SPECIES IDENTIFICATION IN THE AMERICAN SHARK FIN MARKET AUSTIN AYER MAY 2016

SPECIES IDENTIFICATION IN THE AMERICAN SHARK FIN MARKET

An Honors Thesis Submitted to the Department of Biology in partial fulfillment of the Honors Program STANFORD UNIVERSITY

by AUSTIN AYER MAY 2016

Species Identification in the American Shark Fin Market by Austin Ayer

Approved for submittal to the Department of Biology for consideration of granting graduation with honors:

Research Sponsor Stephen Palumbi ______Date _ May 5th 2016______(signature)

Second Reader Giulio De Leo ______Date _May 5th 2016______(signature)

Ayer 1

Species Identification in the American Shark Fin Market

TABLE OF CONTENTS

TABLES AND FIGURES ...... 2

ABSTRACT ...... 3

INTRODUCTION ...... 4

METHODS ...... 10

RESULTS ...... 13

DISCUSSION ...... 20

CONCLUSIONS ...... 27

REFERENCES ...... 28

Ayer 2

TABLES AND FIGURES ______

Table 1: Primers used for amplification of mitochondrial shark DNA (Page 11)

Table 2: Identifications of shark fin products purchased in the San Francisco market between 2003 and 2008 (Page 16)

Table 3: Unique identifications of shark fin products purchased in the Las Vegas market in 2015 made using a newly developed partial DNA-barcoding assay (Page 20)

Table 4: Species composition of a sample of 92 shark fins sampled from the San Francisco market (Page 23) ______

Figure 1: Map of a shark mitochondrial COI gene and primer sets (Page 13)

Figure 2: Partial phylogenetic tree generated from the full COI gene for various known shark species and CITES listed test sequences from the San Francisco market (Page 15)

Figure 3: An ambiguous portion of the phylogenetic tree generated from the full COI gene for various known shark species and test sequences from the San Francisco market (Page 16)

Figure 4: Partial phylogenetic tree generated using the Mini-barcoding assay developed by Fields et al. for various known shark species and Las Vegas soup test sequences (Page 19)

Ayer 3

ABSTRACT

With a lucrative trade in shark fins driving the unsustainable exploitation of the global shark fishery, tighter regulation of both the fishery and the fin market is needed. Given the important, apex predator role that many sharks play in marine ecosystems, as well as the precarious conservation status of certain species, there is a pressing need for more information regarding the species composition of shark fin imports. Because the removal and processing of shark fins can hinder identification based on morphological characteristics, a molecular approach to species identification has gained popularity. Here, genetic surveys of the San Francisco shark fin market and the Las Vegas shark fin soup market are described, including the discovery of CITES listed endangered species in both. Additionally, a novel, partial-COI DNA-barcoding assay is developed to improve identification potential from the highly degraded DNA found in shark fin soup.

Ayer 4

INTRODUCTION

The Global Shark Fishery

As in many of the world’s most important fisheries, the global shark fishery is being exploited at an unsustainable rate. The expansion and industrialization of fishing practices over the last half century have led to an overall decline in shark populations. 1 Targeted shark fisheries, as well as bycatch (much of it from long line, purse-seine, and gillnet fisheries targeting tuna and billfish), pull millions of sharks from the ocean each year.1, 2 However, quantifying the precise extent of the shark fishery and its decline is difficult, due to the incomplete and under reporting of shark catches, as well as the likelihood of high levels of illegal, unregulated, and unreported (IUU) catch.3 Using data on reported catch, discarded sharks (finned or not), and estimated IUU catch, Worm et al. estimated total global shark catch for the year 2000 at 1.44 million metric tons, and for 2010 at 1.41 million metric tons. Generalizing based on average shark weights, these catch levels represent 100 million and 97 million individual sharks, respectively. The removal of an estimated one billion sharks from the world’s oceans in a decade has profound implications for the future of these fish. Using published stock assessments, the same researchers estimated the exploitation rate for all sharks at between 6.4% and 7.9% annually. Although this may seem to be a relatively low exploitation rate, it is much higher that the average rebound rate of 4.9% per year calculated from a compilation of life histories of 62 shark species.1 The staggering number of sharks being fished becomes even more daunting when the life history strategies of sharks are considered. Life history strategies of members of the class Condrichthyes, which includes sharks, rays, skates, and chimaeras, are characterized by slower growth rates, later attainment of sexual maturity, and lower fecundity compared to most bony fish.4,5 These factors combine to make sharks more vulnerable at a species level to fishing pressures than other fish, exacerbating the consequences of the high catch numbers for sharks. The over- exploitation of shark stocks, combined with their vulnerability to fishing-induced Ayer 5 population decline, indicates that global shark populations are declining rapidly. Without intensive management, current fishing practices are likely to cause the collapse of shark fisheries whose target species have lower rebound potential.6 The apex predator status of most sharks confers them great influence over the ecosystems in which they live. Large shark species exert heavy top-down predation influence, both through consumptive and behavioral mechanisms, on species of lower trophic levels.4 The removal of large sharks releases smaller elasmobranch predators, marine mammals, and marine reptiles from their principal source of predation, causing cascading effects throughout the ecosystem.4 For example, Bascompte et al. modeled trophic interactions for hundreds of species in the Caribbean, and found that sharks were present in 48% of trophic chains. The model suggested that the removal of sharks could have contributed to an observed shift from coral- to seaweed-dominated reefs via an increase in populations of fish consumers.7 Additionally, some studies have placed large sharks in the role of keystone predator, although others suggest that supporting evidence for these claims are lacking.8 While it is still unclear whether certain individual shark species qualify as keystone predators, the removal of large sharks from the oceans has the potential to cause cascading ecological effects, and highlights the importance of understanding which species are being brought to market. The 1973 Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) provides an international legal framework for the recognition of the conservation status of individual species, as well as the enforcement of regulations regarding the sale of products from those species.9 Currently, there are eight species of shark listed by CITES: whale shark, Rhincodon typus, basking shark, Cetorhinus maximus, white shark, Carcharodon carcharias, porbeagle, Lamna nasus, oceanic whitetip, Carcharhinus longimanus, scalloped hammerhead, Sphyrna lewini, smooth hammerhead, S. zygaena, and great hammerhead, S. mokarran. Each of these species is listed in CITES Appendix II, described as a list of species that may become threatened with extinction in the absence of trade controls. Within the United States, these species have special management status that criminalizes the unpermitted sale of their parts and Ayer 6 products under the Endangered Species Act. Parties can apply for export permits to engage in the trade of CITES Appendix II listed species, provided a “Scientific Authority of the State of export has advised that such export will not be detrimental to the survival of that species,” among other requirements.9

