-Stage
ABp
ABa P2
EMS
12 Cell-Stage
plp P3C pla
MS E alp ala prp ara pra
arp
GLP-1 expressing cell Activated GLP-1
Signal sending cell REF-1 expressing cell
Figure 4: Embryogenesis and Inductive Signaling:
At the 2-cell stage GLP-1 mRNA, which has been maternally loaded, is inhibited from transla- tion by GLD-1. At the 4-cell stage GLP-1 is expressed in the AB daughters, ABa and ABp. As ABp is in contact with the signal sending P2 cell, GLP-1 becomes active in the ABp. At the 12- cell stage, the GLP-1 transcriptional target, REF-1 is expressed in the ABp granddaughters. ABp descendants, in grey, are refractive to the signal from the MS cell. The second Notch inductive signal occurs between the MS cell and ABa descendants. At this stage, GLP-1 becomes active in ABalp and ABara, which are in direct contact with the MS cell. (adapted from Priess 2005). 28
A. B. L1 Molt/Early L2
Z1.ppa Z1.ppp Z4.aaa Z4.aap
L1
AC/VU pair
Z1 Z2 Z3 Z4 Mid L2
L2/L3 Molt
Z1 Z4 Pre-VU Pre-AC a p a p
L2 Molt
SS DU DU SS
DTC DTC SS SS VU AC
VU AC VU VU LIN-12 expressing cell LIN-12 activated cell
LAG-2 expressing cell HLH-2 expressing cell
Figure 5: AC specification and lateral inhibition.
A) Schematic of the lineage of the somatic gonad. The gonad primordium at the L1 stage and at the L2 molt. This is showing 5L configuration, where Z4.aaa has become the AC (anchor cell). DTC: distal tip cell. SS: spermatheca/sheath cell. DU: dorsal uterine. VU: ventral uterine (adapt- ed from Lints and Hall 2009).
B) The AC/VU decision. At the L1 molt/early L2, LIN-12 is expressed in the daughters of Z1.pp and Z4.aa. LAG-2 is expressed in the Z1.ppp and Z4.aaa. During the decision, the Pre-AC cell downregulates LIN-12 levels, while the Pre-VU cell downregulates LAG-2 levels. Downregula- tion of LIN-12 allows HLH-2 protein expression (adapted from Levitan and Greenwald 1998; Karp and Greenwald 2003). 29
L1 P3.p P4.p P5.p P6.p P7.p P8.p
L2 P3.p P4.p P5.p P6.p P7.p P8.p
L3 P3.p P4.p P5.p P6.p P7.p P8.p
Pn.p 2° 1° 2°
Pn.px
Pn.pxx
LIN-12 expressing cell LIN-12 activated cell
Lateral signal
Figure 6: VPC fate specification and LIN-12.
LIN-12 expression in the VPCs is visible during the L2 stage. During vulval induction of the VPCs, LIN-12 is down-regulated in P6.p, while the DSL ligands, LAG-2 and APX-1 are tran- scribed in this cell. Expression of LIN-12 is maintained in the P5.p and P6.p daughter and the two inner most granddaughters (Levitan and Greenwald 1998). LIN-12 activity as monitored by 2° cell markers are on in the same cell which have LIN-12 protein expression. After induction P3.p, P4.p and P8.p divide and fuse with hyp7 syncetium (adapted from Levitan and Greenwald 1998). 30
Chapter 2: ΦC31 transgenesis in C. elegans. 31
Abstract:
The ability to make transgenic animals has been a great tool for biologists to study living organisms. It has allowed scientists to uncover many aspects of biology: genetics, biochemistry, cell biology and neurobiology. In C. elegans, transgenes are generated by germline injections of DNA, which forms extra-chromosomal arrays that are composed of many copies of the injected DNA. The nature of extrachromosomal arrays makes them problematic in many circumstances. Furthermore, there is no single, simple, reliable approach that circumvents all of the problems with extrachromosomal arrays. I describe an attempt to use the φC31 integrase system, which has been used successfully in D. melanogaster for single copy insertion of transgenes into the genome. The bacteriophage
φC31 integrase mediates sequence-specific recombination between two largely different sequences, called attB and attP. This method requires one of the att sites to be integrated into the genome. The work in this chapter deals with the attempts to adapt the φC31 system for suitable use in C. elegans.
Introduction:
The ability of making transgenes, that is the introduction of foreign DNA into an organism has been a very significant technical advancement which has helped modern biologist to better study living organisms and the processes involved therein. They have been instrumental in uncovering gene function at the cellular and tissue level of multiple biological model systems. 32
In C. elegans, the method for the introduction of transgenes was first attempted
over 20 years ago (Stinchcomb et al. 1985). Due to the nature of C. elegans biology,
injected foreign DNA undergoes concatemerization, recombination and non-homologous
end-joining to form a pseudo-chromosome, called an extrachromosomal array
(Stinchcomb et al. 1985). Such arrays contain multiple copies of the injected DNA,
anywhere between 80-300 copies (Stinchcomb et al. 1985; Fire & Waterston 1989; Mello
et al. 1991). Recent work has quantified the number of copies in several different arrays,
which suggests transgenes are incorporated into arrays at a much lower copy number than
previously thought (Cochella et al., personal communications, August 2011). The
frequency of propagation of extrachromosomal arrays are quite variable, such that the
array can be lost in cells or tissues creating mosaic animals or lost from the germline, making propagation of the array problematic (Mello & Fire 1995).
Although extrachromosomal arrays have been very useful in studying gene function in C. elegans, there are many disadvantages to this technique. As there are many copies of the transgene, the levels of expression can be several fold higher than the original locus, which could complicate the interpretation of results obtained from extrachromosomal arrays (Fire & Waterston 1989).
As extrachromosomal arrays are repetitive they trigger a silencing mechanism via
RNAi. The germline in particularly is sensitive to array silencing (Kelly et al. 1997; Kelly
& Fire 1998; Seydoux & Strome 1999). This makes it difficult to study gene expression and function in the germline.
Techniques have been developed to overcome some of the limitation of extrachromosomal arrays. To overcome the propensity of extrachromosomal arrays to 33
silence, a method was developed to make the extrachromosomal array similar to chromosomes, by mixing digested genomic DNA with transgenes prior to injection
(Kelly et al. 1997). Fosmid recombineering has been used to create reporter genes with higher expression fidelity as more of the genomic context is included in the transgene
(Tursun et al. 2009). An added benefit is that the transgene itself is larger, thus arrays made from fosmids have lower copy number of the transgene (Tursun et al. 2009). To ensure that the transgenes segregate in a mendelian fashion, irradiating extrachromosomal arrays with γ-rays can integrate arrays into the genome (Mello & Fire
1995).
Two techniques have been used to integrate transgenes in low-copy number into the genome. Injection of DNA coding the sup-7(st5) mutant gene into the C. elegans germline inhibits extrachromosomal array formation due to the toxic effects of sup-7(st5) on gene translation, however at a low frequency the injected DNA can integrate into the genome at low-copy number (Fire 1986). The limiting aspect of this technique is the low frequency of the desired events. Another method to achieve low-copy integration of transgenes has been developed by introducing DNA via micro-particle bombardment
(Praitis et al. 2001).
The best approach for introducing transgenes into the C. elegans genome would have the ability to insert a transgene in single-copy at a known location. This would have many advantages over current methods of making transgenes. Recently, an approach has been developed that uses homologous recombination to introduce transgenes in single- copy at a known location (Frøkjaer-Jensen et al. 2008). This method will be further elaborated in the results and discussion section. Site-specific recombination systems are 34
attractive tools, capable of providing specificity and ease-of-use, to introduce transgenes into the C. elegans genome.
Site-specific recombination systems have been used very successfully in biology.
Two recombination systems that mediate recombination between identical sequences have been developed for in-vivo use in model organisms. These are the Flp recombinase/FRT binding site from the yeast S. cerevisiae and the Cre recombinase/LoxP landing site from the bacteriophage P1 (Golic & Lindquist 1989; Golic 1991; Sauer &
Henderson 1988). Flp/FRT systems have been successful in D. melanogaster to generate involves flanking a gene of interest by a pair of FRT sequences in tandem. Expressing the
Flp recombinase using a heat-shock promoter, causes the gene of interest to be excised from cells at random, thus creating mosaic animals (Golic & Lindquist 1989). A variation of this method has been used to induce gene expression, where the excision of the intervening sequence would cause expression of a gene of interest (Struhl & Basler
1993). Recently, the Flp/FRT system has been adapted for use in C. elegans (Voutev &
Hubbard 2008; M. W. Davis et al. 2008; Vázquez-Manrique et al. 2010). The Cre/loxP system has been used in mammalian model organisms and mammalian cell lines in a similar way to the Flp/FRT site-specific recombination system (Sauer & Henderson
1989; Sauer & Henderson 1988; Sauer & Henderson 1989; Orban et al. 1992; Gu et al.
1993). As both of the recombinases, Flp and Cre, are bi-directional, they are an unattractive option to attempt recombinase mediated transgene insertion.
The λ integrase, from the λ phage, is one of the best-studied site-specific integrases. It is required for the integration and excision of the λ prophage from the E. coli bacterial genome (reviewed in Van Duyne 2005). It mediates recombination between 35
an attB site in the prophage and an attP site in the E. coli genome creating two recombination products; attL and attR sites. The λ integrase requires an integration host
factor (IHF) to be able to catalyze the integration event (Van Duyne 2005). For the
excision event, λ integrase requires the IHF as well as another host factor, Fis, and the
phage-produced factor Xis (Van Duyne 2005). The Xis factor stimulates the excision
event as well as inhibits the integration event. Due to requirement of accessory factors, λ
integrase has not been adapted for use in in-vivo systems, although, Invitrogen™ has
commercialized it for in-vitro use under the brand Gateway®.
The φC31 integrase is a member of a family of serine recombinases (Thorpe &
Smith 1998; Thorpe et al. 2000). It is derived from the Streptomyces phage φC31, where
it is required for the integration and excision of the φC31 phage genome into its host
genome, in a similar fashion to λ integrase. During integration, φC31 integrase catalyzes
recombination between attP and attB sites to create attR and attL sites (figure 2A). The
attachment sites for φC31 are relatively small, less than 50 bp in length (Smith & Thorpe
2002). The major difference between λ integrase and φC31 integrase, in terms of its
ability to be used in heterologous recombination systems, is that φC31 integrase does not
require accessory proteins to catalyze the recombination reaction between attB and attP
sites (Thorpe et al. 2000). Recently, a phage produced factor from φC31 was found to
change the directionality of φC31 integrase, that is to make φC31 integrase capable of
mediating recombination between attL and attR sites (Khaleel et al. 2011).
φC31 integrase has been used in many different organisms, including mammalian cell lines and has been a powerful molecular tool in D. melanogaster (Groth et al. 2000;
Groth et al. 2004; Bischof et al. 2007). In either case, whether a cell line or a D. 36
melanogaster strain, attP sites were integrated into the genome. Expression of the φC31
integrase along with the introduction of a donor plasmid, containing the attB site, is
capable of placing the entire donor plasmid into the genome (see figure 2C). To
differentiate the mechanism of integration by this method, I will refer to this as Whole
Plasmid Integration or WPI. In Drosophila melanogaster, co-injection of φC31 mRNA and the donor plasmid into an attP containing strain result in successful integration of the donor plasmid, although the efficiency of mRNA based integration is very low (Groth et al. 2004; Bateman et al. 2006; Bischof et al. 2007; Bateman & Wu 2008). The issue of handling φC31 mRNA is a concern in terms of getting good integration efficiency. To bypass the requirement for co-injecting φC31 mRNA, transgenic animals expressing
φC31 in the D. melanogaster germline were produced (Bischof et al. 2007). By injecting the donor plasmid into an attP line expressing φC31, the efficiency of integration was greatly increased (Bischof et al. 2007; Bateman & Wu 2008). The rate of integration approached 60% for some attP sites (Bischof et al. 2007).
As an alternative to the WPI, another method has been developed (Bateman et al.
2006). This method termed Recombination-Mediated Cassette Exchange (RMCE), uses
two attP sites flanking a marker integrated into the genome. The donor plasmid contains
two attB sites flanked by a transgene of interest. Injection of the donor plasmid plus a
φC31 source should cause an exchange between the marker and the gene of interest (see
figure 2D). By using a transgenic source of φC31, the integration frequency of RMCE
was not significantly decreased from WPI (Bateman & Wu 2008).
RMCE has several advantages to WPI. One advantage is that no vector sequence
will be integrated with your transgene. In some cases, it might be undesirable to have 37
vector sequences in close proximity to your transgene. In C. elegans in particular, it has been shown that vector sequences can have an impact with the expression of transgenes in extrachromosomal arrays (Etchberger & Hobert 2008). With RMCE, the vector will not be integrated, eliminating one possible source of variability. Another advantage is that one can use the marker in the landing site as a negative selectable marker. In this way, one can distinguish between the integration at the landing site or between a pseudo attP site that might be present in the genome. It will be especially useful in C. elegans where there is a propensity for injected DNA to form extrachromosomal arrays.
In this chapter, I show that φC31-mediated recombination works in C. elegans. I show that it can occur in somatic tissue, however it is difficult to determine how well it works in the germline. Getting high efficiency integration in the germline has proved elusive. In this chapter, I outline the methods tried for getting germline φC31 mediated integration.
Materials and Methods:
Strains:
Caenorhabditis elegans var. Bristol strain N2 was the wild-type parent strain of all mutants and markers used. Key strains used herein were:
HT1593: unc-119(ed3)
GG48: emb-27(g48)
GS5652: ttTi5605; unc-119(ed3)
GS5653: unc-119(ed3); cxTi10882
GS5654: unc-119(ed3); cxTi9393 38
GS5655: cxTi10471; unc-119(ed3)
GS5780: emb-27(g48); ttTi9626
GS5781: emb-27(g48); ttTi11418
GS5694: emb-27(g48); arEx1323[Pceh-22::GFP:: unc-54 3’ UTR; Pglh-
2::3xHAφC31::glh-2 3’ UTR; emb-27(+)]
GS5695: emb-27(g48); arEx1324[Pceh-22::GFP:: unc-54 3’ UTR; Pglh-
2::3xHAφC31::glh-2 3’ UTR; emb-27(+)]
GS5595: arSi1[attP::Pglt-3::Venus::unc-54 3’ UTR::Cb unc-119(+)::sup-
7(st5)::attP]/ttTi5605; unc-119(ed3)
GS5596: arSi1[attP::Pglt-3::Venus::unc-54 3’ UTR::Cb unc-119(+)::sup-
7(st5)::attP]/mnC1[dpy-10(e128) unc-52(e444)]; unc-119(ed3)
GS5883: unc-119(ed3); arSi2[attP::Pglt-3::Venus::unc-54 3’ UTR::Cb unc-
119(+)::sup-7(st5)::attP]/cxTi10882
GS5884: unc-119(ed3); arSi2[attP::Pglt-3::Venus::unc-54 3’ UTR::Cb unc-
119(+)::sup-7(st5)::attP]/mDf9
GS6093: emb-27(g48); arSi3[emb-27(+)::Pglh-2::3xHAφC31::glh-2 3’ UTR]
GS6094: unc-119(ed3) arSi3[emb-27(+)::Pglh-2::3xHAφC31::glh-2 3’ UTR]
GS6095: arSi1[attP::Pglt-3::Venus::unc-54 3’ UTR::Cb unc-119(+)::sup-
7(st5)::attP]//mnC1[dpy-10(e128) unc-52(e444)]; arSi3[emb-27(+)::Pglh-
2::3xHAφC31::glh-2 3’ UTR] unc-119(ed3)
GS6096: arSi3[emb-27(+)::Pglh-2::3xHAφC31::glh-2 3’ UTR] unc-119(ed3); arSi2[attP::Pglt-3::Venus::unc-54 3’ UTR::Cb unc-119(+)::sup-7(st5)::attP]//mDf9.
GS5885: arCe1[attR::Pmyo-3::mCherry::unc-54 3’ UTR::attR]; unc-119(ed3). 39
MV83.3 and MV83.10: pha-1(e2123); arExMV83.3 or arExMV83.10[Phsp-
16.2::φC31::tbb-2 3’ UTR, Prpl-28::attP::pat-3::CFP::unc-54 3’
UTR::attB::2xNLS::YFP::let-858 3’ UTR, pha-1(+)]
Plasmids:
MosSCI plasmids:
pMLV011: Homology region to ttTi5605: A 2.9 kb region flanking both sides of ttTi5605 Mos1 transposable element was amplified from N2 genomic DNA using primers ttTi5605-F (tcgagcaaatcgacaactttcca) and ttTi5605-R (cacggcgatatgtatctgtagatca) and
AccuPrime pfx polymerase (Invitrogen) and cloned into pCR-BLUNT-II-TOPO
(Invitrogen) to create pMLV010. An AscI restriction site was introduced in pMLV010 at the site of the mosI transposable element using primers QCttTi5605-top
(ggtagcaaactcacttcgtgggcgcgccagtgcaagtaagatcagtgt) and QCttTi5605-bottom
(acactgatcttacttgcactggcgcgcccacgaagtgagtttgctacc) and the QuikChange II XL site- directed mutagenesis kit (Agilent Technologies).
pMLV018: Homology region to cxTi10471: A 3.8 kb region flanking both sides of cxTi10471 Mos1 transposable element was amplified from N2 genomic DNA using primers cxTi10471-F (catcaaaaccatctgcaaatgc) and cxTi10471-R
(gtgtgcagaacatccaaactagaa) and AccuPrime pfx polymerase (Invitrogen) and cloned into pCR-BLUNT-II-TOPO (Invitrogen) to create pMLV017. An AscI restriction site was introduced in pMLV017 at the site of the mosI transposable element using primers
QCcxTi10471-F (gatgatgaagaatttggcgcgccatacaccagtttcgg) and QCcxTi10471-R 40
(ccgaaactggtgtatggcgcgccaaattcttcatcatc) and the QuikChange II XL site-directed mutagenesis kit (Agilent Technologies).
pMLV059: Homology region to cxTi10882: A 4.2 kb region flanking both sides of cxTi10882 Mos1 transposable element was amplified from N2 genomic DNA using primers cxTi10882-F (tttgagcacttctgtcctacaagcc) and cxTi10882-R
(gcatagcctgcaggattccatatt) and AccuPrime pfx polymerase (Invitrogen) and cloned into pCR-BLUNT-II-TOPO (Invitrogen) to create pMLV058. An AscI restriction site was introduced in pMLV058 at the site of the mosI transposable element using primers
QCcxTi10882-F (gtacgagttctgcgtttttgaattggcgcgccatagaatcaagcatgctc) and QCcxTi10882-
R (gagcatgcttgattctatggcgcgccaattcaaaaacgcagaactcgtac) and the QuikChange II XL site- directed mutagenesis kit (Agilent Technologies).
pMLV063: Homology region to ttTi11418: A 4.8 kb region flanking both sides of ttTi11418 Mos1 transposable element was amplified from N2 genomic DNA using primers ttTi11418-F (cagcacagtcaatggagaaagca) and ttTi11418-R (taccccgcgacatttgaaaa) and AccuPrime pfx polymerase (Invitrogen) and cloned into pCR-XL-TOPO (Invitrogen) to create pMLV062. An AscI restriction site was introduced in pMLV062 at the site of the mosI transposable element using primers QC ttTi11418-F
(tcactgttccaaaagttccttctaattggcgcgccatacccatcatgccg) and QC ttTi11418-R
(cggcatgatgggtatggcgcgccaattagaaggaacttttggaacagtga) and the QuikChange II XL site- directed mutagenesis kit (Agilent Technologies).
pMLV105: Homology region to cxTi9393: A 5.0 kb region flanking both sides of cxTi9393 Mos1 transposable element was amplified from N2 genomic DNA using primers cxTi9393-F (ataacgtttcagataagcccaagg) and cxTi9393-R (tgcttgttgctgactgatcc) 41
and AccuPrime pfx polymerase(Invitrogen) and cloned into pCR-BLUNT-II-TOPO
(Invitrogen) to create pMLV104. An AscI restriction site was introduced in pMLV104 at the site of the mosI transposable element using primers QCcxTi9393-F
(cagtgagagcacagcgttggcgcgccaaattagcctaggggaaa) and QCcxTi9393-R
(tttcccctaggctaatttggcgcgccaacgctgtgctctcactg) and the QuikChange II XL site-directed mutagenesis kit (Agilent Technologies).
pMLV127: Homology region to ttTi9626: A 3.0 kb region flanking both sides of ttTi9626 Mos1 transposable element was amplified from N2 genomic DNA using primers ttTi9626-F (ggcaaaaacgtgagaaagagaag) and ttTi9626-R (gaaagccaaatgagaatcccg) and
AccuPrime pfx polymerase (Invitrogen) and cloned into pCR-BLUNT-II-TOPO
(Invitrogen) . attP plasmids:
pMLV089: attP::Pglt-3::venus::unc-54 3’ UTR::Cb unc-119(+)::sup-
7(st5)::attP:
attP site was amplified from pM(3xP3RFP-attP') (Bischof et al. 2007) using primers SAattP-F (atgagctcggcgcgccgtactgacggacacaccgaag) and NattP-R
(tgctagctgtcggtcgactacaggtcactaat) then digested with SacI and NheI restriction enzymes and ligated to pBS II KS(-) (Agilent Technologies) digested with SacI and XbaI and treated with alkaline phosphatase to create pMLV006.
A 1.0 kb region flanking sup-7 tRNA was amplified from N2 genomic DNA using primers Hsup-7-F (ataagcttccatgatgcgaaaatgacca) and Sup-7-R
(tgttcagtttgcgggtgcat) and the Expand Long PCR kit (Roche) and cloned into pCR-XL-
TOPO(Invitrogen) to create pMLV027. A C to T change was introduced at the anti-codon 42
site to mimic the sup-7(st5) mutation with primers QCsup7(st5)-top
(gtagcgcgttcgactctagatcgaaaggttgg) and QCsup7(st5)-bottom
(ccaacctttcgatctagagtcgaacgcgctac) and the QuickChange II mutagenesis kit (Agilent
Technologies) to create pMLV028. pMLV028 was digested with HindIII and NheI to liberate the 1.1 kb sup-7(st5) fragment and then it was cloned into the HindIII/SpeI sites of pMLV006 to create pMLV029.
attP site was amplified from pM(3xP3RFP-attP') ((Bischof et al. 2007)) using primers KAattP-F (atggtaccggcgcgccgtactgacggacacaccgaag) and SattP-R
(ccgagtcgacttcgcgctcgcgcgactgacgg) the Expand Long PCR kit (Roche), then digested with KpnI and SalI restriction enzymes and ligated to the KpnI/XhoI sites of pMLV029 to create pMLV030.
pDS263 (D. Shaye, unpublished) was digested with SphI to liberate a 4.2 Kb fragment containing Pglt-3::Venus::unc-54 3’UTR::Cbunc-119(+). This fragment was cloned into the EcoRV site of pMLV030 to create pMLV089.
pMLV093: pMLV089 was digested with AscI to liberate the 5.7 Kb attP cassette.
This fragment was inserted into the AscI site of pMLV011.
pMLV098: pMLV089 was digested with AscI to liberate the 5.7 Kb attP cassette.
This fragment was inserted into the AscI site of pMLV018.
pMLV099: pMLV089 was digested with AscI to liberate the 5.7 Kb attP cassette.
This fragment was inserted into the AscI site of pMLV059.
pMLV115: pMLV089 was digested with AscI to liberate the 5.7 Kb attP cassette.
This fragment was inserted into the AscI site of pMLV105. 43
attB cassettes:
pMLV025: attB::GatewayR1-R2::attB: Two oligos SAattBS-top
(tggcgcgcctgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttgggctccccgggcgcgtactccacctcac cccatctggtccacgc) and SAattBS-bottom
(gtggaccagatggggtgggatggagtacgcgcccggggagcccaagggcacgccctggcacccgcaccgcggcttcgag accgtcaggcgcgccaagct) were annealed and kinase treated and inserted into the SacI/SacII sites of pBS II KS (-) (Agilent Technologies) to generate pMLV013. The R1-R2 gateway cassette fragment (Invitrogen) was cloned into the EcoRV site of pMLV013 to generate pMLV023. Finally, oligonucleotides KAattBA-top
(ggcgcgcctgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttgggctccccgggcgcgtactccacctcacc ccatctggtccaaggcc) and KAattBA-bottom
(ttggaccagatggggtgggatggagtacgcgcccggggagcccaagggcacgccctggcacccgcaccgcggcttcgag accgtcaggcgcgccgtac) were annealed and kinase treated and inserted into the KpnI/ApaI site of pMLV023.
pMLV026: attB::GatewayR3-R4::attB: R3-R4 Gateway cassette was amplified from pDEST(R3-R4) (Invitrogen) using primers oMV0003
(caggatatccaactttgtatagaaaagtt) and oMV0004 (tacgatatccaactatgtataataaagtt) and
AccuPrime pfx polymerase (Invitrogen), then digested with EcoRV and cloned into the
EcoRV site of pMLV013 (described above) to create pMLV024. Finally, oligonucleotides KAattBA-top and KAattBA-bottom were annealed and kinase treated and inserted into the KpnI/ApaI site of pMLV024.
pMLV077: attB::MCS::attB: A dual selection cassette containing the chloramphinocol resistance gene and ccdB death gene was amplified from pENTR4 44
(Invitrogen) using primers oMV0005 (caggatatccattaggcaccccaggcttt) and oMV0006
(tacgatatcactggctgtgtataagggagcc) and AccuPrime pfx polymerase (Invitrogen), then digested with EcoRV and cloned into the EcoRV site of pMLV013 (described above) to create pMLV076. Finally, oligonucleotides KAattBA-top and KAattBA-bottom were annealed and kinase treated and inserted into the KpnI/ApaI site of pMLV077.
pMLV085: attB::Pmyo-3::mCherry::unc-54 3’ UTR::attB: Plasmids pMLV082
(described below), pMLV067 (described below), pCM1.35 (Seydoux & Dunn 1997) and pMLV026 (described above) were incubated with LR clonase II mix to allow for gateway recombination reaction as per manufacturers instructions (Invitrogen). attP/attB cassette:
pMLV194: Prpl-28::attP::pat-3::CFP::unc-54 3’ UTR::attB::2xNLS::YFP::let-
858 3’ UTR: 2xNLS::YFP AgeI/EcoRI from p625 replaced 4xNLS::GFP from L4455 from the Fire Vector kit with the rpl-28 promoter and let-858 3’ UTR creating pMLV191.
