DOCSLIB.ORG

Biochemical Characterization of the Initial Steps of the Kennedy Pathway in Trypanosoma Brucei: the Ethanolamine and Choline Kinases Federica GIBELLINI*, William N

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Biochemical Characterization of the Initial Steps of the Kennedy Pathway in Trypanosoma Brucei: the Ethanolamine and Choline Kinases Federica GIBELLINI*, William N Biochem. J. (2008) 415, 135–144 (Printed in Great Britain) doi:10.1042/BJ20080435 135 Biochemical characterization of the initial steps of the Kennedy pathway in Trypanosoma brucei: the ethanolamine and choline kinases Federica GIBELLINI*, William N. HUNTER* and Terry K. SMITH†1 *Division of Biological Chemistry and Drug Discovery, School of Life Sciences, University of Dundee, Dundee DD1 5EH, Scotland, U.K., and †Centre for Biomolecular Sciences, St Andrews University, North Haugh, St Andrews KY16 9ST, Scotland, U.K. Ethanolamine and choline are major components of the trypano- TbC/EK2 (T. brucei choline/ethanolamine kinase 2), on the other some membrane phospholipids, in the form of GPEtn (glycero- hand, was found to be able to phosphorylate both ethanolamine phosphoethanolamine) and GPCho (glycerophosphocholine). and choline, even though choline was the preferred substrate, Ethanolamine is also found as an integral component of the with a Km 80 times lower than that of ethanolamine. The Km Downloaded from http://portlandpress.com/biochemj/article-pdf/415/1/135/654216/bj4150135.pdf by guest on 02 October 2021 GPI (glycosylphosphatidylinositol) anchor that is required for values for choline, ethanolamine and ATP were 31.4 −+ 2.6 μM, membrane attachment of cell-surface proteins, most notably 2.56 −+ 0.31 mM and 20.6 −+ 1.96 μM respectively. Further sub- the variant-surface glycoproteins. The de novo synthesis of strate specificity analysis revealed that both TbEK1 and TbC/EK2 GPEtn and GPCho starts with the generation of phosphoethanol- were able to tolerate various modifications at the amino group, amine and phosphocholine by ethanolamine and choline kinases with the exception of a quaternary amine for TbEK1 (choline) via the Kennedy pathway. Database mining revealed two putative and a primary amine for TbC/EK2 (ethanolamine). Both enzymes C/EKs (choline/ethanolamine kinases) in the Trypanosoma brucei recognized analogues with substituents on C-2, but substitutions genome, which were cloned, overexpressed, purified and charac- on C-1 and elongations of the carbon chain were not well tolerated. terized. TbEK1 (T. brucei ethanolamine kinase 1) was shown to be catalytically active as an ethanolamine-specific kinase, i.e. it had no choline kinase activity. The Km values for ethanolamine and Key words: choline kinase, ethanolamine kinase, Kennedy ATP were found to be 18.4 −+ 0.9 and 219 −+ 29 μM respectively. pathway, Trypanosoma brucei. INTRODUCTION anchored VSG (variant-surface glycoprotein). This coat prevents attack by components of the innate immune system and, by The zwitterionic glycerophospholipids GPCho (glycerophos- undergoing antigenic variation, allows the parasite to evade a phocholine) and GPEtn (glycerophosphoethanolamine) are the specific immune response by the host. two most abundant phospholipid species in eukaryotic cells and The biosynthesis of the GPI anchor has been genetically [8–10] many bacteria [1]. In the parasitic protozoan Trypanosoma brucei, and chemically [11] validated as a drug target in the bloodstream the agent of African sleeping sickness, GPCho accounts for form of T. brucei. Thus disruption of the biosynthesis of GPEtn approximately half of all phospholipids in both life-cycle stages, could prevent the formation of mature GPI-anchored VSG and whereas GPEtn forms between 16 and 21% [2]. These phos- lead to clearance of the parasite by the host’s immune system. pholipids contribute an important structural role to the membrane Owing to the major structural and functional roles of GPCho