The Shark Fin Market

The high price demanded by shark fins around the world confers a large responsibility on the shark fin market as a driver of the global shark fishery. Finning, or the practice of removing a shark’s cartilaginous fins and discarding the rest of the animal, is a major factor in the unsustainable harvesting of sharks. The global market for shark fin soup, an Asian delicacy, fuels this lucrative practice. Lending shark fin soup its name are the collagenous protein fibers, known as ceratotrichia, that constitute the bulk of a shark fin’s mass. Apart from the fins, however, shark meat holds little commercial value, incentivizing the finning of sharks and the discarding of their carcasses. The demand for shark fins has significantly increased over the last two decades, indicating that the fin market is becoming a more powerful force in the over-exploitation of sharks.10 Extrapolating from an analysis of individual fins sold in Hong Kong (the world’s largest fin market, 85% of total imports) over an 18- month period, Clarke et al. estimated the total biomass of sharks caught for the international fin market in 2004 at 1.70 million metric tons, a similar estimate to that of Worm et al. discussed above.10 Interestingly, these estimates are four times greater than the mid range estimates for total shark catch biomass published by the United Nations Food and Agriculture Organization (FAO), which monitors fisheries globally. This disparity can at least partially be accounted for by the practice of finning, which discards the vast majority of its catch by mass and thus under-reports biomass removed from the ecosystem. The huge number of sharks harvested for the fin market, as well as the vulnerability of many shark fisheries to collapse, suggests a dire need for more information regarding the species composition of the fin market.11,12 While the act of finning itself is prohibited in many countries including the Ayer 7

United States and the European Union, the shark fin market persists in the US with little regulation in terms of species trafficking and little general awareness of species composition. Import regulation, specifically determination of species, is hampered by multiple factors, including the removal of morphologically identifying features in the finning process, and the dozens of market categories used to classify fin products in the Hong Kong market that do not correspond to taxonomic groups.1,12 Additionally, most of the existing literature that delves into species identification focuses on the massive Hong Kong market due to its status a distribution hub, and ignores the relatively small American import market. Even less is known about the species present in American restaurant soup dishes, because reliable methods of extracting and identifying degraded shark DNA from soup have only recently been developed, and still fail to address many important needs. In order to judge American participation in the global decline of various shark fisheries, it is necessary to know which species feature most prominently in the domestic marketplace, which includes restaurant fin dishes. While illegal in eight US states, the sale of shark fins and shark fin food products drives an American market that in 2011 imported 58 metric tons of dried shark fins with a total value of over US$ 104 million.14 Despite the serious economic and ecological implications of this industry, little is known about the species composition of the American shark fin market. This lack of knowledge makes policy decisions regarding market regulation difficult, and allows the trafficking of animal products from threatened and endangered species to occur within the United States.1 Two of the eight CITES listed shark species, the scalloped and smooth hammerhead, have previously been found in American shark fin soup samples, but their presence has never been tested for in the California market, and the greater American market remains undercharacterized.15 In 2011, the state of California passed Bill AB 376, which states, “it shall be unlawful for any person to possess, sell, offer for sale, trade, or distribute a shark fin.”16 Citing the global decline of shark populations, the vulnerability of sharks to fishing pressure, and the ecological importance of sharks as apex predators, the state legislature outlawed the import and sale of shark fins within California. The Ayer 8 sale of shark fin products remains legal in the majority of US states.

Molecular Identification

While traditional investigations of commercial animal products have relied on visual inspection, defining morphological features are often absent in commercial shark products. The practice of finning, combined with the physical and chemical treatments undergone by processed fins, means that identifying morphological features are rarely present by the time shark products reach the commercial market. With the rapid improvement of genetic analysis techniques, molecular diagnostic protocols have become commonplace in species identification practice, circumventing the problems associated with morphological identification of shark fins.13 The mitochondrial cytochrome c oxidase 1 (COI) gene has emerged as the most common “barcoding” gene for animal life.17 Due to the gene’s highly conserved nature across different taxa, variability across species, and abundance in existing literature and databases, the COI gene has become the standard for molecular taxonomic identification.17 The concept of barcode identification relies on the fact that intraspecific genetic variability is usually lower than interspecific variability,18 allowing identification based on a comparison of unknown sequences to known sequences from multiple species. While the full, 650 base pair COI gene has become the standard in barcoding protocols, variations in sequence and quality of DNA necessitate the use of many different sets of primers to achieve amplification of the desired DNA. So called “universal” COI primers have been developed for various subsets of taxa, but more specific primers are constantly in development. The quality of DNA used in molecular identification determines the constraints of possible amplification. Degraded DNA is more difficult to amplify, and DNA that hasn’t been stored properly since the death of the organism presents many challenges for molecular identification. Namely, the length of intact strands of DNA decreases as samples get older.19 This has important ramifications for genetic identification of commercial shark products. Ayer 9

From the moment a shark is killed, DNA repair mechanisms employed by the organism throughout its lifetime cease, while many destructive processes continue to act on the DNA.19 Following the removal and drying of the fin, the tissue undergoes a series of antagonistic processes that further damage the DNA. The removal of skin and application of harsh heat, salt, and sometimes chemical processing in preparation for the soup market degrades DNA and makes traditional barcoding techniques ineffective.20 Additionally the cooking process employed to lend ceratotrichia their desired, chewy texture further reduces the quantity of viable DNA. In response to the challenges that DNA degradation presents to identification of commercial shark products, barcoding assays that utilize partial fragments of the COI gene have recently been developed. The inherent tradeoff of this approach is that the smaller the segment of DNA used in a barcoding assay, the less powerful it becomes as an identification tool. Thus, the major challenge in the identification of processed shark fins is the development of a genetic identification assay that uses a barcode region both small enough to be reliably amplified from degraded DNA, and large enough to provide statistically powerful identification to the species level.

