The Genetic Code Properties of the Genetic Code

Total Page:16

File Type:pdf, Size:1020Kb

Load more

atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tcta aacagaatgattattc atcctcagat gagagtttat ccgtcagcca ct tcagtttc tctaaacagaatgattattc atcctcagat gag agtttat ccgtcagccMaster course:tcagtttc tctaaacagaatgattattc atcctcaga t gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcc tcagat gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattcTHE atcctcagat GENETIC gagagtttat CODE ccgtcagcca cttcagtttc tcta aacagaatgattattc atcctcagat gagagtttat ccgtcagcca ct tcagtttc tctaaacagaatgattattc atcctcagat gag agtttat ccgtcagcca cttcagtttc tctaaacagaatgattattc atcctcaga t gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcctcagatA. Schneider gagagtttat ccgtcagcca cttcagtttc tcta aacagaatgattattc atcctcagat gagagtttat ccgtcagcca ct tcagtttc tctaaacagaatgattattc atcctcagat gag agtttat ccgtcagcca cttcagtttc tctaaacagaatgattattc atcctcaga t gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tcta Properties of the genetic code Properties of the genetic code • The genetic code is degenerate -More than one codon specifies the same amino acid -Degeneracy usually occurs at the third base -Nearly all amino acids can be symbolized XY(A/G) or XY(U/C) • The genetic code is (nearly) universal The central dogma prions F. Crick. (1970) Nature, vol. 227, pp. 561-563 Role of tRNAs 3’-end (becomes charged with specific amino acid) Anticodon (recognizes codon in mRNA) Role of tRNAs There are fewer tRNA species than codons Wobble base (first base of the anticodon) first base of the anticodon Inosine (I) corresponds to deaminated adenine Standard Watson Crick base pairs U pairs with A and G Inosine pairs with A, U and C Adenosine Inosine -pairs with U -pairs with A, U, C Inosine pairs with A, U and C Aminoacylation of tRNAs Activating enzyme = aminoacyl-tRNA synthetase atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tcta aacagaatgattattcTHE GENETIC atcctcagat gagagtttatCODE ccgtcagcca ct tcagtttc tctaaacagaatgattattc atcctcagat gag agtttat ccgtcagcca cttcagtttc tctaaacagaatgattattc atcctcaga t gagagtttat• Deciphering ccgtcagcca of the geneticcttcagtttc code tctaaacaga atgattattc atcc tcagat gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc• Formation atcctcagat of aminoacyl-tRNAs gagagtttat ccgtcagcca cttcagtttc tcta aacagaatgattattc atcctcagat gagagtttat ccgtcagcca ct tcagtttc• Natural tctaaacagaatgattattc variations of the genetic atcctcagat code gag agtttat ccgtcagcca cttcagtttc tctaaacagaatgattattc atcctcaga t gagagtttat• Evolutionary ccgtcagcca origin ofcttcagtttc the genetic tctaaacaga code atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tcta aacagaatgattattc• Expanding atcctcagatthe genetic codegagagtttat ccgtcagcca ct tcagtttc tctaaacagaatgattattc atcctcagat gag agtttat ccgtcagcca cttcagtttc tctaaacagaatgattattc atcctcaga t gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tcta Chapter 1 Deciphering the genetic code (including a short history of molecular biology) Friedrich Miescher (1844-1895) Important biological discoveries in the second half of the 19th century • M. J. Schleiden, T. Schwann show that all tissues of plants and animals are of cellular origin (the cell is the fundamental unit of biology) • 1855 L. Pasteur and R. Virchow show that new cells can only arise from other cells (no spontaneous generation!) • 1858 C. R. Darwin and A. R. Wallace present the concept of evolution by natural selection • 1865 G. Mendel discovers the laws of heredity • 1866 E. Haeckel proposes that the nucleus contains factors for the transmission of hereditary traits • 1869 F. Miescher isolates DNA How did Miescher discover DNA? Experimental approach • Aim: To determine the chemical compositon of the cells • Model system leucocytes from pus F. Miescher’s laboratory in Tübingen Results • Isolates substance from isolated nuclei which he terms “nuclein” • Substance is present in all cells investigated • Substance is present in erythrocytes of birds but not of humans • Substance contains C, H, O, N • Contains large amounts of P but no S • Substance is different to any known protein Further experiments • Uses salmon sperm as a model (consists almost only of nuclei) • Determines P2O5 content as 22.5% (modern value 22.9%) • Predicts that nuclein must have very high molecular weight “Sofern wir (...) annehmen wollten, dass eine einzelne Substanz (...) auf irgendeine Art (...) die spezifische Ursache der Befruchtung sei, so müsste man ohne Zweifel vor allem an das Nuclein denken.