Cxcr4s in Teleosts: Two Paralogous Chemokine Receptors and Their

CXCR4s in Teleosts: Two Paralogous Chemokine Receptors and Their Roles in Hematopoietic Stem/Progenitor Cell Homeostasis This information is current as of October 2, 2021. Xin-Jiang Lu, Kai Zhu, Hong-Xia Shen, Li Nie and Jiong Chen J Immunol 2020; 204:1225-1241; Prepublished online 20 January 2020;

doi: 10.4049/jimmunol.1901100 Downloaded from http://www.jimmunol.org/content/204/5/1225

Supplementary http://www.jimmunol.org/content/suppl/2020/01/17/jimmunol.190110 Material 0.DCSupplemental http://www.jimmunol.org/ References This article cites 65 articles, 18 of which you can access for free at: http://www.jimmunol.org/content/204/5/1225.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision by guest on October 2, 2021

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2020 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

CXCR4s in Teleosts: Two Paralogous Chemokine Receptors and Their Roles in Hematopoietic Stem/Progenitor Cell Homeostasis

Xin-Jiang Lu, Kai Zhu, Hong-Xia Shen, Li Nie, and Jiong Chen

Hematopoietic stem/progenitor cells (HSPCs) generate the entire repertoire of immune cells in vertebrates and play a crucial role during infection. Although two copies of CXC motif chemokine receptor 4 (CXCR4) genes are generally identified in teleosts, the function of teleost CXCR4 genes in HSPCs is less known. In this study, we identified two CXCR4 genes from a teleost, ayu (Plecoglossus altivelis), named PaCXCR4a and PaCXCR4b. PaCXCR4b was constitutively expressed in ayu HSPCs, whereas PaCXCR4a was induced by LPS treatment. The stromal-derived factor-1–binding activity of CXCR4b was significantly higher than that of CXCR4a, whereas the LPS-binding activity of CXCR4a was significantly higher than that of CXCR4b in the teleosts + ayu, large yellow croaker (Larimichthys crocea), and tiger puffer (Takifugu rubripes). CXCR4a HSPCs were mobilized into blood Downloaded from by LPS, whereas CXCR4b+ HSPCs were mobilized by leukocyte cell–derived chemotaxin-2. PaSDF-1 and PaCXCR4b, but not PaCXCR4a, inhibited HSPC proliferation by regulating reactive oxygen species levels. Compared with PaCXCR4b+ HSPCs, PaCXCR4a+ HSPCs preferentially differentiated into myeloid cells in ayu by maintaining high stem cell leukemia expression. These data suggest that the two copies of CXCR4s achieve a division of labor in the regulation of teleost HSPC homeostasis, supporting the concept that subfunctionalization after gene duplication in teleosts may stabilize the immune system. The Journal of Immunology, 2020, 204: 1225–1241. http://www.jimmunol.org/

ematopoiesis is a complex and well-orchestrated process progenitor cell (HSPC) homeostasis, including proliferation, mo- that produces all lineages of immune cells in vertebrates bilization, and differentiation (1, 2). Teleosts, as early vertebrates, H (1). In the bone marrow niches of mammals, a variety of constitute a highly successful and diverse group, including half of factors have been reported to be crucial for hematopoietic stem/ vertebrate species (3). The immune system of teleosts shows many differences compared with that of mammals. For example, teleost-specific genome duplication produces two copies of several State Key Laboratory for Managing Biotic and Chemical Threats to the Quality and crucial immune genes that exhibit subfunctionalization (4, 5). by guest on October 2, 2021 Safety of Agro-products, Ningbo University, Ningbo 315211, Zhejiang, People’s Moreover, HSPC composition has been modified for adaptation to Republic of China; Laboratory of Biochemistry and Molecular Biology, School of Marine Sciences, Ningbo University, Ningbo 315211, People’s Republic of China; special environments in some teleosts, such as cavefish (Astyanax and Key Laboratory of Applied Marine Biotechnology of Ministry of Education, mexicanus) (R. Peuß, A.C. Box, Y. Wang, S. Chen, J. Krishnan, Ningbo University, Ningbo 315211, Zhejiang, People’s Republic of China D. Tsuchiya, B. Slaughter, and N. Rohner, manuscript posted on ORCID: 0000-0002-7796-4401 (X.-J.L.). bioRxiv). However, the teleost-specific regulatory mechanism Received for publication September 10, 2019. Accepted for publication December underlying HSPC homeostasis is still unclear. 11, 2019. Although HSPCs are not mature immune cells and are frequently This work was supported by the Program for the Natural Science Foundation of China (31972821; 31772876; 41776151), the Zhejiang Provincial Natural Science dormant, it has been suggested that HSPCs participate in the Foundation of China (LR18C040001; LZ18C190001), the Scientific Innovation Team primary response to infections (6, 7). HSPCs can be mobilized by Project of Ningbo (2015C110018) and the K.C. Wong Magna Fund in Ningbo directly sensing infection through TLR (8). In addition to the di- University. rect sensing of pathogens, HSPC activity in response to infection The sequences presented in this article have been submitted to GenBank (https:// www.ncbi.nlm.nih.gov/genbank/) under accession numbers MN148390, MN148391, is also mediated indirectly by proinflammatory cytokines (9, 10). MN148393, MN158722, MN158723, MN158724, MN156535, and MN156536, Furthermore, infections also affect the lymphoid versus myeloid MN628572, MN628573. fate choice. LPS binds with TLR4 to induce the rapid generation Address correspondence and reprint requests to Prof. Jiong Chen, Ningbo University, of myeloid cells, including macrophages (11). In zebrafish, HSPCs 818 Fenghua Road, Ningbo 315211, Zhejiang, People’s Republic of China. E-mail address: [email protected] can also proliferate and differentiate into required immune cell lineages postinfection (12). HSPCs are mobilized into the pe- The online version of this article contains supplemental material. ripheral blood from the kidney postinfection in another teleost, Abbreviations used in this article: BPI, bacterial/permeability increasing protein; CFU-C, CFU cell; CRU, competitive repopulating unit; DHR, dihydrorhodamine- ayu (Plecoglossus altivelis) (13). HSPC mobilization is induced 123; EGR1, early growth response protein 1; GATA2, GATA-binding protein 2; by bacterial components such as LPS (14), or host cytokines such GATA3, GATA-binding protein 3; HSC, hematopoietic stem cell; HSPC, hematopoi- as G-CSF and leukocyte cell–derived chemotaxin-2 (LECT2) etic stem/progenitor cell; LECT2, leukocyte cell–derived chemotaxin-2; Mef2C, myocyte enhancer factor 2C; MHC I, MHC class I; MO/MF, monocyte/macrophage; (15). However, it is necessary to further investigate the regulatory MPO, myeloperoxidase; NAC, N-acetylcysteine; PaCXCR4a, P. altivelis CXCR4a; mechanism underlying HSPC self-renewal, mobilization, and PaCXCR4b, P. altivelis CXCR4b; PaSRB2a, ayu scavenger receptor class B 2a; PAX5, reduced paired box 5; PU.1, PU box-binding protein; ROS, reactive oxygen differentiation postinfection in teleosts. species; RT-qPCR, real-time quantitative PCR; RUNX1, runt-related transcription CXC chemokines and their receptors play crucial roles in the factor 1; SCL, stem cell leukemia; SDF, stromal cell–derived factor; shRNA, short migration and function regulation of immune cells in both teleosts hairpin RNA; siRNA, small interfering RNA; SP, side population. and mammals (16, 17). Stromal cell–derived factor (SDF)-1 (also Copyright Ó 2020 by The American Association of Immunologists, Inc. 0022-1767/20/$37.50 known as CXCL12) is a member of the CXC group of chemokines www.jimmunol.org/cgi/doi/10.4049/jimmunol.1901100 1226 THE ROLES OF TWO CXCR4s IN TELEOST HSPCS