Goals

In this thesis, I describe genetic surveys of the San Francisco shark fin market and the Las Vegas shark fin soup market in order to better characterize the species composition of the American imports. Specifically, I look for the presence of CITES listed species within the market. Additionally, I explore existing options for attaining species level identifications from highly degraded shark DNA. Finally, I develop a new partial-barcoding assay with potential for forensic applications to market regulation.

Ayer 10

METHODS

Aim 1: Identify species of shark fins acquired in the California market

Sample Preparation and Analysis

Commercial shark fin products (n=107) were collected from retail markets in San Francisco’s Chinatown during three separate surveys prior to the 2011 statewide ban on the shark fin trade. The products were collected in 2003, 2007, and 2008, and ranged in quality from full fins with skin to skinless fin fragments. The products were individually bagged and frozen for several years prior to genetic analysis. Approximately 10 mg of tissue from each fin was prepared for Polymerase Chain Reaction (PCR) amplification using Nucleospin tissue DNA extraction kits (Macherey-Nagel). The mitochondrial cytochrome c oxidase 1 (COI) gene, the most common barcoding gene for animal life, was amplified from extracted DNA via PCR. Amplification of the 650 base pair fragment of mitochondrial DNA was performed using standard protocols and multiple pairs of oligonucleotide vertebrate COI primers: the M13 labeled universal fish barcoding forward primers21 (FishF2_t1 and VF2_t1) in conjunction with either the M13 labeled universal fish barcoding reverse primer (FishR2_t1) or the Folmer degenerate reverse primer (dgHCO2198). PCR was performed in a volume of 20 uL, which included 1 uL of extracted DNA, and concentrations of 100 nM for each primer, 1.5 uM magnesium chloride, 300 nM BSA, 200 nM dNTPs, and 1.25 uM Taq Polymerase. Thermal cycling protocol consisted of a 2 minute activation phase at 94ºC, followed by 35 cycles of a 30 second denaturing phase at 94ºC, a 40 second annealing phase at 52ºC, and a 1 minute elongation phase at 72ºC, followed by a final 10 minute extension phase at 72ºC. Following PCR, amplified fragments were visualized via gel electrophoresis using 3X EZ-Vision DNA dye (Amresco) and 1.5% agarose gel. Successful amplification products were sequenced using standard Sanger chemistry.

Ayer 11

Table 1: Primers used for amplification of mitochondrial shark DNA. Name Primer ID Sequence (5’-3’)

Universal Fish Forward FishF2_t1 TGTAAAACGACGGCCAGTCGACTAATCATAAAGATATCGGCAC

Universal Fish Forward VF2_t1 TGTAAAACGACGGCCAGTCAACCAACCACAAAGACATTGGCAC

Universal Fish Reverse FishR2_t1 CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAG Folmer Degenerate dgHCO2198 Reverse TAAACTTCAGGGTGACCAAARAAYCA Shark COI Mini Shark COI- Reverse MINIR AAGATTACAAAAGCGTGGGC

COI Internal Forward COI int_F GGWACWGGWTGAACWGTWTAYCCYCC

Sequence Identification Analysis

Returned sequences were edited in Sequencher, a sequence-editing package, and cross-referenced against known COI sequences for many shark species available on the GenBank BLAST database. Identification of test sequences was based on phylogenetic reconstruction methods using neighbor joining genetic distance algorithms as implemented in the program Geneious (Biomatters 2014). Available COI sequences up to a maximum of five were downloaded from GenBank for every species in each genus identified in the preliminary BLAST cross-reference. All test and known sequences were aligned using the program Clustal Omega. The statistical significance of test and known sequence groupings (a measure of the confidence in test sequence identification) was estimated by bootstrap resampling of the sequence data. Identifications were made using a phylogeny tested with 100 bootstrap resamplings.

Aim 2: Identify species from DNA extracted from shark fin soup

Sample Preparation and Analysis

In a July 2015 survey, 9 dishes containing shark fin tissue were purchased from 9 different restaurants in the Las Vegas area. Eight of the restaurant samples were ceratotrichia extracted from shark fin soup, with the ninth being ceratotrichia extracted from steamed shark fin dumplings. Ceratotrichia were extracted from the dishes on site, rinsed with water, and frozen prior to genetic analysis. Ceratotrichia Ayer 12 were stored and frozen in one of three mediums: Proteinase K solution, water, or soup broth. Approximately 10 mg of tissue from each ceratotrichia was prepared for Polymerase Chain Reaction (PCR) amplification using Nucleospin tissue DNA extraction kits (Macherey-Nagel). PCR was performed with the extracted DNA using various sets of primers in order to amplify different fragments of the mitochondrial COI gene. Amplification of the full COI gene was attempted as described above. Next, a recently developed Mini-DNA barcoding assay was performed to amplify a short, approximately 130 base pair segment of the COI gene. This amplification followed reaction and thermal cycling protocols described by Fields et al.,15 using a reverse primer that anneals to a widely conserved region within the COI gene (Shark COI- MINIR) in conjunction with the universal fish barcoding forward primers, to yield a trimmed sequence representing the first 120-130 base pairs of the COI gene. Finally, due to limited identification potential of the mini-barcoding region (see below), a novel partial-barcode assay was tested on the same Las Vegas tissue extractions described above. The goal of the new assay was to amplify a fragment of the COI gene long enough to allow improved identification power over that of the Mini-barcoding assay, while still short enough to be reliably amplified from heavily degraded DNA. By using a degenerate internal forward primer (COI int_F) located approximately 330 base pairs from the end of the COI gene, in conjunction with the Folmer degenerate reverse primer (dgHCO2198), a distinct, longer internal segment of the COI gene than that which was amplified in the Mini-barcoding assay was successfully amplified from shark fin soup DNA. PCR for this assay was performed in a volume of 20 uL, which included 3 uL of extracted DNA, and concentrations of 100 nM for each primer, 1.5 uM magnesium chloride, 300 nM BSA, 200 nM dNTPs, and 1.25 uM Taq Polymerase. Thermal cycling protocol consisted of a 3 minute activation phase at 94ºC, followed by 38 cycles of a 30 second denaturing phase at 94ºC, a 30 second annealing phase at 50ºC, and a 45 second elongation phase at 72ºC, followed by a final 5 minute extension phase at 72ºC. Amplification products were visualized and sequenced as described in Aim 1.