“ Friedrich Miescher (1874) DNA as the "Stuff of Genes" Oswald T. Avery • Streptococcus pneumoniae -no capsule -not virulent • Streptococcus pneumoniae -with capsule -virulent Transformation as an experimental assay Micros- cope Petri dish Griffith, 1928 Erwin Chargaff’s rule The discovery of the double helix • X-ray diffraction pattern (R. Franklin) • Main method: Model building • Double but not triple helix • Phosphate sugar backbone is on the outside • The helices are antiparalell • The bases interact via hydrogen bonds (A with T and G with C) Crick on Chargaff’s rules “This was very exciting, and we thought 'ah ha!' and we realized - I mean what anyone who is familiar with the history of science ought to realize - that when you have one-to-one ratios, it means things go to together. And how on Earth no one pointed out this simple fact in those years, I don't know.” 1972 Chargaff on Watson and Crick “Crick and Watson are very different. Watson is now a very able, effective administrator. Crick is very different: brighter than Watson, but he talks a lot, and so he talks a lot of nonsense.” 1972 1953 “The double helix” Eagle-Pub Cambridge “We have discovered the secret of life” (F. Crick, February 1953) “It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material” Watson and Crick, 1953 Nobel price 1962 "for their discoveries concerning the molecular structure of nucleic acids and its significance for information transfer in living material" The coding problem • What is the dictionary by which the four-letter nucleic acid language is translated into the twenty-letter protein language What was not known in 1953 • No DNA sequence known • Very few protein sequences (mainly fragments from insulin) • How many different amino acids occur in proteins was disputed • The idea that proteins have defined sequences was not universally accepted • mRNA and tRNA have not been discovered yet RNA Tie Club (ca. 1954) RNA Tie club Members: J. Watson (Phe), F. Crick (Tyr), S. Brenner, E. Teller, G. Gamow (Ala) G. Gamow’s futile attempt to crack the genetic code Nucleo- tides Amino acids Gamow, George (1904-1968) Overlapping or non overlapping code? Proceedings of the National Academy of Sciences 43 (1957): Amino acid : Nucleotide = 1 : 1 implies an overlapping genetic code • Each nucleotide participates in two coding units (diamonds) Crick’s comma free genetic code “The most elegant biological theory ever to be proposed and proved wrong" (H. F. Judson) Crick’s comma free genetic code sense …CGU AAG… GU A non-sense U AA Proceedings of the National Academy of Sciences 43 (1957): Crick’s comma free genetic code Set of 10 words: ass, ate, eat, sat, sea, see, set, tat, tea, tee. • “Comma-free” does not work for this set of words: ate, eat, tea since teatea contains ate • “Comma-free” does work for this set of words: ass, sat, see, set, tat, tea and tee Crick’s Adaptor hypothesis (1950) The main idea was that it was very difficult to consider how DNA or RNA, in any conceivable form, could provide a direct template for the side-chains of the twenty standard amino acids. What any structure was likely to have was a specific pattern of atomic groups that could form hydrogen bonds. I therefore proposed a theory in which there were twenty adaptors (one for each amino acid), together with twenty special enzymes. Each enzyme would join one particular amino acid to its own special adaptor. This combination would then diffuse to the RNA template. An adaptor molecule could fit in only those places on the nucleic acid template where it could form the necessary hydrogen bonds to hold it in place. Sitting there, it would have carried its amino acid to just the right place where it was needed.” presented to the RNA Tie Club Crick’s Adaptor hypothesis (1950) The main idea was that it was very difficult to consider how DNA or RNA, in any conceivable form, could provide a direct template for the side-chains of the twenty standard amino acids. What any structure was likely to have was a specific pattern of atomic groups that could form hydrogen bonds. I therefore proposed a theory in which there were twenty tRNAs (one for each amino acid), together with twenty aminoacyl-tRNA synthetases. Each aminoacyl-tRNA synthetase would join one particular amino acid to its own special tRNA. This combination would then diffuse to the RNA template. An tRNA molecule could fit in only those places on the nucleic acid template where it could form the necessary hydrogen bonds to hold it in place. Sitting there, it would have carried its amino
Recommended publications
  • Braking the Genetic Code by Nierenberg