(18). The physiological SDF-1 receptor is CXC motif chemokine To inhibit HSPC mobilization in vivo, we neutralized LPS and LECT2 receptor 4 (CXCR4), a heptahelical receptor coupled to hetero- using human bacterial/permeability increasing protein (BPI) peptide and trimeric GTP-binding proteins (19). SDF-1/CXCR4 is involved in anti-LECT2 Ab. The BPI peptide (85–99 aa) was synthesized by GL Biochem (Shanghai, China) and has been demonstrated to inhibit the HSPC homeostasis, development, tumor metastasis, metabolism, binding of LPS to monocytes (33). The anti-LECT2 Ab was prepared by and HIV entry (20–22). CXCR4 normally promotes bone marrow immunizing mice with recombinant LECT2, which was produced in our HSPC mobilization, homing, retention, and quiescence (23). previous work (34). Ayu were treated i.p. with 0.5 mg of BPI peptide/g Moreover, CXCR4 desensitization affects the lymphoid differen- body weight or 0.5 mg of anti-LECT2 Ab/g 30 min postinfection. tiation of HSPCs (24). CXCR4 genes have also been cloned in a Characterization of cDNA gene sequences in teleosts variety of teleosts (16). It has long been known that two copies of CXCR4 genes (CXCR4a and CXCR4b) exist in teleosts, whereas The cDNA sequences of the ayu CXCR4a (P. altivelis CXCR4a [PaCXCR4a]), CXCR4b (P. altivelis CXCR4b [PaCXCR4b]) and P. altivelis SDF-1 only one single copy of CXCR4 is present in mammals (25). In (PaSDF-1) genes were obtained from transcriptome analysis of ayu teleosts, CXCR4b has been found to be involved in embryogenesis monocytes/macrophages (MO/MFs), and transcriptomic data were de- and ganglia formation (26), whereas CXCR4a is related to vessel posited into the Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/ development (27). Furthermore, CXCR4b also participates in geo/). All accession numbers are listed in Table I. PCR, cloning, and se- neutrophil recruitment in teleosts (28). However, the functions of quencing were used to confirm the authenticity of these sequences. The similarities between the obtained sequences and other known sequences CXCR4a and CXCR4b in teleost HSPCs are still unclear. Because were analyzed using the basic local alignment search tool (http://blast.ncbi. CXCR4 represents the sole chemokine receptor in HSPCs to nlm.nih.gov/blast.cgi). Multiple sequence alignments were generated using mediate migration/chemotaxis (29), investigating its effect on ClustalW (http://clustalw.ddbj.nig.ac.jp/). Phylogenetic and molecular HSPC homeostasis in teleosts is necessary to understand the di- evolutionary analyses were conducted using Molecular Evolutionary Ge- netic Analysis 5.0 Program. The sequences used in this study are listed in Downloaded from verse mechanisms underlying the immune response. Table I. As the most species-rich group of vertebrates, teleosts are useful for finding mammalian immune system paradigms (30). Ayu is an Real-time quantitative PCR important experimental teleost widely cultured in Japan, China, Total RNA was extracted from fish tissues and cells using RNAiso (Takara, and Korea, and its genome has been successfully sequenced Dalian, China). After treatment with DNase I, first-strand cDNA was (National Center for Biotechnology Information Sequence Read synthesized using avian myeloblastosis virus reverse transcriptase Archive accession number SRR8369080). In this study, we found (Takara), and real-time quantitative PCR (RT-qPCR) was performed on an http://www.jimmunol.org/ that CXCR4b was highly expressed in ayu whole kidney, whereas ABI StepOne Real-Time PCR System (Applied Biosystems, Foster City, CA) using SYBR Premix Ex Taq II (Takara). The specific primer se- CXCR4a was expressed at low levels in the healthy whole kidney quences for PaCXCR4a, PaCXCR4b, PaSDF-1, ayu scavenger receptor and upregulated postinfection. Furthermore, CXCR4a preferred to class B 2a (PaSRB2a), GATA-binding protein 2 (GATA2), runt-related interact with LPS, whereas CXCR4b preferred to interact with transcription factor 1 (RUNX1), GATA-binding protein 3 (GATA3), re- SDF-1. CXCR4a and CXCR4b also showed different capabilities duced paired box 5 (PAX5), early growth response protein 1 (EGR1), PU box-binding protein (PU.1), myeloperoxidase (MPO), stem cell leukemia of interacting with LPS and SDF-1 in other teleosts, large yellow (SCL), C/EBP-a (C/EBPa), Ikaros, myocyte enhancer factor 2C (Mef2C), croaker (Larimichthys crocea), and tiger puffer (Takifugu rubri- and the housekeeping gene 18S rRNA are listed in Table II. Amplifications pes). Considering that the two copies of the CXCR4 gene in tel- were carried out in a 25-ml reaction volume containing the sample, pri- by guest on October 2, 2021 eosts may display subfunctionalization, we further investigated the mers, and SYBR Premix Ex Taq II. The reaction mixture was incubated in functions of CXCR4a and CXCR4b in HSPCs. an ABI StepOne Real-Time PCR System (Applied Biosystems) for 300 s at 95˚C, followed by 40 amplification cycles of 30 s at 95˚C, 30 s at 60˚C, and 30 s at 72˚C. The mRNA expression of the target genes was nor- Materials and Methods malized to that of 18S rRNA using the 22DDCT method. Animals Western blot analysis Ayu, large yellow croaker, and tiger puffer were used in all experiments. Ayu (Zhemin No. 1, weighing 40 6 5 g each) has undergone seven suc- The cells were washed twice in sterile PBS and lyzed in a buffer (20 mM cessive generations of mass selection for fast growth, and the effective HEPES, 1.5 mM MgCl2, 0.2 mM EDTA, 100 mM NaCl, 0.2 mM DTT, population size is ∼4000 fish. After seven generations of mass selection, 0.5 mM sodium orthovanadate, and 0.4 mM PMSF [pH 7.4]) containing the growth rate for Zhemin No. 1 is stable. The slow-growth ayu were phosphatase inhibitor (Phosphatase Inhibitor Cocktail; Sigma-Aldrich, removed from the population to characterize fast growth. The fish were St. Louis, MO). The protein concentration in each soluble fraction was kept in freshwater tanks at 20˚C in a recirculating system using filtered measured using the Bradford method (35). For Western blot analysis, the water. From 2017 to 2019, three different year classes of fish were used. proteins were resolved using SDS-PAGE and transferred to polyvinylidene During experiments, the ayu feed rate was 3% body weight per day, and difluoride membranes. The membranes were blocked for 1 h in a 10% the pellet feed mainly consisted of fish meal, wheat flour, soybean meal, nonfat dry milk solution containing TBS-Tween at 37˚C. After a 1.5 h fish oil, and vitamin premix. For the HSPC transplantation experiments, incubation with specific Abs, the membranes were washed and incubated the initial body weight of ayu was 40 6 5 g, whereas the body weight for 1 h with an HRP-labeled secondary Ab (1:5000; Santa Cruz Biotech- was 82 6 7 g after 16 wk of HSPC transplantation. The genetic diversity nology) and visualized using an ECL Western blotting detection system. of Zhemin No. 1 has been measured by amplified fragment length The intensity of each band obtained by Western blot was analyzed using polymorphisms (31). The proportion of polymorphic genes in Zhemin the National Institutes of Health ImageJ Program. Ayu b-actin was used as No. 1 is 42.74%, which is lower than that in wild ayu (32). Large yellow the control. croakers weighing 100 6 20 g were purchased from a mariculture farm The SCL Abs were from commercial sources (1:400; R&D Systems, in Xiangshan County, Ningbo, China and maintained in a flow-through Minneapolis, MN). The Abs of PaCXCR4a and PaCXCR4b were prepared seawater supply at 25˚C. Tiger puffers weighing 15 6 1gwerepur- using peptides derived from these proteins (1:200, PaCXCR4a: 107–121 chased from Tianzheng (Dalian, China) and kept in recirculating water at aa, and 1:200, PaCXCR4b: 102–115 aa; GL Biochem). These peptides 20˚C. The fish were held in the laboratory for $2 wk, with healthy ap- were synthesized to generate the respective mAbs (1 mg/ml; GL Bio- pearance and normal activity, prior to use in experiments. All fish used in chem). The PaCXCR4a and PaCXCR4b mAbs generated, named 3G4 and this study were healthy and showed no pathological signs of infection. 7D6, are both IgG1 Abs. We cloned the full-length versions of PaCXCR4a, Twomediaroutinelyusedtoscreenforfishhealthweretrypticsoyagar PaCXCR4b, and PaSDF-1 into pcDNA3.1 plasmid (Invitrogen) and then and thiosulfate citrate bile salts sucrose agar. Bacterial CFUs were not transfected the constructs into HEK293T cells to produce recombinant detected in the blood of healthy fish. The experimental conditions and proteins. For PaCXCR4a and PaCXCR4b detection, HEK293T cells were procedures were approved by the Ningbo University Institutional Animal lyzed for Western blot analysis. For PaSDF-1 detection, the HEK293T Care and Use Committee and were carried out in compliance with the supernatant was concentrated in Amicon-Ultra 4 centrifugal filter units National Institutes of Health’s Guide for the Care and Use of Laboratory with a 3-kDa cutoff (Millipore, Bedford, MA) for Western blot detection. Animals. The Abs were validated using Western blot (Supplemental Fig. 1). The Journal of Immunology 1227 Downloaded from http://www.jimmunol.org/ by guest on October 2, 2021 FIGURE 1. Two CXCR4 genes were expressed in teleost HSPCs. (A) Phylogenetic (neighbor-joining) analysis of the complete amino acid sequence of teleost and mammalian CXCR4s using the Molecular Evolutionary Genetics Analysis 5.0 Program. Node values represent the percentage bootstrap confidence derived from 1000 replicates. The source sequences are listed in Table I. (B) The mRNA expression of PaCXCR4s in ayu whole kidney following V. anguillarum infection at 1 3 104 CFU per fish or LPS treatment (10 mg/g body weight; n = 5). (C) The protein expression of PaCXCR4a and PaCXCR4b in ayu HSPCs as detected by Western blot. Representative blots of three independent experiments are shown. (D) The expression of PaCXCR4a and PaCXCR4b on the surface of HSPCs following LPS treatment. (E) The mRNA levels of PaCXCR4a and PaCXCR4b in PaCXCR4a+ and PaCXCR4b+ HSPCs. Each bar represents the mean 6 SE (n = 5). Data are representative of three independent experiments. *p , 0.05, **p , 0.01, ***p , 0.001.

ELISA [125I]–PcSDF-1, and [125I] –TrSDF-1 labeled by the Bolton–Hunter pro- cedure (37). Two days after transfection, cells were washed in PBS and SDF-1 protein expression was measured in the whole kidney of ayu by incubated at a total of 5 3 106 cells in binding buffer (50 mM HEPES ELISA. Tissue samples tested in this study were homogenized in a buffer [pH 7.4], 1 mM CaCl2, 1 mM MgCl2, 0.2% BSA, and 0.1% NaN3) con- used for Western blotting. Microplates (Nunc, Roskilde, Denmark) were taining 5% dialyzed FBS (Invitrogen) for 1 h at room temperature before coated overnight using tissue samples. Plates were precoated using 50 mg/ml being used for the binding experiment. Fifty microliters of cells were in- poly-L-lysine (Sigma-Aldrich) to increase protein binding. Blocking of cubated with 0.2 nM [125I]-labeled PaSDF-1 or 2 mg/ml [125I]-labeled LPS unbound binding sites was performed using 5% teleost gelatin (Sigma- for 30 min at 24˚C, and the reaction was terminated by the addition of 1 ml Aldrich). An anti–PaSDF-1 polyclonal Ab was prepared by GL Biochem of ice-cold washing buffer (10 mM HEPES [pH 7.4], 5 mM CaCl2,1mM using a peptide derived from PaSDF-1 (81–98 aa). One hundred microli- MgCl2, and 0.5 M NaCl). The solution was filtered under a vacuum ters of the anti–PaSDF-1 Ab (5 mg/ml) was added to each well, and the through a Whatman GF/C glass filter, and the filter was then washed three plates were then incubated for 1 h and washed three times. One hundred times with washing buffer. The radioactivity retained on the filter was microliters of an HRP-labeled secondary Ab (1:2500 dilution in PBS; counted on a g counter (300 SL; Hidex, Turku, Finland), and the IC50 and Santa Cruz Biotechnology, Santa Cruz, CA) was added to each well, after Kd values were calculated by nonlinear regression analysis in GraphPad which the plates were incubated for 1 h and washed three times. Finally, an Prism 6 (GraphPad Software, La Jolla, CA). Nonspecific binding was alkaline phosphatase yellow liquid substrate system for ELISA (Sigma- determined in the presence of 1 mg/ml unlabeled LPS or 100 nM unlabeled Aldrich) was used, and the OD was measured at 405 nm. SDF-1. Specific binding values in the saturation and competitive binding experiments were calculated as the total binding minus nonspecific Receptor-binding assay binding. N-terminal peptides of PaSDF-1 (KPLSLVERCWCRTTASTVPQR), large Knockdown with lentivirus yellow croaker SDF-1 (PcSDF-1, KPISLVERCYCRSTVNNIPRS), and tiger puffer SDF-1 (TrSDF-1, KPISLVERCWCRSTLNTVPQR) were For in vivo gene knockdown by lentivirus delivery, small interfering RNAs synthesized for receptor-binding assay and proliferation analysis by GL (siRNAs) against PaSRB2a, PaCXCR4a, PaCXCR4b, PaSDF-1, and SCL Biochem. The 21 aa of the N terminus of SDF-1 can activate CXCR4 were predicted by BLOCK-iT RNAi Designer (Invitrogen). Short hairpin signaling (36). Receptor-binding assays were performed with CXCR4a- RNAs (shRNAs) containing the selected siRNA sequences were designed HEK293T or CXCR4b-HEK293T cells using [125I]–PaSDF-1, [125I]-LPS, and are listed in Table II. DNA oligonucleotides for shRNA expression 1228 THE ROLES OF TWO CXCR4s IN TELEOST HSPCS

Table I. Sequences used in this study

Species

Accession Number Ensemble Identifier Latin Name English Name Protein ENSTRUP00000022640 Takifugu rubripes tiger puffer CXCR4b ENSTNIP00000003765 Tetraodon nigroviridis spotted green pufferfish CXCR4b ENSGACP00000009641 Gasterosteus aculeatus Three spined stickleback CXCR4b XM 010740176 Larimichthys crocea large yellow croaker CXCR4b ENSORLP00000025392 Oryzias latipes Japanese rice fish CXCR4b ENSONIP00000005554 Oreochromis niloticus Nile tilapia CXCR4b XM 020920341 Boleophthalmus pectinirostris giant mudskipper CXCR4b ENSGMOP00000010259 Gadus morhua Atlantic cod CXCR4b MN148391 Plecoglossus altivelis ayu CXCR4b ENSDARP00000061498 Danio rerio zebrafish CXCR4b AXF84207 Ctenopharyngodon idella grass carp CXCR4b LHQP01018997 Cyprinus carpio common carp CXCR4b QPKE01007971 Carassius auratus goldfish CXCR4b XP_007232446 Astyanax mexicanus Mexican tetra CXCR4b AXF84206 Ctenopharyngodon Idella grass carp CXCR4a ENSDARP00000074800 Danio rerio zebrafish CXCR4a XP_007230928 Astyanax mexicanus Mexican tetra CXCR4a

LHQP01016790 Cyprinus carpio common carp CXCR4a Downloaded from GBZM01009969 Carassius auratus goldfish CXCR4a ENSP00000386884 Homo sapiens human CXCR4 ENSMUSP00000053489 Mus musculus mouse CXCR4 GFIX01019416 Gadus morhua Atlantic cod CXCR4a MN148390 Plecoglossus altivelis ayu CXCR4a ENSTRUP00000026928 Takifugu rubripes tiger puffer CXCR4a ENSTNIP00000010726 Tetraodon nigroviridis spotted green pufferfish CXCR4a http://www.jimmunol.org/ ENSONIP00000019715 Oreochromis niloticus Nile tilapia CXCR4a ENSORLP00000014200 Oryzias latipes Japanese ricefish CXCR4a ENSLOCP00000001045 Lepisosteus oculatus spotted gar CXCR4a ENSGACT000000016399 Gasterosteus aculeatus Three spined stickleback CXCR4a JRPU01002392 Larimichthys crocea large yellow croaker CXCR4a JACM01036689 Boleophthalmus pectinirostris giant mudskipper CXCR4a MN148393 Plecoglossus altivelis ayu SDF-1 XM_019259616 Larimichthys crocea large yellow croaker SDF-1 XM_011612317 Takifugu rubripes tiger puffer SDF-1 KX228907 Plecoglossus altivelis ayu MhcPlal-UAA*0101

