atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tcta aacagaatgattattc atcctcagat gagagtttat ccgtcagcca ct tcagtttc tctaaacagaatgattattc atcctcagat gag agtttat ccgtcagccMaster course:tcagtttc tctaaacagaatgattattc atcctcaga t gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcc tcagat gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattcTHE atcctcagat GENETIC gagagtttat CODE ccgtcagcca cttcagtttc tcta aacagaatgattattc atcctcagat gagagtttat ccgtcagcca ct tcagtttc tctaaacagaatgattattc atcctcagat gag agtttat ccgtcagcca cttcagtttc tctaaacagaatgattattc atcctcaga t gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcctcagatA. Schneider gagagtttat ccgtcagcca cttcagtttc tcta aacagaatgattattc atcctcagat gagagtttat ccgtcagcca ct tcagtttc tctaaacagaatgattattc atcctcagat gag agtttat ccgtcagcca cttcagtttc tctaaacagaatgattattc atcctcaga t gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tcta Properties of the genetic code Properties of the genetic code
• The genetic code is degenerate -More than one codon specifies the same amino acid -Degeneracy usually occurs at the third base -Nearly all amino acids can be symbolized XY(A/G) or XY(U/C) • The genetic code is (nearly) universal The central dogma
prions
F. Crick. (1970) Nature, vol. 227, pp. 561-563 Role of tRNAs
3’-end (becomes charged with specific amino acid)
Anticodon (recognizes codon in mRNA) Role of tRNAs
There are fewer tRNA species than codons
Wobble base (first base of the anticodon) first base of the anticodon
Inosine (I) corresponds to deaminated adenine Standard Watson Crick base pairs U pairs with A and G Inosine pairs with A, U and C
Adenosine Inosine
-pairs with U -pairs with A, U, C Inosine pairs with A, U and C Aminoacylation of tRNAs
Activating enzyme = aminoacyl-tRNA synthetase atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tcta aacagaatgattattcTHE GENETIC atcctcagat gagagtttatCODE ccgtcagcca ct tcagtttc tctaaacagaatgattattc atcctcagat gag agtttat ccgtcagcca cttcagtttc tctaaacagaatgattattc atcctcaga t gagagtttat• Deciphering ccgtcagcca of the geneticcttcagtttc code tctaaacaga atgattattc atcc tcagat gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc• Formation atcctcagat of aminoacyl-tRNAs gagagtttat ccgtcagcca cttcagtttc tcta aacagaatgattattc atcctcagat gagagtttat ccgtcagcca ct tcagtttc• Natural tctaaacagaatgattattc variations of the genetic atcctcagat code gag agtttat ccgtcagcca cttcagtttc tctaaacagaatgattattc atcctcaga t gagagtttat• Evolutionary ccgtcagcca origin ofcttcagtttc the genetic tctaaacaga code atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tcta aacagaatgattattc• Expanding atcctcagatthe genetic codegagagtttat ccgtcagcca ct tcagtttc tctaaacagaatgattattc atcctcagat gag agtttat ccgtcagcca cttcagtttc tctaaacagaatgattattc atcctcaga t gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tcta Chapter 1 Deciphering the genetic code (including a short history of molecular biology)
Friedrich Miescher (1844-1895) Important biological discoveries in the second half of the 19th century
• M. J. Schleiden, T. Schwann show that all tissues of plants and animals are of cellular origin (the cell is the fundamental unit of biology) • 1855 L. Pasteur and R. Virchow show that new cells can only arise from other cells (no spontaneous generation!) • 1858 C. R. Darwin and A. R. Wallace present the concept of evolution by natural selection • 1865 G. Mendel discovers the laws of heredity • 1866 E. Haeckel proposes that the nucleus contains factors for the transmission of hereditary traits • 1869 F. Miescher isolates DNA How did Miescher discover DNA?