    Braking the Genetic Code by Nierenberg

    1 REVIEW The Invention of Proteomic Code and mRNA Assisted Protein Folding. by Jan C. Biro Homulus Foundation, 612 S Flower St. #1220, 90017 CA, USA. [email protected] Keywords: Gene, code, codon, translation, wobble-base, Abbreviations (excluding standard abbreviations: 2 Abstract Background The theoretical requirements for a genetic code were well defined and modeled by George Gamow and Francis Crick in the 50-es. Their models failed. However the valid Genetic Code, provided by Nirenberg and Matthaei in 1961, ignores many theoretical requirements for a perfect Code. Something is simply missing from the canonical Code. Results The 3x redundancy of the Genetic code is usually explained as a necessity to increase the resistance of the mutation resistance of the genetic information. However it has many additional roles. 1.) It has a periodical structure which corresponds to the physico-chemical and structural properties of amino acids. 2.) It provides physico-chemical definition of codon boundaries. 3.) It defines a code for amino acid co-locations (interactions) in the coded proteins. 4.) It regulates, through wobble bases the free folding energy (and structure) of mRNAs. I shortly review the history of the Genetic Code as well as my own published observations to provide a novel, original explanation of its redundancy. Conclusions The redundant Genetic Code contains biological information which is additional to the 64/20 definition of amino acids. This additional information is used to define the 3D structure of coding nucleic acids as well as the coded proteins and it is called the Proteomic Code and mRNA Assisted Protein Folding.
  • MCDB 5220 Methods and Logics April 21 2015 Marcelo Bassalo

    MCDB 5220 Methods and Logics April 21 2015 Marcelo Bassalo

    Cracking the Genetic Code MCDB 5220 Methods and Logics April 21 2015 Marcelo Bassalo The DNA Saga… so far Important contributions for cracking the genetic code: • The “transforming principle” (1928) Frederick Griffith The DNA Saga… so far Important contributions for cracking the genetic code: • The “transforming principle” (1928) • The nature of the transforming principle: DNA (1944 - 1952) Oswald Avery Alfred Hershey Martha Chase The DNA Saga… so far Important contributions for cracking the genetic code: • The “transforming principle” (1928) • The nature of the transforming principle: DNA (1944 - 1952) • X-ray diffraction and the structure of proteins (1951) Linus Carl Pauling The DNA Saga… so far Important contributions for cracking the genetic code: • The “transforming principle” (1928) • The nature of the transforming principle: DNA (1944 - 1952) • X-ray diffraction and the structure of proteins (1951) • The structure of DNA (1953) James Watson and Francis Crick The DNA Saga… so far Important contributions for cracking the genetic code: • The “transforming principle” (1928) • The nature of the transforming principle: DNA (1944 - 1952) • X-ray diffraction and the structure of proteins (1951) • The structure of DNA (1953) How is DNA (4 nucleotides) the genetic material while proteins (20 amino acids) are the building blocks? ? DNA Protein ? The Coding Craze ? DNA Protein What was already known? • DNA resides inside the nucleus - DNA is not the carrier • Protein synthesis occur in the cytoplasm through ribosomes {• Only RNA is associated with ribosomes (no DNA) - rRNA is not the carrier { • Ribosomal RNA (rRNA) was a homogeneous population The “messenger RNA” hypothesis François Jacob Jacques Monod The Coding Craze ? DNA RNA Protein RNA Tie Club Table from Wikipedia The Coding Craze Who won the race Marshall Nirenberg J.
  • Leslie E. Orgel 1927–2007