MN628572 Plecoglossus altivelis ayu MhcPlal-UAA*0201 by guest on October 2, 2021 MN628573 Plecoglossus altivelis ayu MhcPlal-UAA*0301

were synthesized by Invitrogen, annealed, and constructed into the CFU cell pSUPER Vector (Oligoengine, Seattle, WA) downstream of the [1H] promoter as previously described (38). The constructs generated with different A CFU cell (CFU-C) assay was carried out as described previously (13). siRNAs (1 mg) or control pSUPER (1 mg) along with the overexpression Briefly, we plated mononuclear cells in 2.5 ml of methylcellulose medium plasmid pcDNA3.1-target genes (1 mg) were cotransfected into HEK293T supplemented with 10% conditioned medium obtained from PBMCs in the cells in 12-well plates. The efficiencies of the siRNAs against target genes presence of PHA (Sigma-Aldrich) for 7 d. The numbers of mononuclear 3 5 3 6 were determined by RT-qPCR. cells were 2 10 per plate from the whole kidney or 1 10 per plate The U6 promoter cassette in the lentiviral vector pLB was replaced with from the blood. After 7 d of culture, the number of colonies per dish was 1 counted. the [ H]-siRNA cassette excised from the most effective siRNA constructs + + to produce lentiviral vectors. Lentiviruses were produced by transient For CFU-C analysis of PaCXCR4a and PaCXCR4b whole kidney transfection of the packaging cell line HEK293T cells. In brief, lentiviral leukocytes, cells were isolated by magnetic beads. Ayu whole kidney vectors (20 mg) were cotransfected with the pCMV-dR8.2 dvpr (15 mg) leukocyte–enriched fractions were obtained from the Ficoll medium in- 6 and pCMV–VSV-G (6 mg) packaging vectors into HEK293T cells using terface using a Ficoll density gradient (1.077 0.001 g/ml) (Invitrogen, FuGENE 6 Transfection Reagent (Promega). The lentiviral supernatant Shanghai, China). After incubating with the Ab against PaCXCR4a (1:200) was harvested at 48–72 h posttransfection, concentrated via ultracentri- or PaCXCR4b (1:200), cells were collected by magnetic bead separation 3 5 3 5 fugation at 25,000 rpm for 90 min at 4˚C to be dissolved in 100 ml of PBS, (Miltenyi Biotec, Bergisch Gladbach, Germany). In total, 1 10 ,2 10 , 3 5 and then purified and concentrated using a Fast-Trap Lentivirus Purifica- and 3 10 cells per plate were used to determine the CFU-C numbers and tion and Concentration Kit (Millipore). Lentiviral titers were determined calculate the average value in one sample to reduce SE. by transduction analysis of GFP expression in HEK293T cells, and in- Flow cytometry fected cells were examined by fluorescence microscopy (Nikon, Tokyo, Japan). For analysis of blood immune cells, blood was taken from ayu that were The silencing efficiencies of the constructed lentiviruses were deter- anesthetized (0.03% [v/v] ethylene glycol monophenyl ether; Sinopharm mined both in vitro and in vivo. In vitro, HEK293T cells were transfected Chemical Reagent, Shanghai, China) using heparin vacutainers (Becton with the pcDNA3.1-target gene. Concentrated lentivirus (10 ml) was added Dickinson, Franklin Lakes, NJ) and then centrifuged at 1500 rpm for 5 min. to the culture medium, and 4 mg/ml polybrene (Sigma-Aldrich) was si- Blood plasma was decanted from the blood cells, which were resuspended multaneously added to increase the infection efficiency. The silencing in 4 ml of PBS, layered using a Ficoll gradient (Invitrogen), and subse- efficiencies of the lentiviruses were detected by RT-qPCR. For the in vivo quently centrifuged at 400 3 g for 25 min. The PBMC fraction at the assay, the lentiviruses (1 3 108 transducing units per fish per day) were Ficoll-medium interface was collected. The cells were stained with an Ab repeatedly delivered into fish by injection once a day for 3 d. Total RNA for 30 min at 4˚C, and the samples were analyzed on a flow cytometer was isolated from the liver and spleen and reverse transcribed into cDNA. (Gallios; Beckman Coulter Diagnostics). The analysis was performed us- RT-qPCR was conducted to evaluate the efficiency of in vivo suppression ing Kaluza Software (Beckman Coulter Diagnostics) and FlowJo Software of the target gene. (Tree Star, Ashland, OR). An anti–PaCSF1R Ab was prepared in our Table II. Primers used in this study Immunology of Journal The

Primer Gene Accession Number Nucleotide Sequence (59→39) Sequence Information PaCXCR4aF CXCR4a MN148390 59-GGAATTCATGTCCTACTATGAGCATATT-39a Eukaryotic expression PaCXCR4aR 59-CCTCGAGTTAGCTGGAGTGCAGACTAG-39b PaCXCR4bF CXCR4b MN148391 59-GGAATTCATGGCATACTACGAGGAGAG-39a Eukaryotic expression PaCXCR4bR 59-CCTCGAGTTAACTGTAGAGAACACTGGAG-39b Pa SDF-1F SDF-1 MN148393 59-GGAATTCATGGATTTGAAATTATTGGCGTT-39a Eukaryotic expression Pa SDF-1R 59-CCTCGAGCTAGTTGGCTTGTTTGGATCT-39b PaMhcPlal-UAA*0101F MhcPlal-UAA*0101 59-CAAGTCCCAAACTTCCCAGA-39 RT-qPCR PaMhcPlal-UAA*0101R 59-GGTACCCAGCGCTATACCAG-39 PaMhcPlal-UAA*0201F MhcPlal-UAA*0101 59-TCATTCCGCGACTAACATCA-39 RT-qPCR PaMhcPlal-UAA*0201R 59-AGCTGCCTTGTTCATCCAGT-39 PaMhcPlal-UAA*0301F MhcPlal-UAA*0101 59-TCAACATCATTCCGCGACTA-39 RT-qPCR PaMhcPlal-UAA*0301R 59-GGCTCTCTGGATGTTGCTGT-39 PaCXCR4aF CXCR4a MN148390 59-CCAGAACTCAGGAAGCAGGA-39 RT-qPCR PaCXCR4aR 59-ACAGGAAGAAGCAGAGGACC-39 PaCXCR4bF CXCR4b MN148391 59-GGGCTTCCAGAACAAATGCA-39 RT-qPCR PaCXCR4bR 59-TGCCAGGTATCGATCCAGAC-39 Pa SDF-1F SDF-1 MN148393 59-AGTCTGGTGGAGAGGTGCTG-39 RT-qPCR Pa SDF-1R 59-TATCACTTGGAAGGGGCAGT-39 Pa18S rRNAF 18S rRNA FN646593 59-GAATGTCTGCCCTATCAACT-39 RT-qPCR Pa18S rRNAR 59- GATGTGGTAGCCGTTTCT-39 PaSRB2aF SRB2a MH699855 59-ACTTCTACCAAGCAGACCCC-39 RT-qPCR PaSRB2aR 59-GGGGAAGATGGTCTGGTTGA-39 PaGATA2F GATA2 KU833214 59-TGTGCTAACTGCCAGACGAC-39 RT-qPCR PaGATA2R 59-GGCTCTTTTTGGACTTGCTG-39 PaRunX1F RUNX1 KU833216 59-CATCCACCACCCTCTCATCT-39 RT-qPCR PaRunX1R 59-GTCCGTTCTCACCAGCTCTC-39 PaGATA3F GATA3 KU833213 59-GTGGCTTGAAGGAAGCAAAG-39 RT-qPCR PaGATA3R 59-CGGGTCTGGAGACACATCTT-39 PaPax5F PAX5 KU833217 59-CGTGTGTGTGACAACGACAG-39 RT-qPCR PaPax5R 59-CGCTGATGGAGTAGGAGGAG-39 PaEgr1F EGR1 KU833211 59-AGCCCAACCCCATCTACTCT-39 RT-qPCR PaEgr1R 59-AAGCTGGAACTGCACGTCTT-39 PaPu.1F PU.1 KU833215 59-GAGCTCAGACGAGGACGAAC-39 RT-qPCR PaPu.1R 59-CCGTTCCTCAACAGGTCAAT-39 PaMPOF MPO MN158724 59-ATCAACAAGTATCGCACGGC-39 RT-qPCR PaMPOR 59-TGGGTGAACTCTTGATCGCT-39 PaSCLF SCL MN156535 59-CGAATGGTGCAGTTGAGTCC-39 RT-qPCR PaSCLR 59-GAGCAGGTCGACGTTTCATC-39 PaC/EBPaF C/EBPa MN156536 59-CGTCGACAAGAACAGTAGCG-39 RT-qPCR PaC/EBPaR59-GTAATGTGTCCAGTTCCCGC-39 PaIkarosF Ikaros MN158722 59-TTCGCCATATCAAGCTGCAC-39 RT-qPCR PaIkarosR 59-CTAGAGAACTGCGCTGCTTG-39 PaMef2CF Mef2C MN158723 59-CCGAGGACAAATACCGCAAG-39 RT-qPCR PaMef2CR 59-TAAGGGGCAGTAGGTTGTGG-39 PaSRB2a-siRNA-sense SRB2a MH699855 59-GATCCCCCCTTGACCTTAATCCGACCACTGGTTTCAAGA- Lentiviral RNAi GAACCAGTGGTCGGATTAAGGTCAAGGTTTTTA-39 (Table continues)

1229

Downloaded from from Downloaded http://www.jimmunol.org/ by guest on October 2, 2021 2, October on guest by 1230 THE ROLES OF TWO CXCR4s IN TELEOST HSPCS

pr- ork (39). mAbs against PaCD4, PaCD8, and PaIgM were prepared using ev- peptides derived from these proteins (PaCD4: 58–70 aa, PaCD8: 25–40 aa, io- PaIgM: 165–178 aa; GL Biochem). The Abs were labeled with PE using us an Ab Labeling Kit (Thermo Fisher Scientiﬁc). w- For side population (SP) cell isolation, whole kidney leukocytes were stained with 7.5 mg/ml Hoechst 33342 (Sigma-Aldrich) at a concentration 3 7 RT-PCR RT-PCR RT-PCR of 5 10 cells/ml in staining medium (RPMI 1640 containing 2% FBS) for 90 min at 25˚C. After Hoechst 33342 staining, whole kidney leukocytes Lentiviral RNAi Lentiviral RNAi Lentiviral RNAi Lentiviral RNAi

Sequence Information were washed by centrifugation, resuspended in RPMI 1640 containing 2% FBS, and kept on ice until use. Flow cytometry analysis and sorting were performed on a flow cytometer (MACSQuant Analyzer 10; Miltenyi Biotec). The Hoechst dye was excited by a UV laser, and its fluorescence 9 9 9 9 9 9 9 9 was measured at two wavelengths using a 410/20 (Hoechst blue) bandpass -3 -3 -3 -3 -3 -3 -3 -3 filter and a 575/20 (Hoechst red) bandpass filter. The SP cells were identified by a Hoechst blue versus Hoechst red dot-plot and defined as HSPCs. Cells were loaded with dihydrorhodamine-123 (DHR; 5 mg/ml; Sigma- Aldrich) for 5 min at 24˚C. The cells in the control group were treated with PBS. Reactive oxygen species (ROS) production was quantified via flow cytometry by measuring intracellular rhodamine (Gallios Flow Cytometer; Beckman Coulter Diagnostics), and the ROS content was expressed as the mean fluorescence intensity of treated cells. HSPC transplantation Downloaded from Three MHC class I (MHC I) alleles were identified in ayu until now. The

9 ) frequencies of ayu MHC I alleles are 62% for MhcPlal-UAA*0101, 19% 3 for MhcPlal-UAA*0201, and 21% for MhcPlal-UAA*0301. Ayu were 9 → hand-netted, marked by a fin clip, and released. Total RNA was isolated from ayu fin samples for MHC I allele analysis. Ayu were recaptured by hand-netting and assigned into new groups according to the MHC I allele information for MHC-matched HSPC transplantation. We determined the MHC I alleles according to PCR products of the fin cDNA from ayu. The http://www.jimmunol.org/ amplification was performed using the primers of MhcPlal-UAA*0101, MhcPlal-UAA*0201, and MhcPlal-UAA*0301 (Table II). HSPCs for

Nucleotide Sequence (5 transplantation were obtained from ayu whole kidney. Single-cell sus- 9

-3 pensions of whole kidney were prepared using a 100-mmwiremesh, 9 9 9 9 9 layered using a Ficoll gradient (GE Healthcare), and subsequently -3 -3 -3 -3 -3 centrifuged at 400 3 g for 25 min. The leukocyte fraction in the Ficoll- medium interface was collected and resuspended in PBS. The SP cells were sorted from whole kidney leukocytes using the MoFlo XDP Cell Sorter (Beckman Coulter Diagnostics) and deﬁned as HSPCs. Concen-

trated lentivirus with GFP was added to the culture medium, and 4 mg/ml by guest on October 2, 2021