and, in addition, determine membrane fluidity and cell-surface and GPEtn in T. brucei, disruption of their biosynthetic pathways charge. Their biosynthesis and utilization is, not surprisingly, is likely to interfere with the parasite biology in multiple ways implicated in a variety of cellular processes [1]. In mammals, and thus the enzymes involved become of interest as possible GPCho is an important source of signalling molecules, and the novel targets for chemotherapy. Indeed, it has been proposed biosynthetic intermediate PtdCho (phosphatidylcholine) has been that the mode of action of lysophospholipid analogues (e.g. reported to be a mitogen required for DNA synthesis induced miltefosine, edelfosine or ilmofosine) used currently against other by growth factors [3]. Owing to its physicochemical properties, trypanosomatid parasites, i.e. Leishmania major, are involved in GPEtn has a tendency to form non-bilayer structures, and its the inhibition of GPCho biosynthesis [12]. incorporation into membranes affects the processes of membrane GPEtn and GPCho are synthesized de novo via two branches trafficking and the folding, stabilization and incorporation of of the same metabolic pathway, the Kennedy pathway [13] certain proteins into membranes [4]. Moreover, GPEtn is utilized (Figure 1). Ethanolamine and choline are readily phosphorylated in the biosynthesis of GPI (glycosylphosphatidylinositol), a to generate PtdEtn (phosphatidylethanolamine) and PtdCho, complex glycolipid that anchors proteins to the exterior leaflet which are subsequently activated to high-energy donors, CDP- of eukaryotic plasma membranes [5–7]. This is particularly ethanolamine and CDP-choline respectively, before they are important for the bloodstream form of T. brucei, which expresses coupled to diacylglycerol to form GPEtn and GPCho. For this a dense cell-surface coat (107 molecules per parasite) of a GPI- reason, the two branches of the Kennedy pathway are often Abbreviations used: C/EK, choline/ethanolamine kinase; EK, ethanolamine kinase; GPCho, glycerophosphocholine; GPEtn, glycerophosphoethan- olamine; GPI, glycosylphosphatidylinositol; GPSer, glycerophosphoserine; HPTLC, high-performance TLC; LB, Luria–Bertani; MALDI, matrix-assisted laser-desorption ionization; ORF, open reading frame; PtdCho, phosphotidylcholine; PtdEtn, phosphatidylethanolamine; RT, reverse transcription; Tb, Trypanosome brucei; TEV, tobacco etch virus; TOF, time-of-flight; UTR, untranslated region; VSG, variant-surface glycoprotein. 1 To whom correspondence should be addressed (email [email protected]). The nucleotide sequence data reported for choline/ethanolamine kinase and ethanolamine kinase of Trypanosoma brucei have been submitted to the DDBJ, EMBL, GenBank® and GSDB Nucleotide Sequence Databases under accession numbers AM939568 and AM939569 respectively. c The Authors Journal compilation c 2008 Biochemical Society 136 F. Gibellini, W. N. Hunter and T. K. Smith ethanolamine kinase 2)-specific cDNA was generated and ampli- fied using a mini-exon-specific forward primer, 5-CGCGGATC- CGAACGCTATTATTAGAACAGTTTCTGTAC-3, in combina- tion with an ORF (open reading frame)-specific reverse primer, 5- CTTCTGTTCCACGGGTATAGTC -3, specific for the sequence of TbC/EK2 using the SuperScript III One step RT (reverse transcription)–PCR kit with Platinum Taq (Invitrogen). The amplified cDNAs were purified (QIAquick PCR purification kit, Qiagen), ligated into pCR®-Blunt II TOPO® (Invitrogen) and sequenced. Cloning of the TbC/EK1 gene and construction of the pET15b-TbC/EK1 expression vectors Using the Saccharomyces cerevisiae EK gene sequence as Downloaded from http://portlandpress.com/biochemj/article-pdf/415/1/135/654216/bj4150135.pdf by guest on 02 October 2021 Figure 1 Pathways for the biosynthesis of the aminoglycerophospholipids a query, two putative C/EK (choline/ethanolamine kinase) GPCho and GPEtn genes were identified in the T. brucei genome database (http:// www.genedb.org) using tBlastN. The two putative ORFs The two branches of the Kennedy pathway are (a) the CDP-choline pathway and (b)the (Tb11.18.0017 for TbC/EK1, and Tb927.5.1140 for TbC/EK2) CDP-ethanolamine pathway. The relevant steps are discussed in the text. CK, choline kinase together with ∼350 bp of their 5-and3-UTRs (untranslated (Tb11.18.0017/Tb927.5.1140); CCT, CTP:phosphocholine cytidyltransferase (Tb10.389.0730); CPT,diacylglycerol:CDP-cholinecholinephosphotransferase(Tb10.6k15.1570);EK,ethanolam- regions), were amplified from T. brucei strain 427 genomic ine kinase (Tb11.18.0017/Tb927.5.1140); ECT, CTP:phosphoethanolamine cytidyltransferase DNA using Pfu DNA polymerase and the forward and (Tb11.01.5730); EPT, diacylglycerol:CDP-ethanolamine ethanolaminephosphotransferase reverse primers 5 -ATAAGTAAGCGGCCGCCCGCCTAAG- (Tb10.6k15.1570); PSD, phosphatidylserine decarboxylase (Tb09.211.1610); PEMT, TTAGAAGTTGCGCT-3 and 5-ATAAGTAAGCGGCCGCTC- phosphatidylethanolamine methyltransferases; DAG, diacylglycerol. The dashed box indicates CAATAGCTCCAGGGAAGGAAAGGGACG-3 for TbC/EK1; methyltransferase enzymes which are not present in either T. brucei or T. cruzi , but are present and 5-ATAAGTAAGCGGCCGCAAGTGCGTTGTGCAGGT- in L. major. CGGCGACGGT-3 and 5-ATAAGTAAGCGGCCGCCGTTGG- AAGGAGGAAAACGGCCGAGG-3 for TbC/EK2. The referred to as the CDP-ethanolamine or CDP-choline pathways. resulting 2.1 kb (TbC/EK1 and UTRs) and 3.7 kb (TbC/EK2 A second major pathway for the formation of GPEtn is via and UTRs) fragments were cloned into pCR®-Blunt-II TOPO®. GPSer (glycerophosphoserine) decarboxylation: GPSer, which is Clones were sequenced and compared with the annotated formed through the action of a phosphatidylserine synthase, is GenBank® sequences. A BamHI restriction site, internal to decarboxylated by a phosphatidylserine decarboxylase to form the TbC/EK1 ORF was silenced by site-directed mutagenesis GPEtn. In most eukaryotic cells, GPCho can also be generated using the forward primer 5-GTGTTGAGGGGGATAAGC- from GPEtn by three methylation
Load more

Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Conserved Phosphoryl Transfer Mechanisms Within Kinase Families
    Kenyon et al. BMC Research Notes 2012, 5:131 http://www.biomedcentral.com/1756-0500/5/131 RESEARCHARTICLE Open Access Conserved phosphoryl transfer mechanisms within kinase families and the role of the C8 proton of ATP in the activation of phosphoryl transfer Colin P Kenyon*, Robyn L Roth, Chris W van der Westhuyzen and Christopher J Parkinson Abstract Background: The kinome is made up of a large number of functionally diverse enzymes, with the classification indicating very little about the extent of the conserved kinetic mechanisms associated with phosphoryl transfer. It has been demonstrated that C8-H of ATP plays a critical role in the activity of a range of kinase and synthetase enzymes. Results: A number of conserved mechanisms within the prescribed kinase fold families have been identified directly utilizing the C8-H of ATP in the initiation of phosphoryl transfer. These mechanisms are based on structurally conserved amino acid residues that are within hydrogen bonding distance of a co-crystallized nucleotide. On the basis of these conserved mechanisms, the role of the nucleotide C8-H in initiating the formation of a pentavalent intermediate between the g-phosphate of the ATP and the substrate nucleophile is defined. All reactions can be clustered into two mechanisms by which the C8-H is induced to be labile via the coordination of a backbone carbonyl to C6-NH2 of the adenyl moiety, namely a “push” mechanism, and a “pull” mechanism, based on the protonation of N7. Associated with the “push” mechanism and “pull” mechanisms are a series of proton transfer cascades, initiated from C8-H, via the tri-phosphate backbone, culminating in the formation of the pentavalent transition state between the g-phosphate of the ATP and the substrate nucleophile.