Ayer 13

Sequence Identification Analysis

Returned sequences were edited in Sequencher, a sequence-editing package. Identification of test sequences was based on phylogenetic reconstruction methods as described in Aim 1. The test sequences were aligned with the same batch of known sequences used in the San Francisco fin phylogeny. The statistical significance of test and known sequence groupings was estimated by bootstrap resampling of the sequence data. Identifications were made using a phylogeny tested with 100 bootstrap resamplings. Identifications are reported as a genetic distance value and a phylogenetic relationship between test sequence and known sequences. Figure 1 shows a map of the mitochondrial COI gene and the relative locations of each set of primers referenced above.

Figure 1: Map of a shark mitochondrial COI gene and primer sets. The full COI amplification used in Aim 1 and attempted in Aim 2 is represented by the black box at the top of the figure. The Mini-barcoding amplification described by Fields et al. is represented by the red box, and the novel amplification assay is represented by the green box. Locations of individual primers are shown on the map, and relative distances (in base pairs) are shown at the bottom of the figure.

RESULTS

Aim 1: Identify species of shark fins acquired in the California market Of the 107 San Francisco shark fin products from which tissue was sampled, 92 yielded successful COI amplifications. Of those 92 fins, 48 were identified to the species level, with the remaining 44 identified to the genus level. Representatives were identified from 10 distinct genera and at least 19 different species. Most notably, seven of the fin products belonged to one of three CITES listed endangered Ayer 14 species: scalloped hammerhead, Sphyrna lewini, smooth hammerhead, S. zygaena, and great hammerhead, S. mokarran. Taxonomic identification was based on phylogenetic reconstruction methods using a neighbor-joining genetic distance algorithm. Strength of identification is reported here using two values: branch likelihood and group type. A branch likelihood value indicates the likelihood of the given phylogenetic relationship, and represents the number of times (out of 100) that a new phylogenetic reconstruction of the data would generate the branch in its current location. The group type value indicates the phylogenetic relationship between test sequence and known sequences. A group type of “outgroup” signifies a test sequence branch grouped alongside a branch containing a series of known sequences, in which the known sequences are more closely related to each other than to the test sequence. A group type of “within” signifies a test sequence embedded within a branch containing known sequences, in which all sequences are equally related to one another. A group type of “within” represents a more confident identification than an “outgroup” type, but the branch likelihood value is the stronger indicator of identification. Figures 2 and 3 show portions of the phylogenetic tree used to identify fins from the San Francisco market. Figure 2 exhibits the portion of the tree used to confidently identify fins belonging to members of 3 CITES listed hammerhead species, while Figure 3 demonstrates an ambiguous portion of the tree in which species level identification was impossible. Branch likelihood values greater than 70 were considered indicative of identification, although the vast majority of identifications had likelihood values above 90. Species identifications with branch likelihood values below 70 were discounted, and the next smallest taxonomic relationship (genus) was used for identification. Table 2 details the identifications made. Ayer 15

Figure 2: Partial phylogenetic tree generated from the full COI gene for various known shark species and CITES listed test sequences from the San Francisco market. The test sequences identified as belonging to S. lewini (0701, 0704, 0711) and S. zygaena (0310) are grouped within the known sequences of those species, while those belonging to S. mokarran (0303, 0311, 0802) are outgrouped to the known S. mokarran sequences. All of the identifications detailed in the figure are confident identifications of CITES listed species.

Ayer 16

Figure 3: An ambiguous portion of the phylogenetic tree generated from the full COI gene for various known shark species and test sequences from the San Francisco market. All test sequences shown in the figure are outgrouped to two clusters of known sequences representing two different species (C. altimus and C. plumbeus). While we can conclude that these test sequences belong to one of those two species, it is impossible to assign them a species-level identification, so they are conservatively assigned to the genus Carcharhinus.

Table 2: Identifications of shark fin products purchased in the San Francisco market between 2003 and 2008. Red text denotes a CITES listed endangered species. Sample Year Group Branch Genus Species Common Name ID Collected Type Likelihood 0301 2003 Carcharhinus falsiformis Silky Shark Within 98 0302 2003 Carcharhinus falsiformis Silky Shark Within 98 0303 2003 Sphyrna mokarran Great Hammerhead Outgroup 100 0304 2003 Carcharhinus Requiem Sharks Outgroup 98 0306 2003 Carcharhinus brevipinna Spinner Shark Within 100 0308 2003 Alopias Thresher Sharks Outgroup 100 0309 2003 Carcharhinus Requiem Sharks Outgroup 98 0310 2003 Sphyrna zygaena Smooth Hammerhead Within 100 0311 2003 Sphyrna mokarran Great Hammerhead Outgroup 100 0312 2003 Carcharhinus Requiem Sharks Outgroup 96 0315 2003 Squalus Dogfish Sharks Outgroup 100 0316 2003 Carcharhinus Requiem Sharks Outgroup 98 0317 2003 Carcharhinus acronotus Blacknose Shark Outgroup 94 0318 2003 Carcharhinus Requiem Sharks Outgroup 98 0319 2003 Prionace glauca Blue Shark Within 100 0321 2003 Carcharhinus Requiem Sharks Outgroup 96 0322 2003 Carcharhinus Requiem Sharks Outgroup 96 0323 2003 Raja binoculata Great Skate Within 100 0325 2003 Carcharhinus Requiem Sharks Outgroup 98 0701 2007 Sphyrna lewini Scalloped Hammerhead Within 100 0702 2007 Carcharhinus Requiem Sharks Outgroup 96 Ayer 17