Primers X-F(sequence) and X-R(sequence) containing the attP and attB sites were used to amplify pat-3::CFP::unc-54 3’ UTR from Fire Vector L4664 and cloned into pCR-
XL-TOPO vector via TOPO cloning (Invitrogen) to generate pMLV190. A BamHI digest liberated the 2.2 Kb attP::pat-3::CFP::unc-54 3’UTR::attB fragment and it was cloned into the BamHI site of pMLV191.
φC31 vectors:
pMLV022: pcDNA3.1_phiC31NLS: Primers QC-phiC31-AgeI-TOP
(agacgtagcggcgaccggttagcgagacaccc) and QC-phiC31-AgeI-BOTTOM
(gggtgtctcgctaaccggtcgccgctacgtct) were used to perform site-directed mutagenesis on 45
pcDNA3.1_phiC31 (Bischof et al. 2007) to introduce an AgeI site in the c-terminal portion of phiC31 to form pMLV019. Oligonucleotides phiC31-AgeINLS-TOP
(ccgggccaaagaagaagcgtaaggtaggtacctaggctag) and phiC31-AgeINLS-BOTTOM
(ccggctagcctaggtacctaccttacgcttcttctttggc) containing one NLS sequence were annealed and double-stranded oligonucleotides were treated with T4 polynucleotide kinase and ligated to AgeI site of pMLV019.
pMLV074: pENTR[φC31]: Primers oC31B1-F
(ggggacaagtttgtacaaaaaagcaggcttaaccggtagaaaaaatggacacgtacgcgggt) and oC31B2-2-R
(ggggaccactttgtacaagaaagctgggtagctagcctacgccgctacgtcttc) with gateway sites were used to amplify φC31 from pcDNA3.1_phiC31 (Bischof et al. 2007) and cloned into pDONR221 via gateway cloning (Invitrogen).
pMLV075: pENTR[φC31::NLS]: Primers oC31B1-F
(ggggacaagtttgtacaaaaaagcaggcttaaccggtagaaaaaatggacacgtacgcgggt) and oC31-B2-R
(ggggaccactttgtacaagaaagctgggtaggcgcgatccgggtgtct) with gateway sites were used to amplify φC31::NLS from pMLV022 and cloned into pDONR221 via gateway cloning
(Invitrogen).
pMLV090: pENTR[φC31w/ introns]: Artificial introns å and ∂ from the GFP fire vector kit (A. Fire, G. Seydoux, J. Ahnn and S. Xu, unpublished) were placed in the
φC31 ORF. Annealed Intron-å-top(gtaagtttaaacatatatatactaactaaccctgattatttaaattttcag) and
Intron-å-bot (ctgaaaatttaaataatcagggttagttagtatatatatgtttaaacttac) and treated double- stranded oligo-nucleotide with T4 polynucleotide kinase, then ligated pMLV074 digested with FspI and dsIntron-å. Then, annealed Intron-∂-top
(gtaagtttaaacatgattttactaactaactaatctgatttaaattttcag) and Intron-∂-bot 46
(ctgaaaatttaaatcagattagttagttagtaaaatcatgtttaaacttac) and treated double-stranded oligonucleotide with T4 polynucleotide kinase, then ligated pMLV074w/å digested with
XmnI and dsIntron-∂.
pMLV091: pENTR[φC31NLSw/ introns]: Artificial introns å and ∂ from the GFP fire vector kit (A. Fire, G. Seydoux, J. Ahnn and S. Xu, unpublished) were placed in the
φC31 ORF. Annealed Intron-å-top(gtaagtttaaacatatatatactaactaaccctgattatttaaattttcag) and
Intron-å-bot (ctgaaaatttaaataatcagggttagttagtatatatatgtttaaacttac) and treated double- stranded oligo-nucleotide with T4 polynucleotide kinase, then ligated pMLV075 digested with FspI and dsIntron-å. Then, annealed Intron-∂-top
(gtaagtttaaacatgattttactaactaactaatctgatttaaattttcag) and Intron-∂-bot
(ctgaaaatttaaatcagattagttagttagtaaaatcatgtttaaacttac) and treated double-stranded oligonucleotide with T4 polynucleotide kinase, then ligated pMLV075w/å digested with
XmnI and dsIntron-∂.
pMLV110: pENTR[3xHAφC31]:
pMLV111: pENTR[3xHAφC31NLS]:
pMLV112: pENTR[3xHAφC31w/introns]:
pMLV113: pENTR[3xHAφC31NLSw/introns]: Annealed 3xHA-top
(ccggtagaaaaaatgatctacccatacgatgttcctgactatgcgggctatccctatgacgtcccggactatgcagggtatccat atgacgttccagattacgctgcg) and 3xHA-bot
(ccggcgcagcgtaatctggaacgtcatatggataccctgcatagtccgggacgtcatagggatagcccgcatagtcaggaac atcgtatgggtagatcattttttcta) and treated double-stranded oligonucleotide with T4 polynucleotide kinase. Then ligated pMLV074, pMLV075, pMLV090 and pMLV091 digested with AgeI and ds3xHA. 47
φC31 mosSCI plasmids:
pMLV124: Pglh-2::3xHAφC31w/introns::glh-2 3’ UTR: Digested pJL43.1 with
MluI, treated cut vector with Klenow fragment to generate a blunt-ends, then digested with NheI and treated cut vector with Alkaline phosphatase. Isolated 6 kb fragment.
Digested pMLV112 with AgeI, treated cut vector with Klenow fragment to generate a blunt-end, then digested with NheI to isolate 1.9 Kb fragement. Inserted the 1.9 kb
3xHAφC31 fragment into the MluI/NheI sites of pJL43.1.
pMLV129: Pglh-2::3xHAφC31w/introns::glh-2 3’ UTR::emb-27(+): Digested pMLV124 with BamHI and XhoI to liberate a 5.1 Kb Pglh-2::3xHAφC31w/introns::glh-
2 3’ UTR fragment, then inserted into BglII/SalI site of pMLV126(described below).
pMLV131: pMLV129 into pMLV127: An 8.1 kb StuI pMLV129 fragment was inserted into an NdeI site of pML127(described above).
pMLV134: pEXP[Phsp-16.2::φC31::tbb-2 3’ UTR]: pCM1.56(gift from G.
Seydoux), pMLV074 and pCM1.36 (gift from G. Seydoux) and cloned into pDESTR4-
R3 via gateway cloning (Invitrogen).
pMLV135: pEXP[Phsp-16.2::φC31NLS::tbb-2 3’ UTR]: pCM1.56(gift from G.
Seydoux), pMLV075 and pCM1.36 (gift from G. Seydoux) and cloned into pDESTR4-
R3 via gateway cloning (Invitrogen).
pMLV136: pEXP[Phsp-16.2::H2BtagRFP::tbb-2 3’ UTR]: pCM1.56(gift from
G. Seydoux), pMS25 (M. Sallee, unpublished) and pCM1.36 (gift from G. Seydoux) and cloned into pDESTR4-R3 via gateway cloning (Invitrogen).
pMLV144: pDEST[R4-R3]emb-27(+): R3-R4 Gateway cassette was amplified from pDEST(R3-R4) (Invitrogen) using primers oMV0003 48
(caggatatccaactttgtatagaaaagtt) and oMV0004 (tacgatatccaactatgtataataaagtt) and
AccuPrime pfx polymerase (Invitrogen), then digested with EcoRV and cloned into the
AfeI site of pMLV126(described below).
pMLV149: pDEST9626[R4-R3]emb-27(+): A 4.7 kb StuI pMLV144 fragment was inserted into an NdeI site of pML127 (described above).
pMLV160: pEXP9626[Pmex-5(w/o ATG)::φC31::tbb-2 3’ UTR]emb-27: pJA252
(gift from J. Arringher), pMLV074 and pCM1.36 (gift from G. Seydoux) and cloned into pMLV149 via gateway cloning (Invitrogen).
pMLV168: pEXP9626[Ppie-1(w/o ATG)::φC31::tbb-2 3’ UTR]emb-27: pMLV114, pMLV074 and pCM1.36 (gift from G. Seydoux) and cloned into pMLV149 via gateway cloning (Invitrogen).
Heat-shock φC31 vectors:
pMLV134: pEXP[Phsp-16.2::φC31::tbb-2 3’ UTR]: pCM1.56(gift from G.
Seydoux), pMLV074 and pCM1.36 (gift from G. Seydoux) and cloned into pDESTR4-
R3 via gateway cloning (Invitrogen).
pMLV135: pEXP[Phsp-16.2::φC31NLS::tbb-2 3’ UTR]: pCM1.56(gift from G.
Seydoux), pMLV075 and pCM1.36 (gift from G. Seydoux) and cloned into pDESTR4-
R3 via gateway cloning (Invitrogen).
pMLV136: pEXP[Phsp-16.2::H2BtagRFP::tbb-2 3’ UTR]: pCM1.56(gift from
G. Seydoux), pMS25 (M. Sallee, unpublished) and pCM1.36 (gift from G. Seydoux) and cloned into pDESTR4-R3 via gateway cloning (Invitrogen).
49
Miscellaneous plasmids:
pMLV067: pENTR(R1-R2)-CFP(gf15): Primers oDS24
(caccggaccggtagaaaaaatgagtaaaggagaagaac) and oDS25
(gaattcatcttaagatatcgctttgtatagttcatccatgcc) with gateway sites were used to amplify
CFP(gf15) from L4663 (A. Fire, G. Seydoux, J. Ahnn and S. Xu, unpublished) and cloned into pDONR221 via gateway cloning (Invitrogen).
pMLV068: pENTR(R1-2R)-mCherry(optimized): Primers oMV001
(caccggaccggtagaaaaaatggtctcaaagggtgaag) and oMV002
(gaattcatcttaaagcgctgccttatacaattcatccatgcc) with gateway sites were used to amplify mCherry(optimized) (McNally et al. 2006) and cloned into pDONR221 via gateway cloning (Invitrogen).
pMLV082: pENTR(L4-R1)-Pmyo-3: Digested pCM1.56 with SalI and AgeI, then treated cut vector with Klenow fragment to generate a blunt-ends. Digested L4643 with
HindIII and XbaI, treated cut vector with Klenow fragment to generate a blunt-ends.
Inserted the 2.4 kb Pmyo-3 fragment into the SalI/AgeI sites of pCM1.56.
pMLV114: pENTR(L4-R1)-Ppie-1(w/o ATG): Primers Ppie-1-QC-ATG-F
(aaatcaaattttcttttccaggctcaaacaaagccgattgcc) and Ppie-1-QC-ATG-R
(ggcaatcggctttgtttgagcctggaaaagaaaatttgattt) were used to perform site-directed mutagenesis on pCG142 (Merritt et al. 2008) to delete the ATG present in the promoter of pie-1.
pMLV126: emb-27(+) rescue construct: A 3.0 kb region from upstream gene to the downstream gene of emb-27 was amplified from N2 genomic DNA using primers 50
emb-27-F (tgaacagctgaagttacacg) and emb-27-R (gccacccatccttcagcaaa) and AccuPrime pfx polymerase (Invitrogen) and cloned into pCR-BLUNT-II-TOPO (Invitrogen).
Extra-chromosomal arrays:
arEx1323 and arEx1324: This array was generated as a complex array by injecting pCW2.1(Pceh-22::GFP) digested with ScaI at 1 ng/µl, pMLV126 (emb-27(+)) digested with SmaI at 1 ng/µl, pMLV124(Pglh-2::3xHAφC31::glh-2 3’ UTR) digested with Ecl136II at 1 ng/µl and N2 genomic DNA digested with PvuII at 75 ng/µl into
GG48 (emb-27(g48)).
arEx1419: This array was generated as a complex array by injecting pMLV134(Phsp-16.2::φC31::tbb-2 3’ UTR) digested with ScaI at 1 ng/µl, pMLV085(attB::Pmyo-3::mCherry::unc-54 3’ UTR::attB) digested with ScaI at 1 ng/µl and N2 genomic DNA digested with PvuII at 75 ng/µl into GS5596 (arSi1/mnC1[dpy-
10(e128) unc-52(e444)]; unc-119(ed3)).
arEx1457-arEx1460: This array was generated as a simple array by injecting pMLV134(Phsp-16.2::φC31::tbb-2 3’ UTR) at 50 ng/µl, and pMLV085(attB::Pmyo-
3::mCherry::unc-54 3’ UTR::attB) at 50 ng/µl into GS5596 (arSi1/mnC1[dpy-10(e128) unc-52(e444)]; unc-119(ed3)).
arEx1461-arEx1464: This array was generated as a complex array by injecting pMLV134(Phsp-16.2::φC31::tbb-2 3’ UTR) digested with ScaI at 1 ng/µl, pMLV085(attB::Pmyo-3::mCherry::unc-54 3’ UTR::attB) digested with ScaI at 5 ng/µl and N2 genomic DNA digested with PvuII at 150 ng/µl into GS5596 (arSi1/mnC1[dpy-
10(e128) unc-52(e444)]; unc-119(ed3)). 51
arEx1468-arEx1470: This array was generated as a complex array by injecting
pMLV095(Pmyo-3::CFP(g15)::unc-54 3’ UTR) digested with ScaI at 2 ng/µl, pMLV126
(emb-27(+)) digested with SmaI at 1 ng/µl, pMLV136(Phsp-16.2::H2B-tagRFP::tbb-2 3’
UTR) digested with ScaI at 1 ng/µl and N2 genomic DNA digested with PvuII at 150 ng/µl into GG48 (emb-27(g48)).
arEx1471-arEx1473: This array was generated as a complex array by injecting pMLV095(Pmyo-3::CFP(g15)::unc-54 3’ UTR) digested with ScaI at 2 ng/µl, pMLV126
(emb-27(+)) digested with SmaI at 1 ng/µl, pMLV134(Phsp-16.2::φC31::tbb-2 3’ UTR) digested with ScaI at 1 ng/µl and N2 genomic DNA digested with PvuII at 150 ng/µl into
GG48 (emb-27(g48)).
arEx1580-arEx1583: This array was generated as a simple array by injecting pMLV134(Phsp-16.2::φC31::tbb-2 3’ UTR) at 50 ng/µl, pMLV085(attB::Pmyo-
3::mCherry::unc-54 3’ UTR::attB) at 50 ng/µl and pBX (pha-1(+)) at 40 ng/µl into pha-
1(e2123).
arEx1584-arEx1587: This array was generated as a complex array by injecting pMLV134(Phsp-16.2::φC31::tbb-2 3’ UTR) digested with ScaI at 1 ng/µl, pMLV085(attB::Pmyo-3::mCherry::unc-54 3’ UTR::attB) digested with ScaI at 5 ng/µl, pBX(pha-1(+)) digested with ScaI at 1 ng/µl and N2 genomic DNA digested with PvuII at 150 ng/µl into pha-1(e2123).
arExMV83.3 and arExMV83.10: This array was generated as a simple array by injecting pMLV134(Phsp-16.2::φC31::tbb-2 3’ UTR) at 30 ng/µl, pMLV194(Prpl-
28::attP::pat-3::CFP::unc-54 3’UTR::attB::2xNLS::YFP::let-858 3’ UTR) at 30 ng/µl and pBX (pha-1(+)) at 40 ng/µl into pha-1(e2123). 52
Single-copy insertion via MosSCI:
Single-copy insertions of attP cassette into MosI transposable element sites were performed as described previously (Frøkjaer-Jensen et al. 2008). Transgenic worms were made by injecting into the following strains: GS5652 (ttTi5605; unc-119(ed3)); GS5653
(unc-119(ed3); cxTi10882); GS5654 (unc-119(ed3); cxTi9393) or GS5655 (cxTi10471; unc-119(ed3)). The standard injection mix consisted of 50 ng/ml repair template, 50 ng/ml Mos1 transposase, pJL43.1 (Pglh-2::transposase) (Bessereau et al. 2001) and 10 ng/ml of p716 (Pmyo-3::mCherry) (Myers 2007). Injected worms were placed at 22 °C and screened for the presence of rescued worms without the Pmyo-3::mCherry co- injection marker.
Single-copy insertion of φC31 containing transgenes into MosI transposable element sites were based on work previously described (Frøkjaer-Jensen et al. 2008).
Transgenic worms were made by injecting into the following strains: GS5780 (emb-
27(g48); ttTi9626). The standard injection mix consisted of 50 ng/ml repair template, 50 ng/ml Mos1 transposase, pJL43.1 (Pglh-2::transposase) (Bessereau et al. 2001) and 10 ng/ml of p716 (Pmyo-3::mCherry) (Myers 2007). Injected worms were placed at 15 °C for three day, then moved to 25 °C and screened for starved plates, which would indicate rescue of emb-27. Roughly a tenth of rescued starved plates were chunked to a freshly seeded plate and placed at 25 °C. Repeated this operation once more. Plates, in which the
Pmyo-3::mCherry co-injection marker was not visible, were kept for further analysis. At this point singled-out worms from each mCherry negative plate. 53
φC31-mediated recombination:
mRNA co-injections: The plasmid pcDNA3.1_phiC31 (Bischof et al. 2007) or pMLV022 were linearized with the restriction enzyme BamHI, and capped mRNA was transcribed in-vitro according to the protocol of the mMESSAGE mMACHINE kit
(Ambion). Co-injections of φC31 mRNAs and donor plasmids were diluted in nuclease- free water (Ambion) at various concentrations. These mixes were injected into the C. elegans germline as previously described (Mello & Fire 1995). Injected worms were placed in 100 mm NGM plates, at 22 °C for three days, then moved to 15 °C for a week.
F2s were screened for the presence of Unc worms.
Direct injection: Co-injections of DNAs were diluted in nuclease-free water
(Ambion) at various concentrations. These mixes were injected into the C. elegans germline as previously described (Mello & Fire 1995). Injected worms were placed in
100 mm NGM plates, at 22 °C for three days, then moved to 15 °C for a week. F2s were screened for the presence of Unc worms.
φC31-containing arrays: Germline-expressing φC31 containing arrays were crossed into GS5596 arSi1/mnC1[dpy-10(e128) unc-52(e444)]; unc-119(ed3). Donor plasmids were diluted into water and injected into the C. elegans germline as previously described (Mello & Fire 1995). Injected worms were placed in 100 mm NGM plates, at
22 °C for three days, then moved to 15 °C for a week. F2s were screened for the presence of Unc worms.
Heat-shocked arrays: Heat-shock promoter driven φC31 and donor plasmids containing arrays were directly injected into the germline of strain GS5596
(arSi1/mnC1[dpy-10(e128) unc-52(e444)]; unc-119(ed3)) as previously described (Mello 54
& Fire 1995). Strains containing the arrays were bleached to collect semi-synchronous embryos, then were subjected to heat-shock treatments at 37 °C for 1 hour on days 0, 1 and 2 after the egg prep. On day 3, L4 animals were transferred to 100 mm NGM plates seeded with OP50. About 10 L4s were placed on each plate. Animals were placed at 22
°C for three days then moved to 15 °C for a week. F2s were screened for the presence of
Unc worms.
For experiments involving somatic RMCE and intramolecular recombination, semi-synchronous embryos were collected. Either embryos or L1/L2 animals were subjected to a 2 hour heat-shock at 33 °C or 37 °C. φC31 mediated recombination was confirmed by PCR or visualized under the dissecting scope.
Single-copy φC31 strains: Donor plasmids were diluted into water and injected into the C. elegans germline as previously described (Mello & Fire 1995). Injected worms were placed in 100 mm NGM plates, at 22 °C for three days, then moved to 15 °C for a week. F2s were screened for the presence of Unc worms.
Immunostaining.
Immunostaining was performed as described previously(Finney & Ruvkun 1990).
HA antibody staining was used as described previously (Karp & Greenwald 2003).
Imaging.
Images were acquired and scoring was performed on a Zeiss Axio Imager Z1 microscope with an ApoTome system and a Hamamatsu ORCA-ER camera, or a Zeiss
Axio Imager D1 with an AxioCam MRm camera. Images were processed with Adobe
Photoshop software. 55
Results and Discussion: φC31 can mediate recombination in C. elegans:
To determine whether φC31 integrase is active in C. elegans, I tested whether it
could direct intramolecular excision of pat-3::CFP::unc-54 3’ UTR flanked by tandem
attP and attB sites in somatic cells. If φC31 integrase is active there should be an excision
of the intervening sequence, in this case it is pat-3::CFP::unc-54 3’ UTR, thus allowing
the expression of the 2xNLS::YFP::let-858 3’ UTR (figure 3). Simple arrays containing
the cassette and φC31 under a heat-shock promoter were made. Hermaphrodites carrying
these arrays were subjected to heat-shock treatment at 33 °C for two hours during
embryogenesis or the L1/L2 larval stages. Excision of pat-3::CFP was observed by the
presence of 2xNLS::YFP expression. The frequency of excision was relatively the same
between heat-shock treatment during embryogenesis or during early larval stages. Of
three lines tested, all of them gave a high-percentage recombination frequency, with at
least 95% of animals showing at least one recombination event. In animals carrying the
arrays, without undergoing heat-shock treatment a few animals had 2xNLS::YFP
expression, these were only intestinal cells, presumably due to leaky expression of φC31.
Expression of 2xNLS::YFP was seen in heat-shocked animals in intestinal cells,
pharyngeal cells, hypodermal cells and gonadal cells (figure 4).
This experiment shows that φC31 is active in C. elegans and can mediate
recombination between attP and attB sites. With the similarity of this technique with
Flp/FRT and Cre/loxP recombination systems, it is possible to use some of the same strategies used in these other systems, including but not limited to expressing φC31 with a tissue-specific promoter to mark the lineages of those cells. 56
φC31 can mediate recombination in the C. elegans germline:
A plasmid containing an attP site, pM(3xP3RFP-attP') (Bischof et al. 2007) was
co-bombarded with an Ce unc-119 plasmid to establish lines with integrated attP sites.
Injection of 20 P0 hermaphrodites, of pMLV001, containing an attB site and a muscle specific mCherry expressing transgene, with φC31 mRNA at 250 ng/ul, into the attP line was screened for proper segregation of the mCherry transgene. This generated one line that appeared to be integrated (table 1). An attempt was made to use less donor plasmid, which did not generate an integrated line.
The integrated line was tested to discern whether it was produced by a φC31 mediated-integration event (figure 5B and figure 5C). Lines that were thought to be extrachromosomal lines were also tested (figure 5B). PCR was used to detect the presence of the donor site, the attB site, and the presence of a φC31 recombination product, the attL site. If there is correct integration of the donor plasmid, there should be a loss of the attB and a gain of the attL site. And if an extrachromosomal array has been formed, there will not be a loss of the attB site or a gain of the attL site. In the integrated line 1, there is the presence of an attL site and the absence of an attB site present in the donor plasmid, suggesting that φC31 was able to mediate recombination between the attB site the attP in the germline. This provides evidence that φC31 is able to work in the germline to promote site-specific recombination.
The ability to screen for the integration event was hampered by the low expression of the fluorescent transgene in low copy number. Furthermore, the bombarded attP line was integrated in multiple copies (data not shown). The revised approach below was attempted to circumvent the idiosyncrasies of C. elegans transgenesis. 57
Constructing suitable landing platforms in the C. elegans genome:
At the time of devising a plan to incorporate transgenes into C. elegans using
φC31, a new technique to target transgenes in single copy was being developed
(Frøkjaer-Jensen et al. 2008). This technique, MosSCI, took advantage of the double- strand break created in the genome by the excision of a transposable element. The repair of the double-strand break through homologous recombination is capable of introducing transgenes into the genome. This technique would be used for getting the attP landing site into the genome in single copy. At the beginning of the project presented in the thesis, there were only two Mos1 insertion sites that were characterized and shown to be suitable for MosSCI, ttTi5605 and ttTi10882 (Frøkjaer-Jensen et al. 2008). At the time of writing however, another 6 Mos1 sites have been shown to be suitable for transgenesis, krTi5271, krTi5273, ttTi4348, ttTi4391, cxTi10816 and ttTi14024 (Giordano-Santini et al.
2010; Frøkjaer-Jensen et al. 2012). For the φC31 system to be viable, more than one site would need to be available. In addition to the Mos1 insertions ttTi5606 and ttTi10882, I also attempted MosSCI with the Mos1 insertions cxTi10471 and cxTi9393, which were unsuccessful.
The propensity of injected DNA to form extrachromosomal arrays in C. elegans makes it difficult to screen for integration events by rescue of mutant worms or by the presence of a fluorescent protein. By using RMCE, it might be easier to find integration events, where a negative selectable marker could be used to select against non- recombinants. It has been shown in D. melanogaster that RMCE works just as efficiently as WPI (Bateman et al. 2006; Bateman & Wu 2008). 58
Three components have gone into the landing platform (see figure 6B). A good fluorescent transgene was used, Pglt-3::venus::unc-54 3’ UTR that gives expression in the excretory canal cell and provides a way to follow the landing platform once it is integrated (Mano et al. 2007). Cb unc-119 was used for positive selection of the landing platform when integrated in single-copy as used in the MosSCI technique (Frøkjaer-
Jensen et al. 2008). I have used a transgene with the sup-7(st5) mutation as negative selectable marker. sup-7(st5) is a tryptophan tRNA with the tryptophan anti-codon mutated to recognize an amber stop (Waterston 1981; Wills et al. 1983; Bolten et al.