9 polybrene (Sigma-Aldrich) was simultaneously added to increase the in- + -3 fection efﬁciency. After 48 h of transduction, GFP SP cells were sorted for transplantation. The SP cells were injected into an irradiated ayu (25 Gy) via caudal vessels. Limiting-dilution competitive repopulating unit (CRU) assays were AGCTTAAAAACCTTGACCTTAATCCGACCACTGGTTCTCTTGAAACCAGTGGTCGGATTAAGGT- GATCCCCGCACGTCATCTACACGGTGAATTCAAGAGATTCACCGTGTAGATGACGTGCTTTTTA AGCTTAAAAAGCACGTCATCTACACGGTGAATCTCTTGAATTCACCGTGTAGATGACGTGCGGG GATCCCCGGCAGGCAAGGTGATATATGTTTCAAGAGAACATATATCACCTTGCCTGCCTTTTTA AGCTTAAAAAGGCAGGCAAGGTGATATATGTTCTCTTGAAACATATATCACCTTGCCTGCCGGG GATCCCCGCATCCGTGAACTAAGGTTCCTTCAAGAGAGGAACCTTAGTTCACGGATGCTTTTTA AGCTTAAAAAGCATCCGTGAACTAAGGTTCCTCTCTTGAAGGAACCTTAGTTCACGGATGCGGG GATCCCCGGAAGTGCCGGTTATCGAATTTTCAAGAGAAATTCGATAACCGGCACTTCCTTTTTA AGCTTAAAAAGGAAGTGCCGGTTATCGAATTTCTCTTGAAAATTCGATAACCGGCACTTCCGGG GGGACACACTCCCTCAAAT GGGACACACTCCCTCAAAT CGTAGTAGACCATCTGAACC AGCGCGGCTTTAGAATCTC GGGACACACTCCCTCAAAT GTTACTCATATAGATTCCAGTG

CAAGGGGG performed as described previously (40). Lethally irradiated host ayu re------9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 + + 5 5 5 5 5 5 5 5 ceived a mix of limiting quantities of GFP-labeled CXCR4a or CXCR4b SP cells and 2 3 105 ayu whole kidney leukocytes. After 16 wk, the relative contribution of GFP+ leukocytes to total leukocytes was estab- lished. Animals with .1% donor contribution were considered positive for donor cell engraftment. The CRU frequency was calculated using LCALC Software (Stem Cell Technologies). The CRU frequencies of 1400 CXCR4a+ and 600 CXCR4b+ SP cells KX228907 5 MN148390 5 MN148391 5 MN156535 5 MN148393 5 MN628572 5 MN628573 5 I. 3 5 I. were similar to that of 2 10 whole kidney leukocytes. For analysis of Accession Number differentiation capability, 1400 CXCR4a+ SP cells labeled with GFP were EcoR Xho transplanted into ayu with 600 unlabeled CXCR4b+ SP cells serving as competitor cells. Moreover, 600 CXCR4b+ SP cells labeled with GFP were transplanted into ayu with 1400 unlabeled CXCR4a+ SP cells serving as competitor cells. The percentages of GFP+ MO/MFs, neutrophils, T cells, and B cells were analyzed by ﬂow cytometry. The ratios were deﬁned as SCL Gene MHC MHC MHC + + SDF-1 GFP MO/MFs divided by total MO/MFs, GFP neutrophils divided by CXCR4a CXCR4b total neutrophils, GFP+ CD4 cells divided by total CD4 cells, GFP+ CD8 cells divided by total CD8 cells, and GFP+ IgM cells divided by total IgM cells. HSPC proliferation To determine the proliferation status of the cells, DNA synthesis was

) measured by BrdU incorporation using BD Pharmingen BrdU Flow Kits (BD Biosciences) according to the manufacturer’s protocol. Ayu were given two daily doses of BrdU (6 mg per ayu) by injection (i.p.) for three Primer consecutive days. BrdU+ HSPCs were analyzed 3 h after the last

Continued administration. For proliferation analysis of PaCXCR4a+ and PaCXCR4b+ HSPCs, ayu were transplanted with PaCXCR4a+ and PaCXCR4b+ HSPCs, respectively, The underlined nucleotides representThe the underlined restriction nucleotides sites represent for the restriction sites for PaSRB2a-siRNA-antisense PaCXCR4a-siRNA-sense PaCXCR4a-siRNA-antisense PaCXCR4b-siRNA-sense PaCXCR4b-siRNA-antisense PaSDF-1-siRNA-sense PaSDF-1-siRNA-antisense PaSCL-siRNA-sense PaSCL-siRNA-antisense MhcPlal-UAA*0101f MhcPlal-UAA*0201f MhcPlal-UAA*0101r MhcPlal-UAA*0201r MhcPlal-UAA*0301f MhcPlal-UAA*0301r a b and gene knockdown, BrdU injection, and ﬂow cytometry were then

Table II. ( performed to measure HSPC proliferation. The Journal of Immunology 1231

Survival assay Ayu were transplanted with PaCXCR4a+ or PaCXCR4b+ HSPCs, and PaCXCR4a and PaCXCR4b were knocked down using lentivirus vectors encoding shRNA. Ayu were injected weekly with 5-ﬂuorouracil (100 mg/kg body weight) after 16 wk of HSPC transplantation, and the survival rates of the PaCXCR4a and PaCXCR4b knockdown ayu were monitored for 7 wk.

Statistics The data represent the mean 6 SEM. The biological repeats are indicated by n. Sample size was chosen based on preliminary data and observed effect sizes. Animal experiments were performed by an observer blinded to the experimental conditions. We analyzed the survival curves with the Kaplan–Meier method using SPSS (version 13.0) Software. The remaining data were analyzed by one-way ANOVA. When variances were signiﬁ- cantly different (p , 0.05), logarithmic transformation was used to stabilize the variance. If the normal distribution was not valid, statistical signiﬁcance was evaluated using the Mann–Whitney U test (two-tailed). The single, double, and triple asterisk symbols (*, **, and ***) represent p values , 0.05, 0.01, and 0.001, respectively.

Results Downloaded from Characterization and expression of two teleost CXCR4 genes in HSPCs To elucidate the expression and function of CXCR4 proteins in teleosts, we ﬁrst obtained the PaCXCR4a and PaCXCR4b gene sequences from transcriptome data (GSE73321). Sequence com-

parisons revealed that PaCXCR4a and PaCXCR4b shared 85.0 and http://www.jimmunol.org/ 73.6% amino acid identity, respectively, with the large yellow croaker and cavefish genes. Phylogenetic analysis indicated that the fish CXCR4b genes were grouped together to form a cluster distinct from that of the fish CXCR4a and mammalian CXCR4 clusters (Fig. 1A, Table I). Because HSPCs are known to exist in teleost whole kidney (41), the HSPC function in ayu whole kidney was investigated. After Vibrio anguillarum infection or LPS treatment, PaCXCR4a was dramatically upregulated, whereas PaCXCR4b

was slightly upregulated in the whole kidney (Fig. 1B, Table II). by guest on October 2, 2021 The PaCXCR4a protein level was upregulated in ayu HSPCs (SP cells) after LPS treatment, whereas the PaCXCR4b protein level was not changed after LPS treatment (Fig. 1C). We further investigated the surface expression of PaCXCR4a and PaCXCR4b in ayu HSPCs, revealing that the surface expression of PaCXCR4a was increased after LPS treatment (Fig. 1D). Moreover, PaCXCR4a mRNA was expressed in PaCXCR4a+ HSPCs, whereas PaCXCR4b mRNA was expressed in PaCXCR4b+ HSPCs (Fig. 1E). PaSRB2a is important for LPS internalization, and we knocked down PaSRB2a in ayu HSPCs by shRNA. The shRNA expression efficiency of the lentiviruses detected in HEK293T cells reached .90% using the expression of GFP as an indicator for PaSRB2a expression (Fig. 2A). PaSRB2a shRNA reduced the mRNA levels of PaSRB2a in both the whole kidney and HSPCs (Fig. 2B). PaCXCR4a, PaCXCR4b, and PaSDF-1 were measured in LPS- FIGURE 2. PaSRB2a mediated the effect of LPS on ayu HSPCs. (A) treated HSPCs after PaSRB2a shRNA incubation. PaCXCR4a shRNA expression efficiency of lentiviruses. Scale bar, 100 mm. GFP mRNA was upregulated in LPS-stimulated HSPCs from the fluorescence was detected in HEK293T cells by microscopy. (B) PaSRB2a pSUPER-treated ayu (Fig. 2C). In the LPS-treated groups, mRNA levels in whole kidney and HSPC after delivery of lentiviruses into PaSRB2a shRNA treatment reduced PaCXCR4a mRNA levels C ayu. ( ) PaCXCR4a mRNA levels after PaSRB2a shRNA treatment in in ayu HSPCs (Fig. 2C). To investigate whether the binding of HSPCs from LPS-treated ayu. (D) The binding of LPS with PaCXCR4a LPS to PaCXCR4a induced auto-upregulation of receptor ex- did not affect the auto-upregulation of receptor expression. LPS was used to induce PaCXCR4a expression in ayu, and shRNA treatment was then pression, we used LPS to induce PaCXCR4a expression in ayu employed to knock down PaSRB2a expression. PaCXCR4a mRNA was first and shRNA treatment was employed to knock down PaSRB2a detected in HSPCs of ayu after secondary LPS stimulation. (E) PaCXCR4b mRNA levels after PaSRB2a shRNA treatment in HSPCs from LPS- treated ayu. (F) PaSDF-1 mRNA levels after PaSRB2a shRNA treatment in the whole kidney from LPS-treated ayu (n = 5). (G) PaCXCR4a and levels in whole kidney from LPS-treated ayu (n = 5). Each bar represents PaCXCR4b protein levels in HSPCs from LPS-treated ayu. Representative the mean 6 SE. Data are representative of two independent experiments. blots of three independent experiments are shown. (H) PaSDF-1 protein **p , 0.01, ***p , 0.001, ##p , 0.01, ###p , 0.001. 1232 THE ROLES OF TWO CXCR4s IN TELEOST HSPCS

expression. Hence, PaCXCR4a was expressed in ayu HSPCs, which have low PaSRB2a expression after LPS and PaSRB2a shRNA treatment. We found that PaCXCR4a expression was not changed in HSPCs from ayu with upon secondary LPS stimulation (Fig. 2D). These results did not support that the binding of LPS to PaCXCR4a induce the auto-upregulation of receptor expression. There was no significant change in the expression of PaCXCR4b after PaSRB2a shRNA treatment (Fig. 2E), and PaSRB2a shRNA reduced the LPS-induced inhibition of SDF-1 transcription (Fig. 2F). Moreover, PaSRB2a shRNA also reduced LPS-induced PaCXCR4a protein levels in ayu HSPCs (Fig. 2G). The ELISA results showed that PaSRB2a shRNA reduced the LPS-induced inhibition of PaSDF-1 protein expression (Fig. 2H). These data suggest that LPS regulates the expression of PaCXCR4a and PaSDF-1 in HSPCs. Receptor binding assay of two teleost CXCR4 genes A receptor-binding assay showed that the SDF-1–binding activity of PaCXCR4b was significantly higher than that of PaCXCR4a, whereas the LPS-binding activity of PaCXCR4a was significantly Downloaded from higher than that of PaCXCR4b (Fig. 3A). In PaCXCR4a transfected HEK293T cells, increasing [125I]-LPS concentration resulted in a typical saturation curve with Kd value of 10.29 mg/ml (Supplemental Fig. 2A). In a competitive binding assay, unlabeled 125 LPS displaced [ I]-LPS with IC50 values of 4.42 mg/ml (Supplemental Fig. 2B). These data demonstrated that PaCXCR4a http://www.jimmunol.org/ had a good affinity for LPS. We also detected LPS binding in PaSRB2a-transfected HEK293T cells (Fig. 3B). In HEK293T cells double-transfected with PaCXCR4a and PaSRB2a, additive LPS binding was detected compared with that in PaCXCR4a- transfected HEK293T cells (Fig. 3B). Moreover, BPI inhibited LPS binding in PaCXCR4a-transfected HEK293T cells, whereas LECT2 did not affect LPS binding in PaCXCR4a-transfected HEK293T cells (Fig. 3C). We further explored the interactions by guest on October 2, 2021 of SDF-1 or LPS in HEK293T cells with PaCXCR4a/PaCXCR4b chimeras (Fig. 3D), revealing that the N terminus of PaCXCR4b was crucial for the interaction with PaSDF-1 (Fig. 3E) and that the extracellular loop 2 of PaCXCR4a was crucial for interaction with LPS (Fig. 3F). Because two CXCR4 genes generally exist in teleosts, we further performed receptor-binding assays of the two CXCR4 genes in other teleost species, the large yellow croaker and the tiger puffer. A receptor-binding assay showed that the SDF-1–binding activity of CXCR4b was significantly higher than that of CXCR4a, whereas the LPS-binding activity of CXCR4a was significantly higher than that of CXCR4b in large yellow croaker (Fig. 4A, 4B). The SDF- 1–binding activity of CXCR4b was significantly higher than that of CXCR4a, whereas the LPS-binding activity of CXCR4a was significantly higher than that of CXCR4b in tiger puffers (Fig. 4C, 4D). These data suggest that the different binding activities of CXCR4a and CXCR4b are a general phenomenon in teleosts. FIGURE 3. Binding activity analysis of the two PaCXCR4 genes. (A) Two teleost CXCR4s mediate HSPC mobilization The differential binding activity of PaCXCR4a or PaCXCR4b with SDF-1 or LPS. The value of PaCXCR4b binding with SDF-1 was set to 1, and the Postinfection, HSPC homeostasis is affected by many factors, value of PaCXCR4a binding with LPS was set to 1. The HEK293T cells including bacterial components and host-derived cytokines, in were transfected with PaCXCR4a or PaCXCR4b. (B) LPS-binding activity mammals. We further investigated whether the HSPC number in C in PaCXCR4a and PaSRB2a double-transfected HEK293T cells. ( ) LPS- the blood is regulated by infection. Escherichia coli infection binding activity after BPI peptide or LECT2 treatment in PaCXCR4a- resulted in a dramatic increase in the HSPC number in the blood transfected HEK293T cells. BPI peptide and LECT2 were incubated with of ayu (Fig. 5A), whereas the HSPC number was decreased in the HEK293T cells in all 3 mM. (D) Schematic representations of PaCXCR4a/ PaCXCR4b chimeras. (E) The binding activity of SDF-1 with PaCXCR4a/ blood of infected ayu 1 d after treatment with the BPI peptide, PaCXCR4b chimeras in HEK293T cells. (F) The binding activity of LPS which neutralizes LPS (Fig. 5A). Moreover, infection in teleosts with PaCXCR4a/PaCXCR4b chimeras in HEK293T cells. Each bar rep- upregulates the expression of the cytokine LECT2 (42), which resents the mean 6 SE (n = 5). Data are representative of three inde- regulates HSPC homeostasis in mammals (15). We further in- pendent experiments. *p , 0.05, **p , 0.01, ***p , 0.001, #p , 0.05. vestigated whether the HSPC number in the blood of infected ayu The Journal of Immunology 1233