0703 2007 Carcharhinus acronotus Blacknose Shark Outgroup 94 0704 2007 Sphyrna lewini Scalloped Hammerhead Within 100 0705 2007 Isurus oxyrinchus Shortfin Mako Shark Within 100 0708 2007 Carcharhinus acronotus Blacknose Shark Outgroup 94 0709 2007 Sphyrna tudes Smalleye Hammerhead Within 100 0710 2007 Carcharhinus Requiem Sharks Outgroup 96 0711 2007 Sphyrna lewini Scalloped Hammerhead Within 100 0712 2007 Negaprion brevirostris Lemon Shark Outgroup 100 0715 2007 Carcharhinus Requiem Sharks Outgroup 96 0716 2007 Carcharhinus Requiem Sharks Outgroup 96 0717 2007 Carcharhinus Requiem Sharks Outgroup 96 0718 2007 Carcharhinus Requiem Sharks Outgroup 96 0719 2007 Carcharhinus amblyrhynchos Grey Reef Shark Within 100 0720 2007 Carcharhinus Requiem Sharks Outgroup 98 0721 2007 Carcharhinus Requiem Sharks Outgroup 98 0722 2007 Carcharhinus Requiem Sharks Outgroup 98 0723 2007 Carcharhinus Requiem Sharks Outgroup 98 0725 2007 Carcharhinus Requiem Sharks Outgroup 96 0726 2007 Carcharhinus Requiem Sharks Outgroup 98 0727 2007 Carcharhinus leucas Bull Shark Outgroup 100 0728 2007 Carcharhinus Requiem Sharks Outgroup 96 0730 2007 Carcharhinus leucas Bull Shark Outgroup 100 0731 2007 Carcharhinus leucas Bull Shark Outgroup 100 0733 2007 Carcharhinus Requiem Sharks Outgroup 96 0734 2007 Carcharhinus Requiem Sharks Outgroup 96 0736 2007 Carcharhinus Requiem Sharks Outgroup 96 0737 2007 Carcharhinus leucas Bull Shark Outgroup 100 0738 2007 Carcharhinus Requiem Sharks Outgroup 96 0740 2007 Carcharhinus leucas Bull Shark Outgroup 100 0742 2007 Carcharhinus leucas Bull Shark Outgroup 100 0743 2007 Carcharhinus leucas Bull Shark Outgroup 100 0744 2007 Carcharhinus leucas Bull Shark Outgroup 100 0745 2007 Carcharhinus Requiem Sharks Outgroup 96 0801 2008 Galeocerdo cuvier Tiger Shark Outgroup 100 0802 2008 Sphyrna mokarran Great Hammerhead Outgroup 100 Caribbean Sharpnose 0803 2008 Rhizoprionodon porosus Outgroup 89 Shark 0805 2008 Carcharhinus Requiem Sharks Outgroup 96 0806 2008 Carcharhinus acronotus Blacknose Shark Outgroup 94 0807 2008 Carcharhinus isodon Finetooth Shark Outgroup 100 0808 2008 Carcharhinus Requiem Sharks Outgroup 98 0809 2008 Carcharhinus Requiem Sharks Outgroup 98 0810 2008 Carcharhinus leucas Bull Shark Outgroup 100 Atlantic Sharpnose 0811 2008 Rhizoprionodon terraenovae Outgroup 72 Shark

0812 2008 Rhizoprionodon Sharpnose Sharks Within 100 0813 2008 Carcharhinus Requiem Sharks Outgroup 98 0814 2008 Carcharhinus acronotus Blacknose Shark Outgroup 94 0815 2008 Galeocerdo cuvier Tiger Shark Outgroup 100 0816 2008 Carcharhinus falsiformis Silky Shark Within 98 0817 2008 Carcharhinus Requiem Sharks Outgroup 98 0818 2008 Carcharhinus falsiformis Silky Shark Within 98 0819 2008 Carcharhinus isodon Finetooth Shark Outgroup 100 0820 2008 Carcharhinus Requiem Sharks Outgroup 98 0821 2008 Carcharhinus Requiem Sharks Outgroup 98 0822 2008 Carcharhinus isodon Finetooth Shark Outgroup 100 0823 2008 Carcharhinus Requiem Sharks Outgroup 98 0824 2008 Carcharhinus isodon Finetooth Shark Outgroup 100 Ayer 18

0826 2008 Carcharhinus Requiem Sharks Outgroup 98 0827 2008 Carcharhinus Requiem Sharks Outgroup 98 0828 2008 Carcharhinus Requiem Sharks Outgroup 98 0829 2008 Carcharhinus leucas Bull Shark Outgroup 100 0830 2008 Carcharhinus leucas Bull Shark Outgroup 100 0831 2008 Prionace glauca Blue Shark Within 100 0833 2008 Carcharhinus brevipinna Spinner Shark Within 100 0834 2008 Carcharhinus Requiem Sharks Outgroup 98 0835 2008 Carcharhinus Requiem Sharks Outgroup 98 0836 2008 Carcharhinus Requiem Sharks Outgroup 98 0837 2008 Carcharhinus Requiem Sharks Outgroup 98 0838 2008 Carcharhinus isodon Finetooth Shark Outgroup 100 0839 2008 Carcharhinus acronotus Blacknose Shark Outgroup 94 0840 2008 Carcharhinus Requiem Sharks Outgroup 98 0841 2008 Galeocerdo cuvier Tiger Shark Outgroup 100

Aim 2: Identify species from DNA extracted from shark fin soup Samples were acquired from 9 dishes from 9 different Las Vegas restaurants, yielding hundreds of individual ceratotrichia for analysis. Of the 44 ceratotrichia from which DNA extractions were attempted, 9 repeatedly yielded DNA from non- elasmobranch species upon amplification and sequencing, indicating contamination during the storage and extraction procedure. Amplified non-target DNA included chicken, crab, shrimp, pig, and various bacteria, demonstrating the challenge of accurately extracting DNA from soup containing DNA from multiple organisms. Despite issues with contamination, DNA was successfully amplified from multiple ceratotrichia from each dish. No clear relationship was found between the different ceratotrichia storage mediums (Proteinase K, water, brother) and amplification success. Various DNA barcoding assays were attempted for the 35 remaining Las Vegas sample extractions. Amplification of the full, 650 base pair COI gene failed for each of these samples, reinforcing the need for a smaller barcoding assay when working with heavily degraded DNA. Amplification of the approximately 130 base pair Mini-barcoding fragment was achieved for 29 of the 35 non-contaminated samples, including representative samples from every sample source/dish. Despite the 83% amplification success rate, the Mini-barcoding assay proved ineffective for phylogenetic identification in all but one instance, in which a species level identification was made for the CITES listed scalloped hammerhead (S. lewini). Ayer 19

Figure 4 shows the portion of the phylogenetic tree generated from the Mini- barcoding region used to make this identification.

Figure 4: Partial phylogenetic tree generated using the Mini-barcoding assay developed by Fields et al. for various known shark species and Las Vegas soup test sequences. The test sequence, PK04, is outgrouped to a series of known S. lewini (scalloped hammerhead) sequences with a branch likelihood value of 89. This represents the only confident, species-level identification made using the Mini- barcoding region and a phylogenetic approach to identification.