1984). Homozygous sup-7(st5) animals are sterile at 15°C, and are fertile at 25°C.
The efficiency of integration was much lower than it was reported for the known
Mos1 insertion sites, ttTi5605 and cxTi10882 (Frøkjaer-Jensen et al. 2008 and Table 2).
This is most likely due to the presence of sup-7(st5) in the landing platform, whose toxicity inhibits the formation of extrachromosomal arrays (Fire 1986; Mello et al. 1991).
However, two lines at two different sites, ttTi5605 and cxTi10882, were obtained (table 2 and figure 7). These two lines had the appropriate markers, were in the correct orientation and no aberrations were noticed by PCR (figure 7). No integrated lines were recovered from cxTi10471 and cxTi9393 Mos1 insertion sites. Attempts to investigate whether these insertion sites were suitable for MosSCI was not done.
RMCE in the germline in C. elegans: mRNA injections of φC31 into the C. elegans germline:
To circumvent the need for expressing φC31 in the germline, φC31 mRNA was transcribed in-vitro and co-injected with the donor plasmid. This method has been used successfully in D. melanogaster, although with low integration efficiency (Bateman et al. 59
2006; Bischof et al. 2007; Bateman & Wu 2008). Different concentrations of both mRNA and donor plasmids were tried. Only one RMCE event was recovered from injecting the
φC31 mRNA at 1000 µg/µl and the donor plasmid at 50 ng/µl (table 3 and figure 9).
It is possible that the 5’ UTR and 3’UTR of the in-vitro transcribed φC31 mRNA were not conducive to germline translation as sequences in the UTRs can influence the translation of germline expressing genes (Marin & Evans 2003; Wood et al. 2011). Thus, one could place φC31 in a context that is more suitable for germline translation. By placing a SL1 or SL2 sequence upstream of the start ATG and placing a 3’ UTR from a gene that is expressed in the germline, such as pie-1, downstream of φC31, the in-vitro transcribed mRNA might be more stable in the germline and/or translated at a higher frequency, thereby increasing the efficiency of RMCE.
As the method to transcribe mRNA in-vitro is time consuming and expensive, it is not an ideal solution to express φC31 in the germline for the purpose of inserting transgenes in the genome of C. elegans. Several different methods of expressing φC31 in the germline were tried (see below).
Expression of φC31 in the germline from extrachromosomal arrays:
Different attempts to integrate the donor plasmids via RMCE into the C. elegans germline were performed (figure 8). As it was a successful strategy for MosSCI
(Frøkjaer-Jensen et al. 2008), extra-chromosomal arrays were made with heat-shock driven φC31 and the donor plasmid. Hermaphrodites carrying these arrays were subjected to heat-shock treatment at 37°C for 1 hr. and the F1 and F2 progeny were screened for the RMCE event. However, these attempts were unsuccessful in generating germline integration (table 4). 60
Attempts to directly inject a plasmid with φC31 being driven by a germline specific promoter such as glh-2 or pie-1 and the donor plasmid together were done. This has been successful in MosSCI to get single-copy events at a reasonable frequency
(Frøkjaer-Jensen et al. 2008). This was not a successful strategy at generating RMCE events in the germline (table 3).
An extrachromosomal arrays was made containing a Pglh-2::3xHAφC31::glh-2 3’
UTR and an emb-27(+) rescuing plasmid was used to rescue emb-27(g48). The emb-
27(g48) mutation is a temperature sensitive mutation, that is viable at 15°C, but embryonic lethal at 25°C (Cassada et al. 1981). EMB-27 is part of the anaphase promoting complex required in the metaphase-to-anaphase transition for both mitosis and meiosis in the germline (Sadler & Shakes 2000; Golden et al. 2000; Rappleye et al. 2002;
E. S. Davis et al. 2002; Yeong 2004). The germline requirement of emb-27 makes it a suitable candidate to use as a co-injection marker to ensure that the extrachromosomal array is not silenced in the germline. Indeed, complex extrachromosomal arrays containing Pglh-2::3xHAφC31::glh-2 3’ UTR and emb-27(+), which rescue emb-27(g48) embryonic lethality at 25°C, do appear to have expression of the φC31 in the germline by antibody staining against the HA tag (data not shown). However, attempts to recover
RMCE events with these arrays were not fruitful (table 3).
Integrated φC31 transgenes:
The optimal solution towards expressing φC31 in the germline, would be to integrate a φC31 transgene into the C. elegans genome. This has been successful in D. melanogaster to significantly increase the efficiency of φC31 mediated integration
(Bischof et al. 2007). An attempt was made to insert Pglh-2::3xHAφC31::glh-2 3’ UTR 61
into the genome as a single copy using MosSCI. Instead of using unc-119(ed3) rescue to isolate potential candidates, rescue of emb-27(g48) was used. The Mos1 insertion site ttTi9626 was used to attempt this integration (figure 6). An integrant was isolated that appears to have inserted correctly (table 5). An attempt was made to integrate a donor plasmid into the landing platform in the germline using this transgenes without success
(table 4).
It is possible that this φC31 is not being expressed in the germline of the transgene. To address this possibility, I have made two germline expressing φC31 vector constructs, where well-characterized germline promoters are driving φC31 integrase.
Two different promoters are being tested, mex-5 and pie-1 promoters that have been shown to express GFP in the germline in single copy (Frøkjaer-Jensen et al. 2008; Zeiser et al. 2011). However, time did not allow adequate examination of these transgenes to determine whether they would express φC31 and thus be suitable for RMCE in the germline.
Conclusion:
In this chapter, I describe an attempt to use φC31 integrase to insert transgenes in the C. elegans genome. I show that φC31 is active in C. elegans and that φC31 mediated integration can occur in the C. elegans germline using injected mRNA though it is rare.
Until a φC31 germline expressing strain is established, I cannot say whether φC31 would be a viable method to integrate transgenes into the genome. Work in Drosophila suggests that stably expressing lines will increase efficiency of integration. It is worth noting that I 62
haven’t shown that it couldn’t work for integrating transgenes in the C. elegans germline.
I will make more comments about φC31 in Chapter 4.
In the course of this work I have developed a new MosSCI site where single copy integration is possible. Although I haven’t shown whether it is suitable for germline expression. This adds to the list of possible sites where MosSCI has been tried. It is worth pointing out that in about half of the Mos1 sites, where MoSCI has been tried, no germline expression is seen (Frøkjaer-Jensen et al. 2012). To complicate matters even further, of the appropriate Mos1 sites, one third of integrated germline specific transgenes are expressed correctly in the germline (Frøkjaer-Jensen et al. 2008).
I also developed a new selectable marker for MosSCI by using emb-27 rescue.
The efficiency of integration of using emb-27 rescue is comparable to unc-119 rescue.
Using emb-27 rescue I was able to get integration efficiency close to what has been reported with unc-119 rescue (Frøkjaer-Jensen et al. 2008 and Table 5). This adds to list of possible selection markers for MosSCI, including resistance against the antibiotics
Puromycin and Neomycin (Semple et al. 2010; Giordano-Santini et al. 2010). 63
Chapter 2: Figures and Tables. 64
A. B. Extrachromosomal arrays Integrated arrays
Pre-injection mixture Extrachromosomal array
genetic marker gene of interest reporter gene
genetic marker gene of interest reporter gene
Chromosomomal DNA
Germline injection
γ-irradiation or UV-irradiation Extrachromosomal array
genetic marker gene of interest reporter gene Extrachromosomal array
genetic marker gene of interest reporter gene
Chromosomomal DNA
Random integration into the genome
Chromosomomal DNA
genetic marker gene of interest reporter gene
C. D. Micro-particle bombardment Mos1 single-copy insertion (MosSCI) Pre-bombardment mixture
reporter gene transposase genetic marker gene of interest genetic marker gene of interest
Gold Particles Mos1 insertion
Bombardment of C. elegans Mos1 transposase expression Mos1 excision
genetic marker
gene of interest reporter gene transposase genetic marker gene of interest
Chromosomomal DNA
Random integration into the genome
Chromosomomal DNA
genetic marker gene of interest DSB induced gene conversion
genetic marker gene of interest
Figure 1. Transgenes in C. elegans.
A.) Schematic of extrachromosomal formation.
B.) Schematic of integrating extrachromosomal arrays by irradiation.
C.) Schematic of micro-particle bombardment. Gold particles are coated with plasmids and bom- barded into C. elegans. Integration of plasmids is random and at low-copy number.
D.) Mos1 single-copy insertion (MosSCI). Single-copy insertion via gene conversion induced by the excision of the Mos1 transposable element. 65
A. B.
attB: attB attR CCGCGGTGCGGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCC
attP: ΦC31 AGTAGTGCCCCAACTGGGGTAACCTTTGAGTTCTCTCAGTTGGGGGCGTA attR: AGTAGTGCCCCAACTGGGGTAACCTTTGGGCTCCCCGGGCGCGTACTCC
attL: CCGCGGTGCGGGTGCCAGGGCGTGCCCTTGAGTTCTCTCAGTTGGGGGCGTA attP attL
C.
ΦC31 Mediated Integration Recombination Mediated Cassete Exchange (RMCE)
attB attB attB donor plasmid marker 1 donor plasmid marker 1
ΦC31 ΦC31
marker 2 attP attP marker 2 attP
landing platform landing platform
marker 2 attR marker 1 attL attR marker 1 attR
integrated transgene integrated transgene
Figure 2. φC31 mediated integration.
A.) Schematic of φC31 mediated recombination between the attachment sites attB and attP which gives rise to the hybrid sites attR and attL. The φC31 recombination is unidirectional.
B.) Core DNA sequence of the different φC31 attachment sites, attB in bold and attP in light. The resulting hybrid sites, attR and attL are shown as well. Recombination cross-over event oc- curs within the underlined sequence.
C.) Schematic of two different techniques for φC31-mediated transgene insertion. One employs the use of a single attP site already inserted in the genome in single-copy, where φC31 mediates the integration of a donor plasmid containing a single attB site with the single attP site. The other technique, recombination mediated cassette exchange (RMCE), employs the use of a cassette flanked by two attP sites, which has been inserted in the genome. A donor plasmid containing a gene of interest is flanked by twoattB sites. φC31 mediates recombination between the att sites, the gene of interest in the plasmid replaces the cassette integrated in the genome. 66
A.
extrachromosomal array
attP attB Phsp-16.2::φC31::tbb-2 Prpl-28 pat-3::CFP 2xNLS-YFP
heat-shock
attB
φC31
attP Phsp-16.2::φC31::tbb-2
excision of PAT-3::CFP
attR Phsp-16.2::φC31::tbb-2 Prpl-28 2xNLS-YFP
Figure 3: φC31 mediated cassette excision in C. elegans.
A.) Schematic of φC31-mediated excision of fluorescent protein, between the attachment sites attP and attB. The excision event removes the PAT-3::CFP and allows expression of 2xNLS::YFP. channel isshowninB,D, FandH. testine (H).PAT-3::CFP isexpressedundertheubiquitous dermal cellsinthehead (F) andinvulvaprecursorcells,ventralneurons, somaticgonadandin 2xNLS::YFP afterheat-shock(E-H).Expressionisseenintheposteriorpharynxbulbandhypo Expression of2xNLS::YFP isnotseeninthenoheat-shockcontrol(A-D).Expressionof Figure 4:
Heat-Shock No Heat-Shock Evidence forφC31mediatedcassetteexcisionin G. E. PAT-3::CFP A. C. PAT-3::CFP PAT-3::CFP PAT-3::CFP H. F. 2xNLS-YFP D. 2xNLS-YFP B. 2xNLS-YFP 2xNLS-YFP rpl-28 promoter(A,C,EandG). Green C. elegans. - 67 - 68
Table 1: Insertion of transgenes via φC31.
P0 mCherry Integrated a b c Donor Plasmid φC31 source injected expression F2 lines pMLV001 (50 ng/μl) - 20 11 12 0 pMLV001 (50 ng/μl) mRNA (250 ng/μl) 20 9 15 1 pMLV001 (50 ng/μl) mRNA (250 ng/μl) 20 11 1 0
a Number of P0 animals injected.
b mCherry expression of F1 animals indicate the minimum frequency of successful gonad injec- tion.
b The integrated line was assessed by PCR. 69
A. B.
attP attB line 1 line 2 line 3 line 4 attB Pmyo-3::mCherry
ΦC31
unc-119 attB attP
unc-119 attL attR attL Pmyo-3::mCherry
C. Line 1: Pmyo-3::mCherry
Figure 5: WPI of transgenes in C. elegans via φC31.
A.) Brief schematic showing the integration of a plasmid containing Pmyo-3::mCherry and an attB site into a strain in which an attP site was bombarded into the genome.
B.) PCR showing evidence for φC31 mediated integration. Four Pmyo-3::mCherry expressing stable lines resulting from a co-injection of φC31 mRNA and pMLV001 were tested. Only line 1 showed segragation of Pmyo-3::mCherry consistent with it being integrated. The lanes attP and attB are plasmids containing the respective att sites, which are serving as controls. Line 1 shows a loss of the attB site, which should be present in pMLV001 and any extrachromosomal arrays formed from pMLV001. In line 1 there is also the presence for an attL site. The presence of an attL site combined with the loss of an attB in Line 1, provides evidence that the pMLV001 was integrated into the genome via φC31 mediated recombination.
C.) Expression of mCherry in muscle tissue of the integrated Line 1. 70
A. B. cxTi10471 krTi5271 Mos1 insertion Chr. I 15M14M13M12M11M10M9M8M7M6M5M4M3M2M1MOM Mos1 insertion site
ttTi5605 Mos1 transposase expression Mos1 excision Chr. II Double strand break formation 15M14M13M12M11M10M9M8M7M6M5M4M3M2M1MOM
ttTi9626
Chr. III Cb unc-119 13M12M11M10M9M8M7M6M5M4M3M2M1MOM attP attP Repair Template Pglt-3::Venus sup-7(st5) cxTi10882 DSB induced gene conversion Chr. IV 17M16M15M14M13M12M11M10M9M8M7M6M5M4M3M2M1MOM
Cb unc-119 cxTi9393 attP attP Pglt-3::Venus sup-7(st5) Chr. V 20M19M18M17M16M15M14M13M12M11M10M9M8M7M6M5M4M3M2M1MOM Integrated attP landing platform
krTi5273 Chr. X 17M16M15M14M13M12M11M10M9M8M7M6M5M4M3M2M1MOM Figure 6: Insertion of attP cassette into the genome via MosSCI.
A.) Location of Mos1 transposons. ttTi5605, cxTi10882, krTi5271 and krTi5273 are Mos1 inser- tion which have been shown capable of accepting transgenes via MosSCI (Frøkjær-Jensen et al., 2008; Giordano-Santini et al., 2010). Introduction of transgenes into Mos1 insertions, cxTi10471, cxTi9393 and ttTi9626, were attempted in this work.
B.) The MosSCI technique allows for insertion into a unique, single genomic locus (Robert and Bessereau, 2007; Frøkjær-Jensen et al., 2008) via gene conversion induced by the excision of the Mos1 transposable element. This approach was used to insert a single copy of an attP cassette containing; Pglt-3::venus::unc-54 3’ UTR visible marker, Cb unc-119(+) rescue fragment and sup-7(st5) negative selectable marker. 71
Table 2: Integration of attP cassette into the genome by MosSCI. Correct a b c d e Strain Repair Template P0 injected Integrants integration cxTi10471; unc-119(ed3) pMLV098 420 0 0 ttTi5605; unc-119(ed3) pMLV093 182 1 1 unc-119(ed3); cxTi10882 pMLV099 452 2 1 unc-119(ed3); cxTi9393 pMLV115 420 0 0 a Mos1 transposon insertion strains attempted for MosSCI inserts of landing platforms.
b Repair templates containing the landing platform (attP::Pglt-3::Venus::unc-54 3’ UTR::Cb unc- 119::sup-7(st5)::attP) which were injected into their respective strain.
c Number of P0 animals injected.
d Integrants were selected based on the unc-119 rescue and the expression of Venus in the excre- tory cell. The presence of sup-7(st5) in the landing platform selects against the stable formation of extrachromosomal arrays.
e Integrants were verified by PCR (see figure 3). A. B. Insertion of attP cassette into ttTi5605: arSi1 Lanes Primers Expected Size A 1+3 2.3 kb A GFEDCB H ttTi5605 6.0 kb B 2+3 1.6 kb 4.0 kb C 1+4 3.6 kb F49E12.6 F14E5.1 F14E5.2 3.0 kb D 2+4 2.9 kb 2.0 kb 1 2 3 4 5 3 6 7 1.5 kb E 5+6 2.7 kb Cb unc-119 F 3+6 1.6 kb 1.0 kb F49E12.6 F14E5.1 attP attP F14E5.2 G 5+7 3.4 kb Pglt-3::Venus sup-7(st5) 1 kb H 3+7 2.2 kb C. D. Insertion of attP cassette into cxti10882: arSi2 Lanes Primers Expected Size A 1+3 2.7 kb cxTi10882 A GFEDCB H F36A4.11 6.0 kb B 1+4 4.0 kb 4.0 kb srbc-70 F30B5.7 dpy-13 F36A4.9 col-34 ttr-20 C 2+3 2.6 kb 3.0 kb (pseudogene) D 2+4 3.8 kb 2.0 kb 1 2 3 4 5 3 6 7 1.5 kb E 5+6 3.0 kb Cb unc-119 1.0 kb F 3+6 1.8 kb F30B5.7 dpy-13 attP attP F36A4.9 col-34 Pglt-3::Venus sup-7(st5) (pseudogene) G 5+7 3.4 kb 1 kb H 3+7 2.3 kb Figure 7: The attP cassettes generated by MosSCI.
A.) Schematic of arSi1, insertion attP cassette into the Mos1 site ttTi5605. The yellow lines denote the region of homology in the repair template. The numbers correspond to primers used for checking correct integration.
B.) Transgene insertion at target site was confirmed by PCR. Different sets of primers were used to verify the correct insertion of the transgene.
C.) Schematic of arSi2, insertion attP cassette into the Mos1 site cxTi10882. The yellow lines denote the region of homology in the repair template. The numbers correspond to primers used for checking correct integration.
D.) Transgene insertion at target site was confirmed by PCR. Different sets of primers were used to verify the correct insertion of the transgene. 72 73
A. B. donor plasmid extrachromosomal array
attB attB attB attB Phsp-16.2::φC31::tbb-2 Pmyo-3::mCherry Pmyo-3::mCherry
landing φC31 landing φC31 platform Cb unc-119 platform Cb unc-119 attP attP attP attP Pglt-3::Venus sup-7(st5) Pglt-3::Venus sup-7(st5)
integrated transgene integrated transgene
attR attR attR attR Pmyo-3::mCherry Pmyo-3::mCherry
attR attR attR attR Pmyo-3::mCherry Pmyo-3::mCherry
Figure 8: Overview of φC31 mediated insertion of transgenes in C. elegans.
A.) Schematic of RMCE of Pmyo-3::mCherry transgene from an extrachromosomal array. The landing platform containing the attP cassette has been inserted in single-copy at a known locus. φC31 is expressed under the control of a heat-shock promoter from the extrachromosomal array containing Pmyo-3::mCherry flanked by attB sites. Correct insertion of the transgene is assessed by the loss of unc-119(+) rescue, loss of Pglt-3::Venus expression and the loss of sup-7(st5) negative selectable marker.
B.) Schematic of RMCE of Pmyo-3::mCherry. The landing platform containing the attP cas- sette has been inserted in single-copy at a known locus. Pmyo-3::mCherry flanked by attB sites is directly injected into the gonad of worms expressing φC31 or in some cases co-injected with φC31 mRNA(see Materials and Methods). Correct insertion of the transgene is assessed as above (figure 3a). 74
Table 3: RMCE attempts via direct injection.
Donor P0 mCherry Straina φC31 sourceb plasmidc injectedd expressione RMCEf GS5595g mRNA (500 ng/μl) pMLV085 (50 ng/μl) 79 34 0 GS5595g mRNA (1000 ng/μl) pMLV085 (50 ng/μl) 82 52 0 GS5596 mRNA (250 ng/μl) pMLV085 (50 ng/μl) 125 68 0 GS5596 mRNA (1000 ng/μl) pMLV085 (50 ng/μl) 42 19 1h GS5596 mRNA (1000 ng/μl) pMLV085 (250 ng/μl) 90 64 0 GS5595g pMLV080i (50 ng/μl) pMLV085 (50 ng/μl) 80 32 0 GS5595g pMLV081j (50 ng/μl) pMLV085 (50 ng/μl) 44 32 0 GS5596 pMLV081j (50 ng/μl) pMLV085 (50 ng/μl) 42 22 0 GS5596 pMLV124k (50 ng/μl) pMLV085 (50 ng/μl) 122 84 0 NA arEx1323l pMLV085 (50 ng/μl) 131 99 0 GS6095 arSi3m pMLV085 (50 ng/μl) 40 24 0 a Strain containing the landing platform arSi1.
b Source of φC31. mRNA, DNA and transgene provided φC31.
c Donor plasmid injected and concentration used.
d Number of P0 animals injected.
e mCherry expression of F1 animals indicate the frequency of successful gonad injection.
f Successful RMCE event was assessed by the loss unc-119 rescue, loss of excretory cell Venus expression and mCherry expression.
g In the strain GS5595, as the landing platform, arSi1, was not balanced, the strain gave rise to Unc progeny. Screening for RMCE event during injection of this strain required the presence of mCherry expression and correct segregation of the transgene.
h Correct insertion of the Pmyo-3::mCherry::unc-54 3’ UTR was verified by PCR analysis (see Figure 4).
i Co-injection of Pglh-2::φC31::glh-2 3’ UTR with donor plasmid.
j Co-injection of Ppie-1(short)::φC31::glh-2 3’ UTR with donor plasmid.
k Co-injection of Pglh-2::3xHAφC31w/introns::glh-2 3’ UTR with donor plasmid.
l arEx1323[Pglh-2::3xHAφC31w/introns::glh-2 3’ UTR] was generated in an emb-27(g48) back- ground crossed into strain GS5596.
m Integration of Pglh-2::3xHAφC31w/introns::glh-2 3’ UTR via MosSCI (see Table 5). 75
Table 4: RMCE attempts via heat-shock driven φC31. Correct a b c d e Strain Array Array type P0 screened integration GS6097 arEx1419 complexf 120 0 GS6276 arEx1457 simple 100 0 GS6277 arEx1458 simple 100 0 GS6282 arEx1463 complexg 100 0 GS6283 arEx1464 complexg 100 0 a Strain containing the landing platform arSi1.
b Extrachromosamal array.
c Both simple and complex arrays were used.
d Number of P0 animals screened after the heat-shock treatment.
e Successful RMCE event was assessed by the loss unc-119 rescue, loss of excretory cell Venus expression and mCherry expression.
f C. elegans genomic DNA was injected at 75 ng/μl.
g C. elegans genomic DNA was injected at 150 ng/μl. 76
A. 6 1 5 4 8 9 3 5 2 7
F49E12.6 F14E5.1 attR attR F14E5.2 Pmyo-3::mCherry 1 kb
B. Lanes A B C D E F G H I J K L M N Primer Pairs 5-4 5-8 1-4 6-4 1-8 6-8 5-3 5-9 2-3 2-9 7-3 7-9 5-5 1-2 Expected Sizes (Kb) 0.56 1.90 1.96 2.72 3.35 4.11 1.01 1.35 2.44 2.77 3.12 3.46 4.63 7.47
10 kb 6 kb 4 kb 3 kb *
2 kb *
1 kb
0.5 kb
Figure 9: Verification of RMCE in the germline by φC31.
A.) Schematic of the genomic location after the RMCE event, showing the positive orientation in which the transgene could be inserted. The numbers correspond to primers used for checking correct integration.
B.) Transgene insertion at target site was confirmed by PCR. Different sets of primers were used to verify the correct insertion of the transgene. The asterisk in lane N, denote background bands found in parent strains; ttTi5606; unc-119(ed3) and arSi1/mnC1; unc-119(ed3). 77
Table 5: Integration of germline-expressing φC31 transgenes into the genome by MosSCI. emb-27 Correct b c d e Repair Template Concentration P0 injected rescue Integrants integration pMLV131 50 ng/μl 132 36 3 1 pMLV160 50 ng/μl 80 38 9 4 pMLV168 50 ng/μl 80 53 8 3 pMLV160 2 ng/μl 80 9 1 1 pMLV168 2 ng/μl 80 7 1 1 a Mos1 transposon insertion strain used was GS5780: emb-27(g48); ttTi9626.
b Different concentration of repair template was attempted, as it had been reported that it can af- fect germline expression of transgenes.
c Number of P0 animals injected.
d Integrants were selected based on the emb-27 rescue and the loss of mCherry expression in muscle tissue.
e Integrants were verified by PCR. 78
Cm(R) Cm(R) Cm(R)
ccdB ccdB ccdB MCS MCS attR1 attR2 attR4 attR3
attB attB attB attB attB attB
pBSattBC[MCS] pDESTattBC[R1-R2] pDESTattBC[R3-R4] f(1) origin f(1) origin f(1) origin
pUC origin pUC origin pUC origin
ampicillin ampicillin ampicillin Figure 10: Vectors for φC31 mediated RMCE.
Three vectors for φC31 mediated recombination. One plasmid with multiple cloning sites for conventional cloning and two plasmids with Invitrogen’s Gateway cassettes, using both the [R1- R2] cassette and the [R3-R4] cassette for the three-way multi gateway system. 79
arEx1468 arEx1469 A A’ D D’
DIC TagRFP DIC TagRFP B B’ E E’
DIC TagRFP DIC TagRFP C C’ F F’
DIC TagRFP DIC TagRFP Figure 11: Expression of heat-shock promoter.