    [Show full text]
  • Choline Kinase Inhibition As a Treatment Strategy for Cancers With
    Choline Kinase Inhibition as a Treatment Strategy of Cancers with Deregulated Lipid Metabolism Sebastian Trousil Imperial College London Department of Surgery and Cancer A dissertation submitted for the degree of Doctor of Philosophy 2 Declaration I declare that this dissertation is my own and original work, except where explicitly acknowledged. The copyright of this thesis rests with the author and is made available under a Creative Commons Attribution Non-Commercial No Derivatives licence. Researchers are free to copy, distribute or transmit the thesis on the condition that they attribute it, that they do not use it for commercial purposes and that they do not alter, transform or build upon it. For any reuse or redistribution, researchers must make clear to others the licence terms of this work. Abstract Aberrant choline metabolism is a characteristic shared by many human cancers. It is predominantly caused by elevated expression of choline kinase alpha, which catalyses the phosphorylation of choline to phosphocholine, an essential precursor of membrane lipids. In this thesis, a novel choline kinase inhibitor has been developed and its therapeutic potential evaluated. Furthermore the probe was used to elaborate choline kinase biology. A lead compound, ICL-CCIC-0019 (IC50 of 0.27 0.06 µM), was identified through a focused library screen. ICL-CCIC-0019 was competitive± with choline and non-competitive with ATP. In a selectivity screen of 131 human kinases, ICL-CCIC-0019 inhibited only 5 kinases more than 20% at a concentration of 10 µM(< 35% in all 131 kinases). ICL- CCIC-0019 potently inhibited cell growth in a panel of 60 cancer cell lines (NCI-60 screen) with a median GI50 of 1.12 µM (range: 0.00389–16.2 µM).
    [Show full text]
  • Change in Brain Plasmalogen Composition by Exposure to Prenatal Undernutrition Leads to Behavioral Impairment of Rats
    Research Articles: Behavioral/Cognitive Change in brain plasmalogen composition by exposure to prenatal undernutrition leads to behavioral impairment of rats https://doi.org/10.1523/JNEUROSCI.2721-18.2019 Cite as: J. Neurosci 2019; 10.1523/JNEUROSCI.2721-18.2019 Received: 21 October 2018 Revised: 28 July 2019 Accepted: 31 July 2019 This Early Release article has been peer-reviewed and accepted, but has not been through the composition and copyediting processes. The final version may differ slightly in style or formatting and will contain links to any extended data. Alerts: Sign up at www.jneurosci.org/alerts to receive customized email alerts when the fully formatted version of this article is published. Copyright © 2019 the authors 1 Change in brain plasmalogen composition by exposure to prenatal 2 undernutrition leads to behavioral impairment of rats 3 4 Abbreviated title: Ethanolamine plasmalogen and behavior 5 6 Kodai Hino1, Shunya Kaneko1, Toshiya Harasawa1, Tomoko Kimura1, Shiro Takei2, 7 Masakazu Shinohara3,4, Fumiyoshi Yamazaki5, Shin-ya Morita6, Shumpei Sato5, 8 Yoshihito Kubo1, Tadaaki Kono1, Mitsutoshi Setou5,7,8, Mina Yoshioka1, Junya Fujino1, 9 Hiroyuki Sugihara9, Hideto Kojima10, Naoto Yamada11, Jun Udagawa1 10 11 1Division of Anatomy and Cell Biology, Department of Anatomy, Shiga University of 12 Medical Science, Otsu 520-2192, Japan 13 2Department of Environmental Biology, College of Bioscience and Biotechnology, 14 Chubu University, Kasugai, 487-8501, Japan 15 3Division of Epidemiology, Kobe University Graduate School
    [Show full text]
  • Localization Developmental Process Response to Stimulus Signaling