A new partial barcoding assay was performed on the same 35 Las Vegas ceratotrichia extractions described above. Upon amplification and sequence trimming, the proposed set of primers located approximately 330 base pairs apart yielded a clean sequence of approximately 290 base pairs in length. Amplification was achieved for 10 of the 35 Las Vegas extractions (28.6%) including representative samples from 6 of the 9 restaurants surveyed. Confident species level identifications were made for all 10 of these amplifications, yielding shark sequences representing 3 species from 3 distinct genera. Notably, one sample was identified as belonging to the CITES listed scalloped hammerhead, S. lewini. Interestingly, the soup sample containing scalloped hammerhead ceratotrichia was also found to contain ceratotrichia from a pelagic thresher shark, Alopias pelagicus. Table 3 details the identifications made from samples purchased in the Las Vegas market using the new partial-barcoding assay. While replicate identifications Ayer 20

(samples from the same source representing the same species) have been excluded to clarify results, the number of replicate identifications is reported for each sample.

Table 3: Unique identifications of shark fin products purchased in the Las Vegas market in 2015 made using a newly developed partial DNA-barcoding assay. Red text denotes a CITES listed endangered species. Group Branch Replicate Source Genus Species Common Name Type Likelihood IDs Capital Seafood Prionace glauca Blue Shark Within 94 2 KJ Kitchen Prionace glauca Blue Shark Within 94 2 Scalloped Harbor Palace Sphyrna lewini Within 100 1 Hammerhead Pelagic Thresher Harbor Palace Alopias pelagicus Outgroup 100 1 Shark East Ocean Dim Sum & Prionace glauca Blue Shark Within 94 1 Seafood Chang's Hong Kong Prionace glauca Blue Shark Within 94 2 Cuisine Joyful House Prionace glauca Blue Shark Within 94 1

DISCUSSION

Aim 1: Identify species of shark fins acquired in the California market

Genetic Identification and Market Regulation

Ninety-two of the 107 San Francisco shark fins yielded successful full-COI amplifications (86.0%). DNA from the remaining 15 fins did not amplify upon repeated extraction and amplification attempts using multiple sets of degenerate primers, suggesting DNA degradation as the factor limiting identification. The distribution of un-amplified fins across the three sampling years (1 from 2003, 10 from 2007, 4 from 2008), suggests that time since acquisition, and thus time spent stored at minus 20ºC, is not the factor responsible for DNA degradation to the point of amplification inhibition. It may be that tissue storage and treatment between catch time and time of purchase is responsible for the failure to amplify the full COI gene from certain San Francisco fins. That being said, these results make it clear that it is possible to amplify full COI gene sequences from a significant majority of whole shark fin products, even after they have made their way through the lengthy supply chain from catch to commercial sale. Ayer 21

Of the 92 fins from which the COI gene was amplified, 48 were identified to the species level (52.2%), with the remaining 44 identified to the genus level (47.8%). Given the successful amplification of the full COI gene for every fin in the phylogenetic analysis, the lack of a species-level identification for approximately half of the fins is a function of low genetic resolution within the COI gene for certain groups of species, not of low quality amplification. In order to increase the proportion of species-level identifications, more detailed phylogenetic analyses would need to be implemented for the low-resolution species groups, or a different gene altogether would need to be characterized across each species and amplified. Importantly, identification of CITES listed species was not hindered by the aforementioned low genetic resolution, as the vast majority of genus-level identifications were within the genus Carcharhinus, which contains no CITES listed species. No genus-level identifications were made for genera that contain a CITES listed species. The preservation of intact DNA throughout the journey to market, combined with the high resolution of the COI gene, especially among legally-important species, means that individual genetic identification as a means of regulating shark fin imports is feasible, at least in terms of the viability of DNA amplification. However, scalability remains a major obstacle to the implementation of such a forensic screening program. With the advent of next generation sequencing technologies, capable of handling large batches of sequences at once, genetic screening of shark fin imports has the potential to be a cost-effective manner of regulating the shark fin market.

Diversity of Species

Within the San Francisco market, fins were identified from at least 19 different species representing 10 distinct genera and 3 different orders. Considering the sample size of successful COI amplifications (92), this finding represents an impressive diversity within the commercial shark fin market. Table 4 details the proportion of each species or genus in the San Francisco market survey. Ayer 22

Among the samples, three species of oceanic pelagic shark were identified: blue, Prionace glauca, silky, Carcharhinus falsiformis, and shortfin mako, Isurus oxyrinchus. Oceanic pelagic sharks are characterized by their tendency to live in open ocean environments, away from coasts and the sea floor, as well as their high mobility and large size.22 Due to many factors, including life history strategies and size, oceanic pelagic sharks face a significantly higher risk of extinction than the average for all marine sharks and rays.22 This places extra importance on the regulation of fisheries that catch these sharks, as well as markets in which their products are sold. Additionally, one species of skate (big, Raja binoculata) was identified. Skates, like rays, are cartilaginous fish that belong to the same subclass as sharks (Elasmobranchii), but pertain to a distinct order (Rajiformes). The presence of skate tissue within the shark fin market suggests that suppliers could be diluting the market with less valuable shark fin-substitutes. Indeed, a previous study found that 11% of a batch of “fins” confiscated in Australian waters belonged to rays or skates.23 The San Francisco market survey described here found many of the same species identified as major components of the Hong Kong shark fin market in a survey published in 2006.10 Both surveys found blue, shortfin mako, silky, tiger, smooth hammerhead, great hammerhead, scalloped hammerhead, thresher, and bull sharks within their respective markets. However, the Hong Kong survey found blue shark to be by far the most common individual species, representing 18.2% of the market by weight. By contrast, the San Francisco survey found bull shark to be the largest single species contributor to the market, with nearly 12% of all fins belonging to C. leucas, while blue shark fins made up only 2.17% of the San Francisco survey. However, because the Hong Kong survey was organized around local market categories, which do not correspond to individual species and do not account for the majority of species diversity within the market (54.0% of market weight reported as “other”), a more comprehensive comparison of the two market surveys is difficult. Ayer 23