Expression of Phsp-16.2::H2BtagRFP::tbb-2 3’ UTR. (A-C) arEx1468. (D-F) arEx1469. (A-E) L4 and young adults, showing DIC and the TagRFP. After heat-shock treatment at 37°C for 1 hr. Expression is seen in the somatic gonad but not in the germline (seen in A-E), the intestine, the hypodermis and the head (not shown). H2BtagRFP expression in the embryo. One of the embry- os does not contain the array (F and F’). 80
Chapter 3: Modulation of Notch signaling pathway by Presenilin associated proteins. 81
Abstract:
The γ-secretase complex is an important component in the Notch signaling pathway. Not only is the γ-secretase complex involved in the Notch pathway, it is also implicated in the pathology of familial Alzheimer’s disease (FAD). As γ-secretase complex components show a Notch loss-of-function phenotype in C. elegans, a targeted approach was done to find new Notch modulators. A set of genes shown to interact biochemically (Wakabayashi et al. 2009) with the γ-secretase complex was screened for suppression and enhancement of Notch in the C. elegans germline. Knockdown of several genes show suppression of a Notch gain-of-function allele, glp-1(ar202), while knockdown of these genes show no interaction of a Notch loss-of-function allele, glp-
1(bn18). This allele-specificity suggests that the glp-1(ar202) suppressors are not integral
Notch components. Surprisingly, one of the candidates, rab-11.2, was able to suppress glp-1(bn18) embryonic lethality, which suggests a role for RAB-11 in Notch turnover or recycling.
Introduction:
The GLP-1 and LIN-12 Notch proteins mediate cell-cell interactions during the development of C. elegans. They are involved in many cell fate decisions in the embryo, larvae and the adult. Notch is presented to the cell surface as a heterodimer. Prior to its trafficking to the cell surface, Notch undergoes a proteolytic cleavage in the extracellular domain in between the N-terminal and C-terminal heterodimer domains. The Furin class of proteases mediates this S1 cleavage step. Once Notch is bound by a family member of 82
the Delta/Serrate/Lag-2 (DSL) ligands at the EGF repeats in the extracellular domain of
Notch, it undergoes two rounds of proteolytic cleavages. The first of the cleavages, the
S2 cleavage event, occurs in the extracellular domain, and is mediated by the metalloproteases SUP-17/Kuzbanian or ADM-4/TACE (Wen et al. 1997; Jarriault &
Greenwald 2005). The second cleavage step occurs within the transmembrane domain and it is called S3 cleavage, which releases the Notch intracellular domain from the membrane. The S3 cleavage is mediated by the SEL-12/HOP-1 presenilin containing γ- secretase complex (Levitan & Greenwald 1995; X. Li & Greenwald 1997; Westlund et al.
1999). The Notch intracellular domain (NICD) is released and translocates to the nucleus to form a tripartite complex with the sequence-specific DNA binding protein LAG-
1/RBP-J and the co-activator SEL-8/MAM to activate transcription of target genes
(Struhl et al. 1993; Jarriault et al. 1995; Christensen et al. 1996; Roehl et al. 1996; L. Wu et al. 2000; Petcherski & Kimble 2000).
The γ-secretase complex contains a presenilin, SEL-12 or HOP-1, and includes three other components: APH-1, a seven transmembrane domain protein, APH-2, a type I integral membrane protein thought to be the substrate receptor for γ-secretase and PEN-2, a small protein with two transmembrane domains (Kimberly et al. 2003; Edbauer et al.
2003). The presenilins provide the catalytic activity of the complex (Wolfe et al. 1999).
The γ-secretase complex has been co-opted by the Notch pathway as mutations in the
Presenilin catalytic subunits, sel-12 and hop-1, phenocopies loss of Notch signaling (X.
Li & Greenwald 1997; Westlund et al. 1999).
Although it appears that the main function of the γ-secretase complex is to promote Notch signaling, there have been other γ-secretase substrates identified 83
(reviewed in Parks & Curtis 2007). The most important of these substrates is the protein
APP, whose processing by γ-secretase complex leads to the accumulation of Aβ peptides,
which are found in amyloid plaques of patients suffering from Alzheimer’s disease (Kang
et al. 1987; Goate et al. 1991; Scheuner et al. 1996). Like Notch, the extracellular domain
of APP undergoes a couple of rounds of proteolytic cleavages. In neurons, APP is
cleaved at the S2 site by the BACE protease and then cleaved at the S3 site by the γ-
secretase complex (De Strooper et al. 1998; Vassar et al. 1999). Normally, the γ-secretase
complex generates a 40 amino acid peptide known as Aβ40 and also a minor larger
peptide species, Aβ42. Mutations in PS1 found in some FAD patients cause an error in the processing of the extracellular domain of APP, favoring the production of the larger Aβ42
peptide. The two extra amino acids in the Aβ42 peptide cause a propensity for the Aβ peptide to aggregate, which is thought to be the cause of plaque formation and progression of Alzheimer’s disease (Scheuner et al. 1996).
Genetic analysis identified the core components of the γ-secretase complex. In humans, the Presenilin locus was first identified in genetic linkage studies for Familial
Alzheirmer’s Disease (FAD) families (Schellenberg et al. 1992; Van Broeckhoven et al.
1992; St George Hyslop et al. 1992; Sherrington et al. 1995). In C. elegans, in a genetic screen for suppression of a gain-of-function lin-12 allele, the worm orthologue, sel-12 was identified as a Notch pathway component (Levitan & Greenwald 1995).
A genetic locus which contains Nicastrin, a core component of the γ-secretase complex was identified in genetic linkage studies of FAD families (Zubenko et al. 1998;
Kehoe et al. 1999). Subsequent genetic analysis revealed that polymorphisms in Nicastrin are not indicative of AD pathologies (Orlacchio et al. 2002; Confaloni et al. 2003). 84
Instead, biochemical studies identified Nicastrin as PS1 interactor in mammalian cell lines (Yu et al. 2000). In C. elegans, a screen for genes involved in the development of the anterior pharynx found APH-2, the C. elegans Nicastin orthologue (Goutte et al.
2000). The aph-2 gene was subsequently found to genetically interact with lin-12
(Levitan et al. 2001) In the same screen another γ-secretase component APH-1 was uncovered (Goutte et al. 2002). In another screen for enhancement of a sel-12 loss-of- function mutation in C. elegans, yet another component of the γ-secretase was found;
PEN-2 (Francis et al. 2002).
Null mutations in these three components of γ-secretase complex display phenotypes that are associated with the loss of Notch signaling in C. elegans, mainly they have maternal-effect lethal (Mel) and have a loss of anterior pharynx (Aph) phenotypes
(Goutte et al. 2000; Goutte et al. 2002; Levitan et al. 2001; Francis et al. 2002). They also interact genetically with components of the notch pathway (Levitan et al. 2001; Francis et al. 2002).
There has been an interest in the γ-secretase complex, not only in its relation to
Notch signaling but also to APP processing. In an attempt to better understand the γ- secretase complex, Wakabayashi et al. pulled down the γ-secretase complex and identified proteins that were associated with γ-secretase by mass-spectrophotometry.
They were successful in identifying the tetraspanins, CD81 and CD9, in their involvement in the processing of APP by the γ-secretase complex. In a separate study, originating with genetic analysis in C. elegans, the mammalian tetraspanins, TSPAN33 and TSPAN5, were found to be required in Notch signaling at the level of γ-secretase activity, while CD81 did not affect Notch processing (Dunn et al. 2010). This leads to an 85
intriguing possibility that there might be accessory proteins that differentially promote the processing of γ-secretase substrates.
Wakabayashi et al. indentified 54 other proteins that were associated with the γ- secretase complex. Among the proteins identified were: P24A, V-ATPase subunit A, and
V-ATPase subunit d1. The gene p24a, which is homologous to sel-9 in C. elegans, was identified as a suppressor of a hypomorphic of C. elegans Notch receptor lin-12
(Sundaram & Greenwald 1993; Wen & Greenwald 1999). The V-ATPase subunits were found to be involved in Notch signaling and endosomal trafficking in Drosophila melanogaster (Yan et al. 2009; Vaccari et al. 2008) A subset of the 56 proteins were tested by Wakabayashi et al. for their effect on APP processing in tissue culture assays.
Effects on Notch processing were not tested. Thus, the list of γ-secretase associated proteins from the work of Wakabayashi et al. could contain potential novel Notch modulators.
Materials and Methods:
Strains:
Caenorhabditis elegans var. Bristol strain N2 was the wild-type parent strain of all mutants and markers used. Key strains used herein were:
GS4691: rhIs4[glr-1::gfp, dpy20(+)]
GC143: glp-1(ar202)
GS5680: glp-1(ar202); him-5(e1490)
GC888: glp-1(bn18)
GS1485: lag-2(q420) 86
GS5818: rrf-3(pk1426); lag-2(q420)
GS5819: eri-1(mg366); lag-2(q420)
GS5820: lag-2(q420); nre-1(hd20) lin-15b(hd126)
RB1672: sel-12(ok2078)
GS6170: erl-1(tm2703)
GS6171: R09B5.11(ok1759)
GS6172: F53H8.3(ok3175)
FX03165: H17B01.1(tm3165)
FX544: cdc-48.1(tm544)
FX659: cdc-48.2(tm659)
VC207: atgp-1(ok388)
RB767: atgp-2(ok532)
FX02081: rab-11(tm2081)
BW1809: gpa-16(it143); him-5(e1490)
MT363: goa-1(n363)
GS5813: tsp-9(tm378)
EW15: bar-1(ga80)
RB2256: sec-22(ok3053)
PE97: hmp-1(fe4)
NL790: gpa-4(pk381)
GS6479: +/nT1; hmp-1(fe4)/nT1[qIs51]
GS6190: sup-17(n1258); rhIs4[glr-1::gfp, dpy-20(+)]
GS6070: rhIs4[glr-1::gfp, dpy-20(+)]; adm-4(ok265) 87
GS6060: rhIs4[glr-1::gfp, dpy-20(+)]; sel-12(ok2078)
GS6069: hop-1(ar179); rhIs4[glr-1::gfp, dpy-20(+)]
GS6176: rhIs4[glr-1::gfp, dpy-20(+)]; erl-1(tm2703)
GS6177: rhIs4[glr-1::gfp, dpy-20(+)]; R09B5.11(ok1759)
GS6178: rhIs4[glr-1::gfp, dpy-20(+)]; F53H8.3(ok3175)
GS6179: H17B01.1(tm3165); rhIs4[glr-1::gfp, dpy-20(+)]
GS6181: H17B01.1(tm3165); rhIs4[glr-1::gfp, dpy-20(+)]; R09B5.11(ok1759);
F53H8.3(ok3175)
GS6183: cdc-48.1(tm544); rhIs4[glr-1::gfp, dpy-20(+)]
GS6184: cdc-48.2(tm659); rhIs4[glr-1::gfp, dpy-20(+)]
GS6061: rhIs4[glr-1::gfp, dpy-20(+)]; atgp-1(ok388)
GS6062: atgp-2(ok532); rhIs4[glr-1::gfp, dpy-20(+)]
GS6063: rab-11(tm2081); rhIs4[glr-1::gfp, dpy-20(+)]
GS6192: gpa-16(it143); rhIs4[glr-1::gfp, dpy-20(+)]
GS6193: goa-1(n363); rhIs4[glr-1::gfp, dpy-20(+)]
GS5814: rhIs4[glr-1::gfp, dpy-20(+)]; tsp-9(tm378)
GS5899: rhIs4[glr-1::gfp, dpy-20(+)]; bar-1(ga80)
GS6185: rhIs4[glr-1::gfp, dpy-20(+)]; sec-22(ok3053)
GS6189: rhIs4[glr-1::gfp, dpy-20(+)]; hmp-1(fe4)
GS6261: sup-17(n1258); glp-1(ar202)
GS6260: glp-1(ar202); adm-4(ok265)
GS6263: glp-1(ar202); sel-12(ok2078)
GS6262: hop-1(ar179; glp-1(ar202) 88
GS6216: glp-1(ar202); erl-1(tm2703)
GS6217: glp-1(ar202); R09B5.11(ok1759)
GS6218: glp-1(ar202); F53H8.3(ok3175)
GS6219: H17B01.1(tm3165); glp-1(ar202)
GS6221: H17B01.1(tm3165); glp-1(ar202); R09B5.11(ok1759); F53H8.3(ok3175)
GS6222: cdc-48.1(tm544); glp-1(ar202)
GS6223: cdc-48.2(tm659); glp-1(ar202)
GS6224: glp-1(ar202); bar-1(ga80)
GS6225: rab-11.2(tm2081); glp-1(ar202)
GS6226: glp-1(ar202); atgp-1(ok388)
GS6227: atgp-2(ok532); glp-1(ar202)
GS6228: atgp-2(ok532); glp-1(ar202); atgp-1(ok388)
GS6287: gpa-16(it143); glp-1(ar202)
GS6285: goa-1(n363); glp-1(ar202)
GS5898: glp-1(ar202); tsp-9(tm378)
GS6007: glp-1(ar202); sec-22(ok3053)
GS6475: glp-1(ar202); gpa-4(pk381)
GS6477: glp-1(ar202); +/nT1; hmp-1(fe4)/nT1[qIs51]
GS6265: sup-17(n1258); glp-1(bn18)
GS6264: glp-1(bn18); adm-4(ok265)
GS6267: glp-1(bn18); sel-12(ok2078)
GS6266: hop-1(ar179); glp-1(bn18)
GS6232: glp-1(bn18) 89
GS6233: glp-1(bn18); erl-1(tm2703)
GS6234: glp-1(bn18); R09B5.11(ok1759)
GS6235: glp-1(bn18); F53H8.3(ok3175)
GS6236: H17B01.1(tm3165); glp-1(bn18)
GS6238: H17B01.1(tm3165); glp-1(bn18); R09B5.11(ok1759); F53H8.3(ok3175)
GS6239: cdc-48.1(tm544); glp-1(bn18)
GS6240: cdc-48.2(tm659); glp-1(bn18)
GS6242: glp-1(bn18); bar-1(ga80)
GS6243: rab-11.2(tm2081); glp-1(bn18)
GS6244: glp-1(bn18); atgp-1(ok388)
GS6245: atgp-2(ok532); glp-1(bn18)
GS6246: atgp-2(ok532); glp-1(bn18); atgp-1(ok388)
GS6286: gpa-16(it143); glp-1(bn18)
GS6284: goa-1(n363); glp-1(bn18)
GS6247: glp-1(bn18); tsp-9(tm378)
GS6241: glp-1(bn18); sec-22(ok3053)
GS6476: glp-1(bn18); gpa-4(pk381)
GS6478: glp-1(bn18); +/nT1; hmp-1(fe4)/nT1[qIs51]
GS6481: erl-1(tm2703); lag-2(q420)
Strains carrying glp-1(ar202); glp-1(bn18) and lag-2(q420) were maintained at 15 °C, otherwise all other strains were maintained at 20 °C. 90
Conservation analysis:
The conserved list was compiled from the data of Wakabayashi et. al.
(Wakabayashi et al. 2009). The compiled list was put though Biomart in the Ensembl
database to retrieve conserved C. elegans genes (Smedley et al. 2009; Vilella et al. 2009;
Flicek et al. 2011). The resulting list was double-checked against Treefam and
HomoloGene databases for homologous genes (H. Li et al. 2006; Ruan et al. 2008;
Sayers et al. 2011).
RNAi experiments:
Feeding RNAi experiments for suppression of glp-1(ar202) were performed as
previously described (Dunn et al. 2010). Individual bacterial strains producing double-
stranded RNA (dsRNA) targeting the 46 C. elegans orthologues of the Presenilin pull-
down list we obtained (Kamath & Ahringer 2003). Gravid adults were bleached and eggs
were placed on unseeded plates at 15 °C. Starved, synchronized, L1- stage glp-1(ar202)
hermaphrodites were placed on dsRNA-expressing bacteria, and plates were shifted to 25
°C for three days. The production of progeny, eggs and/or oocytes was evidence of suppression.
Feeding RNAi experiments for the enhancement of lag-2(q420) were performed
as previously described (Timmons et al. 2001; Timmons et al. 2003), with the following
modifications: L4 hermaphrodites were placed on dsRNA-expressing bacteria at 15 °C.
Hermaphrodites were transferred to fresh dsRNA-expressing bacteria, for three
consecutive days. Each plate was scored for Emb (Embryonic lethal), Lag (lin-12 and
glp-1) and Viable animals after three days at 15 °C. 91
Phenotypic analysis:
For scoring sterility of glp-1(ar202), gravid adults were bleached and the eggs were placed on seeded OP50 plates at 15°C for 18-24hrs, then they were shifted to 25°C for 1 day. L4 animas were individually placed on fresh OP50 NGM plates at 25°C and scored 2 days later. The production of progeny, eggs and/or oocytes was scored to determine the degree of suppression.
For scoring enhancement of sterility of glp-1(bn18), gravid adults were bleached and the eggs were placed on seeded OP50 plates at 15°C for 18-24hrs, then they were shifted to 20°C for 1 day. L4 animals were individually placed on fresh OP50 NGM plates at 20°C and scored 2 days later. glp-1(bn18) is not sterile on its own at 20°C. The production of progeny, eggs and/or oocytes was scored to determine the degree of enhancement.
For scoring enhancement of embryonic lethality of glp-1(bn18), L4 animals were placed on OP50 seeded NGM plates and shifted 20°C. Hermaphrodites were transferred to fresh OP50 seeded NGM plates for 3 consecutive days and their progeny were assessed for Emb, two days later.
For scoring suppression of sterility of glp-1(bn18), gravid adults were bleached and the eggs were placed on seeded OP50 plates at 15°C for 18-24hrs, then they were shifted to 23°C for 1 day. L4 animas were individually placed on fresh OP50 NGM plates at 23°C and scored 2 days later. The production of progeny, eggs and/or oocytes was scored to determine the degree of enhancement. 92
For scoring suppression of embryonic lethality of glp-1(bn18), L4 animals were placed on OP50 seeded NGM plates and shifted 23°C. Hermaphrodites were transferred to fresh OP50 seeded NGM plates for 3 consecutive days and their progeny were assessed for viability two days later.
Results:
RNAi screen for positive modulators of Notch in C. elegans.
Gain-of-function alleles of glp-1 cause tumor formation in the germline due to over-proliferating mitotic cells (Berry et al. 1997; Pepper et al. 2003). In the case of weaker gain-of-function alleles, a proximal tumor, consisting of mitotic cells develops, and late onset tumors develop in the distal germline (Pepper et al. 2003). These alleles tend to be temperature-sensitive, such that at 15 °C their germline develops normally and at 25 °C the tumorous phenotypes appear. The animals become sterile at 25°C due to the tumors that develop in the germline. One weak allele that has been uncovered is glp-
1(ar202). RNAi against components of the notch pathway can suppress the activity of gain-of-function glp-1(ar202) allele, and thus can suppress the sterile phenotype of glp-
1(ar202) (Jarriault & Greenwald 2005; Dunn et al. 2010).
To test which presenilin interacting protein is a possible positive modulator of
Notch in C. elegans, RNAi feeding clones of the 46 C. elegans orthologues of the proteins identified in a human presenilin pull-down assay were fed to glp-1(ar202) hermaphrodite at 25 °C. Errors in some of the clones sequenced after the screen was completed suggest that not all 46 C. elegans orthologues were screened. However, the 93
positives from the screen were correct. The positives, H17B01.1 and erl-1 were identified through this screen as suppressing glp-1(ar202) by RNAi (table 3).
The gene H17B01.1 is orthologous to the vertebrate class I glucose transporters, which include hGLUT1. In C. elegans there are an additional two class I glucose transporter that are “in”-paralogues” to H17B01.1, these are: F53H8.3 and R09B05.11.
These paralogues were also used for further analysis. The gene erl-1 is orthologous to the vertebrate ERLIN, which stand for ER lipid rafts.
To determine whether the RNAi effects were due to a suppression of GLP-
1/Notch signaling or due to an effect on germline proliferation, we first attempted RNAi against a temperature-sensitive allele of lag-2, a DSL ligand, which is necessary for sending the Notch signal. The allele lag-2(q420) is a missense mutation in a splice acceptor, such that at 15 °C enough WT protein is made to allow for Notch signaling to occur, though at 25 °C there is not enough full-length mRNA made leading to loss-of- function phenotypes (Lambie & Kimble 1991; Henderson et al. 1994). The phenotype displayed is reminiscent of lin-12(lf) glp-1(lf) double mutants, hence the name of the phenotype, Lag for Lin-12 and Glp-1 (Lambie & Kimble 1991).
RNAi of known modulators of Notch were tried in lag-2(q420) to test for the viability of the assay. The results suggest that it might be feasible to look at enhancement of the Lag phenotype for positive modulators of LIN-12/GLP-1 signaling (figure 1A and figure 1B). Clones of erl-1 and the glucose transporters, H17B01.1, F53H8.3 and
R09B5.11, were used to enhance lag-2(q420) at 15°C. RNAi against erl-1 was able to enhance lag-2(q420) in an RNAi sensitized background, at a level that was statistically significant and at the same level as RNAi against hop-1 or sel-12. For the glucose 94
transporters, the results were more complicated: although, clone H17B01.1 did not seem
to enhance the Lag phenotype to the same extend as hop-1 or sel-12 RNAi, one of its
paralogues, F53H8.3, did enhance the Lag phenotype (figure 1C).
To validate that the RNAi results, especially the enhancement of lag-2(q420), we
used an allele of erl-1; erl-1(tm2703), which is a deletion that removes exon 2, exon 3,
and part of exon 4, and is likely to be a null. The erl-1(tm2703); lag-2(q420) double
mutant did not have an enhanced Lag phenotype compared with lag-2(q420) alone
(figure 1D), suggesting the lag-2 enhancement assay might be misleading. This result
caused a re-evaluation of the lag-2(q420) assay and also a re-evaluation of the general
approach taken.
Positive modulators of GLP-1/Notch:
With issues in the Lag RNAi enhancement assay and our RNAi library, we
decided to do genetic experiments with the alleles of the other genes identified in the
Wakabayashi list. Of the 46 C. elegans genes that are homologous with Wakabayashi set
(table 1), 31 have available alleles. Of these, 20 genes have alleles that are viable or semi- viable, of which 17 are either confirmed null or putative null. The other 3 are either temperature-sensitive conditional alleles or loss-of-function alleles. 4 of the 20 genes are linked to glp-1 and thus were not tested. As sensitized backgrounds, we used glp-
1(ar202), a gain-of-function allele and glp-1(bn18), a loss-of-function allele. Both glp-1 alleles are temperature sensitive.
The initial assay was to test for suppression of sterility cause by the glp-1(ar202) gain-of function allele at 25 °C. However, we later realized that out-crossing the glp-
1(ar202) lab strain into the same background strain used to create the doubles with glp- 95
1(ar202) caused an increase in the number of worms that laid an egg or oocyte, even though the average number of eggs/oocytes were quite small (table 4). Out of the 16 genes screened, 5 alleles suppressed glp-1(ar202) sterile phenotype above the background (table 5). Reassuringly, erl-1(tm2703) and H17B01.1(tm3165), which were recovered from the RNAi screen, were able to suppress glp-1(ar202) in this assay (table
5). Furthermore, the RNAi results indicate that the suppression in the double mutant is unlikely to reflect genetic background issues. The genes sec-22(ok3053), cdc-
48.1(tm544), and goa-1(n363) were also capable of suppressing glp-1(ar202) sterility to a level above background (table 5), an effect also seen when looking at average brood size of the double mutants (table 5). Attempts to verify these results with RNAi to knockdown sec-22, cdc-48.1 and goa-1 were inconclusive (table 6).
Next, we checked whether any of the possible candidates could enhance a loss-of- function allele of glp-1. The allele glp-1(bn18) is a temperature sensitive mutation, which is fertile at 15 °C and 20 °C, but sterile at 25 °C (Kodoyianni et al. 1992; Dunn et al.
2010). None of the tested genes enhance glp-1(bn18) sterility at 20 °C to a high confidence level (table 7).
There are many cell fate choices during embryogenesis that require GLP-1/Notch signaling, such that a loss of Notch signaling results in embryonic lethality (Priess et al.
1987; Mello et al. 1994; Mickey et al. 1996). To investigate potential roles of the presenilin interactors in GLP-1/Notch signaling in embryonic development, double mutants with glp-1(bn18) were scored for enhanced embryonic lethality at 20 °C. At 20
°C glp-1(bn18) has about 5% embryonic lethality phenotype. Of the alleles tested
R09B5.11(ok1759), gpa-16(it143) and goa-1(n363) showed an enhancement of 96
embryonic lethality in combination with glp-1(bn18) (table 7 and table 8). Strains that
were doubly homozygous with glp-1(bn18) and F53H8.3(ok3175), atgp-1(ok388), rab-
11.2(tm2081), or tsp-9(tm378) showed a level of embryonic lethality higher than that of
glp-1(bn18) alone (table 7). However, this was due entirely to the alleles themselves, as
the starting strains of F53H8.3(ok3175), atgp-1(ok388), rab-11.2(tm2081), and tsp-
9(tm378) had embryonic lethality at the same level as the doubles with glp-1(bn18) (table
8).
Negative regulators of GLP-1/Notch:
It is possible that the presenilin interactors from the Wakabayashi list inhibit γ-
secretase activity and thus would negatively regulate Notch signaling. To test for
negative regulators of GLP-1/Notch in C. elegans, suppression of glp-1 loss-of-function
phenotypes were assayed both in the germline and in the embryo.
To test for negative regulators of GLP-1/Notch in the germline, fertility was
scored at 23°C. In this condition, glp-1(bn18) is about 48.6% fertile (table 9). In this
assay, none of the tested alleles enhanced the glp-1(bn18) sterile phenotype (table 9).