    Leslie E. Orgel 1927–2007

    Leslie E. Orgel 1927–2007 A Biographical Memoir by Jack D. Dunitz and Gerald F. Joyce ©2013 National Academy of Sciences. Any opinions expressed in this memoir are those of the authors and do not necessarily reflect the views of the National Academy of Sciences. LESLIE ELEAZER ORGEL January 12, 1927–October 27, 2007 Elected to the NAS, 1990 Leslie Eleazer Orgel was a theoretical chemist and inves- tigator of the origins of life who made deep and lasting contributions in both of these scientific areas. He was born in London, England, on January 12, 1927, the second of three children of Simon and Deborah (Gnivisch) Orgel. His older brother Nevill was born on July 2, 1922, and died on December 28, 1957. His younger sister Delia was born on June 19, 1933, and currently resides in Silver Spring, Maryland. Leslie Orgel died on October 27, 2007, in San Diego, California, from pancreatic cancer. He is survived by his wife of 57 years, Alice (Levinson) Orgel; by his three children, Vivienne (b. April 4, 1955), Richard (b. November 29, 1956), and Robert (b. June 25, 1968); and by five By Jack D. Dunitz grandchildren. and Gerald F. Joyce After attending Dame Alice Owen’s School in London, which was evacuated during World War II to Bedford, England, Orgel studied chemistry at the University of Oxford, graduating in 1948 as BA with First Class Honours in Chem- istry. He then undertook graduate research with Leslie Sutton, senior chemistry tutor at Magdalen College and himself a distinguished physical chemist. Orgel’s1 first publication (1951) dealt with the semi-empirical calculation of electric dipole moments of conjugated heterocyclic molecules, and can be of no more than historical interest today.
  • Wo 2012/064675 A2

    Wo 2012/064675 A2

    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date - if 18 May 2012 (18.05.2012) WO 2012/064675 A2 (51) International Patent Classification: (81) Designated States (unless otherwise indicated, for every C12N 15/11 (2006.01) C12Q 1/68 (2006.01) kind of national protection available): AE, AG, AL, AM, C07H 21/00 (2006.01) C12N 15/10 (2006.01) AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, (21) International Application Number: DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, PCT/US201 1/059656 HN, HR, HU, ID, JL, IN, IS, JP, KE, KG, KM, KN, KP, (22) International Filing Date: KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, 7 November 20 11 (07.1 1.201 1) ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PE, PG, PH, PL, PT, QA, RO, RS, RU, (25) Filing Language: English RW, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, (26) Publication Language: English TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (30) Priority Data: 61/41 1,974 10 November 2010 (10.1 1.2010) US (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (72) Inventor; and GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, SZ, TZ, (71) Applicant : WEBB, Nigel, L.
  • Francis Crick Personal Papers

    Francis Crick Personal Papers

    http://oac.cdlib.org/findaid/ark:/13030/kt1k40250c No online items Francis Crick Personal Papers Special Collections & Archives, UC San Diego Special Collections & Archives, UC San Diego Copyright 2007, 2016 9500 Gilman Drive La Jolla 92093-0175 [email protected] URL: http://libraries.ucsd.edu/collections/sca/index.html Francis Crick Personal Papers MSS 0660 1 Descriptive Summary Languages: English Contributing Institution: Special Collections & Archives, UC San Diego 9500 Gilman Drive La Jolla 92093-0175 Title: Francis Crick Personal Papers Creator: Crick, Francis Identifier/Call Number: MSS 0660 Physical Description: 14.6 Linear feet(32 archives boxes, 4 card file boxes, 2 oversize folders, 4 map case folders, and digital files) Physical Description: 2.04 Gigabytes Date (inclusive): 1935-2007 Abstract: Personal papers of British scientist and Nobel Prize winner Francis Harry Compton Crick, who co-discovered the helical structure of DNA with James D. Watson. The papers document Crick's family, social and personal life from 1938 until his death in 2004, and include letters from friends and professional colleagues, family members and organizations. The papers also contain photographs of Crick and his circle; notebooks and numerous appointment books (1946-2004); writings of Crick and others; film and television projects; miscellaneous certificates and awards; materials relating to his wife, Odile Crick; and collected memorabilia. Scope and Content of Collection Personal papers of Francis Crick, the British molecular biologist, biophysicist, neuroscientist, and Nobel Prize winner who co-discovered the helical structure of DNA with James D. Watson. The papers provide a glimpse of his social life and relationships with family, friends and colleagues.
  • Chem 431C-Lecture 8A Central Dogma of Molecular Biology Proteins