Table 4: Species composition of a sample of 92 shark fins sampled from the San Francisco market. Red text denotes a CITES listed endangered species. Genus/Species Common Name # of Fins Percentage of Sample Carcharhinus leucas Bull Shark 11 11.96 Carcharhinus acronotus Blacknose Shark 6 6.52 Carcharhinus isodon Finetooth Shark 5 5.43 Carcharhinus falsiformis Silky Shark 4 4.35 Galeocerdo cuvier Tiger Shark 3 3.26 Sphyrna lewini Scalloped Hammerhead 3 3.26 Sphyrna mokarran Great Hammerhead 3 3.26 Carcharhinus brevipinna Spinner Shark 2 2.17 Prionace glauca Blue Shark 2 2.17 Carcharhinus amblyrhynchos Grey Reef Shark 1 1.08 Isurus oxyrinchus Shortfin Mako 1 1.08 Negaprion brevirostris Lemon Shark 1 1.08 Raja binoculata Big Skate 1 1.08 Rhizoprionodon porosus Caribbean Sharpnose Shark 1 1.08 Rhizoprionodon terraenovae Atlantic Sharpnose Shark 1 1.08 Sphyrna tudes Smalleye Hammerhead 1 1.08 Sphyrna zygaena Smooth Hammerhead 1 1.08 Carcharhinus spp. Requiem Sharks 42 45.65 Alopias spp. Thresher Sharks 1 1.08 Squalus spp. Dogfish Sharks 1 1.08 Rhizoprionodon spp. Sharpnose Sharks 1 1.08 Total 92 100

CITES and the California Shark Fin Ban

Perhaps the most notable finding from the San Francisco market survey is the presence of multiple CITES listed species. Seven fins, constituting 7.59% of the market survey, were found to belong to one of three CITES listed species: great hammerhead, Sphyrna mokarran, scalloped hammerhead, S. lewini, or smooth hammerhead, S. zygaena. While it is unlikely that the species of the fins was made explicit, or even known, during the import and sale of the fins, it is important to note that the three previously mentioned hammerhead species were not listed in CITES Appendix II until 2014, well after the San Francisco fins were collected. Thus, permits were not required for the import or sale of the fins in question at the time of collection. However, given the relatively short time span between the survey and the CITES listing of the hammerhead species, as well as the difficulty of identification and regulation within the shark fin market, it is likely that American imports still contain CITES listed species. Ayer 24

Given the motivations of the 2011 California ban on the trade of shark fin products, the findings of this survey bolster the reasoning behind the ban. In addition to the finding of products from 3 species now protected by law, most of the species found in the survey are apex predators, and many belong to species that are listed as vulnerable or endangered by the International Union for the Conservation of Nature (IUCN). Allowing the trade of shark fins to continue in its currently unregulated manner would have run counter to the conservation ideals expressed by the California State Legislature in the bill, and contributed to the ongoing decline of global shark populations.

Aim 2: Identify species from DNA extracted from shark fin soup

Challenges of Species Identification from Restaurant Samples

As expected, making species level identifications from DNA extracted from shark fin soup proved more difficult than whole-fin identification. The difficulty of avoiding contamination, as well as the inability to amplify long segments of DNA, presented the two largest challenges to successful identification. Despite thoroughly rinsing each ceratotrichia before storage, over 30% of all amplifications from restaurant samples were for non-elasmobranch species. The use of other meat as well as meat-based broth in most shark fin dishes complicates the accurate extraction and amplification of shark DNA. The increased risk of contamination necessitates the acquisition of a larger number of samples, as well as the performance of multiple extractions and amplifications for each sample. Assuming shark DNA could be successfully extracted, amplifying a long enough segment of DNA to provide the necessary identification power presented the greatest challenge to the project. The complete failure of all restaurant samples to amplify for the full COI gene suggests that the insults of cooking simply degrade the DNA too much to ever reliably amplify a segment of over 600 base pairs in a single amplification procedure. This result was expected, as studies have already moved beyond verification of this fact and begun to develop identification assays that rely on smaller segments of the COI gene. Ayer 25

After failed amplification of the full COI gene, the next step was to try the Mini-barcoding assay described by Fields et al. The authors found they could amplify a 127 base pair segment of the COI gene from shark fin soup DNA 62% of the time. They were also able to identify all amplified DNA to either the genus or species level using BLAST and BOLD (Barcode of Life Database) cross-referencing as the identification protocol, and were able to prove the efficacy of their identification assay for 7 of the 8 CITES listed shark species. Although application of the Mini- barcoding assay to the Las Vegas soup samples achieved similar success in terms of amplification (64%), the results of this study indicate that the Mini-barcoding assay does not provide enough identification power to identify the majority of shark species to the species level using a more rigorous, phylogenetic identification approach. In contrast to database identification protocols (BLAST, BOLD), the phylogenetic protocol used here requires greater certainty to make an identification. The BOLD identification algorithm assigns a species name for any relationship with a genetic distance value below a certain threshold, while the BLAST matching feature returns the best species match, regardless of uncertainty or alternative options. A phylogenetic approach will return the most likely evolutionary relationship given the data and the specific algorithm used, but will not resolve ambiguous relationships between sequences, preventing uncertain species identification. Phylogenies generated for the 127 base pair Mini-barcoding region using the methods described above produced ambiguous relationships between test and known sequences, preventing any conclusive species identification in all but one instance (CITES listed S. lewini, Figure 4). These findings indicate that while the development of the Mini-barcoding assay is an important step in amplifying DNA from shark fin soup, it is not the comprehensive assay needed to facilitate powerful and rigorous identification of diverse species from heavily degraded DNA.

Ayer 26

A Novel Barcoding Assay for Shark Fin Soup

On one end of the identification spectrum is the full COI gene: powerful enough for phylogenetic identification across many different taxa, but essentially impossible to amplify from shark fin soup DNA. On the other end of the spectrum is the Mini-barcoding assay: small enough to be reliably amplified from heavily degraded DNA, but not large enough to provide rigorous, species-level identifications for the majority of species. Having attempted both assays and experienced their respective shortfalls, the logical next step was to try to find a sweet spot between the two of them. Working off the premise that the length of a given DNA segment is the best determinant of both its likelihood to amplify and its identification power, a new set of primers was applied to the Las Vegas soup samples, yielding a 290 base pair segment of the COI gene. Amplification using the novel assay was successful for 28.6% of the samples. While the relatively low amplification success rate compared to the Mini-barcoding assay suggests that 290 base pairs is approaching the threshold length for reliable amplification from soup DNA, the identification power of the assay is encouraging. Species level identifications were made for all 10 of the successful amplifications, yielding shark sequences representing 3 species from 3 distinct genera. While a larger sample size including many different species will be necessary to truly characterize the power of the 290 base pair assay, these results suggest that with replicate samples and extractions, the novel assay could provide a reliable mechanism for rigorously identifying shark species from highly-degraded soup DNA. Additionally, these results are consistent with the theory that even highly degraded DNA is accessible for amplification in small pieces. With the Mini- barcoding assay covering the first 120 base pairs of the COI gene, and the novel int_F assay covering the final 290 bases, it seems reasonable to expect that the middle, 250 base pair segment of the COI gene could also be amplified using a combination of known or designed primers. This opens the door for a piecewise Ayer 27 amplification of the full COI gene as a means of making rigorous, species level identification from highly degraded DNA.