At 23°C, glp-1(bn18) has about a 99% embryonic and larval lethality (table 9). In this assay, the rab-11.2(tm2081); glp-1(bn18) strain is viable at 23°C, where 61% of the embryos laid make it to adult stage (table 9). This is compared to the level of suppression by sel-10(ok1632), which suppresses glp-1(bn18) embryonic lethality by 9.5 % (table 9).
97
Discussion:
I have tested many genes that were reported to be associated with the γ-secretase complex in a mammalian tissue culture system (Wakabayashi et al. 2009). There have been other Presenilin interactors characterized biochemically, which I have not tested in this work (reviewed in Parks & Curtis 2007). There is little overlap between the proteins identified by Wakabayashi et al. and other work showing protein interactions with
Presenilin (Parks & Curtis 2007). I chose the Wakabayashi list as the purification of the
γ-secretase complex revealed a role of tetraspanins in γ-secretase function. This corroborated the genetic evidence that suggested the role of tetraspanins in Notch processing during the γ-secretase step (Dunn et al. 2010).
However, it is possible that some of the proteins identified in the PS pull-down are not relevant to Presenilin activity. There are three possible sources of false positives in the study in Wakabayashi et al. First, the proteins identified by mass- spectrophotometry were purified from solubilized membranes associated with PS1 or
PS2. Solubilization of membranes was achieved by cold treatment with a mild detergent, which should solubilize individual protein units (Speers & Wu 2007). However, there are membranes that are resistant to complete solubilization by mild detergents, these have been termed Detergent Resistant Membranes (DRM) and are thought to be representative of cellular membrane structures called lipid rafts (Lingwood & Simons 2010).
Furthermore, the γ-secretase complex is associated with these detergent resistant membranes (Wahrle et al. 2002; Wakabayashi et al. 2009). Thus, it is possible that some of the identified proteins in Wakabayashi et al. interact indirectly with Presenilin as part of these lipid rafts. 98
Second, the purification of the γ-secretase complex relied on expression of transgenic Presenilins. Studies have shown that transgenically expressed Presenilins differ in subcellular localization from the endogenous Presenilins (reviewed in Haass &
De Strooper 1999). This might affect the proteins or membrane compartments that are associated with the overexpressed Presenilins. For example, studies of overexpressing transmembrane proteins elicited a stress response which caused the formation of aggresomes due to misfolded proteins (Johnston et al. 1998). However, in the
Wakabayashi study there was a control purification using a distant paralogue to the
Presenilins, SPPL-3 (Wakabayashi et al. 2009). This control purification should filter out any proteins that were recovered due to the overexpression of a transmembrane protein.
As Presenilin is mostly localized to the ER and the Golgi compartments, it is likely that it is not in the γ-secretase complex. This is evidenced by the finding that there is a significant amount of full-length Presenilin in the purified fractions (Wakabayashi et al. 2009). As Presenilin undergoes endoproteolysis upon γ-secretase complex formation and activation, the presence of full-length Presenilin in the purified fraction suggests that some of the Presenilin purified is not in the γ-secretase complex and it is not in an active state. Thus, proteins isolated in the purification of Presenilin could be interacting with the
Presenilin subunit in the ER or in the trafficking of Presenilin through the secretory pathway. These proteins might not be involved in γ-secretase activity and they would be unlikely to be involved in substrate recognition.
The Presenilin pull down isolated large proteolipid structures, such as the tetraspanin web and lipid rafts (Wakabayashi et al. 2009). As a result the interactions might uncover direct protein-protein interactions or indirect interactions as part of the 99
tetraspanin web and lipid rafts. These indirect interactions could be important for γ-
secretase function, they could mark the sub-cellular location of the Presenilin, or they
could be coincidental as part of the tetraspanin web or lipid rafts.
If the points discussed above are true, any genetic interaction between the
Wakabayashi list and glp-1 that is uncovered does not indicate a role in Presenilin
activity per se. Further analysis would have to be done to determine whether such genetic
interactions involve γ-secretase activity.
The allele specificity of the positives suggests that these genes are not core
components of Notch signaling pathway. I would expect that the core components of the
Notch pathway would interact with both the glp-1(ar202), gain-of-function allele and
glp-1(bn18), loss-of-function allele. However, there is a possibility that these genes could
still be core components of Notch in C. elegans due to the potential of genetic and
functional redundancy. Here, I outline the positive results and the potential effect they
have on GLP-1 signaling in C. elegans.
Goalpha:
GOA-1 is a member of the alpha subunit of the heterotrimeric G-protein family.
The heterotrimeric G-protein consist of three subunits, the α, β and γ subunits. The
complex exists as a functional dimer where the Gα subunit associates with Gβγ dimer.
Signal transduction can occur through either the Gα or Gβγ subunits. Downstream
effectors of the heterotrimeric G-protein affect many different cellular processes. Gα0, which is GOA-1 in C. elegans, regulates ion channels and transporters, transcriptional machinery and the secretory pathway (reviewed in Neves et al. 2002). 100
Antibody staining of GOA-1 in dissected gonads shows expression in sheath cell and spermatheca (Govindan et al. 2006). It is involved in oocyte maturation and it inhibits meiotic progression until the Major Sperm Proteins are present (Govindan et al.
2006; Cheng et al. 2008). The mechanism of GOA-1 on oocyte maturation is through the regulation of the gap junctions between the sheath cell and oocyte (Govindan et al. 2006).
Loss of goa-1 leads to higher oocyte maturation rates and this is thought to occur by the loss of the gap junctions between sheath cell and oocyte (Govindan et al. 2006).
Perhaps in glp-1(ar202) animals gap junctions still form between the proximal sheath and the proximal tumor. Removing GOA-1 activity from the sheath and spermatheca causes the gap junctions not to form, which inhibits tumorogenesis of the proximal gonad. As it has been shown, removal of the gonadal sheath cell and spermatheca by ablation can lead to the suppression of glp-1(ar202) proximal tumor
(Killian & Hubbard 2005). Thus, it is possible that removing GOA-1 activity is inhibiting sheath cell or spermathecal function.
CDC-48/p97:
CDC-48 is a highly conserved family of ubiquitin-selective chaperones which contain an AAA-ATPase domain. Their key function is to unfold proteins and disassemble protein complexes. CDC-48/p97 has been shown to play critical roles in a broad range of diverse cellular processes in yeast, C. elegans, Drosophila and mammals.
These processes include the Golgi, ER, and nuclear membrane reassembly, ERAD, the ubiquitin-proteasome system, cell cycle regulation, DNA repair, autophagosome maturation and mitophagy (reviewed in Yamanaka et al. 2011). 101
The expression pattern of cdc-48.1 cannot distinguish the autonomy of CDC-48.1 in the suppression of glp-1(ar202). In-situ hybridization of cdc-48.1 and cdc-48.2 shows mRNA expression in the germline of L4 and adult hermaphrodites (Yamauchi et al.
2006). Analysis of the amount of mRNA transcribed per paralogue suggested that cdc-
48.1 was transcribed two-fold higher than cdc-48.2. Translational fusion constructs with
CDC-48.1 shows protein expression in the embryos and spermatocytes in the L4 stage and spermatheca in the adult (Yamauchi et al. 2006).
In C. elegans cdc-48.1 and cdc-48.2 function with sel-11(or hrd-1) in the UPR and ERAD pathways (Sasagawa et al. 2009). The suppression of glp-1(ar202) by cdc-
48.1 is probably not by a UPR pathway, as the knock down of cdc-48.1 would lead to stability glp-1(ar202) and thus, it should enhance its tumorous phenotype. This expected phenotype would be consistent with sel-11 suppressing a loss-of-function extracellular glp-1 mutation, glp-1(e2142) (Sundaram & Greenwald 1993).
In C. elegans double knockdown of cdc-48.1 and cdc-48.2 cause an embryonic lethal phenotype. The main characteristic of the double knockdown is the appearance of numerous vacuoles in the embryo (Yamanaka et al. 2004). This might be suggestive of a defect in the secretory pathway.
Given the genetic redundancy of cdc-48.1 and cdc-48.2 in the germline and the expression pattern of CDC-48.1 translational fusion it is possible that the deletion of cdc-
48.1 is having an effect through limiting secretion of a factor from the sheath cell or spermatheca. The DSL ligands APX-1 and ARG-1 are expressed in the proximal sheath cells and spermathecal cells (McGovern et al. 2009). Ablation of these cells can suppress the Pro phenotypes of glp-1(ar202) (Killian & Hubbard 2005). It is possible that 102
impairment in the secretory pathway may lead to loss of DSL ligand in the signaling cells
and suppression of Notch signaling.
ERLIN:
The two Erlins in Mammals, Erlin1 and Erlin2, were first identified in
mammalian culture systems as being enriched in lipid rafts from the ER (Browman et al.
2006). Spfh2 (Erlin2) was identified as being required for degradation and ubiquitination
of IP3 receptors in the ER (Pearce et al. 2007). Erlin2 functions along with other ERAD pathway components such as Hrd1/SEL-1 and p97/CDC-48 in the degradation of IP3R
(Pearce et al. 2007). Both Erlin1 and Erlin2 recognize and bind to IP3R and target it to the
ERAD pathway (Wang et al. 2009).
There is no known function of C. elegans erlin, erl-1. Antibody staining shows that ERL-1 is expressed in the germline and in embryos (Hoegg 2010). The null mutant of erl-1 is completely viable. The association of mammalian Erlin2 and p97, suggests that
C. elegans erl-1 and cdc-48.1 function in the same or related pathways. The suppression of glp-1(ar202) by loss of erl-1 could be similar to that of cdc-48.1 (see above).
SEC-22:
In yeast and mammals, Sec22p, a vSNARE, is involved in both the anterograde
and retrograde ER to Golgi transport (Sacher et al. 1997; Ballensiefen et al. 1998; Liu &
Barlowe 2002; Liu & Barlowe 2002; Ballensiefen et al. 1998; Sacher et al. 1997).
In C. elegans the expression pattern has not been well characterized. According to
the NEXTDB it might be expressed in the proximal gonad by in-situ hybridization,
although the staining is very weak (NEXTDB, The Nematode Expression Pattern 103
DataBase at nematode.lab.nig.ac.jp). Although, the expression pattern of sec-22 is not well characterized, the observation that loss of sec-22 is able to suppress glp-1(ar202), but has no effect on glp-1(bn18) indicates the possibility of sec-22 functioning in the proximal gonad. If so, the effect of sec-22 on glp-1(ar202) could be similar to that of cdc-
48.1 on the proximal tumor of glp-1(ar202) animals.
Sec22p forms a SNARE complex with Syntaxin-5 to mediate vesicle trafficking in the early secretory pathway (Dorer et al. 2006). Furthermore, Syntaxin-5 is associated with p97 in Golgi reassembly process (Rabouille et al. 1998). It is possible that sec-22 and cdc-48.1 are involved in the same pathway in the ER to Golgi trafficking.
An analogous protein to CDC-48, NSF which have been shown to affect Notch signaling at wing margin in Drosophila and involves the SNARE component syntaxin-1
(Stewart et al. 2001). NSF and syntaxin-1 are involved in fusing vesicles from the Golgi to the plasma membrane. It is possible that CDC-48/p97, Sec-22p and Syntaxin-5 are playing an analogous role in the early secretory pathway in ER to Golgi trafficking. In these cases, improper export of the Notch to the plasma membrane is sufficient to knockdown Notch activity.
Glucose Transporters:
It has been shown that glucose starvation in mammalian tissue culture cells results in decrease expression of the growth-factor IL3-Rα at the cell surface (Wellen et al.
2010). This observation was the result of decrease in glycosylation of the growth-factor receptor. Addition of downstream intermediate, GlnNAc, in the hexosamine pathway restored cell surface expression IL3-Rα (Wellen et al. 2010). Thus, cellular glucose levels can modulate the activity of cell-surface receptors through the glycosylation pathway. 104
GLP-1/Notch is highly glycosylated and defects in Notch glycosylation decrease
its activity (reviewed in Stanley 2007). Therefore, it is possible that the knockdown of a
glucose transporter is negatively affecting the presentation of GLP-1 to the cell surface or
the activity of GLP-1. It also has been reported that the DSL ligands are also glycosylated
and this could have an effect on DSL ligand function (Panin et al. 2002).
H17B01.1 is expressed strongly in the proximal gonad, possibly the sheath cells
and spermatheca (NEXTDB; http://nematode.lab.nig.ac.jp/db2/ShowCloneInfo.php?clone=567d8).
There are two possibilities of how the glucose transporter is affecting GLP-1 activity in the proximal germline. If the sheath cell and spermatheca are influencing the proximal tumor in glp-1(ar202) animals through the gap junctions, it is possible that glucose is being delivered to the tumor via these gap junctions. It is also possible that glycosylation of the DSL ligands are necessary for proper ligand function.
RAB-11:
RAB-11 is a member of the Rab family of small GTPases. Members of this
family have been shown to be involved in trafficking of membrane vesicles throughout
the cell (reviewed in Stenmark & Olkkonen 2001). In Mammals, Rab11a is thought to
promote the trafficking of vesicles from the trans-Golgi Network to the plasma
membrane and is involved in the recycling endosomes (Stenmark & Olkkonen 2001). In
Drosophila, Rab11 positively regulates Notch signaling in asymmetric cell division of the
SOP by recycling the Delta ligand back to the plasma membrane (Emery et al. 2005).
Although, this is unlikely to be happening in this situation as it appears that rab-11.2 is
negatively regulating Notch in the C. elegans embryo. 105
It has been shown that blocking endosomal trafficking in Drosophila can lead to up-regulation of Notch activity (Jaekel & Klein 2006; Moberg et al. 2005; Thompson et al. 2005; Vaccari & Bilder 2005; Vaccari et al. 2008). This up-regulation of Notch is dependent on γ-secretase activity (Jaekel & Klein 2006). The requirement of RAB-11 in the recycling endosomes suggests that blockage of trafficking of Notch through the endosomes can increase Notch activity by aberrant activation by γ-secretase similar to what has been shown in D. melanogaster.
106
Chapter 3: Figures and Tables. 107
Table 1: Presenilin-associated proteins. M. musculus Protein C. elegans Orthologues Gene UniProt Entrez Gene Sequence Name (Gene) Gene Public Name Anxa2 P07356 12306 C28A5.3 nex-3 ZC155.1 nex-1 Atp1a1 Q8VDN2 11928 B0365.3 eat-6 Atp2a2 O55143 11938 K11D9.2 sca-1 Atp6v0d1 P51863 11972 C30F8.2 vha-16 Atp6v1a P50516 11964 Y49A3A.2 vha-13 Cd47 Q61735 16423 Cd81 P35762 12520 C25G6.2 tsp-9 Ctnna1 P26231 12385 R13H4.4 hmp-1 Ctnnb1 Q02248 12387 C54D1.6 bar-1 K05C4.6 hmp-2 B0336.1 wrm-1 Ddost O54734 13200 T09A5.11 T09A5.11 Gnal R06A10.2 gsa-1 Gnai1 Y95B8A.5 gpa-16 T07A9.7 gpa-4 Gnai2 Y95B8A.5 gpa-16 T07A9.7 gpa-4 Gnai3 Y95B8A.5 gpa-16 T07A9.7 gpa-4 Gnao1 C26C6.2 goa-1 Gnat1 Y95B8A.5 gpa-16 T07A9.7 gpa-4 Gnat2 Y95B8A.5 gpa-16 T07A9.7 gpa-4 Got2 P05202 14719 C14F11.1 C14F11.1 C44E4.3 C44E4.3 Hspa8 P63017 15481 F26D10.3 hsp-1 Hspa9a P38647 15526 C37H5.8 hsp-6 Hspe1 Y22D7AL.10 Y22D7AL.10 Hspe1-rs1 Y22D7AL.10 Y22D7AL.10 Itga3 Q62470 16400 F54G8.3 ina-1 Itgb1 P09055 16412 ZK1058.2 pat-3 Ifitm3 Q9CQW9 66141 Igsf8 Q8R366 140559 Jup Q02257 16480 C54D1.6 bar-1 K05C4.6 hmp-2 B0336.1 wrm-1 Lman1 Q9D0F3 70361 K07A1.8 ile-1 Myadm O35682 50918 P4hb P09103 18453 C07A12.4 pdi-2 C14B1.1 pdi-1 Pdia3 P27773 14827 H06O01.1 pdi-3 Plp2 Q9R1Q7 18824 K09G1.1 K09G1.1 Ptgfrn Q9WV91 19221 Rab11a many 53869 W04G5.2 rab-11.2 F53G12.1 rab-11.1 Rab11b many 19326 W04G5.2 rab-11.2 F53G12.1 rab-11.1 Rpn2 Q9DBG6 20014 M01A10.3 M01A10.3 Sec22b O08547 20333 F55A4.1 F55A4.1 Serpinh1 P19324 12406 Slc2a1 P17809 20525 F53H8.3 F53H8.3 H17B01.1 H17B01.1 R09B5.11 R09B5.11 Slc3a2 P10852 17254 C38C6.2 atgp-2 F26D10.9 atgp-1 Slc38a2 Q8CFE6 67760 Slc7a5 Q9Z127 20539 F07C3.7 aat-2 Erlin1, Spfh1 226144 C42C1.15 C42C1.15 Erlin2, Spfh2 244373 C42C1.15 C42C1.15 Tmem109 Q3UBX0 68539 Tmed10 Q9D1D4 68581 F47G9.1 F47G9.1 Tmed2 Q9R0Q3 56334 W02D7.7 sel-9 Upk1b Q9Z2C6 22268 Vamp8 O70404 22320 B0513.9 B0513.9 Y69A2AR.6 Y69A2AR.6 Vcp Q01853 269523 C06A1.1 cdc-48.1 C41C4.8 cdc-48.2 Vdac1 Q60932 22333 R05G6.7 R05G6.7 LOC547349 - 547349 Wakabayashi list of PS1 and PS2 membrane associated proteins and their C. elegans ortho- logues. Table 2: C. elegans orthologues of Presenilin-associated proteins. Gene Public Sequence Name Name (Gene) KOG Info (merged) Allele Class Phenotype goa-1 C26C6.2 [KOG0082] G-protein alpha subunit (small G protein superfamily) n363 null gpa-16 Y95B8A.5 [KOG0082] G-protein alpha subunit (small G protein superfamily) it143 ts loss-of-function gpa-4 T07A9.7 [KOG0082] G-protein alpha subunit (small G protein superfamily) pk381 null rab-11.2 W04G5.2 [KOG0087] GTPase Rab11/YPT3, small G protein superfamily tm2081 null WT rab-11.1 F53G12.1 [KOG0087] GTPase Rab11/YPT3, small G protein superfamily tm2341 putative null lethal gsa-1 R06A10.2 [KOG0099] G protein subunit Galphas, small G protein superfamily pk75 loss-of-function lethal hsp-1 F26D10.3 [KOG0101] Molecular chaperones HSP70/HSC70, HSP70 superfamily tm5076 putative null lethal and/or sterile hsp-6 C37H5.8 [KOG0102] Molecular chaperones mortalin/PBP74/GRP75, HSP70 superfamily tm515 putative null lethal and/or sterile pdi-2 C07A12.4 [KOG0190] Protein disulfide isomerase (prolyl 4-hydroxylase beta subunit) gk375 putative null lethal pdi-1 C14B1.1 [KOG0190] Protein disulfide isomerase (prolyl 4-hydroxylase beta subunit) gk271 putative null WT pdi-3 H06O01.1 [KOG0190] Protein disulfide isomerase (prolyl 4-hydroxylase beta subunit) sca-1 K11D9.2 [KOG0202] Ca2+ transporting ATPase eat-6 B0365.3 [KOG0203] Na+/K+ ATPase, alpha subunit ok1334 putative null lethal atgp-1 F26D10.9 [KOG0471] Alpha-amylase ok388 putative null WT atgp-2 C38C6.2 [KOG0471] Alpha-amylase ok532 putative null WT R09B5.11 R09B5.11 [KOG0569] Permease of the major facilitator superfamily ok1759 putative null WT F53H8.3 F53H8.3 [KOG0569] Permease of the major facilitator superfamily ok3175 putative null WT H17B01.1 H17B01.1 [KOG0569] Permease of the major facilitator superfamily tm3165 putative null WT cdc-48.1 C06A1.1 [KOG0730] AAA+-type ATPase tm544 putative null WT cdc-48.2 C41C4.8 [KOG0730] AAA+-type ATPase tm659 putative null WT nex-1 ZC155.1 [KOG0819] Annexin gk148 putative null WT nex-3 C28A5.3 [KOG0819] Annexin gk385 putative null WT B0513.9 B0513.9 [KOG0860] Synaptobrevin/VAMP-like protein Y69A2AR.6 Y69A2AR.6 [KOG0860] Synaptobrevin/VAMP-like protein sec-22 F55A4.1 [KOG0862] Synaptobrevin/VAMP-like protein SEC22 ok3053 putative null WT pat-3 ZK1058.2 [KOG1226] Integrin beta subunit (N-terminal portion of extracellular region) st564 null lethal aat-2 F07C3.7 [KOG1287] Amino acid transporters vha-13 Y49A3A.2 [KOG1352] Vacuolar H+-ATPase V1 sector, subunit A C44E4.3 C44E4.3 [KOG1411] Aspartate aminotransferase/Glutamic oxaloacetic transaminase AAT1/GOT2 C14F11.1 C14F11.1 [KOG1411] Aspartate aminotransferase/Glutamic oxaloacetic transaminase AAT1/GOT2 Y22D7AL.10 Y22D7AL.10 [KOG1641] Mitochondrial chaperonin F47G9.1 F47G9.1 [KOG1691] emp24/gp25L/p24 family of membrane trafficking proteins sel-9 W02D7.7 [KOG1692] Putative cargo transport protein EMP24 (p24 protein family) ostd-1 M01A10.3 [KOG2447] Oligosaccharyltransferase, delta subunit (ribophorin II) ostb-1 T09A5.11 [KOG2754] Oligosaccharyltransferase, beta subunit vha-16 C30F8.2 [KOG2957] Vacuolar H+-ATPase V0 sector, subunit dd ok2332 putative null lethal erl-1 C42C1.15 [KOG2962] Prohibitin-related membrane protease subunits (Erlin) tm2703 putative null WT R05G6.7 R05G6.7 [KOG3126] Porin/voltage-dependent anion-selective channel protein tm3491 putative null lethal and/or sterile ina-1 F54G8.3 [KOG3637] Vitronectin receptor, alpha subunit gm86 null Lethal hmp-1 R13H4.4 [KOG3681] Alpha-catenin fe4 loss-of-function Semi-viable ile-1 K07A1.8 [KOG3838] Mannose lectin ERGIC-53, involved in glycoprotein traffic tsp-9 C25G6.2 [KOG3882] Tetraspanin family integral membrane protein tm378 putative null WT bar-1 C54D1.6 [KOG4203] Armadillo/beta-Catenin/plakoglobin ga80 null hmp-2 K05C4.6 [KOG4203] Armadillo/beta-Catenin/plakoglobin zu364 loss-of-function lethal
wrm-1 B0336.1 [KOG4203] Armadillo/beta-Catenin/plakoglobin n1984 ts loss-of-function 108 K09G1.1 K09G1.1 [KOG4788] Members of chemokine-like factor super family and related proteins 109
Table 3: RNAi screen for positive regulators of Notch/GLP-1 in C. elegans. RNAi clone Plate 1 Plate 2 Plate 3 FV + - - GFP + - - SUP-17 ++ ++ - TSP-12 +++ +++ +++ GLP-1 +++ +++ +++ C42C1.15 ++ ++ + H17B01.1 ++ ++ - F53H8.3 ++ - - Suppression of sterility of glp-1(ar202): L1 hermaphrodites were fed RNAi containing bacte- ria at 25.0 ºC. Three plates per RNAi clones were scored for the number of eggs and oocytes produced. Shown in the graph are the top three hits of the RNAi screen. Clones H17B01.1 and C42C1.15 show suppression of glp-1(ar202) above background. Each plate was scored as fol- lows: (-) 1-25 eggs on a plate; (+) 26-50 eggs on a plate; (++) 51-100 eggs on a plate; (+++) >100 eggs on a plate. 110
A. B. 80 Emb 100 70 Lag 80 60 50 60 40 40 30 Percent Lag Percent Lag 20 20 10 0 0 lag-2(q420) eri-1(mg366); rrf-3(pk1426); lag-2(q420); pFV mCherry GFP Sup-17 Lag-1 Lag-2 lag-2(q420) lag-2(q420) nre-1(hd20) lin-15b(hd159) RNAi Clone Genotype
GFP RNAi Sup-17 RNAi Lag-2 RNAi
C. 100100.0% % 9090.0% % 8080.0% % 7070.0% %
6060.0% % * * 5050.0% % * * # 4040.0% % † 3030.0% %
display the Lag phenotype 2020.0% % Percent of hatched animals that 1010.0% %
0.0%0 % pFV mCherry lag-1 lag-2lag-2 sel-12sel-12 hop-1hop-1 C42C1.15erl-1 H17B01.1H17B01.1 F53H8.3F53H8.3 R09B5.11R09B5.11 RNAi Clone
rrf-3(pk1426) rrf-3(pk1426); lag-2(q420)
D. 100 %100%
90 %90%
80 %80%
70 %70%
60 %60%
50 %50%
40 %40%
30 %30%
display the Lag phenotype 20 %20% Percent of hatched animals that 10 %10%
0 %0% erl-1(tm2703) lag-2(q420) lag-2(q420); erl-1(tm2703)
15°C 20°C 25°C 111
Figure 1: Enhancement of lag-2(q420).