    male germ-line positive a regulation of type antigen processing adult somatic relaxation of stem cell regulation of beak entry into III interferon stabilization of CRD-mediated mRNA and presentation of beak development muscle skeletal muscle population systemic arterial morphogenesis diapause production membrane potential stabilization exogenous peptide monocyte activation development maintenance blood pressure flight forward locomotion antigen via MHC class Regulation of I, TAP-dependent Developmental process biological quality negative Immune system Locomotion sensory organ positive regulation of branched duct hatching secondary neural regulation of precursor cell endoplasmic reticulum oenocyte leading edge cell epithelial cell fate leading edge cell tube formation transmission of process division calcium ion concentration differentiation fate commitment determination, open differentiation nerve impulse hemocyte development regulation of toll-like tracheal system multivesicular body receptor 5 Multicellular organismal process size involved in actin inductive cell endosome transport signaling polymerization-dependent cell motility migration amnioserosa regulation of pathway presynaptic corticotropin regulation of neutrophil angiogenesis formation collateral cellular pH reduction membrane assembly hormone differentiation oenocyte tendon cell involved in proepicardium sprouting of secreting cell development differentiation coronary vascular development injured axon differentiation morphogenesis post-embryonic zygotic specification endodermal-mesodermal
    [Show full text]
  • O O2 Enzymes Available from Sigma Enzymes Available from Sigma
    COO 2.7.1.15 Ribokinase OXIDOREDUCTASES CONH2 COO 2.7.1.16 Ribulokinase 1.1.1.1 Alcohol dehydrogenase BLOOD GROUP + O O + O O 1.1.1.3 Homoserine dehydrogenase HYALURONIC ACID DERMATAN ALGINATES O-ANTIGENS STARCH GLYCOGEN CH COO N COO 2.7.1.17 Xylulokinase P GLYCOPROTEINS SUBSTANCES 2 OH N + COO 1.1.1.8 Glycerol-3-phosphate dehydrogenase Ribose -O - P - O - P - O- Adenosine(P) Ribose - O - P - O - P - O -Adenosine NICOTINATE 2.7.1.19 Phosphoribulokinase GANGLIOSIDES PEPTIDO- CH OH CH OH N 1 + COO 1.1.1.9 D-Xylulose reductase 2 2 NH .2.1 2.7.1.24 Dephospho-CoA kinase O CHITIN CHONDROITIN PECTIN INULIN CELLULOSE O O NH O O O O Ribose- P 2.4 N N RP 1.1.1.10 l-Xylulose reductase MUCINS GLYCAN 6.3.5.1 2.7.7.18 2.7.1.25 Adenylylsulfate kinase CH2OH HO Indoleacetate Indoxyl + 1.1.1.14 l-Iditol dehydrogenase L O O O Desamino-NAD Nicotinate- Quinolinate- A 2.7.1.28 Triokinase O O 1.1.1.132 HO (Auxin) NAD(P) 6.3.1.5 2.4.2.19 1.1.1.19 Glucuronate reductase CHOH - 2.4.1.68 CH3 OH OH OH nucleotide 2.7.1.30 Glycerol kinase Y - COO nucleotide 2.7.1.31 Glycerate kinase 1.1.1.21 Aldehyde reductase AcNH CHOH COO 6.3.2.7-10 2.4.1.69 O 1.2.3.7 2.4.2.19 R OPPT OH OH + 1.1.1.22 UDPglucose dehydrogenase 2.4.99.7 HO O OPPU HO 2.7.1.32 Choline kinase S CH2OH 6.3.2.13 OH OPPU CH HO CH2CH(NH3)COO HO CH CH NH HO CH2CH2NHCOCH3 CH O CH CH NHCOCH COO 1.1.1.23 Histidinol dehydrogenase OPC 2.4.1.17 3 2.4.1.29 CH CHO 2 2 2 3 2 2 3 O 2.7.1.33 Pantothenate kinase CH3CH NHAC OH OH OH LACTOSE 2 COO 1.1.1.25 Shikimate dehydrogenase A HO HO OPPG CH OH 2.7.1.34 Pantetheine kinase UDP- TDP-Rhamnose 2 NH NH NH NH N M 2.7.1.36 Mevalonate kinase 1.1.1.27 Lactate dehydrogenase HO COO- GDP- 2.4.1.21 O NH NH 4.1.1.28 2.3.1.5 2.1.1.4 1.1.1.29 Glycerate dehydrogenase C UDP-N-Ac-Muramate Iduronate OH 2.4.1.1 2.4.1.11 HO 5-Hydroxy- 5-Hydroxytryptamine N-Acetyl-serotonin N-Acetyl-5-O-methyl-serotonin Quinolinate 2.7.1.39 Homoserine kinase Mannuronate CH3 etc.