FIGURE 4. Binding activity analysis of CXCR4s from large yellow croaker and tiger puffer. (A and B) The interaction of large yellow croaker CXCR4s with SDF-1 or LPS. (C and D) The interaction of tiger puffer CXCR4s with SDF-1 or LPS. The value of CXCR4b interacting with SDF-1 was set to 1, and the value of CXCR4a interacting with LPS was set to 1. Each bar represents the mean 6 SE (n = 5). Data are representative of two independent experiments. ***p , 0.001.

was regulated by LECT2. The HSPC number was decreased in the (Fig. 6C, 6D), suggesting that LECT2 mobilized more HSCs into blood of infected ayu 3 d after treatment with an anti-LECT2 Ab blood compared with LPS. Moreover, the CFU-C number was (Fig. 5B). We further investigated the effect of V. anguillarum increased in the blood of LPS- or LECT2-treated ayu (Fig. 6E). infection on the HSPC number in blood after LPS neutralization The CRU frequency in the blood of LECT2-treated ayu was 2.5- or LECT2 blockage. V. anguillarum infection resulted in an in- fold higher than that of LPS-treated ayu, whereas the number of crease in the HSPC number in ayu blood (Fig. 5C). The HSPC CFU-Cs in the blood of LECT2-treated ayu was 1.3-fold higher Downloaded from number was decreased in the blood of infected ayu 3 d after than that of LPS-treated ayu. Hence, we further investigated the treatment with the BPI peptide (Fig. 5C). After V. anguillarum CRU frequency of PaCXCR4a+ and PaCXCR4b+ HSPCs. The infection, the HSPC number in the blood was decreased at 4 d CRU frequency was 1 per 331 in PaCXCR4a+ HSPCs from ayu after treatment with an anti-LECT2 Ab (Fig. 5D). whole kidney and 1 per 144 in PaCXCR4b+ HSPCs from ayu The transfection efﬁciency of the lentiviruses was detected using (Fig. 6F), suggesting that the numbers of HSCs in PaCXCR4b+ SP the expression of GFP as an indicator for HSPCs. The GFP-labeled cells was higher compared with PaCXCR4a+ SP cells. PaCXCR4a+ HSPCs were transplanted into ayu with 2 3 105 whole kidney and PaCXCR4b+ HSPCs therefore possess different reconstitution http://www.jimmunol.org/ leukocytes, and GFP+ immune cells in ayu were differentiated capabilities. from transplanted GFP-labeled HSPCs. The positive rates of GFP+ We further investigated whether the SDF-1/PaCXCR4 axis immune cells maintained within the ayu graft are shown in participated in LPS- or LECT2-induced HSPC mobilization. Al- Fig. 6A. The similar frequencies of MO/MFs, neutrophils, T cells, though the number of CFU-Cs was negligible in PaCXCR4a+ cells and B cells were found after GFP-labeled HSPC transplantation, that were isolated by magnetic beads from the whole kidney and suggesting that GFP labeling did not change the differentiation of blood of healthy ayu, the number of CFU-Cs in PaCXCR4a+ cells immune cells. The number of hematopoietic stem cells (HSCs) from both whole kidney and blood were detectable in LPS-treated + were further estimated by measuring the whole kidney repopu- ayu (Fig. 7A, 7B). The number of CFU-Cs in PaCXCR4b cells by guest on October 2, 2021 lating cells, known as the CRU, the frequency of which was from blood was not increased in LPS-treated ayu compared with measured using a competitive limiting-dilution repopulation assay that of PBS-treated ayu (Fig. 7C, 7D). The experimental protocol (Fig. 6B). The frequency of CRUs was 14.1 and 35.7 per ml in to analyze the effect of the SDF-1/CXCR4 axis on LPS-induced the blood of LPS-treated and LECT2-treated ayu, respectively HSPC mobilization is shown in Fig. 7E. Although the number of

FIGURE 5. LPS and LECT2 participate in HSPC mobilization in ayu. (A) The number of CFU-Cs in one million WBCs after BPI peptide treatment in E. coli– infected ayu. Ayu were injected i.p. with 1 3 108 CFU of E. coli.(B) The number of CFU-Cs in one million WBCs after anti-LECT2 Ab treatment in E. coli–infected ayu. (C) The number of CFU-Cs in blood after BPI peptide treatment in V. anguillarum–infected ayu. Ayu were injected i.p. with 1 3 103 CFU of V. anguillarum.(D) The number of CFU-Cs in blood in V. anguillarum–infected ayu after anti-LECT2 Ab treatment. Each bar represents the mean 6 SE, n =5. Data are representative of two independent experiments. *p , 0.05, **p , 0.01, ***p , 0.001. 1234 THE ROLES OF TWO CXCR4s IN TELEOST HSPCS Downloaded from http://www.jimmunol.org/ by guest on October 2, 2021

FIGURE 6. The number of HSPCs in the blood of LPS- and LECT2- treated ayu. (A)GFP+ immune cells are maintained within the ayu graft. Scale bar, 50 mm. GFP ﬂuorescence was detected in HEK293T cells by microscopy. GFP+ leukocytes were detected in the blood after transplantation with HSPCs labeled with GFP. (B) The protocol used to detect the CRU of ayu HSPCs. (C and D) The frequency of CRU in the blood of LPS- or LECT2-treated ayu. (E) The number of CFU-Cs in the blood of LPS- or LECT2-treated ayu. (F) The frequency of CRU within each group of ayu competitively transplanted with PaCXCR4a+ or PaCXCR4b+ HSPCs at each dose (n = 15 each point). Horizontal dashed line, 37% of recipient mice failed to be engrafted. Vertical dashed lines, various CRU frequencies for each treatment. ***p , # 0.001, p , 0.05. FIGURE 7. LPS induced HSPC mobilization via the SDF-1/CXCR4 axis in ayu. (A and B) The number of CFU-Cs per 106 cells after LPS treatment among PaCXCR4a+ cells in the whole kidney. (B) The number of CFU-Cs per 106 cells CFU-Cs was not changed in blood after PBS treatment in after LPS treatment among PaCXCR4a+ cells in blood. (C) The number of CFU- PaCXCR4a shRNA-treated ayu, PaCXCR4a shRNA reduced Cs per 106 cells after LPS treatment among PaCXCR4b+ cells in the whole the LPS-induced promotion of the number of CFU-Cs in ayu kidney. (D) The number of CFU-Cs per 106 cells after LPS treatment among blood (Fig. 7F). However, PaCXCR4b and PaSDF-1 shRNA PaCXCR4b+ cells in blood. (E) The protocol used to evaluate the effect of LPS 6 treatment led to an increase in the number of CFU-Cs in the on HSPC mobilization. (F) The number of CFU-Cs per 10 cells of whole kidney and blood after LPS treatment in PaCXCR4a knockdown ayu. (G)The blood of LPS-treated ayu (Fig. 7G, 7H). Because BPI affected 6 the binding of LPS with PaCXCR4a and PaSRB2a affected number of CFU-Cs per 10 whole kidney and blood cells after LPS treatment in the PaCXCR4b knockdown ayu. (H) The number of CFU-Cs per 106 whole PaCXCR4a expression, we further investigated the effect of kidney and blood cells after LPS treatment in PaSDF-1 knockdown ayu. (I)The BPI and PaSRB2a on HSPC mobilization, revealing that BPI number of CFU-Cs per 106 whole kidney and blood cells after LPS treatment in peptide and PaSRB2a shRNA treatment reduced the LPS- BPI peptide treated ayu. (J)ThenumberofCFU-Csper106 whole kidney and induced HSPC mobilization (Fig. 7I, 7J). Hence, PaCXCR4a, blood cells after LPS treatment in PaSRB2a knockdown ayu. Each bar repre- BPI, and PaSRB2 affected LPS-induced HSPC mobilization sents the mean 6 SE (n = 5). Data are representative of three independent ex- in ayu. periments. **p , 0.01, ***p , 0.001, #p , 0.05, ##p , 0.01, ###p , 0.001. The Journal of Immunology 1235

FIGURE 8. LECT2 induced HSPC mobilization via the SDF-1/CXCR4 axis in ayu. (A) The number of CFU-Cs per 106 cells among PaCXCR4b+ cells after LPS treatment. (B) The number of CFU-Cs per 106 whole kidney and blood cells after LPS treatment in PaCXCR4b knockdown ayu. (C) The number of CFU- Cs per 106 cells after LPS treatment in the PaSDF-1 knockdown ayu. Each bar represents the mean 6 SE (n = 5). Data are representative of three independent experiments. **p , 0.01, ***p , 0.001, ##p , 0.01, ###p , 0.001. Downloaded from http://www.jimmunol.org/

LECT2, a multifunctional cytokine, can induce HSPC mobili- of HSPCs in PaCXCR4b shRNA–treated ayu, PaCXCR4b zation. We further explored whether the SDF-1/PaCXCR4 axis shRNA–treated ayu died more readily from hematological mediated LPS-induced HSPC mobilization. The number of CFU- failure after depletion of cycling HSPCs by weekly challenge by guest on October 2, 2021 Cs from PaCXCR4b+ cells in both the whole kidney and blood with the cell cycle cytotoxic agent 5-fluorouracil (Fig. 9D). increased significantly after LECT2 treatment, especially in the Furthermore, PaSDF-1 inhibited HSPC proliferation in the pSUPER- blood (Fig. 8A). No CFU-Cs were detected in PaCXCR4a+ cells treated ayu but not in the PaCXCR4b shRNA–treated ayu (Fig. 9E). from the whole kidney and blood after BSA or LECT2 treatment. Hence, the SDF-1/CXCR4b axis inhibited HSPC proliferation PaCXCR4b shRNA increased HSPC mobilization in the BSA- in ayu. treated ayu (Fig. 8B). LECT2 also increased HSPC mobilization To analyze ROS production, cells were stained with DHR, and in the pSUPER-treated ayu (Fig. 8B). However, LECT2 did not the fluorescence emitted by the oxidized DHR was measured by increase HSPC mobilization in the PaCXCR4b shRNA–treated flow cytometry. ROS levels were lower in PaCXCR4b+ HSPCs ayu (Fig. 8B). Furthermore, LECT2 also did not increase HSPC than in PaCXCR4a+ HSPCs (Fig. 10A). Because ROS have been mobilization in the PaSDF-1 shRNA–treated ayu (Fig. 8C). found to regulate HSPC proliferation (43), we further investigated Hence, PaCXCR4b and PaSDF-1 mediated LECT2-induced HSPC whether ROS mediated the proliferation of PaCXCR4a+ and mobilization. PaCXCR4b+ HSPCs. Briefly, PaCXCR4a+ or PaCXCR4b+ HSPCs were isolated from infected ayu. PaCXCR4a expression in The effect of two CXCR4 genes on proliferation PaCXCR4a+ HSPCs and PaCXCR4b expression in PaCXCR4b+ We further evaluated the proliferation capacity of HSPCs treated HSPCs were knocked down by shRNA treatment. ROS were de- with PaCXCR4a or PaCXCR4b shRNA. BrdU can be incorporated tected in HSPCs after PaCXCR4a+ or PaCXCR4b+ HSPCs into the newly synthesized DNA in place of thymidine and is transplanted into ayu (Fig. 10B). Although PaCXCR4a shRNA commonly used in cell proliferation studies, and the percentage of treatment did not affect the ROS levels in PaCXCR4a+ HSPCs BrdU+ HSPCs in the whole kidney was markedly increased in the (Fig. 10C), PaCXCR4b shRNA treatment increased the ROS PaCXCR4b+ HSPCs from the PaCXCR4b shRNA–treated ayu levels in PaCXCR4b+ HSPCs (Fig. 10D). PaCXCR4a shRNA (Fig. 9A), suggesting that PaCXCR4b knockdown increased HSPC treatment did not affect HSPC proliferation, which was blocked proliferation. We further investigated the roles of PaCXCR4a and by the ROS inhibitor N-acetylcysteine (NAC) (Fig. 10E). PaCXCR4b in hematological failure. First, we distinguished the PaCXCR4b shRNA treatment enhanced HSPC proliferation, fish that died of hematological failure rather than from infection. whereas NAC blocked the PaCXCR4b effect on HSPC prolifera- The CFU-C number was significantly decreased in the blood of tion (Fig. 10F). PaSDF-1 treatment decreased the ROS levels of the ayu that were dying from hematological failure, whereas the PaCXCR4b+ HSPCs but not those of PaCXCR4a+ HSPCs CFU-C number was significantly increased in the blood of (Fig. 10G, 10H). PaSDF-1 treatment did not affect the ROS levels V. anguillarum–infected fish (Fig. 9B). There was no significant in PaCXCR4b shRNA–treated HSPCs (Fig. 10H). These data change in the PaCXCR4a+ HSPCs from the PaCXCR4a shRNA– suggested that ROS mediated CXCR4b knockdown–induced treated ayu (Fig. 9C). In accordance with the enhanced proliferation HSPC proliferation. 1236 THE ROLES OF TWO CXCR4s IN TELEOST HSPCS Downloaded from http://www.jimmunol.org/