A.) Enhancement of lag-2(q420): L4 hermaphrodites were fed RNAi containing bacteria at 15.0 ºC. The number of progeny displaying the Lag phenotype were scored for each clone (n>300). Clones that showed suppression of glp-1(ar202) above background as well as paralogues for those clones.
B.) Enhancement of lag-2(q420) in RNAi sensitizer backgrounds. L4 hermaphrodites were fed RNAi containing bacteria at 15.0 ºC. The number of progeny displaying the Lag phenotype were scored for each clone (n>300).
C.) Enhancement of lag-2(q420): L4 hermaphrodites were fed RNAi containing bacteria at 15.0 ºC. The number of progeny displaying the Lag phenotype were scored for each clone (n>300). Clones that showed suppression of glp-1(ar202) above background as well as paralogues for those clones.
D.) erl-1(tm2703) does not enhance lag-2(q420): L4 hermaphrodites were placed on plates on pre-calibrated at 15 °C, 20 °C and 25 °C. The number of progeny displaying the Lag phenotype were scored for each genotypes. 112
Table 4: Background suppression of glp-1(ar202). Percent Average Strain Genotype Fertilitya Brood-Sizeb GC143 glp-1(ar202) 1/344 (0.4 %) 0.0 ±0.16 GS5680c glp-1(ar202); him-5(e1490) 18/111 (16.2 %) 1.4 ±0.47 GS6212d glp-1(ar202) 42/118 (35.6 %) 2.5 ±0.40 GS6213d glp-1(ar202) 35/119 (29.4 %) 2.0 ±0.39 GS6214d glp-1(ar202) 38/117 (32.5 %) 2.2 ±0.45 GS6215d glp-1(ar202) 35/120 (29.2 %) 1.4 ±0.26 a Percent fertility scored at 25.1°C. Fertility scored as the presence of larvae, eggs or oocytes. b Number of larvae, eggs or oocytes laid. The number of parents scored is indicated in the percent fertility column. c Strain GS5680 was used in the construction of all glp-1(ar202) containing strains. d These glp-1(ar202) strains are derived from glp-1(ar202); him-5(e1490), strain: GS5680; and have been outcrossed to rhIs4 strain, GS4691. 113
Table 5: Suppression of glp-1(ar202). Percent Average Genotype Fertilitya Brood-Sizeb glp-1(ar202)c 38/117 (32.5 %) 2.2 ±0.45 sup-17(n1258); glp-1(ar202) 71/85 (83.5 %)# NDd glp-1(ar202); adm-4(ok265) 56/59 (94.9 %)# NDd glp-1(ar202); sel-12(ok2078)e 6/36 (16.7 %) 1.1 ±0.49 hop-1(ar179); glp-1(ar202) 4/25 (16.0 %) 0.9 ±0.61f glp-1(ar202); erl-1(tm2703) 30/58 (51.7 %)* 5.7 ±1.23 # H17B01.1(tm3165); glp-1(ar202) 33/57 (57.9 %)# 6.3 ±1.36# glp-1(ar202); R09B5.11(ok1759) 16/53 (30.2 %) 3.1 ±1.04* glp-1(ar202); F53H8.3(ok3175) 4/56 (7.1 %)# 0.4 ±0.28 H17B01.1(tm3165); glp-1(ar202); 32/59 (54.2 %)* 3.8 ±0.62* R09B05.11(ok1759); F53H8.3(ok3175) cdc-48.1(tm544); glp-1(ar202) 38/60 (63.3 %)# 5.2 ±1.05# cdc-48.2(tm659); glp-1(ar202) 13/59 (22.0 %) 0.9 ±0.27 glp-1(ar202); atgp-1(ok388) 20/60 (33.3 %) 2.2 ±0.64 atgp-2(ok532); glp-1(ar202) 20/60 (33.3 %) 2.1 ±0.68 rab-11.2(tm2081); glp-1(ar202) 14/60 (23.3 %) 1.1 ±0.28 gpa-16(it143); glp-1(ar202) 22/59 (37.3 %) 2.1 ±0.57 glp-1(ar202); gpa-4(pk381) ND ND goa-1(n363); glp-1(ar202) 52/60 (86.7 %)# 12.9 ±1.70# glp-1(ar202); tsp-9(tm378) 17/60 (28.3 %) 2.4 ±0.61 glp-1(ar202); bar-1(ga80) 4/59 (6.8 %)# 1.1 ±0.78 glp-1(ar202); hmp-1(fe4) ND ND glp-1(ar202); sec-22(ok3053) 24/39 (61.5%)# 9.6 ±2.29# a Percent fertility scored at 25.1 °C. Fertility scored as the presence of larvae, eggs or oocytes. A two-tailed fisher’s exact test was done comparing to strain GS6214,glp-1(ar202). Key for statis- tical test: * p<0.05; # p<0.00227 (Bonferroni correction for significance).
b Number of larvae, eggs or oocytes laid. The number of parents scored is indicated in the per- cent fertility column. Student’s t-test was performed to ascertain statistical significance. Key for statistical test: * p<0.05; # p<0.00227 (Bonferroni correction for significance).
c Representative glp-1(ar202) strain, GS6214, that has been outcrossed to rhIs4 strain, GS4691, twice.
d 10 out 20 suppressed sup-17(n1258); glp-1(ar202) animals were Egl. Many of the suppressed glp-1(ar202); adm-4(ok265) hermaphrodites were Egl. Average brood-sizes were not scored for these two strains.
e The sel-12(ok2078) allele is a 1.5 kb deletion which removes part of the second exon and exons 3-6.
f 1 out 4 hop-1(ar179); glp-1(ar202) suppressed animals was Egl. 114
Table 6: RNAi for positive regulators of Notch/GLP-1 in C. elegans.
RNAi clone Plate 1 Plate 2 Plate 3 Plate 4 Plate 5 GFP + + - - - sup-17 +++ +++ ++ ++ ++ glp-1 +++ +++ +++ +++ +++ erl-1 +++ ++ ++ + + H17B01.1 ++ ++ ++ ++ ++ cdc-48.1 ++ ++ + + - sec-22 +++ + + - - goa-1 ++ + + - -
Suppression of sterility of glp-1(ar202): L1 hermaphrodites were fed RNAi containing bacteria at 25.1 ºC. Five plates per RNAi clones were scored for the number of eggs and oocytes pro- duced. Each plate was scored as follows: (-) 1-25 eggs on a plate; (+) 26-50 eggs on a plate; (++) 51-100 eggs on a plate; (+++) >100 eggs on a plate. 115
Table 7: Enhancement of glp-1(bn18). Percent Percent Genotype Sterilitya Embb glp-1(bn18)c 4/40 (10.0 %) N D glp-1(bn18)d 5/239 (1.6 %) 54/1053 (5.1%) glp-1(bn18); sup-17(n1258) 0/50 (0.0 %) 52/616 (8.4 %)* glp-1(bn18); adm-4(ok265) 1/50 (2.0 %) 27/484 (5.6 %) glp-1(bn18); sel-12(ok2078) 2/49 (4.1 %) 37/356 (10.4 %) hop-1(ar179); glp-1(bn18) 40/99 (40.4 %)# 110/397 (23.8 %)# glp-1(bn18); erl-1(tm2703) 2/49 (4.1 %) 20/526 (3.8 %) H17B01.1(tm3165); glp-1(bn18) 3/50 (6.0 %) 88/1120 (7.9 %) glp-1(bn18); R09B5.11(ok1759) 0/49 (0.0 %) 56/246 (22.8 %)# glp-1(bn18); F53H8.3(ok3175) 1/35 (2.9 %) 27/240 (11.3 %)# H17B01.1(tm3165); glp-1(bn18); R09B05.11(ok1759); F53H8.3(ok3175) 1/50 (2.0 %) 74/1018 (7.3 %) cdc-48.1(tm544); glp-1(bn18) 0/50 (0.0%) 29/428 (6.8 %) cdc-48.2(tm659); glp-1(bn18) 0/50 (0.0 %) 11/481 (2.3 %) glp-1(bn18); atgp-1(ok388) 3/50 (6.0 %) 37/419 (8.8 %) atgp-2(ok532); glp-1(bn18) 3/50 (6.0 %) 22/453 (4.9 %) rab-11.2(tm2081); glp-1(bn18) 1/50 (2.0 %) 42/474 (8.9%) gpa-16(it143); glp-1(bn18) 1/50 (2.0 %) 72/422 (17.1%)# glp-1(bn18); gpa-4(pk381) ND ND goa-1(n363); glp-1(bn18) 5/50 (10 %)* 232/925 (25.1%)# glp-1(bn18); tsp-9(tm378) 0/50 (0.0 %) 51/618 (8.3 %) glp-1(bn18); bar-1(ga80) 4/46 (8.0 %)* 28/450 (6.2 %) glp-1(bn18); hmp-1(fe4) ND ND glp-1(bn18); sec-22(ok3053) 0/50 (0.0 %) 22/400 (5.5 %) a Percent sterility scored at 20 °C. Fertility scored as the presence of larvae, eggs or oocytes. A two-tailed fisher’s exact test was done comparing to strain GS6232,glp-1(bn18). Key for statisti- cal test: * p<0.05; # p<0.00227 (Bonferroni correction for significance).
b Emb phenotype score at 20 °C. L4 larvae were placed at 20 °C for 1 day, then transferred for to fresh plates. Emb, Lvl and Viable animals were scored after 2 days at 20 °C. A two-tailed fisher’s exact test was done comparing to strain GS6232, glp-1(bn18). Key for statistical test: * p<0.05; # p<0.00227 (Bonferroni correction for significance).
c Strain GC388, glp-1(bn18).
d Strain GS6232, glp-1(bn18), that has been outcrossed to rhIs4 strain, GS4691, twice. 116
Table 8: Background Embryonic Lethality at 20 °C Percent Strain Genotype Emba GS4691 rhIs4 30/540 (5.6 %) GS6179 H17B01.1(tm3165); rhIs4s 61/976 (6.3 %) GS6177 rhIs4; R09B5.11(ok1759) 42/675 (6.2 %) GS6178 rhIs4; F53H8.3(ok3175) 53/880 (6.0 %) GS6181 H17B01.1(tm3165); rhIs4; R09B05.11(ok1759); F53H8.3(ok3175) 65/874 (7.4 %) GS6061 rhIs4; atgp-1(ok388) 35/377 (9.3 %) GS6063 rab-11.2(tm2081); rhIs4 78/854 (9.1 %) GS6192 gpa-16(it143); rhIs4 60/820 (7.3 %) GS6193 goa-1(n363); rhIs4 25/350 (7.1 %) GS5814 rhIs4; tsp-9(tm378) 63/541 (11.6 %) a Emb phenotype score at 20 °C. L4 larvae were placed at 20 °C for 1 day, then transferred for to fresh plates. Emb, Lvl and Viable animals were scored after 2 days at 20 °C. 117
Table 9: Suppression of glp-1(bn18). Percent Percent Genotype Fertilitya Viabilityb glp-1(bn18)c 74/144 (48.6 %) 3/265 (1.13 %) glp-1(bn18); sel-10(ok1632) ND 15/159 (9.43 %)# glp-1(bn18); erl-1(tm2703) 17/35 (48.6 %) 0/283 (0.00 %) H17B01.1(tm3165); glp-1(bn18) 18/36 (50.0 %) 0/256 (0.00 %) glp-1(bn18); R09B5.11(ok1759) 12/35 (34.3 %) 6/102 (5.88 %)* glp-1(bn18); F53H8.3(ok3175) 10/36 (27.8 %) 2/175 (1.14 %) H17B01.1(tm3165); glp-1(bn18); R09B05.11(ok1759); F53H8.3(ok3175) 14/36 (38.9 %) 1/264 (0.38 %) cdc-48.1(tm544); glp-1(bn18) 14/35 (40.0 %) 0/169 (0.00 %) cdc-48.2(tm659); glp-1(bn18) 18/36 (50.0 %) 1/170 (0.59 %) glp-1(bn18); atgp-1(ok388) 7/36 (19.4 %)# 1/227 (0.44 %) atgp-2(ok532); glp-1(bn18) 13/36 (36.1 %) 1/189 (0.53 %) rab-11.2(tm2081); glp-1(bn18) 11/35 (31.4 %) 150/245 (61.22 %)# gpa-16(it143); glp-1(bn18) 9/36 (25.0 %)* 0/193 (0.00 %) glp-1(bn18); gpa-4(pk381) ND ND goa-1(n363); glp-1(bn18) 8/36 (22.2 %)* 0/275 (0.00 %) glp-1(bn18); tsp-9(tm378) 8/36 (22.2 %)* 1/227 (0.44 %) glp-1(bn18); bar-1(ga80) ND ND glp-1(bn18); hmp-1(fe4) ND ND glp-1(bn18); sec-22(ok3053) 12/33 (36.4 %) 0/192 (0.0 %) a Percent sterility scored at 23.0 °C. Fertility scored as the presence of larvae, eggs or oocytes. A two-tailed fisher’s exact test was done comparing to strain GS6232,glp-1(bn18). Key for statisti- cal test: * p<0.05; # p<0.00263 (Bonferroni correction for significance due to multiple testing).
b Emb phenotype score at 23.0 °C. L4 larvae were placed at 23.0 °C for 1 day, then transferred for to fresh plates. Emb, Lvl and Viable animals were scored after 2 days at 23.0 °C. A two-tailed fisher’s exact test was done comparing to strain GS6232,glp-1(bn18). Key for statistical test: * p<0.05; # p<0.00263 (Bonferroni correction for significance due to multiple testing). 118
Table 10: Summary of results and comparison with Wakabayashi List. APP processing Notch output M. musculus C. elegans Genetic analysis RNAi result glp-1(ar202) glp-1(bn18) H17B01.1 decrease 0 GLUT1 increase F53H8.3 0 0 R09B5.11 0 decrease cdc-48.1 decrease 0 VPC/p97 increase cdc-48.2 0 0 SEC22 decrease sec-22 decrease 0 rab-11.1 NA NA Rab-11a decrease rab-11.2 0 increase Erlin NA erl-1 decrease 0 GNAO1 NA goa-1 decrease decrease CD9 decrease tsp-9 0 0 CD81 decrease atgp-1 0 0 CD98hc decrease atgp-2 0 0 Plp2 increase K09G1.1a NA NA B0513.9b NA NA Vamp8 decrease Y692AR.6 NA NA p24a decrease sel-9 NA NA EWI-F decrease NA NA NA EWI-2 decrease NA NA NA MYADM decrease NA NA NA 119
Chapter 4: General Discussion. 120
Summary:
In this thesis I describe two separate projects. In Chapter 2, I describe an attempt to use φC31 integrase to insert transgenes in the C. elegans genome. Discussion of this technique is contained within Chapter 2. In brief, I showed that φC31 is active in C. elegans somatic cells. I also show that RMCE using injected φC31 mRNA is rare in the germline. I will briefly comment on the potential importance of this method and how it can be improved in this Chapter.
In Chapter 3, I use genetic analysis to test many genes that were reported to be associated with the γ-secretase complex in a mammalian tissue culture system as to whether they modulate Notch in C. elegans (Wakabayashi et al. 2009). I have identified several genes that suppress a glp-1(gf) allele and one gene that suppresses a glp-1(lf) allele.
In this Chapter, I discuss why these genes are unlikely to be core components of
Notch signaling. I also discuss some of the questions that arose in the course of conducting experiments on the Wakabayashi list. These issues include genetic background, allele specificity and soma-to-germline interactions. Finally, I discuss what experiments could be done to screen for novel modulators of Presenilin.
Discussion: φC31 potential uses and future prospects:
Even though I have not had much success with φC31 integration, I believe it is still important to pursue the method as means to achieve single copy insertion. In Chapter 121
2, I show that φC31 integrase is active in C. elegans. I also have been able to achieve
integration into the genome using φC31 integrase via mRNA germline injections. The
issue now is one of optimizing the method to make it a viable alternative to MosSCI,
which has an integration efficiency of around 10 percent (Frøkjaer-Jensen et al. 2008). In
order to have high integration efficiency I have attempted to integrate a germline
expressing φC31 transgene using MosSCI. I have not been able to test whether this can
increase φC31 mediated integration efficiency to a suitable level. It is important to test
these strains in order to determine whether this method is viable.
It might be that φC31 cannot mediate integration of transgenes into the genome at a frequency that would make it attractive for use in C. elegans. In this case, φC31 could be used in a similar fashion to Flp/FRT and like the Flp/FRT method it could be used to manipulate transgenes in vivo. For example, one could mark cell lineages by expressing
φC31 from a transiently expressing promoter, causing expression of a marker of choice.
This marker of choice could be a fluorescent protein or one could misexpress a gene throughout a lineage as well to study gene function. Perhaps a more useful technique would be to conditionally knockout out an essential gene to study its role in developmental processes.
Genetics and potential issues:
The work in Chapter 3 highlights some issues with genetic analysis. Careful
consideration of genetic background is important in determining the extent of genetic
interactions uncovered. In the case of the work presented in Chapter 3, outcrossing the
original glp-1(ar202) strain into a new genetic background, which was similar to the
genetic background used in the double mutant strains, resulted in an increase in the 122
percentage of hermaphrodites that were scored as fertile compared to the original glp-
1(ar202) strain (see Chapter 3, table 4). The effect of genetic background is also seen in the glp-1(bn18) assay, where the level of sterility of the original glp-1(bn18) strain is higher than the out-crossed glp-1(bn18) strain at the non-permissive temperature (see
Chapter 3, Table 5).
There are two possible explanations for these observations. It is possible that there is a mutation in a positive regulator of Notch in the original glp-1(ar202) and glp-1(bn18) strains, which was removed during strain construction. Another possibility is that there is a mutation in a negative regulator of glp-1 introduced during construction of the rhIs4 strains that confers a mild effect on glp-1 phenotypes. As the glp-1(ar202) and glp-
1(bn18) alleles were isolated in different laboratories, it is more probable that the modifier is coming from the rhIs4 strains. There was no attempt to isolate the potential modifier of glp-1.
Difference in assay types:
In wild-type animals, the site of action of glp-1 is in the distal germline to maintain a population of mitotic germ cells. The proximal tumor in glp-1(ar202) is maintained throughout development due to the expression of DSL ligands proximally, first lag-2 in the AC, and then apx-1 and arg-1 in the sheath cell (Pepper, Killian &
Hubbard 2003b; McGovern et al. 2009). In some glp-1(ar202) animals with proximal tumors, oogenesis can still occur normally, although oocytes appear to be blocked by the proximal tumor from further development (Pepper, Killian & Hubbard 2003b). As the glp-1(ar202) suppression assay was based on the ability of the animal to produce eggs, it is a proxy for measuring proximal tumor formation or severity. The proximal tumor is in 123
a different environment than the distal proliferating cells, as the proximal tumor is surrounded by sheath cells and exposed to potential signaling molecules from the sheath cells; thus it is possible that the glp-1(ar202) assay used in this work would uncover genes not normally involved in the glp-1 mediated maintenance of the distal mitotic zone.
Instead, it could uncover genes involved in the maintenance of the proximal tumor, which might involve the communication between the sheath cell and the proximal tumor (see
Chapter 3 Discussion, and below). Although, it must be noted that this assay has been successful at uncovering Notch modulators (Jarriault & Greenwald 2005; Dunn et al.
2010).
The differences in the assay might contribute to a different outcome in the screen.
For example glp-1(ar202) assay depends on the ability to lay eggs: the proximal tumor impedes oogenesis progression. I have not measured the degree of suppression of the proximal tumor, which might be a better assessment of Notch suppression (Pepper,
Killian & Hubbard 2003b). I also did not measure the effects of mutations on the extent of distal germline proliferation, which would be easier to compare with glp-1(bn18) loss- of-function assays.
In the glp-1(bn18) loss-of-function assays we measured an all-or-nothing response. Any subtle defects in germline proliferation would have been missed. A more careful assessment of germline proliferation could be done by either measuring the number of progeny laid per animal or by measuring the extent of germline proliferation in the distal mitotic zone (Pepper, Killian & Hubbard 2003b; Tian et al. 2004).
124
Differences in alleles:
The two glp-1 alleles used to test the various genes from the Wakabayashi list, have different biochemical and genetic properties, which could have a differential effect on the result of each assay.
The glp-1(ar202) allele is a gain-of-function point mutation in the first Lin-
12/Notch Repeat (LNR) domain in the extracellular domain. As the LNR repeats are thought to shield the S2 cleavage site from the metalloproteases, mutations in these domains destabilize the LNR domains allowing access to the S2 cleavage site by the metalloproteases, triggering the release of the NICD from the membrane (Sanchez-
Irizarry et al. 2004; Gordon et al. 2009). In fact, many dominant mutations in both glp-1 and lin-12 are found in the LNR repeats. These include: lin-12(n952), lin-12(n302), glp-
1(oz264), glp-1(oz274), glp-1(ar218) and finally glp-1(ar202) (Greenwald & Seydoux
1990; Kerins 2006; Pepper, Killian & Hubbard 2003b).
Mutations in the extracellular domain can elicit the unfolded protein response
(UPR) as it is likely that these mutations can lead to a malfolded extracellular domain.
One consequence of UPR, is the ER-associated degradation pathway (ERAD). Genes involved in the UPR and ERAD pathway have been uncovered in screens for suppressors and enhancers of lin-12, including sel-1 and sel-11 (Sundaram & Greenwald 1993; Grant
& Greenwald 1996; Choi et al. 2010). These two genes are capable of suppressing loss- of-function mutations in glp-1 when the mutation is in the extracellular domain but are not capable of suppressing intracellular mutations in glp-1 (Sundaram & Greenwald
1993). 125
The glp-1(bn18) mutation is an amino acid change A1034T in the ankyrin repeats of the intracellular domain. The ankyrin repeats mediates protein-protein contacts with the CSL protein LAG-1 and helps bind SEL-8 to form the tri-partite transcriptional complex. As the mutation is in the intracellular domain, it might not be subjected to UPR and ERAD. This might explain the different behavior of the mutants in the glp-1(ar202) assay and the glp-1(bn18) assay. However, it might be expected that a knockdown of a
UPR or ERAD pathway component would result in an enhancement of glp-1(ar202).
Thus, it is unlikely that the positive results in glp-1(ar202) suppression test are involved in UPR or ERAD as discussed in Chapter 3.
The glp-1(ar202) gain-of-function allele is somewhat independent of ligand activity for its germline phenotype as loss of ligand does not completely suppress the Pro phenotype. (Pepper, Killian & Hubbard 2003b; McGovern et al. 2009). On the other hand, the glp-1(bn18) loss-of-function allele is fully dependent on ligand activity as loss of DSL ligand’s ability to signal can have a dramatic impact on the Ste phenotype of glp-
1(bn18) (Tian et al. 2004).
A modulator of the Notch pathway would not be expected to be allele-specific: it should not differentiate between the different alleles, and should affect the allele specific phenotypes regardless of the nature of the allele. Thus, it is advantageous to test different alleles to determine the requirement of a gene for a pathway.
Soma-to-germline interactions:
Here, I discuss the various ways that the somatic gonad can affect the germline and how that might influence the interpretation of the results from the modulators of glp-
1(ar202) assay. 126
In the case of the distal germline, that signal is coming from the distal tip cell
(DTC). Ablation of the DTC results in the reduction of germline proliferation (Kimble &
White 1981). As discussed in Chapter 1, the DTC expresses the DSL gene lag-2 and signals to the glp-1 expressing distal germline to promote proliferation. Defects in the
DTC that might compromise LAG-2 function would be expected to enhance the loss-of- function glp-1(bn18) allele. As none of the glp-1(ar202) suppressors enhanced glp-
1(bn18) sterility, it is unlikely that they are involved with ligand function at the DTC.
Thus, it is possible that there are interactions between the proximal somatic gonad and the germline that is influencing glp-1(ar202) sterility.
An interaction between the proximal somatic gonad and the germline was first seen in lin-12(0) animals, where a population of germ cells remained mitotically proliferating at the proximal end of the germline (Seydoux et al. 1990). The proximal tumor phenotype of lin-12(0) is dependent on the presence of the AC (Seydoux et al.
1990). In a WT background, ablation of the somatic gonad except the AC leads to a Pro phenotype, phenocopying the lin-12(0) mutant animal. The Pro phenotype in these two cases was due to inappropriate contact between the DSL producing anchor cell (AC) and the proximal germline (Seydoux et al. 1990). In this case, the somatic gonad, including the SS lineage, is shielding the proximal germline from inappropriate activation of GLP-
1/Notch signaling by the AC. Furthermore, ablation of the AC can influence the timing of meiotic entry of the germline and can partially suppress the Pro phenotype of glp-
1(ar202) (Pepper, Lo, Killian, Hall, et al. 2003a). Due to the subtlety of effects on the germline by the AC, it is unlikely that the glp-1(ar202) suppressors are acting in the AC. 127
There is extensive signaling between the sheath cells/spermatheca and the germline. The sheath cells and the spermatheca arise from the SS cell; there are two SS cells per gonad arm (Chapter 1, figure 5). The proximal soma-to-germline interaction is more complicated as the ablation of the SS lineage results in several defects. Ablation of both SS cells at L2/L3 molt results in reduced germline proliferation and defects in the exit from the pachytene stage of meiotic prophase, while the ablation of one SS cell at
L2/L3 molt can result in the failure of ovulation of mature oocytes and feminization of the germline (McCarter et al. 1997).
Ablation experiments of the SS cells in a strain containing a constitutively active glp-1 allele, glp-1(oz112), suggests that either there is a signal emanating from the SS lineage that is independent of GLP-1 for germline proliferation or that the cells from the
SS lineage are providing nutrition to the germline to maintain proliferation (McCarter et al. 1997). In addition, the SS lineage is required for the Pro tumor phenotype of glp-
1(ar202): specifically the ablation of the proximal sheath/spermatheca can suppress the
Pro phenotype of glp-1(ar202) (Killian & Hubbard 2005). The DSL genes apx-1 and arg-
1 are expressed in the proximal sheath and spermatheca, thus it is possible that glp-
1(ar202) suppressors are having an effect on the ligand side of Notch signaling in the proximal sheath and/or spermatheca (Chapter 3, Discussion).