    [Show full text]
  • 12) United States Patent (10
    US007635572B2 (12) UnitedO States Patent (10) Patent No.: US 7,635,572 B2 Zhou et al. (45) Date of Patent: Dec. 22, 2009 (54) METHODS FOR CONDUCTING ASSAYS FOR 5,506,121 A 4/1996 Skerra et al. ENZYME ACTIVITY ON PROTEIN 5,510,270 A 4/1996 Fodor et al. MICROARRAYS 5,512,492 A 4/1996 Herron et al. 5,516,635 A 5/1996 Ekins et al. (75) Inventors: Fang X. Zhou, New Haven, CT (US); 5,532,128 A 7/1996 Eggers Barry Schweitzer, Cheshire, CT (US) 5,538,897 A 7/1996 Yates, III et al. s s 5,541,070 A 7/1996 Kauvar (73) Assignee: Life Technologies Corporation, .. S.E. al Carlsbad, CA (US) 5,585,069 A 12/1996 Zanzucchi et al. 5,585,639 A 12/1996 Dorsel et al. (*) Notice: Subject to any disclaimer, the term of this 5,593,838 A 1/1997 Zanzucchi et al. patent is extended or adjusted under 35 5,605,662 A 2f1997 Heller et al. U.S.C. 154(b) by 0 days. 5,620,850 A 4/1997 Bamdad et al. 5,624,711 A 4/1997 Sundberg et al. (21) Appl. No.: 10/865,431 5,627,369 A 5/1997 Vestal et al. 5,629,213 A 5/1997 Kornguth et al. (22) Filed: Jun. 9, 2004 (Continued) (65) Prior Publication Data FOREIGN PATENT DOCUMENTS US 2005/O118665 A1 Jun. 2, 2005 EP 596421 10, 1993 EP 0619321 12/1994 (51) Int. Cl. EP O664452 7, 1995 CI2O 1/50 (2006.01) EP O818467 1, 1998 (52) U.S.