    Chem 431C-Lecture 8A Central Dogma of Molecular Biology Proteins

    Chem 431c-Lecture 8a Reminder: Wednesday is Test 2 Day Covers Chapters 25 and 26 in toto. 90 points Translation: mRNA directed 6 discussion questions. 15 points each. Work protein synthesis quickly and concisely. Answer the question asked. Some students answer more than is asked. Penalty will be levied. Chapter 27: Will the test be difficult? For some, Yes. Protein Metabolism Study major concepts. Sample Question: Describe Mismatch Repair giving unique enzymes involved and describing when it is used. Copyright © 2004 by W. H. Freeman & Company Central dogma of molecular Proteins biology Typical cell needs 1000’s of proteins. • Proteins =the Protein biosynthesis elucidation-one of greatest endproducts of the challenges in biochemistry; information There are >70 ribosomal proteins; 90% of chem pathways energy used by cell; 15,000 ribosomes; 100,000 molecules of protein factors and enzymes; 200,000 tRNA molecules, Process is complex yet fast: protein of 100 aa’s/5 sec in E.coli. Ribosomes line the endoplasmic reticulum Genetic Code -nucleotide triplet codon/amino acid -non overlapping (overlap would be limiting) -first 2 letters usu. fixed but 3rd may be variable -degenerate: more than 1 codon/amino acid - reading frame determined by initiation codon – AUG; termination codons are UAA, UAG and UGA 1 Crick’s adaptor hypothesis Triplet non-overlapping code Just like assembling a Lego molecule? How many possible unique triplet codons can you have? Reading Frame in genetic code Open reading frame (ORF) In a random sequence of nucleotides, probability of 1/ 20 codons in each reading frame is a termination codon. So if it doesn’t have a termination codon among 50 or more, it’s an “open reading frame”(ORF).
  • Structure and Function of the Ribosome

    Structure and Function of the Ribosome

    7 OCTOBER 2009 Scientifc Background on the Nobel Prize in Chemistry 2009 STRUCTURE AND FUNCTION OF THE RIBOSOME THE ROYAL SWEDISH ACADEMY OF SCIENCES has as its aim to promote the sciences and strengthen their infuence in society. BOX 50005 (LILLA FRESCATIVÄGEN 4 A), SE-104 05 STOCKHOLM, SWEDEN Nobel Prize® and the Nobel Prize® medal design mark TEL +46 8 673 95 00, FAX +46 8 15 56 70, [email protected] HTTP://KVA.SE are registrated trademarks of the Nobel Foundation Structure and function of the ribosome This year’s Nobel Prize in Chemistry is awarded to Venkatraman Ramakrishnan, Thomas A. Steitz and Ada E. Yonath for their studies of the structure and function of the ribosome. Their scientific contributions and the historical context are summarized below. Brief introduction to the ribosome The ribosome and the central dogma. The genetic information in living systems is stored in the genome sequences of their DNA (deoxyribonucleic acid). A large part of these sequences encode proteins which carry out most of the functional tasks in all extant organisms. The DNA information is made available by transcription of the genes to mRNAs (messenger ribonucleic acids) that subsequently are translated into the various amino acid sequences of all the proteins of an organism. This is the central dogma (Crick, 1970) of molecular biology in its simplest form (Figure 1) DNA () gene →transcription RNA ( mRNA )→translation Protein ( peptide sequence) Figure 1. The central dogma revisited. The genetic information in DNA is preserved by replication of the genome (Watson and Crick, 1953a, b) carried out by DNA polymerase (Kornberg, 1969) so that each daughter cell can receive one genome copy at every cell division.
  • Ribonucleobase Interactions and Their Potential for Ribosome-Free Encoding