As I mention in the discussion section of Chapter 3, many of the positives are expressed in the proximal gonad, particularly the sheath cells and spermatheca. Thus these positives could be acting in ligand production or presentation of the ligand to the cell surface or sheath cell/spermatheca integrity and function. All of these could impact the extent of the proximal tumor, without affecting Notch signaling in the distal germline. 128
Assessing γ-secretase activity:
In Wakabayashi et al. a subset of the proteins identified by the TAP-tag purification method were screened for an effect on APP processing. Along with CD9,
CD81 and CD98hc a few others had an effect on APP processing by RNAi in their tissue culture system (Wakabayashi et al. 2009). There was significant overlap between the hits in the Wakabayashi et al. paper and the work presented in this chapter. However, several of the common hits have opposite effects from the genetic analysis done in Chapter 3
(Chapter 3, table 10).
The opposite effects between the two sets could be explained by the differences in the assays themselves. The RNAi assay in tissue culture is cell-autonomous and might truly reflect the association with presenilin or it might reflect the processing of APP itself. The glp-1 assays depend on coordinated signals within the developing and mature germline or in the embryo of C. elegans.
How might one design a better screen to uncover new modulators of presenilin activity in C. elegans? Forward genetic approaches such as the Sel, Aph and Pen screens have been quite successful in uncovering the components of the γ-secretase complex.
Perhaps, taking the Aph and Pen screens to saturation would allow for identification of other γ-secretase modulators.
A reverse genetic screen, which would rely on RNAi, could be done to screen for genes that are conserved between Humans and C. elegans that might modulate γ- secretase activity. This could be based on phenotypic screens such as the Aph or Glp screens or could be based on modifier screens such as the Sel or Pen screens. However, phenotypic screens have not been used as much in identifying Notch components, as 129
modifier screens have been more successful (see Chapter 1). By using a lin-12(d) allele or better yet, using a lin-12(ΔE) transgene expressed in the VPCs, where disruption of γ- secretase function would disrupt Notch signaling, a suppression screen might be preferable in identifying modulators of the γ-secretase complex. A sensitized background would need to be used to overcome the limitations of RNAi in the VPCs (Greenwald lab members, unpublished results).
As the germline is more amenable to RNAi than the VPCs, it might be worth designing a screen to take advantage of that. As overexpressing a constitutive active form of glp-1 in the germline causes tumors, one could make a conditional glp-1(ΔE) with a temperature-sensitive mutation in the intracellular domain such as glp-1(bn18) or glp-
1(e2144) and insert the glp-1 transgene in the germline using single copy insertion techniques such as MosSCI to allow for expression in the germline. These strains should be wild type at 25 °C but tumorous and sterile at 20 °C and 15 °C. RNAi could be used to suppress the sterility and tumors of the strain at the lower temperatures. As this transgene is ligand independent, one would not need to worry about affecting ligand production and function, though such a screen should also pick-up components downstream of the γ- secretase step in the Notch pathway. It might pick up other components required for the proliferation and maintenance of the germline as well. This would require further analysis to be sure that it is involved in Notch signal transduction and involved in γ-secretase activity.
Alternatively, one could design a fluorescent artificial γ-secretase substrate, such that when the substrate is cleaved, the intracellular domain translocates to the nucleus.
This would allow for a visual inspection of γ-secretase activity. Loss of γ-secretase 130
activity in this instance would be visualized by the retention of the fluorescent substrate at the cell surface. This of course assumes that fluorescent protein would be visible.
Perhaps, these screens would find additional γ-secretase components, which could be tested in mammalian cell lines for γ-secretase in Notch signaling and Aβ production.
These modulators could be target by drugs to disrupt γ-secretase activity to treat T-ALL patients or FAD patients.
131
References:
Abdus-Saboor, I. et al., 2011. Notch and Ras promote sequential steps of excretory tube development in C. elegans. Development (Cambridge, England), 138(16), pp.3545– 3555.
Ambros, V. & Horvitz, H.R., 1984. Heterochronic mutants of the nematode Caenorhabditis elegans. Science (New York, NY), 226(4673), pp.409–416.
Austin, J. & Kimble, J., 1987. glp-1 is required in the germ line for regulation of the decision between mitosis and meiosis in C. elegans. Cell, 51(4), pp.589–599.
Austin, J., Maine, E.M. & Kimble, J., 1989. Genetics of intercellular signalling in C. elegans. Development (Cambridge, England), 107 Suppl, pp.53–57.
Ballensiefen, W., Ossipov, D. & Schmitt, H.D., 1998. Recycling of the yeast v-SNARE Sec22p involves COPI-proteins and the ER transmembrane proteins Ufe1p and Sec20p. Journal of cell science, 111 ( Pt 11), pp.1507–1520.
Bateman, J.R. & Wu, C.-T., 2008. A simple polymerase chain reaction-based method for the construction of recombinase-mediated cassette exchange donor vectors. Genetics, 180(3), pp.1763–1766.
Bateman, J.R., Lee, A.M. & Wu, C.-T., 2006. Site-specific transformation of Drosophila via phiC31 integrase-mediated cassette exchange. Genetics, 173(2), pp.769–777.
Berry, L.W., Westlund, B. & Schedl, T., 1997. Germ-line tumor formation caused by activation of glp-1, a Caenorhabditis elegans member of the Notch family of receptors. Development (Cambridge, England), 124(4), pp.925–936.
Bessereau, J.L. et al., 2001. Mobilization of a Drosophila transposon in the Caenorhabditis elegans germ line. Nature, 413(6851), pp.70–74.
Berset, T. et al., 2001. Notch inhibition of RAS signaling through MAP kinase phosphatase LIP-1 during C. elegans vulval development. Science (New York, NY), 291(5506), pp.1055–1058.
Bischof, J. et al., 2007. An optimized transgenesis system for Drosophila using germ- line-specific phiC31 integrases. Proceedings of the National Academy of Sciences of the United States of America, 104(9), pp.3312–3317.
Blaumueller, C.M. et al., 1997. Intracellular cleavage of Notch leads to a heterodimeric receptor on the plasma membrane. Cell, 90(2), pp.281–291.
Bolten, S.L. et al., 1984. The sup-7(st5) X gene of Caenorhabditis elegans encodes a 132
tRNATrpUAG amber suppressor. Proceedings of the National Academy of Sciences of the United States of America, 81(21), pp.6784–6788.
Bray, S.J., 2006. Notch signalling: a simple pathway becomes complex. Nature reviews Molecular cell biology, 7(9), pp.678–689.
Brenner, S., 1974. The genetics of Caenorhabditis elegans. Genetics, 77(1), pp.71–94.
Brou, C. et al., 2000. A novel proteolytic cleavage involved in Notch signaling: the role of the disintegrin-metalloprotease TACE. Molecular cell, 5(2), pp.207–216.
Browman, D.T. et al., 2006. Erlin-1 and erlin-2 are novel members of the prohibitin family of proteins that define lipid-raft-like domains of the ER. Journal of cell science, 119(Pt 15), pp.3149–3160.
Cassada, R., Isnenghi, E. & Culotti, M., 1981. Genetic analysis of temperature-sensitive embryogenesis mutants in Caenorhabditis elegans. Developmental biology.
Chandu, D., Huppert, S.S. & Kopan, R., 2006. Analysis of transmembrane domain mutants is consistent with sequential cleavage of Notch by gamma-secretase. Journal of neurochemistry, 96(1), pp.228–235.
Chen, N. & Greenwald, I., 2004. The lateral signal for LIN-12/Notch in C. elegans vulval development comprises redundant secreted and transmembrane DSL proteins. Developmental cell, 6(2), pp.183–192.
Cheng, H., Govindan, J.A. & Greenstein, D., 2008. Regulated trafficking of the MSP/Eph receptor during oocyte meiotic maturation in C. elegans. Current biology : CB, 18(10), pp.705–714.
Choi, M.S., Yoo, A.S. & Greenwald, I., 2010. sel-11 and cdc-42, two negative modulators of LIN-12/Notch activity in C. elegans. PloS one, 5(7), p.e11885.
Choi, M.S., 2010. Genes that act in specification of the vulval secondary fate in Caenorhabditis elegans I. Greenwald, ed. New York, NY: Columbia University.
Christensen, S. et al., 1996. lag-1, a gene required for lin-12 and glp-1 signaling in Caenorhabditis elegans, is homologous to human CBF1 and Drosophila Su(H). Development (Cambridge, England), 122(5), pp.1373–1383.
Clark, S.G., Chisholm, A.D. & Horvitz, H.R., 1993. Control of cell fates in the central body region of C. elegans by the homeobox gene lin-39. Cell, 74(1), pp.43–55.
Confaloni, A. et al., 2003. Nicastrin gene in familial and sporadic Alzheimer's disease. Neuroscience letters, 353(1), pp.61–65.
Crittenden, S.L. et al., 2002. A conserved RNA-binding protein controls germline stem cells in Caenorhabditis elegans. Nature, 417(6889), pp.660–663. 133
Crittenden, S.L. et al., 1994. GLP-1 is localized to the mitotic region of the C. elegans germ line. Development (Cambridge, England), 120(10), pp.2901–2911.
D'Souza, B., Meloty-Kapella, L. & Weinmaster, G., 2010. Canonical and non-canonical Notch ligands. Current topics in developmental biology, 92, pp.73–129.
Davis, E.S. et al., 2002. Multiple subunits of the Caenorhabditis elegans anaphase- promoting complex are required for chromosome segregation during meiosis I. Genetics, 160(2), pp.805–813.
Davis, M.W. et al., 2008. Gene activation using FLP recombinase in C. elegans. PLoS genetics, 4(3), p.e1000028.
De Strooper, B. et al., 1998. Deficiency of presenilin-1 inhibits the normal cleavage of amyloid precursor protein. Nature, 391(6665), pp.387–390.
Donoviel, D.B. et al., 1999. Mice lacking both presenilin genes exhibit early embryonic patterning defects. Genes & development, 13(21), pp.2801–2810.
Dorer, M.S. et al., 2006. RNA interference analysis of Legionella in Drosophila cells: exploitation of early secretory apparatus dynamics. PLoS pathogens, 2(4), p.e34.
Dunn, C.D. et al., 2010. A conserved tetraspanin subfamily promotes Notch signaling in Caenorhabditis elegans and in human cells. PNAS, 107(13), pp.5907–5912.
Eckmann, C.R. et al., 2004. GLD-3 and control of the mitosis/meiosis decision in the germline of Caenorhabditis elegans. Genetics, 168(1), pp.147–160.
Edbauer, D. et al., 2003. Reconstitution of gamma-secretase activity. Nature Cell Biology, 5(5), pp.486–488.
Eisenmann, D.M. et al., 1998. The beta-catenin homolog BAR-1 and LET-60 Ras coordinately regulate the Hox gene lin-39 during Caenorhabditis elegans vulval development. Development (Cambridge, England), 125(18), pp.3667–3680.
Emery, G. et al., 2005. Asymmetric Rab 11 endosomes regulate delta recycling and specify cell fate in the Drosophila nervous system. Cell, 122(5), pp.763–773.
Etchberger, J.F. & Hobert, O., 2008. Vector-free DNA constructs improve transgene expression in C. elegans. Nature methods, 5(1), p.3.
Euling, S. & Ambros, V., 1996. Heterochronic genes control cell cycle progress and developmental competence of C. elegans vulva precursor cells. Cell, 84(5), pp.667– 676.
Evans, T.C. et al., 1994. Translational control of maternal glp-1 mRNA establishes an asymmetry in the C. elegans embryo. Cell, 77(2), pp.183–194. 134
Eve Gazave et al., 2009. Origin and evolution of the Notch signalling pathway: an overview from eukaryotic genomes. BMC Evolutionary Biology, 9, p.249.
Ferguson, E.L. & Horvitz, H.R., 1985. Identification and characterization of 22 genes that affect the vulval cell lineages of the nematode Caenorhabditis elegans. Genetics, 110(1), pp.17–72.
Ferguson, E.L., Sternberg, P.W. & Horvitz, H.R., 1987. A genetic pathway for the specification of the vulval cell lineages of Caenorhabditis elegans. Nature, 326(6110), pp.259–267.
Finney, M. & Ruvkun, G., 1990. The unc-86 gene product couples cell lineage and cell identity in C. elegans. Cell, 63(5), pp.895–905.
Fire, A., 1986. Integrative transformation of Caenorhabditis elegans. The EMBO Journal, 5(10), pp.2673–2680.
Fire, A. & Waterston, R.H., 1989. Proper expression of myosin genes in transgenic nematodes. The EMBO Journal, 8(11), pp.3419–3428.
Flicek, P. et al., 2011. Ensembl 2011. Nucleic acids research, 39(Database issue), pp.D800–6.
Francis, R. et al., 2002. aph-1 and pen-2 are required for Notch pathway signaling, gamma-secretase cleavage of betaAPP, and presenilin protein accumulation. Developmental cell, 3(1), pp.85–97.
Francis, R., Maine, E. & Schedl, T., 1995. Analysis of the multiple roles of gld-1 in germline development: interactions with the sex determination cascade and the glp-1 signaling pathway. Genetics, 139(2), pp.607–630.
Frøkjaer-Jensen, C. et al., 2012. Improved Mos1-mediated transgenesis in C. elegans. Nature methods, 9(2), pp.117–118.
Frøkjaer-Jensen, C. et al., 2008. Single-copy insertion of transgenes in Caenorhabditis elegans. Nature Genetics, 40(11), pp.1375–1383.
Fryer, C.J., White, J.B. & Jones, K.A., 2004. Mastermind Recruits CycC:CDK8 to Phosphorylate the Notch ICD and Coordinate Activation with Turnover. Molecular cell, 16(4), pp.509–520.
Giordano-Santini, R. et al., 2010. An antibiotic selection marker for nematode transgenesis. Nature methods, 7(9), pp.721–723.
Goate, A. et al., 1991. Segregation of a missense mutation in the amyloid precursor protein gene with familial Alzheimer's disease. Nature, 349(6311), pp.704–706.
Golic, K.G., 1991. Site-specific recombination between homologous chromosomes in 135
Drosophila. Science (New York, NY), 252(5008), pp.958–961.
Golic, K.G. & Lindquist, S., 1989. The FLP recombinase of yeast catalyzes site-specific recombination in the Drosophila genome. Cell, 59(3), pp.499–509.
Golden, A. et al., 2000. Metaphase to anaphase (mat) transition-defective mutants in Caenorhabditis elegans. The Journal of cell biology, 151(7), pp.1469–1482.
Gordon, W.R. et al., 2009. Structure of the Notch1-negative regulatory region: implications for normal activation and pathogenic signaling in T-ALL. Blood, 113(18), pp.4381–4390.
Goutte, C. et al., 2002. APH-1 is a multipass membrane protein essential for the Notch signaling pathway in Caenorhabditis elegans embryos. Proceedings of the National Academy of Sciences of the United States of America, 99(2), pp.775–779.
Goutte, C. et al., 2000. aph-2 encodes a novel extracellular protein required for GLP-1- mediated signaling. Development (Cambridge, England), 127(11), pp.2481–2492.
Govindan, J.A. et al., 2006. Galphao/i and Galphas signaling function in parallel with the MSP/Eph receptor to control meiotic diapause in C. elegans. Current biology : CB, 16(13), pp.1257–1268.
Grant, B. & Greenwald, I., 1996. The Caenorhabditis elegans sel-1 gene, a negative regulator of lin-12 and glp-1, encodes a predicted extracellular protein. Genetics, 143(1), pp.237–247.
Greenwald, I., 2005. LIN-12/Notch signaling in C. elegans. WormBook : the online review of C elegans biology, pp.1–16.
Greenwald, I. & Seydoux, G., 1990. Analysis of gain-of-function mutations of the lin-12 gene of Caenorhabditis elegans. Nature, 346(6280), pp.197–199.
Greenwald, I.S., Sternberg, P.W. & Horvitz, H.R., 1983. The lin-12 locus specifies cell fates in Caenorhabditis elegans. Cell, 34(2), pp.435–444.
Griffin, J.D. et al., 2000. MAML1, a human homologue of Drosophila Mastermind, is a transcriptional co-activator for NOTCH receptors. Nature Genetics, 26(4), pp.484– 489.
Groth, A.C. et al., 2000. A phage integrase directs efficient site-specific integration in human cells. Proceedings of the National Academy of Sciences of the United States of America, 97(11), pp.5995–6000.
Groth, A.C. et al., 2004. Construction of transgenic Drosophila by using the site-specific integrase from phage phiC31. Genetics, 166(4), pp.1775–1782.
Gu, H., Zou, Y.R. & Rajewsky, K., 1993. Independent control of immunoglobulin switch 136
recombination at individual switch regions evidenced through Cre-loxP-mediated gene targeting. Cell, 73(6), pp.1155–1164.
Haass, C. & De Strooper, B., 1999. The presenilins in Alzheimer's disease--proteolysis holds the key. Science (New York, NY), 286(5441), pp.916–919.
Hall, D.H. et al., 1999. Ultrastructural features of the adult hermaphrodite gonad of Caenorhabditis elegans: relations between the germ line and soma. Developmental biology, 212(1), pp.101–123.
Hansen, D. & Schedl, T., 2006. The regulatory network controlling the proliferation- meiotic entry decision in the Caenorhabditis elegans germ line. Current topics in developmental biology, 76, pp.185–215.
Hansen, D. et al., 2004. Control of the proliferation versus meiotic development decision in the C. elegans germline through regulation of GLD-1 protein accumulation. Development (Cambridge, England), 131(1), pp.93–104.
Heitzler, P. & Simpson, P., 1991. The choice of cell fate in the epidermis of Drosophila. Cell, 64(6), pp.1083–1092.
Heitzler, P. et al., 1996. Genes of the Enhancer of split and achaete-scute complexes are required for a regulatory loop between Notch and Delta during lateral signalling in Drosophila. Development (Cambridge, England), 122(1), pp.161–171.
Henderson, S.T. et al., 1994. lag-2 may encode a signaling ligand for the GLP-1 and LIN- 12 receptors of C. elegans. Development (Cambridge, England), 120(10), pp.2913– 2924.
Herreman, A. et al., 2003. gamma-Secretase activity requires the presenilin-dependent trafficking of nicastrin through the Golgi apparatus but not its complex glycosylation. Journal of cell science, 116(Pt 6), pp.1127–1136.
Herreman, A. et al., 1999. Presenilin 2 deficiency causes a mild pulmonary phenotype and no changes in amyloid precursor protein processing but enhances the embryonic lethal phenotype of presenilin 1 deficiency. Proceedings of the National Academy of Sciences of the United States of America, 96(21), pp.11872–11877.
Hill, R.J. & Sternberg, P.W., 1992. The gene lin-3 encodes an inductive signal for vulval development in C. elegans. Nature, 358(6386), pp.470–476.
Hoegg, M.B., 2010. Structural and Functional Characterization of the Endoplasmic Reticulum Lipid Raft-Associated Proteins (Erlins) S. Robbins, ed. Calgary, Alberta, Canada: University of Calgary.
Horvitz, H.R. & Sulston, J.E., 1980. Isolation and genetic characterization of cell-lineage mutants of the nematode Caenorhabditis elegans. Genetics, 96(2), pp.435–454. 137
Hutter, H. & Schnabel, R., 1994. glp-1 and inductions establishing embryonic axes in C. elegans. Development (Cambridge, England), 120(7), pp.2051–2064.
Jaekel, R. & Klein, T., 2006. The Drosophila Notch Inhibitor and Tumor Suppressor Gene lethal (2) giant discs Encodes a Conserved Regulator of Endosomal Trafficking. Developmental cell, 11(5), pp.655–669.
Jarriault, S. et al., 1995. Signalling downstream of activated mammalian Notch. Nature, 377(6547), pp.355–358.
Jarriault, S. & Greenwald, I., 2005. Evidence for functional redundancy between C. elegans ADAM proteins SUP-17/Kuzbanian and ADM-4/TACE. Developmental biology, 287(1), pp.1–10.
Johnston, J.A., Ward, C.L. & Kopito, R.R., 1998. Aggresomes: a cellular response to misfolded proteins. The Journal of cell biology, 143(7), pp.1883–1898.
Jorissen, E. & Strooper, B.D., 2010. gamma-Secretase and the Intramembrane Proteolysis of Notch. Current topics in developmental biology, 92C, pp.201–230.
Kadyk, L.C. & Kimble, J., 1998. Genetic regulation of entry into meiosis in Caenorhabditis elegans. Development (Cambridge, England), 125(10), pp.1803–1813.
Kamath, R.S. & Ahringer, J., 2003. Genome-wide RNAi screening in Caenorhabditis elegans. Methods (San Diego, Calif.), 30(4), pp.313–321.
Kang, J. et al., 1987. The precursor of Alzheimer's disease amyloid A4 protein resembles a cell-surface receptor. Nature, 325(6106), pp.733–736.
Karp, X., 2004. Roles and regulation of hlh-2 in the AC/VU decision in C. elegans I. Greenwald, ed. New York: Columbia University.
Karp, X. & Greenwald, I., 2004. Multiple roles for the E/Daughterless ortholog HLH-2 during C. elegans gonadogenesis. Developmental biology, 272(2), pp.460–469.
Karp, X. & Greenwald, I., 2003. Post-transcriptional regulation of the E/Daughterless ortholog HLH-2, negative feedback, and birth order bias during the AC/VU decision in C. elegans. Genes & development, 17(24), pp.3100–3111.
Katic, I., Vallier, L.G. & Greenwald, I., 2005. New positive regulators of lin-12 activity in Caenorhabditis elegans include the BRE-5/Brainiac glycosphingolipid biosynthesis enzyme. Genetics, 171(4), pp.1605–1615.
Kehoe, P. et al., 1999. A full genome scan for late onset Alzheimer's disease. Human molecular genetics, 8(2), pp.237–245.
Kelly, W.G. & Fire, A., 1998. Chromatin silencing and the maintenance of a functional germline in Caenorhabditis elegans. Development (Cambridge, England), 125(13), 138
pp.2451–2456.
Kelly, W.G. et al., 1997. Distinct requirements for somatic and germline expression of a generally expressed Caernorhabditis elegans gene. Genetics, 146(1), pp.227–238.
Kerins, J.A., 2006. PRP-17 and pre-mRNA splicing pathway are preferentially required for the proliferation versus meiotic development decision and germline sex determination in Caernorhabditis elegans T. Scheld, ed. Saint Louis, Missouri: Washington University.
Khaleel, T. et al., 2011. A phage protein that binds φC31 integrase to switch its directionality. Molecular microbiology, 80(6), pp.1450–1463.
Kidd, S., 2002. Furin cleavage is not a requirement for Drosophila Notch function. Mechanisms of development, 115(1-2), pp.41–51.
Killian, D.J. & Hubbard, E.J.A., 2005. Caenorhabditis elegans germline patterning requires coordinated development of the somatic gonadal sheath and the germ line. Developmental biology, 279(2), pp.322–335.
Kimberly, W.T. et al., 2003. Gamma-secretase is a membrane protein complex comprised of presenilin, nicastrin, Aph-1, and Pen-2. Proceedings of the National Academy of Sciences of the United States of America, 100(11), pp.6382–6387.
Kimble, J., 1981. Alterations in cell lineage following laser ablation of cells in the somatic gonad of Caenorhabditis elegans. Developmental biology, 87(2), pp.286–300.
Kimble, J. & Crittenden, S.L., 2005. Germline proliferation and its control. WormBook : the online review of C elegans biology, pp.1–14.
Kimble, J. & Hirsh, D., 1979. The postembryonic cell lineages of the hermaphrodite and male gonads in Caenorhabditis elegans. Developmental biology, 70(2), pp.396–417.
Kimble, J.E. & White, J.G., 1981. On the control of germ cell development in Caenorhabditis elegans. Developmental biology, 81(2), pp.208–219.
Kodoyianni, V., Maine, E.M. & Kimble, J., 1992. Molecular basis of loss-of-function mutations in the glp-1 gene of Caenorhabditis elegans. Molecular biology of the cell, 3(11), pp.1199–1213.
Lambie, E.J. & Kimble, J., 1991. Two homologous regulatory genes, lin-12 and glp-1, have overlapping functions. Development (Cambridge, England), 112(1), pp.231– 240.
Lamont, L.B. et al., 2004. FBF-1 and FBF-2 regulate the size of the mitotic region in the C. elegans germline. Developmental cell, 7(5), pp.697–707.
Levitan, D. & Greenwald, I., 1995. Facilitation of lin-12-mediated signalling by sel-12, a 139
Caenorhabditis elegans S182 Alzheimer's disease gene. Nature, 377(6547), pp.351– 354.
Levitan, D. & Greenwald, I., 1998. LIN-12 protein expression and localization during vulval development in C. elegans. Development (Cambridge, England), 125(16), pp.3101–3109.
Levitan, D. et al., 2001. APH-2/nicastrin functions in LIN-12/Notch signaling in the Caenorhabditis elegans somatic gonad. Developmental biology, 240(2), pp.654–661.
Li, H. et al., 2006. TreeFam: a curated database of phylogenetic trees of animal gene families. Nucleic acids research, 34(Database issue), pp.D572–80.
Li, J. & Greenwald, I., 2010. LIN-14 inhibition of LIN-12 contributes to precision and timing of C. elegans vulval fate patterning. Current biology : CB, 20(20), pp.1875– 1879.
Li, T. et al., 2003. Nicastrin is required for assembly of presenilin/gamma-secretase complexes to mediate Notch signaling and for processing and trafficking of beta- amyloid precursor protein in mammals. The Journal of neuroscience : the official journal of the Society for Neuroscience, 23(8), pp.3272–3277.