    [Show full text]
  • Dema and Faust Et Al., Suppl. Material 2020.02.03
    Supplementary Materials Cyclin-dependent kinase 18 controls trafficking of aquaporin-2 and its abundance through ubiquitin ligase STUB1, which functions as an AKAP Dema Alessandro1,2¶, Dörte Faust1¶, Katina Lazarow3, Marc Wippich3, Martin Neuenschwander3, Kerstin Zühlke1, Andrea Geelhaar1, Tamara Pallien1, Eileen Hallscheidt1, Jenny Eichhorst3, Burkhard Wiesner3, Hana Černecká1, Oliver Popp1, Philipp Mertins1, Gunnar Dittmar1, Jens Peter von Kries3, Enno Klussmann1,4* ¶These authors contributed equally to this work 1Max Delbrück Center for Molecular Medicine in the Helmholtz Association (MDC), Robert- Rössle-Strasse 10, 13125 Berlin, Germany 2current address: University of California, San Francisco, 513 Parnassus Avenue, CA 94122 USA 3Leibniz-Forschungsinstitut für Molekulare Pharmakologie (FMP), Robert-Rössle-Strasse 10, 13125 Berlin, Germany 4DZHK (German Centre for Cardiovascular Research), Partner Site Berlin, Oudenarder Strasse 16, 13347 Berlin, Germany *Corresponding author Enno Klussmann Max Delbrück Center for Molecular Medicine Berlin in the Helmholtz Association (MDC) Robert-Rössle-Str. 10, 13125 Berlin Germany Tel. +49-30-9406 2596 FAX +49-30-9406 2593 E-mail: [email protected] 1 Content 1. CELL-BASED SCREENING BY AUTOMATED IMMUNOFLUORESCENCE MICROSCOPY 3 1.1 Screening plates 3 1.2 Image analysis using CellProfiler 17 1.4 Identification of siRNA affecting cell viability 18 1.7 Hits 18 2. SUPPLEMENTARY TABLE S4, FIGURES S2-S4 20 2 1. Cell-based screening by automated immunofluorescence microscopy 1.1 Screening plates Table S1. Genes targeted with the Mouse Protein Kinases siRNA sub-library. Genes are sorted by plate and well. Accessions refer to National Center for Biotechnology Information (NCBI, BLA) entries. The siRNAs were arranged on three 384-well microtitre platres.
    [Show full text]
  • Expression Profiling of Choline and Ethanolamine Kinases in MCF7, HCT116 and Hepg2 Cells, and the Transcriptional Regulation by Epigenetic Modification
    MOLECULAR MEDICINE REPORTS 11: 611-618, 2015 Expression profiling of choline and ethanolamine kinases in MCF7, HCT116 and HepG2 cells, and the transcriptional regulation by epigenetic modification CHUA SIANG LING1, KHOO BOON YIN2, SEE TOO WEI CUN1 and FEW LING LING1 1School of Health Sciences, Universiti Sains Malaysia, Kubang Kerian, Kelantan 16150; 2Institute for Research in Molecular Medicine, Universiti Sains Malaysia, Penang 11800, Malaysia Received December 10, 2013; Accepted September 4, 2014 DOI: 10.3892/mmr.2014.2707 Abstract. The function of choline kinase (CK) and etha- cell lines were varied. The effects of TSA treatment on the nolamine kinase (EK) is to catalyse the phosphorylation mRNA expression levels of ck and ek imply that ck and ek of choline and ethanolamine, respectively, in order to yield mRNA expression may be regulated by epigenetic modifica- phosphocholine (PCho) and phosphoethanolamine (PEtn). A tion. high expression level of PCho, due to elevated CK activity, has previously been associated with malignant transformation. In Introduction the present study, a quantitative polymerase chain reaction was performed to determine the mRNA expression profiles of ck Choline kinase (CK) and ethanolamine kinase (EK) are enzymes and ek mRNA variants in MCF7 breast, HCT116 colon and that initiate the first step in the Kennedy pathway, resulting in HepG2 liver cancer cells. The ck and ek mRNA expression the biosynthesis of phosphatidylcholine and phosphatidyletha- profiles showed that total ckα was expressed most abundantly nolamine (1). In the presence of Mg2+, CK and EK catalyse the in the HepG2 cells. The HCT116 cells exhibited the highest ATP-dependent phosphorylation of choline and ethanolamine ckβ and ek1 mRNA expression levels, whereas the highest into phosphocholine (PCho) and phoshoethanolamine (PEtn), ek2α mRNA expression levels were detected in the MCF7 respectively.