FIGURE 10. PaCXCR4b mediated HSPC proliferation through ROS signaling. (A) ROS levels in PaCXCR4a+ and PaCXCR4b+ HSPCs. (B) The protocol used to evaluate the effect of ROS on the proliferation of PaCXCR4a+ and PaCXCR4b+ HSPCs. (C) ROS levels were not changed in HSPCs after PaCXCR4a knockdown. (D) ROS levels were upregulated in + + FIGURE 9. Proliferation analysis of PaCXCR4a and PaCXCR4b HSPCs after PaCXCR4b knockdown. (E) Proliferation of PaCXCR4a + + HSPCs. (A) Percentage of BrdU HSPCs in the whole kidney of PaCXCR4a knockdown HSPCs after treatment with NAC, an inhibitor of ROS. (F)

+ by guest on October 2, 2021 or PaCXCR4b HSPC-transplanted ayu. Proliferation was determined by Proliferation of PaCXCR4b knockdown HSPCs after treatment with NAC. BrdU incorporation assay (n = 5). Each bar represents the mean 6 SE. (G) PaSDF-1 did not affect the ROS content in HSPCs. (H) PaSDF-1 6 (B) The number of CFU-Cs per 10 blood cells in ayu after 5-FU or decreased the ROS content in HSPCs. Each bar represents the mean 6 SE V. anguillarum treatment. (C) The survival rate of pSUPER- and PaCXCR4a (n = 5). Data are representative of three independent experiments. shRNA–treated ayu. (D) The survival rate of PaCXCR4b shRNA–treated ayu. *p , 0.05, ***p , 0.001. (E) Percentage of BrdU+ HSPCs after PaCXCR4b shRNA or PaSDF-1 treatment. Ayu were injected weekly with 5-FU (100 mg/kg body weight). For infection, ayu were injected i.p. with 1 3 104 CFU of V. anguillarum (n =25in GFP+ cell ratio of CD4+, CD8+, and IgM+ cells after transplan- each group). *p , 0.05, ***p , 0.001. tation with PaCXCR4a+ HSPCs was similar to that after transplantation with PaCXCR4b+ HSPCs (Fig. 12C–E).

+ Transcription factors play important roles in the differentiation The differentiation capability of CXCR4a and + + capability of HSPCs. In PaCXCR4a HSPCs, the mRNA ex- CXCR4b HSPCs pression of the transcription factors SCL and C/EBPa was sig- We further investigated the differentiation capability of PaCXCR4a+ nificantly higher than that of in PaCXCR4b+ HSPCs (Fig. 13A, HSPCs. The mRNA levels of GATA2, RUNX1 (mainly expressed 13B). The mRNA expression levels of GATA3, Ikaros, and in HSPCs), GATA3, PAX5 (mainly expressed in lymphocytes), Mef2C in PaCXCR4b+ HSPCs were significantly higher than EGR1, PU.1, and MPO (mainly expressed in myeloid cells) were those in PaCXCR4a+ HSPCs (Fig. 13C–E). Because SCL ex- measured in CFU-Cs from PaCXCR4a+ and PaCXCR4b+ cells. pression in PaCXCR4a+ HSPCs was 3.25-fold greater than that The mRNA expression of GATA2 and RUNX1 was downregu- in PaCXCR4b+ HSPCs, we focused on SCL as an example to lated after stimulation with PMA in both PaCXCR4a+ and investigate the effect of PaCXCR4 on SCL expression. In iso- PaCXCR4b+ HSPCs (Fig. 11A, 11B). The expression levels of lated PaCXCR4a+ HSPCs, SCL expression was downregulated GATA3 and PAX5 in PaCXCR4b+ CFU-Cs were similar to those after PaCXCR4a shRNA treatment (Fig. 13F). PaCXCR4b shRNA in PaCXCR4a+ cells (Fig. 11C, 11D). The expression levels of treatment did not affect SCL expression in HSPCs (Fig. 13G). EGR1, PU.1, and MPO were higher in PaCXCR4a+ CFU-Cs than Moreover, LPS also increased SCL expression in HSPCs in PaCXCR4b+ cells (Fig. 11E–G). (Fig. 13H). In the SCL knockdown ayu, the mRNA expression of We further explored the differentiation capability of PaCXCR4a+ PaCXCR4a and PaCXCR4b in the ayu whole kidney was not and PaCXCR4b+ HSPCs by transplantation. GFP-labeled PaCXCR4a+ changed (Fig. 13I, 13J). The SCL protein levels were downregu- or PaCXCR4b+ HSPCs were transplanted into ayu. The GFP+ lated in HSPCs after PaCXCR4a shRNA treatment (Fig. 13K). cell ratio of MO/MFs and neutrophils after transplantation with Furthermore, LPS increased SCL mRNA expression in HSPCs of PaCXCR4a+ HSPCs was significantly higher than that after the pSUPER-treated ayu but not in those of the PaCXCR4a transplantation with PaCXCR4b+ HSPCs (Fig. 12A, 12B). The shRNA–treated ayu (Fig. 13L). The Journal of Immunology 1237 Downloaded from

FIGURE 12. PaCXCR4a+ and PaCXCR4b+ HSPCs displayed distinct differentiation patterns. (A and B) The GFP+ cell ratio of MO/MFs and + + neutrophils in ayu after PaCXCR4a or PaCXCR4b HSPC transplanta- http://www.jimmunol.org/ tion. (C–E) The GFP+ cell ratio of T and B cells in ayu after PaCXCR4a+ or PaCXCR4b+ HSPC transplantation. Each bar represents the mean 6 SE (n = 5). Data are representative of three independent experiments. ***p , 0.001.

transplantation with SCL shRNA–treated HSPCs (Fig. 14C–E). Furthermore, SCL shRNA treatment did not change the mRNA expression of GATA3 and PAX5 in CFU-Cs from HSPCs by guest on October 2, 2021 (Fig. 14F, 14G). SCL shRNA treatment decreased the mRNA expression of EGR1, PU.1, and MPO in CFU-Cs from HSPCs (Figs. 14H–J, 15).

Discussion Chemokine receptors have been identified in diverse teleosts, with great differences between teleosts and mammals (16). A variety of teleost species possess two copies of the CXCR4 gene (16), whereas only one CXCR4 gene exists in mammals. In teleosts, CXCR4s have been found to be involved in development and neutrophil recruitment (26–28), and we further investigated the functions of CXCR4a and CXCR4b in the hematopoietic system of teleosts. First, we found that CXCR4a and CXCR4b had different binding activities for LPS and SDF-1. The different binding FIGURE 11. The expression of lineage markers in CFU-Cs from activities of CXCR4a and CXCR4b also existed in other teleosts, + + A B PaCXCR4a and PaCXCR4b HSPCs. ( and ) mRNA expression of large yellow croaker and tiger puffer. Moreover, CXCR4a+ and GATA2 and RUNX1 in CFU-Cs from PaCXCR4a+ or PaCXCR4b+ CXCR4b+ HSPCs displayed significant differences in HSPC ho- HSPCs. (C and D) mRNA expression of GATA3 and PAX5 in CFU-Cs from PaCXCR4a+ or PaCXCR4b+ HSPCs. (E and F) mRNA expression of meostasis. To our knowledge, this report is the first study to il- EGR1 and PU.1 in CFU-Cs from PaCXCR4a+ or PaCXCR4b+ HSPCs. (G) lustrate the subfunctionalization of CXCR4a and CXCR4b in the mRNA expression of MPO in CFU-Cs from PaCXCR4a+ or PaCXCR4b+ hematopoietic system of teleosts. The gene duplication of the HSPCs. Target gene transcripts were normalized to 18S rRNA transcripts. immune system may contribute to different immune regulation in Each bar represents the mean 6 SE (n = 5). Data are representative of teleosts compared with that in mammals (44, 45). Considering the two independent experiments. ***p , 0.001, #p , 0.05, ##p , 0.01, well-known importance of CXCR4 in mammalian HSPC ho- ### p , 0.001. meostasis (46), the subfunctionalization of CXCR4a and CXCR4b in teleosts is helpful for understanding the evolution of the he- The effect of SCL on the differentiation capability of HSPCs was matopoietic system in vertebrates. further investigated. The GFP+ percentages of MO/MFs and Peripheral inflammation or infection will affect the hemato- neutrophils were decreased in the blood of ayu after transplanta- poietic microenvironment to regulate HSPC mobilization in ver- tion with SCL shRNA–treated HSPCs (Fig. 14A, 14B). The GFP+ tebrates (6). We first found that PaCXCR4b knockdown increased percentages of T and B cells were not changed in ayu after HSPCs in ayu blood and decreased HSPCs in ayu whole kidney. 1238 THE ROLES OF TWO CXCR4s IN TELEOST HSPCS

FIGURE 13. PaCXCR4a mediated SCL upregulation. (A–E) The mRNA expression of transcription factors in PaCXCR4a+ or PaCXCR4b+ HSPCs. (F and G) SCL mRNA expression in PaCXCR4a or PaCXCR4b knockdown ayu. (H) SCL mRNA expression was upregulated after LPS treatment. (I and J) PaCXCR4a and PaCXCR4b mRNA expression in the whole kidney of SCL knockdown ayu. (K) The effect Downloaded from of PaCXCR4a shRNA on SCL protein levels. (L) LPS did not change the SCL expression after PaCXCR4a shRNA treatment. Each bar represents the mean 6 SE (n = 5). Data are representative of three independent experiments. *p , 0.05, **p , 0.01, ***p , 0.001. http://www.jimmunol.org/ by guest on October 2, 2021