CONCLUSIONS

The diversity of shark species present in the market surveys described here implicates the domestic trade of these products as a driver of many different shark fisheries. The finding in both surveys of CITES listed shark species, the sale of whose products was likely unpermitted, reinforces the need for better regulation of shark fin imports. If existing regulatory laws are to have a beneficial effect on global shark populations, enforcement will need to play a larger role in the market. While molecular identification has proved itself a viable alternative to morphological identification of shark products, the approach faces difficulties when dealing with the degraded DNA often found in commercial shark products. The novel partial DNA-barcoding assay described here improves upon existing molecular identification alternatives, and has potential forensic applications to the regulation of the shark fin trade.

Ayer 28

REFERENCES

1. Worm, B, Brendal D, Kettemer L, Ward-Paige CA, Chapman DD, Heithaus MR, Kessel ST, Gruber SH. (2013) Global Catches, Exploitation Rates, and Rebuilding Options for Sharks. Marine Policy 40: 194-204. 2. Camhi, MD, Valenti, SV, Fordham, SV, Fowler, SL, Gibson, C (2009) The conservation status of pelagic sharks and rays. Report of the IUCN Shark Specialist Group. Pelagic Shark Red List Workshop, IUCN Species Survival Commission Shark Specialist Group. Newbury, UK. 78 pp. 3. Clarke SC, McAllister MK, Milner-Gulland EJ, Kirkwood GP, Michielsens CGJ, Agnew DJ, et al. (2006) Global estimates of shark catches using trade records from commercial markets. Ecology Letters 9: 1115–1126. 4. Ferretti F, Worm B, Britten G, Heithaus MR, Lotze HK (2010) Patterns and ecosystem consequences of shark declines in the ocean. Ecology Letters 13: 1055–1071. 5. Frisk, MG, Miller, TJ, Fogarty, MJ (2001). Estimation and analysis of biological parameters in elasmobranch fishes: a comparative life history study. Can. J. Fish. Aquatic Sciences 58: 969–981. 6. Musick JA, Burgess G, Cailliet G, Camhi M, Fordham S (2000) Management of Sharks and Their Relatives. Fisheries 25: 9-13. 7. Bascompte J, Melián CJ, Sala E (2005) Interaction strength combinations and the overfishing of a marine food web. Proceedings of the National Academy of Sciences of the United States of America 102: 5443-5447. 8. Kitchell JF, Essington TE, Boggs CH, Schindler DE, Walters CJ (2002) The Role of Sharks and Longline Fisheries in a Pelagic Ecosystem of the Central Pacific. Ecosystems 5: 202-216. 9. Wijnstekers, W (2000) The Evolution of CITES. Châtelaine-Geneva, Switzerland: CITES Secretariat. 10. Abercrombie D, Clarke S, Shivji M (2005) Global-scale genetic identification of hammerhead sharks: Application to assessment of the international fin trade and law enforcement. Conservation Genetics 6: 775–788. 11. Lack M, Sant G. The future of sharks: a review of action and inaction. Washington, DC, USA: TRAFFIC International and the Pew Environment Group; 2011. 12. Shivji M, Clarke S, Pank M, Natanson L, Kohler N, et al. (2002) Genetic Identification of Pelagic Shark Body Parts for Conservation and Trade Monitoring. Conservation Biology 16: 1036–1047 13. Wong EHK, Shivji MS, Hanner RH (2009) Identifying sharks with DNA barcodes: assessing the utility of a nucleotide diagnostic approach. Molecular Ecology Resources 9: 243–256. PMID: 21564984 Ayer 29

14. NOAA (2012). 2012 Shark Finning Report to Congress. US Department of Commerce, National Oceanic and Atmospheric Administration, Silver Spring, Maryland, 2012, pp 127. 15. Fields AT, Abercrombie DL, Eng R, Feldheim K, Chapman DD (2015) A Novel Mini-DNA Barcoding Assay to Identify Processed Fins from Internationally Protected Shark Species. PLoS ONE 10(2): e0114844. doi:10.1371/journal.pone.0114844 16. Cal. Assemb. Bill AB376, Chapter 524 (Cal. Stat. 2011). 17. Hebert PDN, Gregory TR (2005) The Promise of DNA Barcoding for Taxonomy. Systematic Biology 54: 852-859. 18. Meyer CP, Paulay G (2005) DNA Barcoding: Error Rates Based on Comprehensive Sampling. PLOS Biology 3: 2229-2238. 19. Handt O, Höss M, Krings M, Pääbo S (1994) Ancient DNA: methodological challenges. Experientia 50: 524-529. 20. Vannuccini SF, Agriculture Organization of the United Nations (1999) Shark utilization, marketing, and trade. Rome: Food and Agriculture Organization of the United Nations. PMID: 25506965 21. Ward RD, Zemlak TS, Innes BH, Last PR, Hebert PDN (2005) DNA barcoding Australia's fish species. Philosophical Transactions of the Royal Society B: Biological Sciences 360: 1847–1857. PMID: 16214743 22. Dulvy NK, Baum JK, Clarke S, Compagno LJV, Cortés E, Domingo A, Fordham S, Fowler S, Francis MP, Gibson C, Martínez J, Musick JA, Soldo A, Stevens JD, and Valenti S (2008) You can swim but you can’t hide: the global status and conservation of oceanic pelagic sharks and rays. Aquatic Conservation: Marine and Freshwater Ecosystems 18: 459-482. 23. Holmes BH, Steinke D, Ward, RD (2009) Identification of Shark and Ray Fins Using DNA Barcoding. Fisheries Research 95: 280-28