    Ribonucleobase Interactions and Their Potential for Ribosome-Free Encoding

    www.nature.com/scientificreports OPEN Cross-species conservation of complementary amino acid- ribonucleobase interactions and Received: 31 March 2015 Accepted: 02 November 2015 their potential for ribosome-free Published: 10 December 2015 encoding John G. D. Cannon1, Rachel M. Sherman2,3, Victoria M. Y. Wang4,† & Grace A. Newman5 The role of amino acid-RNA nucleobase interactions in the evolution of RNA translation and protein- mRNA autoregulation remains an open area of research. We describe the inference of pairwise amino acid-RNA nucleobase interaction preferences using structural data from known RNA- protein complexes. We observed significant matching between an amino acid’s nucleobase affinity and corresponding codon content in both the standard genetic code and mitochondrial variants. Furthermore, we showed that knowledge of nucleobase preferences allows statistically significant prediction of protein primary sequence from mRNA using purely physiochemical information. Interestingly, ribosomal primary sequences were more accurately predicted than non-ribosomal sequences, suggesting a potential role for direct amino acid-nucleobase interactions in the genesis of amino acid-based ribosomal components. Finally, we observed matching between amino acid- nucleobase affinities and corresponding mRNA sequences in 35 evolutionarily diverse proteomes. We believe these results have important implications for the study of the evolutionary origins of the genetic code and protein-mRNA cross-regulation. Despite having been discovered more than 50 years ago1,2 and studied for nearly as long3, the evolutionary basis of the universal genetic code remains an elusive challenge4. Even before the discovery of messenger RNA (mRNA) and the elucidation of the genetic code George Gamow proposed a stereochemical hypothesis based on the then recently determined structure of DNA5.
  • Considerations in Evolutionary Biochemistry Van Der Gulik, P.T.S

    Considerations in Evolutionary Biochemistry Van Der Gulik, P.T.S

    UvA-DARE (Digital Academic Repository) Considerations in evolutionary biochemistry van der Gulik, P.T.S. Link to publication Creative Commons License (see https://creativecommons.org/use-remix/cc-licenses): Other Citation for published version (APA): van der Gulik, P. T. S. (2019). Considerations in evolutionary biochemistry. Amsterdam: Institute for Logic, Language and Computation. General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons). Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible. UvA-DARE is a service provided by the library of the University of Amsterdam (http://dare.uva.nl) Download date: 28 sep 2020 Considerations in Evolutionary Biochemistry Peter T. S. van der Gulik Considerations in Evolutionary Biochemistry ILLC Dissertation Series DS-2019-06 For further information about ILLC-publications, please contact Institute for Logic, Language and Computation Universiteit van Amsterdam Science Park 107 1098 XG Amsterdam phone: +31-20-525 6051 e-mail: [email protected] homepage: http://www.illc.uva.nl/ These investigations were supported by Centrum Wiskunde & Informatica (CWI), Vici grant 639-023-302 from the Netherlands Organization for Scientific Research (NWO), and the QuSoft Research Center for Quantum Software.
  • Francis Crick, James Watson