Hence, CXCR4b participates in HSPC mobilization from kidney (51), LPS affects HSPC homeostasis by interacting with TLR4 into blood in teleosts. In mammals, CXCR4 also plays a major (14). However, TLR4 does not mediate LPS-induced HSPC mo- role in HSPC mobilization and retention in the hematopoietic bilization (14). In this study, we further found that LPS also in- microenvironment (47). Teleost CXCR4b may perform a similar duced HSPC mobilization through CXCR4a. Our data did not function with mammalian CXCR4 in HSPC mobilization. In support that CXCR4b participated in LPS-induced HSPC mobi- mammals, LPS induces HSPC mobilization through its receptor lization in ayu. Moreover, CXCR4a+ HSPCs exhibited a lower TLR4 and NOD-like receptors (8). Infection and inflammation CRU frequency but a higher proliferation capability than CXCR4b+ also upregulate the expression of host-derived cytokines such as HSPCs. Hence, we found specific LPS-mobilized HSPCs marked G-CSF, which is widely known to mediate HSPC mobilization by CXCR4a, suggesting that teleosts produce bacterial infection– (48). In this study, we found that LPS regulated HSPC mobili- derived HSPCs. In our previous work, we identified SRB2a as the zation through CXCR4a, whereas LECT2 regulated HSPC mo- late-phase allergic skin reaction in teleost macrophages, including bilization through CXCR4b and SDF-1 in teleosts. These results those from ayu (52). In this study, we found that both PaCXCR4a suggest that HSPC mobilization is regulated by both pathogen and PaSRB2a were expressed in the HSPCs of ayu as LPS recep- components and host cytokines in vertebrates. In teleosts, G-CSF tors. BPI, PaSRB2a, and PaCXCR4a affected LPS-induced HSPC also plays an important role in HSPC proliferation (49). However, mobilization in ayu. Although PaSRB2a regulated PaCXCR4a ex- G-CSF mobilization of HSPCs has not been observed in teleosts pression after binding with LPS, PaCXCR4a did not affect the auto- (13). Postinfection, the multifunctional cytokine LECT2 is down- upregulation of receptor expression after binding with LPS. Hence, regulated in mammals (50), whereas it is dramatically upregulated in PaSRB2a and PaCXCR4a have different functions as LPS receptors teleosts (42). LECT2, not G-CSF, induces HSPC mobilization in in HSPCs of ayu. teleosts, suggesting that the mechanisms of infection-induced HSPC We further found that CXCR4b preferred to interact with SDF-1, mobilization are different between teleost and mammals. Although which is the sole endogenous chemokine ligand for the CXCR4 of teleost CXCR4b plays a similar role with mammalian CXCR4 in mammalian HSPCs (29). Furthermore, CXCR4b+ HSPCs could HSPC mobilization, cytokine-mediated HSPC mobilization is diverse not be significantly mobilized after LPS treatment in teleosts. in vertebrates. CXCR4b+ HSPC mobilization was induced by the endogenous We first found that CXCR4a preferentially interacted with LPS cytokine LECT2 after 5 d of treatment. Moreover, CXCR4b also in teleosts. Although mammalian CXCR4 can interact with LPS inhibited the ROS level in HSPCs to prevent their proliferation in The Journal of Immunology 1239

FIGURE 15. Teleost CXCR4s mediate HSPC proliferation, mobilization, and differentiation. CXCR4b suppresses ROS levels in HSPCs, whereas CXCR4a does not affect ROS levels in HSPCs. LPS preferentially mobilizes CXCR4a+ HSPCs into the blood, whereas LECT2 preferentially mobilizes CXCR4b+ HSPCs into the blood. CXCR4a+ HSPCs preferentially differentiate into myeloid cells.

ayu HSPCs. SCL has been found to direct HSC fate in mammals Downloaded from (59). We do not exclude the possibility that other transcription factors may also mediate the differentiation of CXCR4a+ HSPCs. Because SCL shows the highest differential expression between CXCR4a+ and CXCR4b+ HSPCs, SCL may be the main transcription factor that regulates HSPC differentiation.

The immune systems between teleosts and mammals are dif- http://www.jimmunol.org/ ferent in a variety of aspects, including phagocyte types (60–62). Because HSPCs give rise to different lineages of immune cells, investigating HSPC homeostasis regulation will contribute to better understanding the evolution of the vertebrate immune system. The isolation and characterization of HSPCs have been performed in several teleosts, including zebrafish (42), carp (63), goldfish (64, 65), and ayu (13). Transplantation is a crucial method to investigate HSPC function in both mammals and teleosts. In FIGURE 14. SCL mediated HSPC differentiation. (A–E) The ratio of zebrafish, several approaches have been used to improve en- by guest on October 2, 2021 GFP+ immune cells in ayu after the transplantation of pSUPER- or SCL shRNA–treated ayu HSPCs. (F–J) The expression of lineage markers in graftment rates, including the application of sublethal irradiation CFU-Cs from pSUPER- or SCL shRNA–treated ayu HSPCs. Each bar (66), MHC-matched donors (67), and embryonic recipients (68). represents the mean 6 SE (n = 5). Data are representative of three inde- In this study, we developed a transplantation method using GFP- pendent experiments. **p , 0.01, ***p , 0.001. labeled HSPCs in MHC-matched ayu after irradiation, and no host-versus-graft reactions were observed. In principle, this strategy can be used in other teleosts to investigate HSPC function ayu. CXCR4b may prevent HSPC exhaustion at the early stage of by GFP labeling in MHC-matched animals for transplantation. bacterial infection because CXCR4b has a low affinity for LPS In summary, our study reveals that the chemokine receptors and inhibits HSPC proliferation. LPS plays an important role in CXCR4a and CXCR4b mediate HSPC homeostasis in teleosts infection to induce HSPC exhaustion through the TLR4 down- (Fig. 15). CXCR4a preferentially binds with LPS, whereas CXCR4b stream adapters TRIF and MyD88 (53). HSPC exhaustion during preferentially binds with SDF-1. CXCR4a+ HSPCs are prone to infection is detrimental to the replenishment of immune cells (14). differentiate into innate immune cells. Our study illustrates that Hence, the fact that CXCR4b+ HSPCs do not mobilize after LPS the two CXCR4 genes in teleosts may stabilize the HSPC pool treatment keep the immune system stable. postinfection, which also supports the concept that LPS tolerance As primary vertebrate species, teleosts possess both innate in teleosts results from CXCR4b+ HSPCs not mobilizing into the immune and adaptive immune systems (54). The innate immune blood after LPS treatment. system of teleosts has more diverse immune molecules than that of mammals, including lectins, complement, and NK cell receptors Disclosures (30, 55). However, the adaptive immune system of teleosts has The authors have no financial conflicts of interest. fewer Ig types than that of mammals (56, 57), a lack of Ab class- switch recombination, and low Ab affinity maturation (30). Hence, innate immunity may play a more important role as a first re- References sponse to infection in teleosts. In this study, we found that LPS- 1. Laurenti, E., and B. Go¨ttgens. 2018. From haematopoietic stem cells to complex + differentiation landscapes. Nature 553: 418–426. mobilized CXCR4a HSPCs preferentially differentiated into 2. Lucas, D. 2019. Leukocyte trafficking and regulation of murine hematopoietic myeloid cells, macrophages, and neutrophils, which are the main stem cells and their niches. Front. Immunol. 10: 387. cell types of innate immunity. Myeloid cells play an important role 3. Nelson, J. S. 2006. Fishes of the World, 4th Ed. John Wiley & Sons, Hoboken, + NJ, p. 601. in sepsis (58). Hence, the LPS-induced mobilization of CXCR4a 4. Sandve, S. R., R. V. Rohlfs, and T. R. Hvidsten. 2018. Subfunctionalization versus HSPCs to preferentially produce myeloid cells is beneficial to neofunctionalization after whole-genome duplication. Nat. Genet. 50: 908–909. 5. Lu, X. J., Q. Chen, Y. J. Rong, F. Chen, and J. Chen. 2017. CXCR3.1 and resolving inflammation. Moreover, we identified the transcription CXCR3.2 differentially contribute to macrophage polarization in teleost fish. factor SCL as the downstream signaling regulator of CXCR4a in J. Immunol. 198: 4692–4706. 1240 THE ROLES OF TWO CXCR4s IN TELEOST HSPCS