    [Show full text]
  • Lipid Biosynthesis
    Lipid Biosynthesis Objectives: I. Describe how excess carbohydrate and/or amino acid consumption leads to fatty acid and triacylglycerol production. II. What is the precursor of fatty acid biosynthesis (lipogenesis)? A. Where is it generated? B. How is it transported to the site of fatty acid biosynthesis? C. What other necessary precursors can be / are generated as part of the transport process? III. Describe how the precursor is activated for the biosynthesis pathway. IV. The Fatty Acid Biosynthesis Complex. A. Describe the Fatty Acid Biosynthesis Complex. B. Describe the six recurring reactions of fatty acid biosynthesis. C. What coenzymes are required for lipogenesis D. What is the final product of the Fatty Acid Biosynthesis Complex? V. What other reactions are necessary for the complete biosynthesis of the fatty acids needed by the cell? VI. Compare / Contrast β-oxidation of fatty acids and fatty acid biosynthesis. A. State at least three differences between lipogenesis (fatty acid synthesis) and β oxidation. VII. Describe the control points of fatty acid biosynthesis. A. Allosteric control B. Control by Reversible Covalent Modification C. Hormonal control 1. How does the control of lipogenesis integrate with the control of β-oxidation? 2. What is the Triacylglycerol Cycle and Glyceroneogenesis? VIII.Integrate fatty acid biosynthesis with carbohydrate metabolism. A. Describe the regulation of lipid and carbohydrate metabolism in relation to the liver, adipose tissue, and skeletal muscle B. Summarize the antagonistic effects of glucagon and insulin. IX. Describe the synthesis of A. Phosphatidate. B. The Triacylglycerols. C. The Phosphoglycerides. D. Sphingosine / Ceramide. X. Cholesterol Biosynthesis. A. In general terms, describe the synthesis of cholesterol.
    [Show full text]
  • Generate Metabolic Map Poster
    Authors: J. Michael Cherry Eurie Hong Benjamin Vincent Cynthia Krieger An online version of this diagram is available at BioCyc.org. Biosynthetic pathways are positioned in the left of the cytoplasm, degradative pathways on the right, and reactions not assigned to any pathway are in the far right of the cytoplasm. Transporters and membrane proteins are shown on the membrane. Rama Balakrishnan Ron Caspi Periplasmic (where appropriate) and extracellular reactions and proteins may also be shown. Pathways are colored according to their cellular function. YeastCyc: Saccharomyces cerevisiae S288c Cellular Overview Connections between pathways are omitted for legibility.
    [Show full text]
  • A Meta-Analysis of the Effects of High-LET Ionizing Radiations in Human Gene Expression
    Supplementary Materials A Meta-Analysis of the Effects of High-LET Ionizing Radiations in Human Gene Expression Table S1. Statistically significant DEGs (Adj. p-value < 0.01) derived from meta-analysis for samples irradiated with high doses of HZE particles, collected 6-24 h post-IR not common with any other meta- analysis group. This meta-analysis group consists of 3 DEG lists obtained from DGEA, using a total of 11 control and 11 irradiated samples [Data Series: E-MTAB-5761 and E-MTAB-5754]. Ensembl ID Gene Symbol Gene Description Up-Regulated Genes ↑ (2425) ENSG00000000938 FGR FGR proto-oncogene, Src family tyrosine kinase ENSG00000001036 FUCA2 alpha-L-fucosidase 2 ENSG00000001084 GCLC glutamate-cysteine ligase catalytic subunit ENSG00000001631 KRIT1 KRIT1 ankyrin repeat containing ENSG00000002079 MYH16 myosin heavy chain 16 pseudogene ENSG00000002587 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 ENSG00000003056 M6PR mannose-6-phosphate receptor, cation dependent ENSG00000004059 ARF5 ADP ribosylation factor 5 ENSG00000004777 ARHGAP33 Rho GTPase activating protein 33 ENSG00000004799 PDK4 pyruvate dehydrogenase kinase 4 ENSG00000004848 ARX aristaless related homeobox ENSG00000005022 SLC25A5 solute carrier family 25 member 5 ENSG00000005108 THSD7A thrombospondin type 1 domain containing 7A ENSG00000005194 CIAPIN1 cytokine induced apoptosis inhibitor 1 ENSG00000005381 MPO myeloperoxidase ENSG00000005486 RHBDD2 rhomboid domain containing 2 ENSG00000005884 ITGA3 integrin subunit alpha 3 ENSG00000006016 CRLF1 cytokine receptor like
    [Show full text]