Li, X. & Greenwald, I., 1997. HOP-1, a Caenorhabditis elegans presenilin, appears to be functionally redundant with SEL-12 presenilin and to facilitate LIN-12 and GLP-1 signaling. Proceedings of the National Academy of Sciences of the United States of America, 94(22), pp.12204–12209.
Lingwood, D. & Simons, K., 2010. Lipid rafts as a membrane-organizing principle. Science (New York, NY), 327(5961), pp.46–50.
Lints, R. & Hall, D.H., 2009. Reproductive System - Germline. WormAtlas. Available at: http://www.wormatlas.org/hermaphrodite/germ%20line/Germframeset.html [Accessed 2011].
Liu, Y. & Barlowe, C., 2002. Analysis of Sec22p in endoplasmic reticulum/Golgi transport reveals cellular redundancy in SNARE protein function. Molecular biology of the cell, 13(9), pp.3314–3324.
Liu, Y. & Maine, E.M., 2007. The Bro1-Domain Protein, EGO-2, Promotes Notch Signaling in Caenorhabditis elegans. Genetics, 176(4), pp.2265–2277.
Logeat, F. et al., 1998. The Notch1 receptor is cleaved constitutively by a furin-like convertase. Proceedings of the National Academy of Sciences of the United States of America, 95(14), pp.8108–8112.
Ma, G. et al., 2005. APH-1a is the principal mammalian APH-1 isoform present in gamma-secretase complexes during embryonic development. The Journal of neuroscience : the official journal of the Society for Neuroscience, 25(1), pp.192–198. 140
Maine, E.M. & Kimble, J., 1993. Suppressors of glp-1, a gene required for cell communication during development in Caenorhabditis elegans, define a set of interacting genes. Genetics, 135(4), pp.1011–1022.
Maine, E.M. et al., 2005. EGO-1, a putative RNA-dependent RNA polymerase, is required for heterochromatin assembly on unpaired dna during C. elegans meiosis. Current biology : CB, 15(21), pp.1972–1978.
Maloof, J.N. & Kenyon, C., 1998. The Hox gene lin-39 is required during C. elegans vulval induction to select the outcome of Ras signaling. Development (Cambridge, England), 125(2), pp.181–190.
Mango, S.E. et al., 1994. Two maternal genes, apx-1 and pie-1, are required to distinguish the fates of equivalent blastomeres in the early Caenorhabditis elegans embryo. Development (Cambridge, England), 120(8), pp.2305–2315.
Mano, I., Straud, S. & Driscoll, M., 2007. Caenorhabditis elegans glutamate transporters influence synaptic function and behavior at sites distant from the synapse. The Journal of biological chemistry, 282(47), pp.34412–34419.
Mantina, P. et al., 2009. A mutation in teg-4, which encodes a protein homologous to the SAP130 pre-mRNA splicing factor, disrupts the balance between proliferation and differentiation in the C. elegans germ line. Mechanisms of development, 126(5-6), pp.417–429.
Marin, V.A. & Evans, T.C., 2003. Translational repression of a C. elegans Notch mRNA by the STAR/KH domain protein GLD-1. Development (Cambridge, England), 130(12), pp.2623–2632.
McCarter, J. et al., 1997. Soma-germ cell interactions in Caenorhabditis elegans: multiple events of hermaphrodite germline development require the somatic sheath and spermathecal lineages. Developmental biology, 181(2), pp.121–143.
McGovern, M. et al., 2009. A “latent niche” mechanism for tumor initiation. PNAS, 106(28), pp.11617–11622.
McNally, K. et al., 2006. Katanin controls mitotic and meiotic spindle length. The Journal of cell biology, 175(6), pp.881–891.
Mello, C.C. et al., 1991. Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences. The EMBO Journal, 10(12), pp.3959–3970.
Mello, C.C. et al., 1996. The PIE-1 protein and germline specification in C. elegans embryos. Nature, 382(6593), pp.710–712.
Mello, C.C., Draper, B.W. & Priess, J.R., 1994. The maternal genes apx-1 and glp-1 and establishment of dorsal-ventral polarity in the early C. elegans embryo. Cell, 77(1), 141
pp.95–106.
Mello, C.C. & Fire, A., 1995. DNA transformation. Methods in cell biology, 48, pp.451– 482.
Merritt, C. et al., 2008. 3′ UTRs Are the Primary Regulators of Gene Expression in the C. elegans Germline. Current Biology, 18(19), pp.1476–1482.
Mickey, K.M. et al., 1996. An inductive interaction in 4-cell stage C. elegans embryos involves APX-1 expression in the signalling cell. Development (Cambridge, England), 122(6), pp.1791–1798.
Moberg, K.H. et al., 2005. Mutations in erupted, the Drosophila ortholog of mammalian tumor susceptibility gene 101, elicit non-cell-autonomous overgrowth. Developmental cell, 9(5), pp.699–710.
Moskowitz, I.P. & Rothman, J.H., 1996. lin-12 and glp-1 are required zygotically for early embryonic cellular interactions and are regulated by maternal GLP-1 signaling in Caenorhabditis elegans. Development (Cambridge, England), 122(12), pp.4105– 4117.
Moskowitz, I.P., Gendreau, S.B. & Rothman, J.H., 1994. Combinatorial specification of blastomere identity by glp-1-dependent cellular interactions in the nematode Caenorhabditis elegans. Development (Cambridge, England), 120(11), pp.3325–3338.
Myers, T.R. & Greenwald, I., 2007. Wnt signal from multiple tissues and lin-3/EGF signal from the gonad maintain vulval precursor cell competence in Caenorhabditis elegans. PNAS, 104(51), pp.20368–20373.
Myers, T.R., 2007. Thinking outside the vulva: A non-vulval perspective on vulval development. I. Greenwald, ed. New York, NY: Columbia University.
Neves, A. & Priess, J.R., 2005. The REF-1 family of bHLH transcription factors pattern C. elegans embryos through Notch-dependent and Notch-independent pathways. Developmental cell, 8(6), pp.867–879.
Neves, S.R., Ram, P.T. & Iyengar, R., 2002. G protein pathways. Science (New York, NY), 296(5573), pp.1636–1639.
Okochi, M. et al., 2002. Presenilins mediate a dual intramembranous gamma-secretase cleavage of Notch-1. The EMBO Journal, 21(20), pp.5408–5416.
Orban, P.C., Chui, D. & Marth, J.D., 1992. Tissue- and site-specific DNA recombination in transgenic mice. Proceedings of the National Academy of Sciences of the United States of America, 89(15), pp.6861–6865.
Panin, V.M. et al., 2002. Notch ligands are substrates for protein O-fucosyltransferase-1 and Fringe. The Journal of biological chemistry, 277(33), pp.29945–29952. 142
Parks, A.L. & Curtis, D., 2007. Presenilin diversifies its portfolio. Trends in genetics : TIG, 23(3), pp.140–150.
Pearce, M.M.P. et al., 2007. SPFH2 mediates the endoplasmic reticulum-associated degradation of inositol 1,4,5-trisphosphate receptors and other substrates in mammalian cells. The Journal of biological chemistry, 282(28), pp.20104–20115.
Pepper, A.S.-R., Lo, T.W., Killian, D.J., Hall, D.H., et al., 2003a. The establishment of Caenorhabditis elegans germline pattern is controlled by overlapping proximal and distal somatic gonad signals. Developmental biology, 259(2), pp.336–350.
Pepper, A.S.-R., Killian, D.J. & Hubbard, E.J.A., 2003b. Genetic analysis of Caenorhabditis elegans glp-1 mutants suggests receptor interaction or competition. Genetics, 163(1), pp.115–132.
Petcherski, A.G. & Kimble, J., 2000. LAG-3 is a putative transcriptional activator in the C. elegans Notch pathway. Nature, 405(6784), pp.364–368.
Poole, R.J. & Hobert, O., 2006. Early embryonic programming of neuronal left/right asymmetry in C. elegans. Current biology : CB, 16(23), pp.2279–2292.
Praitis, V. et al., 2001. Creation of low-copy integrated transgenic lines in Caenorhabditis elegans. Genetics, 157(3), pp.1217–1226.
Priess, J.R., Schnabel, H. & Schnabel, R., 1987. The glp-1 locus and cellular interactions in early C. elegans embryos. Cell, 51(4), pp.601–611.
Qiao, L. et al., 1995. Enhancers of glp-1, a gene required for cell-signaling in Caenorhabditis elegans, define a set of genes required for germline development. Genetics, 141(2), pp.551–569.
Rabouille, C. et al., 1998. Syntaxin 5 Is a Common Component of the NSF- and p97- Mediated Reassembly Pathways of Golgi Cisternae from Mitotic Golgi Fragments In Vitro. Cell, 92(5), pp.603–610.
Rappleye, C.A. et al., 2002. The anaphase-promoting complex and separin are required for embryonic anterior-posterior axis formation. Developmental cell, 2(2), pp.195– 206.
Rasmussen, J.P. et al., 2008. Notch signaling and morphogenesis of single-cell tubes in the C. elegans digestive tract. Developmental cell, 14(4), pp.559–569.
Roehl, H. et al., 1996. Roles of the RAM and ANK domains in signaling by the C. elegans GLP-1 receptor. The EMBO Journal, 15(24), pp.7002–7012.
Ruan, J. et al., 2008. TreeFam: 2008 Update. Nucleic acids research, 36(Database issue), pp.D735–40. 143
Sacher, M., Stone, S. & Ferro-Novick, S., 1997. The synaptobrevin-related domains of Bos1p and Sec22p bind to the syntaxin-like region of Sed5p. The Journal of biological chemistry, 272(27), pp.17134–17138.
Sadler, P.L. & Shakes, D.C., 2000. Anucleate Caenorhabditis elegans sperm can crawl, fertilize oocytes and direct anterior-posterior polarization of the 1-cell embryo. Development (Cambridge, England), 127(2), pp.355–366.
Sanchez-Irizarry, C. et al., 2004. Notch subunit heterodimerization and prevention of ligand-independent proteolytic activation depend, respectively, on a novel domain and the LNR repeats. Molecular and cellular biology, 24(21), pp.9265–9273.
Sasagawa, Y. et al., 2009. Caenorhabditis elegans p97 controls germline-specific sex determination by controlling the TRA-1 level in a CUL-2-dependent manner. Journal of cell science, 122(Pt 20), pp.3663–3672.
Sauer, B. & Henderson, N., 1988. Site-specific DNA recombination in mammalian cells by the Cre recombinase of bacteriophage P1. Proceedings of the National Academy of Sciences of the United States of America, 85(14), pp.5166–5170.
Sauer, B. & Henderson, N., 1989. Cre-stimulated recombination at loxP-containing DNA sequences placed into the mammalian genome. Nucleic acids research, 17(1), pp.147–161.
Sayers, E.W. et al., 2011. Database resources of the National Center for Biotechnology Information. Nucleic acids research, 39(Database issue), pp.D38–51.
Sanchez-Irizarry, C. et al., 2004. Notch subunit heterodimerization and prevention of ligand-independent proteolytic activation depend, respectively, on a novel domain and the LNR repeats. Molecular and cellular biology, 24(21), pp.9265–9273.
Schellenberg, G.D. et al., 1992. Genetic linkage evidence for a familial Alzheimer's disease locus on chromosome 14. Science (New York, NY), 258(5082), pp.668–671.
Scheuner, D. et al., 1996. Secreted amyloid beta-protein similar to that in the senile plaques of Alzheimer“s disease is increased in vivo by the presenilin 1 and 2 and APP mutations linked to familial Alzheimer”s disease. Nature Medicine, 2(8), pp.864–870.
Semple, J.I., Garcia-Verdugo, R. & Lehner, B., 2010. Rapid selection of transgenic C. elegans using antibiotic resistance. Nature methods, 7(9), pp.725–727.
Serneels, L. et al., 2005. Differential contribution of the three Aph1 genes to gamma- secretase activity in vivo. Proceedings of the National Academy of Sciences of the United States of America, 102(5), pp.1719–1724.
Seydoux, G. & Greenwald, I., 1989. Cell autonomy of lin-12 function in a cell fate decision in C. elegans. Cell, 57(7), pp.1237–1245. 144
Seydoux, G. & Dunn, M.A., 1997. Transcriptionally repressed germ cells lack a subpopulation of phosphorylated RNA polymerase II in early embryos of Caenorhabditis elegans and Drosophila melanogaster. Development (Cambridge, England), 124(11), pp.2191–2201.
Seydoux, G., Schedl, T. & Greenwald, I., 1990. Cell-cell interactions prevent a potential inductive interaction between soma and germline in C. elegans. Cell, 61(6), pp.939– 951.
Seydoux, G. & Strome, S., 1999. Launching the germline in Caenorhabditis elegans: regulation of gene expression in early germ cells. Development (Cambridge, England), 126(15), pp.3275–3283.
Shaye, D.D. & Greenwald, I., 2002. Endocytosis-mediated downregulation of LIN- 12/Notch upon Ras activation in Caenorhabditis elegans. Nature, 420(6916), pp.686– 690.
Shaye, D.D. & Greenwald, I., 2005. LIN-12/Notch trafficking and regulation of DSL ligand activity during vulval induction in Caenorhabditis elegans. Development (Cambridge, England), 132(22), pp.5081–5092.
Shen, J. et al., 1997. Skeletal and CNS defects in Presenilin-1-deficient mice. Cell, 89(4), pp.629–639.
Sherrington, R. et al., 1995. Cloning of a gene bearing missense mutations in early-onset familial Alzheimer's disease. Nature, 375(6534), pp.754–760.
Smardon, A. et al., 2000. EGO-1 is related to RNA-directed RNA polymerase and functions in germ-line development and RNA interference in C. elegans. Current Biology, 10(4), pp.169–178.
Smedley, D. et al., 2009. BioMart--biological queries made easy. BMC genomics, 10, p.22.
Smith, M.C.M. & Thorpe, H.M., 2002. Diversity in the serine recombinases. Molecular microbiology, 44(2), pp.299–307.
Speers, A.E. & Wu, C.C., 2007. Proteomics of integral membrane proteins--theory and application. Chemical reviews, 107(8), pp.3687–3714.
St George Hyslop, P. et al., 1992. Genetic evidence for a novel familial Alzheimer's disease locus on chromosome 14. Nature Genetics, 2(4), pp.330–334.
Stanley, P., 2007. Regulation of Notch signaling by glycosylation. Current opinion in structural biology, 17(5), pp.530–535.
Stenmark, H. & Olkkonen, V.M., 2001. The Rab GTPase family. Genome biology, 2(5), p.REVIEWS3007. 145
Sternberg, P.W., 2005. Vulval development. WormBook : the online review of C elegans biology, pp.1–28.
Sternberg, P.W. & Horvitz, H.R., 1986. Pattern formation during vulval development in C. elegans. Cell, 44(5), pp.761–772.
Stewart, B.A. et al., 2001. SNARE-dependent signaling at the Drosophila wing margin. Developmental biology, 234(1), pp.13–23.
Stinchcomb, D.T., Mello, C.C. & Hirsh, D., 1985. Caenorhabditis elegans DNA that directs segregation in yeast cells. Proceedings of the National Academy of Sciences of the United States of America, 82(12), pp.4167–4171.
Struhl, G. & Adachi, A., 2000. Requirements for presenilin-dependent cleavage of notch and other transmembrane proteins. Molecular cell, 6(3), pp.625–636.
Struhl, G. & Basler, K., 1993. Organizing activity of wingless protein in Drosophila. Cell, 72(4), pp.527–540.
Struhl, G. & Greenwald, I., 1999. Presenilin is required for activity and nuclear access of Notch in Drosophila. Nature, 398(6727), pp.522–525.
Struhl, G. & Greenwald, I., 2001. Presenilin-mediated transmembrane cleavage is required for Notch signal transduction in Drosophila. Proceedings of the National Academy of Sciences of the United States of America, 98(1), pp.229–234.
Struhl, G., Fitzgerald, K. & Greenwald, I., 1993. Intrinsic activity of the Lin-12 and Notch intracellular domains in vivo. Cell, 74(2), pp.331–345.
Suh, N. et al., 2006. The GLD-2 poly(A) polymerase activates gld-1 mRNA in the Caenorhabditis elegans germ line. Proceedings of the National Academy of Sciences of the United States of America, 103(41), pp.15108–15112.
Sulston, J.E. & Horvitz, H.R., 1981. Abnormal cell lineages in mutants of the nematode Caenorhabditis elegans. Developmental biology, 82(1), pp.41–55.
Sulston, J.E. & Horvitz, H.R., 1977. Post-embryonic cell lineages of the nematode, Caenorhabditis elegans. Developmental biology, 56(1), pp.110–156.
Sulston, J.E. & White, J.G., 1980. Regulation and cell autonomy during postembryonic development of Caenorhabditis elegans. Developmental biology, 78(2), pp.577–597.
Sulston, J.E. et al., 1983. The embryonic cell lineage of the nematode Caenorhabditis elegans. Developmental biology, 100(1), pp.64–119.
Sundaram, M. & Greenwald, I., 1993. Suppressors of a lin-12 hypomorph define genes that interact with both lin-12 and glp-1 in Caenorhabditis elegans. Genetics, 135(3), pp.765–783. 146
Tanigaki, K. & Honjo, T., 2010. Two opposing roles of RBP-J in Notch signaling. Current topics in developmental biology, 92, pp.231–252.
Tax, F.E. et al., 1997. Identification and characterization of genes that interact with lin-12 in Caenorhabditis elegans. Genetics, 147(4), pp.1675–1695.
Tax, F.E., Yeargers, J.J. & Thomas, J.H., 1994. Sequence of C. elegans lag-2 reveals a cell-signalling domain shared with Delta and Serrate of Drosophila. Nature, 368(6467), pp.150–154.
Thompson, B.J. et al., 2005. Tumor Suppressor Properties of the ESCRT-II Complex Component Vps25 in Drosophila. Developmental cell, 9(5), pp.711–720.
Thorpe, H.M. & Smith, M.C., 1998. In vitro site-specific integration of bacteriophage DNA catalyzed by a recombinase of the resolvase/invertase family. Proceedings of the National Academy of Sciences of the United States of America, 95(10), pp.5505– 5510.
Thorpe, H.M., Wilson, S.E. & Smith, M.C., 2000. Control of directionality in the site- specific recombination system of the Streptomyces phage phiC31. Molecular microbiology, 38(2), pp.232–241.
Tian, X. et al., 2004. Epsin potentiates Notch pathway activity in Drosophila and C. elegans. Development (Cambridge, England), 131(23), pp.5807–5815.
Timmons, L. et al., 2003. Inducible systemic RNA silencing in Caenorhabditis elegans. Molecular biology of the cell, 14(7), pp.2972–2983.
Timmons, L., Court, D.L. & Fire, A., 2001. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene, 263(1-2), pp.103–112.
Tursun, B. et al., 2009. A toolkit and robust pipeline for the generation of fosmid-based reporter genes in C. elegans. PloS one, 4(3), p.e4625.
Vaccari, T. & Bilder, D., 2005. The Drosophila tumor suppressor vps25 prevents nonautonomous overproliferation by regulating notch trafficking. Developmental cell, 9(5), pp.687–698.
Vaccari, T. et al., 2008. Endosomal entry regulates Notch receptor activation in Drosophila melanogaster. The Journal of cell biology, 180(4), pp.755–762.
Van Broeckhoven, C. et al., 1992. Mapping of a gene predisposing to early-onset Alzheimer's disease to chromosome 14q24.3. Nature Genetics, 2(4), pp.335–339.
Van Duyne, G.D., 2005. Lambda integrase: armed for recombination. Current biology : CB, 15(17), pp.R658–60. 147
Vassar, R. et al., 1999. Beta-secretase cleavage of Alzheimer's amyloid precursor protein by the transmembrane aspartic protease BACE. Science (New York, NY), 286(5440), pp.735–741.
Vázquez-Manrique, R.P. et al., 2010. Improved gene targeting in C. elegans using counter-selection and Flp-mediated marker excision. Genomics, 95(1), pp.37–46.
Vilella, A.J. et al., 2009. EnsemblCompara GeneTrees: Complete, duplication-aware phylogenetic trees in vertebrates. Genome research, 19(2), pp.327–335.
Voutev, R. & Hubbard, E.J.A., 2008. A “FLP-Out” system for controlled gene expression in Caenorhabditis elegans. Genetics, 180(1), pp.103–119.
Wahrle, S. et al., 2002. Cholesterol-dependent gamma-secretase activity in buoyant cholesterol-rich membrane microdomains. Neurobiology of disease, 9(1), pp.11–23.
Wakabayashi, T. et al., 2009. Analysis of the |[gamma]|-secretase interactome and validation of its association with tetraspanin-enriched microdomains. Nature Cell Biology, 11(11), pp.1340–1346.
Wang, L. et al., 2002. A regulatory cytoplasmic poly(A) polymerase in Caenorhabditis elegans. Nature, 419(6904), pp.312–316.
Wang, Y. et al., 2009. SPFH1 and SPFH2 mediate the ubiquitination and degradation of inositol 1,4,5-trisphosphate receptors in muscarinic receptor-expressing HeLa cells. Biochimica et biophysica acta, 1793(11), pp.1710–1718.
Waterston, R.H., 1981. A second informational suppressor, SUP-7 X, in Caenorhabditis elegans. Genetics, 97(2), pp.307–325.
Wellen, K.E. et al., 2010. The hexosamine biosynthetic pathway couples growth factor- induced glutamine uptake to glucose metabolism. Genes & development, 24(24), pp.2784–2799.
Wen, C. & Greenwald, I., 1999. p24 proteins and quality control of LIN-12 and GLP-1 trafficking in Caenorhabditis elegans. The Journal of cell biology, 145(6), pp.1165– 1175.
Wen, C., Metzstein, M.M. & Greenwald, I., 1997. SUP-17, a Caenorhabditis elegans ADAM protein related to Drosophila KUZBANIAN, and its role in LIN-12/NOTCH signalling. Development (Cambridge, England), 124(23), pp.4759–4767.
Weng, A.P., 2004. Activating Mutations of NOTCH1 in Human T Cell Acute Lymphoblastic Leukemia. Science (New York, NY), 306(5694), pp.269–271.
Westlund, B. et al., 1999. Reverse genetic analysis of Caenorhabditis elegans presenilins reveals redundant but unequal roles for sel-12 and hop-1 in Notch-pathway signaling. Proceedings of the National Academy of Sciences of the United States of America, 148
96(5), pp.2497–2502.
Wilkinson, H.A., Fitzgerald, K. & Greenwald, I., 1994. Reciprocal changes in expression of the receptor lin-12 and its ligand lag-2 prior to commitment in a C. elegans cell fate decision. Cell, 79(7), pp.1187–1198.
Wills, N. et al., 1983. The genes sup-7 X and sup-5 III of C. elegans suppress amber nonsense mutations via altered transfer RNA. Cell, 33(2), pp.575–583.
Wolfe, M.S. et al., 1999. Two transmembrane aspartates in presenilin-1 required for presenilin endoproteolysis and gamma-secretase activity. Nature, 398(6727), pp.513– 517.
Wood, A.J. et al., 2011. Targeted genome editing across species using ZFNs and TALENs. Science (New York, NY), 333(6040), p.307.
Xu, T. & Rubin, G.M., 1993. Analysis of genetic mosaics in developing and adult Drosophila tissues. Development (Cambridge, England), 117(4), pp.1223–1237.
Ye, Y., Lukinova, N. & Fortini, M.E., 1999. Neurogenic phenotypes and altered Notch processing in Drosophila Presenilin mutants. Nature, 398(6727), pp.525–529.
Yamanaka, K. et al., 2004. Analysis of the two p97/VCP/Cdc48p proteins of Caenorhabditis elegans and their suppression of polyglutamine-induced protein aggregation. Journal of structural biology, 146(1-2), pp.242–250.
Yamanaka, K., Sasagawa, Y. & Ogura, T., 2011. Recent advances in p97/VCP/Cdc48 cellular functions. Biochimica et biophysica acta.
Yamauchi, S., Yamanaka, K. & Ogura, T., 2006. Comparative analysis of expression of two p97 homologues in Caenorhabditis elegans. Biochemical and biophysical research communications, 345(2), pp.746–753.
Yan, Y., Denef, N. & Schüpbach, T., 2009. The vacuolar proton pump, V-ATPase, is required for notch signaling and endosomal trafficking in Drosophila. Developmental cell, 17(3), pp.387–402.
Yeong, F.M., 2004. Anaphase-promoting complex in Caenorhabditis elegans. Molecular and cellular biology, 24(6), pp.2215–2225.
Yoo, A.S. & Greenwald, I., 2005. LIN-12/Notch activation leads to microRNA-mediated down-regulation of Vav in C. elegans. Science (New York, NY), 310(5752), pp.1330– 1333.
Yoo, A.S., Bais, C. & Greenwald, I., 2004. Crosstalk between the EGFR and LIN- 12/Notch pathways in C. elegans vulval development. Science (New York, NY), 303(5658), pp.663–666. 148
Yu, G. et al., 2000. Nicastrin modulates presenilin-mediated notch/glp-1 signal transduction and betaAPP processing. Nature, 407(6800), pp.48–54.
Zeiser, E. et al., 2011. MosSCI and Gateway Compatible Plasmid Toolkit for Constitutive and Inducible Expression of Transgenes in the C. elegans Germline. PloS one, 6(5), p.e20082.
Zhang, X. & Greenwald, I., 2011. Spatial regulation of lag-2 transcription during vulval precursor cell fate patterning in Caenorhabditis elegans. Genetics, 188(4), pp.847– 858.
Zubenko, G.S. et al., 1998. A genome survey for novel Alzheimer disease risk loci: results at 10-cM resolution. Genomics, 50(2), pp.121–128.