6. Chavakis, T., I. Mitroulis, and G. Hajishengallis. 2019. Hematopoietic progenitor derived from serum amyloid P component neutralize LPS. Infect. Immun. 67: cells as integrative hubs for adaptation to and fine-tuning of inflammation. Nat. 2790–2796. Immunol. 20: 802–811. 34. Zhang, R. C., J. Chen, C. H. Li, X. J. Lu, and Y. H. Shi. 2011. Prokaryotic 7. King, K. Y. 2018. Stem cell regulation during chronic infection. Blood expression, purification, and refolding of leukocyte cell-derived chemotaxin 2 132(Suppl. 1): SCI-32. and its effect on gene expression of head kidney-derived macrophages of a 8. Burberry, A., M. Y. Zeng, L. Ding, I. Wicks, N. Inohara, S. J. Morrison, and teleost fish, ayu (Plecoglossus altivelis). Fish Shellfish Immunol. 31: 911–918. G. Nuń˜ez. 2014. Infection mobilizes hematopoietic stem cells through cooper- 35. Kruger, N. J. 2009. The Bradford method for protein quantitation. In The Protein ative NOD-like receptor and toll-like receptor signaling. Cell Host Microbe 15: Protocols Handbook, 2nd Ed. J. M. Walker, eds. Humana Press, Totowa, NJ, p. 779–791. 15–21. 9. Boettcher, S., and M. G. Manz. 2017. Regulation of inflammation- and infection- 36. Filippo, T. R., L. T. Galindo, G. F. Barnabe, C. B. Ariza, L. E. Mello, driven hematopoiesis. Trends Immunol. 38: 345–357. M. A. Juliano, L. Juliano, and M. A. Porcionatto. 2013. CXCL12 N-terminal end 10. Clapes, T., S. Lefkopoulos, and E. Trompouki. 2016. Stress and non-stress roles is sufficient to induce chemotaxis and proliferation of neural stem/progenitor of inflammatory signals during HSC emergence and maintenance. Front. cells. Stem Cell Res. (Amst.) 11: 913–925. Immunol. 7: 487. 37. Clark-Lewis, I., I. Mattioli, J. H. Gong, and P. Loetscher. 2003. Structure- 11. Megıás, J., A. Yań˜ez, S. Moriano, J. E. O’Connor, D. Gozalbo, and M. L. Gil. function relationship between the human chemokine receptor CXCR3 and its 2012. Direct toll-like receptor-mediated stimulation of hematopoietic stem and ligands. J. Biol. Chem. 278: 289–295. progenitor cells occurs in vivo and promotes differentiation toward macrophages. 38. Zhu, L. Y., A. F. Lin, T. Shao, L. Nie, W. R. Dong, L. X. Xiang, and J. Z. Shao. Stem Cells 30: 1486–1495. 2014. B cells in teleost fish act as pivotal initiating APCs in priming adaptive 12. Hall, C. J., M. V. Flores, S. H. Oehlers, L. E. Sanderson, E. Y. Lam, immunity: an evolutionary perspective on the origin of the B-1 cell subset and K. E. Crosier, and P. S. Crosier. 2012. Infection-responsive expansion of the B7 molecules. J. Immunol. 192: 2699–2714. hematopoietic stem and progenitor cell compartment in zebrafish is dependent 39. Chen, Q., X. J. Lu, M. Y. Li, and J. Chen. 2016. Molecular cloning, upon inducible nitric oxide. Cell Stem Cell 10: 198–209. pathologically-correlated expression and functional characterization of the 13. Lu, X. J., Q. Chen, Y. J. Rong, and J. Chen. 2016. Mobilisation and dysfunction colonystimulating factor 1 receptor (CSF-1R) gene from a teleost, Plecoglossus of haematopoietic stem/progenitor cells after Listonella anguillarum infection in altivelis. Zool. Res. 37: 96–102. ayu, Plecoglossus altivelis. Sci. Rep. 6: 28082. 40. Szilvassy, S. J., R. K. Humphries, P. M. Lansdorp, A. C. Eaves, and C. J. Eaves. 14. Takizawa, H., K. Fritsch, L. V. Kovtonyuk, Y. Saito, C. Yakkala, K. Jacobs, 1990. Quantitative assay for totipotent reconstituting hematopoietic stem cells by Downloaded from A.K.Ahuja,M.Lopes,A.Hausmann,W.D.Hardt,etal.2017.Pathogen- a competitive repopulation strategy. Proc. Natl. Acad. Sci. USA 87: 8736–8740. induced TLR4-TRIF innate immune signaling in hematopoietic stem cells 41. Wattrus, S. J., and L. I. Zon. 2018. Stem cell safe harbor: the hematopoietic stem promotes proliferation but reduces competitive fitness. Cell Stem Cell 21: cell niche in zebrafish. Blood Adv. 2: 3063–3069. 225–240.e5. 42. Chen, J., X. J. Lu, H. Y. Yang, and Y. H. Shi. 2010. An interaction between a 15. Lu, X. J., Q. Chen, Y. J. Rong, G. J. Yang, C. H. Li, N. Y. Xu, C. H. Yu, C-type lectin receptor and leukocyte cell-derived chemotaxin 2 of ayu, H. Y. Wang, S. Zhang, Y. H. Shi, and J. Chen. 2016. LECT2 drives haemato- Plecoglossus altivelis. Fish Shellfish Immunol. 28: 245–248. poietic stem cell expansion and mobilization via regulating the macrophages and 43. Ludin, A., S. Gur-Cohen, K. Golan, K. B. Kaufmann, T. Itkin, C. Medaglia, osteolineage cells. Nat. Commun. 7: 12719. X. J. Lu, G. Ledergor, O. Kollet, and T. Lapidot. 2014. Reactive oxygen species 16. Bird, S., and C. Tafalla. 2015. Teleost chemokines and their receptors. Biology regulate hematopoietic stem cell self-renewal, migration and development, as http://www.jimmunol.org/ (Basel) 4: 756–784. well as their bone marrow microenvironment. Antioxid. Redox Signal. 21: 1605– 17. Zou, J., A. K. Redmond, Z. Qi, H. Dooley, and C. J. Secombes. 2015. The CXC 1619. chemokine receptors of fish: insights into CXCR evolution in the vertebrates. 44. Wang, T., F. Liu, G. Tian, C. J. Secombes, and T. Wang. 2019. Lineage/species- Gen. Comp. Endocrinol. 215: 117–131. specific expansion of the Mx gene family in teleosts: differential expression and 18. Nagasawa, T., H. Kikutani, and T. Kishimoto. 1994. Molecular cloning and modulation of nine Mx genes in rainbow trout Oncorhynchus mykiss. Fish structure of a pre-B-cell growth-stimulating factor. Proc. Natl. Acad. Sci. USA Shellfish Immunol. 90: 413–430. 91: 2305–2309. 45. Wang, T., Y. Hu, E. Wangkahart, F. Liu, A. Wang, E. Zahran, K. R. Maisey, 19. Nie, Y., Y. C. Han, and Y. R. Zou. 2008. CXCR4 is required for the quiescence of M. Liu, Q. Xu, M. Imarai, and C. J. Secombes. 2018. Interleukin (IL)-2 is a key primitive hematopoietic cells. J. Exp. Med. 205: 777–783. regulator of T helper 1 and T helper 2 cytokine expression in fish: functional 20. Yakulov, T. A., A. P. Todkar, K. Slanchev, J. Wiegel, A. Bona, M. Groß, characterization of two divergent IL2 paralogs in salmonids. Front. Immunol. A. Scholz, I. Hess, A. Wurditsch, F. Grahammer, et al. 2018. CXCL12 and MYC 9: 1683. control energy metabolism to support adaptive responses after kidney injury. 46. Wei, Q., and P. S. Frenette. 2018. Niches for hematopoietic stem cells and their by guest on October 2, 2021 Nat. Commun. 9: 3660. progeny. Immunity 48: 632–648. 21. Seleit, A., I. Kra¨mer, E. Ambrosio, N. Dross, U. Engel, and L. Centanin. 2017. 47. Karpova, D., J. K. Ritchey, M. S. Holt, G. Abou-Ezzi, D. Monlish, L. Batoon, Sequential organogenesis sets two parallel sensory lines in medaka. Develop- S. Millard, G. Spohn, E. Wiercinska, E. Chendamarai, et al. 2017. Continuous ment 144: 687–697. blockade of CXCR4 results in dramatic mobilization and expansion of hema- 22. Janssens, R., S. Struyf, and P. Proost. 2018. The unique structural and functional topoietic stem and progenitor cells. Blood 129: 2939–2949. features of CXCL12. Cell. Mol. Immunol. 15: 299–311. 48. de Kruijf, E. F. M., W. E. Fibbe, and M. van Pel. 2019. Cytokine-induced he- 23. Sugiyama, T., H. Kohara, M. Noda, and T. Nagasawa. 2006. Maintenance of the matopoietic stem and progenitor cell mobilization: unraveling interactions be- hematopoietic stem cell pool by CXCL12-CXCR4 chemokine signaling in bone tween stem cells and their niche. Ann. N. Y. Acad. Sci. DOI: 10.1111/nyas.14059. marrow stromal cell niches. Immunity 25: 977–988. 49. Stachura, D. L., O. Svoboda, C. A. Campbell, R. Espıń-Palazoń, R. P. Lau, 24. Freitas, C., M. Wittner, J. Nguyen, V. Rondeau, V. Biajoux, M. L. Aknin, L. I. Zon, P. Bartun˚ ek, and D. Traver. 2013. The zebrafish granulocyte colony- F. Gaudin, S. Beaussant-Cohen, Y. Bertrand, C. Bellanne´-Chantelot, et al. 2017. stimulating factors (Gcsfs): 2 paralogous cytokines and their roles in hemato- Lymphoid differentiation of hematopoietic stem cells requires efficient Cxcr4 poietic development and maintenance. Blood 122: 3918–3928. desensitization. J. Exp. Med. 214: 2023–2040. 50. Lu, X. J., J. Chen, C. H. Yu, Y. H. Shi, Y. Q. He, R. C. Zhang, Z. A. Huang, 25. Chong, S. W., A. Emelyanov, Z. Gong, and V. Korzh. 2001. Expression pattern J. N. Lv, S. Zhang, and L. Xu. 2013. LECT2 protects mice against bacterial sepsis of two zebrafish genes, cxcr4a and cxcr4b. Mech. Dev. 109: 347–354. by activating macrophages via the CD209a receptor. J. Exp. Med. 210: 5–13. 26. Doitsidou, M., M. Reichman-Fried, J. Stebler, M. Ko¨prunner, J. Do¨rries, 51. Triantafilou, K., M. Triantafilou, and R. L. Dedrick. 2001. A CD14-independent D. Meyer, C. V. Esguerra, T. Leung, and E. Raz. 2002. Guidance of primordial LPS receptor cluster. Nat. Immunol. 2: 338–345. germ cell migration by the chemokine SDF-1. Cell 111: 647–659. 52. Lu, X. J., Y. J. Ning, H. Liu, L. Nie, and J. Chen. 2018. A novel lipopolysac- 27. Packham, I. M., C. Gray, P. R. Heath, P. G. Hellewell, P. W. Ingham, charide recognition mechanism mediated by internalization in teleost macro- D. C. Crossman, M. Milo, and T. J. Chico. 2009. Microarray profiling reveals phages. Front. Immunol. 9: 2758. CXCR4a is downregulated by blood flow in vivo and mediates collateral for- 53. Zhang, H., S. Rodriguez, L. Wang, S. Wang, H. Serezani, R. Kapur, mation in zebrafish embryos. Physiol. Genomics 38: 319–327. A. A. Cardoso, and N. Carlesso. 2016. Sepsis induces hematopoietic stem cell 28. Paredes-Zuń˜iga, S., R. A. Morales, S. Munõz-Sańchez, C. Munõz-Montecinos, exhaustion and myelosuppression through distinct contributions of TRIF and M. Parada, K. Tapia, C. Rubilar, M. L. Allende, and O. A. Penã. 2017. MYD88. Stem Cell Reports 6: 940–956. CXCL12a/CXCR4b acts to retain neutrophils in caudal hematopoietic tissue and 54. Star, B., A. J. Nederbragt, S. Jentoft, U. Grimholt, M. Malmstrøm, T. F. Gregers, to antagonize recruitment to an injury site in the zebrafish larva. Immunogenetics T. B. Rounge, J. Paulsen, M. H. Solbakken, A. Sharma, et al. 2011. The genome 69: 341–349. sequence of Atlantic cod reveals a unique immune system. Nature 477: 207–210. 29. Wright, D. E., E. P. Bowman, A. J. Wagers, E. C. Butcher, and I. L. Weissman. 55. Brinchmann, M. F., D. M. Patel, N. Pinto, and M. H. Iversen. 2018. Functional 2002. Hematopoietic stem cells are uniquely selective in their migratory re- aspects of fish mucosal lectins-interaction with non-self. Molecules 23: E1119. sponse to chemokines. J. Exp. Med. 195: 1145–1154. 56. Rajan, B., G. Løkka, E. O. Koppang, and L. Austbø. 2017. Passive immunization 30. Sunyer, J. O. 2013. Fishing for mammalian paradigms in the teleost immune of farmed fish. J. Immunol. 198: 4195–4202. system. Nat. Immunol. 14: 320–326. 57. Xu, Z., F. Takizawa, D. Parra, D. Go´mez, L. von Gersdorff Jørgensen, 31. Li, M. Y., L. Miao, and J. Chen. 2016. Breeding of a new variety of ayu (Ple- S. E. LaPatra, and J. O. Sunyer. 2016. Mucosal immunoglobulins at respiratory coglossus altivlis) named “Zhemin No.1” with fast growth and few abnormality surfaces mark an ancient association that predates the emergence of tetrapods. characters. J. Agric. Biotechnol. 24: 1392–1397. Nat. Commun. 7: 10728. 32. Seki, S., J. J. Agresti, G. A. E. Gall, N. Taniguchi, and B. May. 1999. AFLP 58. Delano, M. J., and P. A. Ward. 2016. Sepsis-induced immune dysfunction: can analysis of genetic diversity in three populations of ayu Plecoglossus altivelis. immune therapies reduce mortality? J. Clin. Invest. 126: 23–31. Fish. Sci. 65: 888–892. 59. Kunisato, A., S. Chiba, T. Saito, K. Kumano, E. Nakagami-Yamaguchi, 33. de Haas, C. J., R. van der Zee, B. Benaissa-Trouw, K. P. van Kessel, J. Verhoef, T. Yamaguchi, and H. Hirai. 2004. Stem cell leukemia protein directs hemato- and J. A. van Strijp. 1999. Lipopolysaccharide (LPS)-binding synthetic peptides poietic stem cell fate. Blood 103: 3336–3341. The Journal of Immunology 1241

60. Li, J., D. R. Barreda, Y. A. Zhang, H. Boshra, A. E. Gelman, S. Lapatra, L. Tort, transcription factors that govern myelopoiesis in fish. Dev. Comp. Immunol. 58: and J. O. Sunyer. 2006. B lymphocytes from early vertebrates have potent 68–85. phagocytic and microbicidal abilities. Nat. Immunol. 7: 1116–1124. 65. Hanington, P. C., D. R. Barreda, and M. Belosevic. 2006. A novel hematopoietic 61. Nagasawa, T., C. Nakayasu, A. M. Rieger, D. R. Barreda, T. Somamoto, and granulin induces proliferation of goldfish (Carassius auratus L.) macrophages. M. Nakao. 2014. Phagocytosis by thrombocytes is a conserved innate immune J. Biol. Chem. 281: 9963–9970. mechanism in lower vertebrates. Front. Immunol. 5: 445. 66.Traver,D.,A.Winzeler,H.M.Stern,E.A.Mayhall,D.M.Langenau,J.L.Kutok, 62. Lu, X. J., and J. Chen. 2019. Specific function and modulation of teleost A. T. Look, and L. I. Zon. 2004. Effects of lethal irradiation in zebrafish and rescue monocytes/macrophages: polarization and phagocytosis. Zool. Res. 40: 146–150. by hematopoietic cell transplantation. Blood 104: 1298–1305. 63. Kobayashi, I., F. Katakura, and T. Moritomo. 2016. Isolation and character- 67. de Jong, J. L., and L. I. Zon. 2012. Histocompatibility and hematopoietic ization of hematopoietic stem cells in teleost fish. Dev. Comp. Immunol. 58: transplantation in the zebrafish. Adv. Hematol. 2012: 282318. 86–94. 68. Traver, D., B. H. Paw, K. D. Poss, W. T. Penberthy, S. Lin, and L. I. Zon. 2003. 64. Katzenback, B. A., F. Katakura, and M. Belosevic. 2016. Goldfish (Carassius Transplantation and in vivo imaging of multilineage engraftment in zebrafish auratus L.) as a model system to study the growth factors, receptors and bloodless mutants. Nat. Immunol. 4: 1238–1246. Downloaded from http://www.jimmunol.org/ by guest on October 2, 2021 1 2 Supplemental Figure 1: Validation of the specificity of antibodies used in this study.

3 (A-C) Validation of the specificity of anti-PaCXCR4a (A), anti-PaCXCR4b (B), and

4 anti-PaSDF-1 (C) IgG. Lane 1: negative control (PBS); lane 2: the kidney of healthy

5 ayu; lane 3: the kidney of V. anguillarum-infected ayu. (D-F) Validation of the

6 specificity of anti-PaCXCR4a (D), anti-PaCXCR4b (E), and anti-PaSDF-1 (F) IgG.

7 Lane 1: negative control stains (secondary antibody only); lane 2: the recombinant

8 proteins of PaCXCR4a, PaCXCR4b, and PaSDF-1 in HEK293T cells. The primers for

9 recombinant protein preparation are listed in Table 2. The molecular weights of

10 recombinant PaCXCR4a, PaCXCR4b, and PaSDF-1 were approximately 45, 45, and

11 15 kDa with His-tag, which were identical with the expected sizes. (G-I) Flow

12 cytometry analysis of HEK-293T cells expressing PaIgM (G), PaCD4 (H), PaCD8 (I). 13 HEK-293T-EV: HEK-293T cells were transfected with empty vector.

14 HEK-293T-Target genes: HEK-293T cells were transfected with PaIgM, PaCD4, or

15 PaCD8.

16 17

19 Supplemental Figure 2: The binding of LPS to CXCR4a in HEK293T cells. (A) of

20 125I-LPS binding to recombinant CXCR4a expressed in HEK293T cells. (B) CXCR4a

21 binding of LPS as characterized by a 125I-LPS competitive binding assay. Nonspecific

22 binding was determined in the presence of 1 mg/ml unlabeled LPS. Specific binding

23 values in saturation binding and competitive binding experiments were calculated as

24 the total binding minus nonspecific binding.