    Francis Crick, James Watson

    Francis Crick and James Watson: And the Building Blocks of Life Edward Edelson Oxford University Press Francis Crick and James Watson And the Building Blocks of Life Image Not Available XFORD PORTRAITS INSCIENCE Owen Gingerich General Editor Francis Crick and James Watson And the Building Blocks of Life Edward Edelson Oxford University Press New York • Oxford Fondly dedicated to Hannah, the newest member of the family. Oxford University Press Oxford New York Athens Auckland Bangkok Bogotá Bombay Buenos Aires Calcutta Cape Town Dar es Salaam Delhi Florence Hong Kong Istanbul Karachi Kuala Lumpur Madras Madrid Melbourne Mexico City Nairobi Paris Singapore Taipei Tokyo Toronto Warsaw and associated companies in Berlin Ibadan Copyright © 1998 by Edward Edelson Published by Oxford University Press, Inc., 198 Madison Avenue, New York, New York 10016 Oxford is a registered trademark of Oxford University Press All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, electronic, mechanical, photocopying, recording, or otherwise, without the prior permission of Oxford University Press. Design: Design Oasis Layout: Leonard Levitsky Picture research: Lisa Kirchner Library of Congress Cataloging-in-Publication Data Edelson, Edward James Watson and Francis Crick and the building blocks of life / Edward Edelson. p. c. — (Oxford portraits in science) Includes bibliographical references and index. ISBN 0-19-511451-5 (library edition) 1. Watson, James D., 1928– —Juvenile literature. 2. Crick, Francis, 1916– —Juvenile literature. 3. DNA—Research—Juvenile literature. 4. Molecular biolo- gists—Biography—Juvenile literature. [1.Watson, James D., 1928– . 2. Crick, Francis, 1916– .
  • Sydney Brenner's Life in Science 1927–2019

    Sydney Brenner's Life in Science 1927–2019

    Sydney Brenner’s Life in Science 1927–2019 A Heroic Voyage: Sydney Brenner’s Life in Science Copyright © 2019 Agency for Science, Technology and Research Biomedical Research Council Agency for Science, Technology and Research 20 Biopolis Way, #08-01 Singapore 138668 All rights reserved. No part of this book may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying, recording or otherwise, without the prior written permission of the Publisher. This companion booklet was originally published in conjunction with the 2015 Sydney Brenner Scientific Symposium and Exhibition, held at Singapore's Biopolis scientific hub. Agency for Science, Cold Spring Technology and Research, Harbor Laboratory, Singapore New York c A Heroic Voyage: Sydney Brenner's Life in Science ONE OF AN EXCELLENT OUR OWN TRAVEL Message by Lim Chuan Poh COMPANION Former Chairman Agency for Science, Technology and Research Message by James Watson Chancellor Emeritus Cold Spring Harbor Laboratory hirty years ago, when Sydney times to reach over S$29 billion in 2012, ver the course of my career, Then there were the exciting, frenetic Brenner first visited Singapore, contributing to 5% of Singapore’s GDP. I’ve had the privilege of years of the Human Genome Project. We the state of research, especially While Singapore’s success in this area tackling some of the most kept up our exchanges, with him in the UK in biomedical sciences, was certainly cannot be attributed to any one fundamental questions in and me in the US, doing as much science as vastly different from what it is person, few have been as deeply involved biology, working alongside possible while being responsible for entire Ttoday.
  • On the Uniqueness of the Standard Genetic Code

    On the Uniqueness of the Standard Genetic Code

    life Article On the Uniqueness of the Standard Genetic Code Gabriel S. Zamudio and Marco V. José * Theoretical Biology Group, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, México D.F. 04510, Mexico; [email protected] * Correspondence: [email protected]; Tel.: +52-5562-3894 Academic Editor: Koji Tamura Received: 15 December 2016; Accepted: 8 February 2017; Published: 13 February 2017 Abstract: In this work, we determine the biological and mathematical properties that are sufficient and necessary to uniquely determine both the primeval RNY (purine-any base-pyrimidine) code and the standard genetic code (SGC). These properties are: the evolution of the SGC from the RNY code; the degeneracy of both codes, and the non-degeneracy of the assignments of aminoacyl-tRNA synthetases (aaRSs) to amino acids; the wobbling property; the consideration that glycine was the first amino acid; the topological and symmetrical properties of both codes. Keywords: RNY code; Standard genetic code; evolution of the genetic code; frozen code; degeneracy; aminoacyl-tRNA synthetases; symmetry 1. Introduction A fundamental feature of all life forms existing on Earth is that, with several minor exceptions, they share the same standard genetic code (SGC). This universality led Francis Crick to propose the frozen accident hypothesis [1], i.e., the SGC does not change. According to Crick [1], the SGC code remained universal because any change would be lethal, or would have been very strongly selected against and extinguished. The astonishing diversity of living beings in the history of the biosphere has not been halted by a frozen SGC. The inherent structure of the frozen SGC, in concert with environmental influences, has unleashed life from determinism.