Experimental approach
• Aim: To determine the chemical compositon of the cells
• Model system leucocytes from pus F. Miescher’s laboratory in Tübingen Results
• Isolates substance from isolated nuclei which he terms “nuclein” • Substance is present in all cells investigated • Substance is present in erythrocytes of birds but not of humans • Substance contains C, H, O, N • Contains large amounts of P but no S • Substance is different to any known protein Further experiments
• Uses salmon sperm as a model (consists almost only of nuclei)
• Determines P2O5 content as 22.5% (modern value 22.9%)
• Predicts that nuclein must have very high molecular weight “Sofern wir (...) annehmen wollten, dass eine einzelne Substanz (...) auf irgendeine Art (...) die spezifische Ursache der Befruchtung sei, so müsste man ohne Zweifel vor allem an das Nuclein denken.“
Friedrich Miescher (1874) DNA as the "Stuff of Genes"
Oswald T. Avery • Streptococcus pneumoniae -no capsule -not virulent
• Streptococcus pneumoniae -with capsule -virulent Transformation as an experimental assay
Micros- cope
Petri dish
Griffith, 1928
Erwin Chargaff’s rule The discovery of the double helix
• X-ray diffraction pattern (R. Franklin) • Main method: Model building • Double but not triple helix • Phosphate sugar backbone is on the outside • The helices are antiparalell • The bases interact via hydrogen bonds (A with T and G with C) Crick on Chargaff’s rules
“This was very exciting, and we thought 'ah ha!' and we realized - I mean what anyone who is familiar with the history of science ought to realize - that when you have one-to-one ratios, it means things go to together. And how on Earth no one pointed out this simple fact in those years, I don't know.”
1972 Chargaff on Watson and Crick
“Crick and Watson are very different. Watson is now a very able, effective administrator. Crick is very different: brighter than Watson, but he talks a lot, and so he talks a lot of nonsense.”
1972 1953 “The double helix” Eagle-Pub Cambridge
“We have discovered the secret of life” (F. Crick, February 1953)
“It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material”
Watson and Crick, 1953 Nobel price 1962
"for their discoveries concerning the molecular structure of nucleic acids and its significance for information transfer in living material" The coding problem
• What is the dictionary by which the four-letter nucleic acid language is translated into the twenty-letter protein language What was not known in 1953
• No DNA sequence known • Very few protein sequences (mainly fragments from insulin) • How many different amino acids occur in proteins was disputed • The idea that proteins have defined sequences was not universally accepted • mRNA and tRNA have not been discovered yet RNA Tie Club (ca. 1954) RNA Tie club
Members: J. Watson (Phe), F. Crick (Tyr), S. Brenner, E. Teller, G. Gamow (Ala) G. Gamow’s futile attempt to crack the genetic code
Nucleo- tides
Amino acids
Gamow, George (1904-1968) Overlapping or non overlapping code?
Proceedings of the National Academy of Sciences 43 (1957): Amino acid : Nucleotide = 1 : 1 implies an overlapping genetic code
• Each nucleotide participates in two coding units (diamonds) Crick’s comma free genetic code
“The most elegant biological theory ever to be proposed and proved wrong"
(H. F. Judson) Crick’s comma free genetic code
sense
…CGU AAG… GU A non-sense U AA
Proceedings of the National Academy of Sciences 43 (1957): Crick’s comma free genetic code
Set of 10 words: ass, ate, eat, sat, sea, see, set, tat, tea, tee.
• “Comma-free” does not work for this set of words:
ate, eat, tea since teatea contains ate
• “Comma-free” does work for this set of words:
ass, sat, see, set, tat, tea and tee Crick’s Adaptor hypothesis (1950)
The main idea was that it was very difficult to consider how DNA or RNA, in any conceivable form, could provide a direct template for the side-chains of the twenty standard amino acids. What any structure was likely to have was a specific pattern of atomic groups that could form hydrogen bonds. I therefore proposed a theory in which there were twenty adaptors (one for each amino acid), together with twenty special enzymes. Each enzyme would join one particular amino acid to its own special adaptor. This combination would then diffuse to the RNA template. An adaptor molecule could fit in only those places on the nucleic acid template where it could form the necessary hydrogen bonds to hold it in place. Sitting there, it would have carried its amino acid to just the right place where it was needed.” presented to the RNA Tie Club Crick’s Adaptor hypothesis (1950)
The main idea was that it was very difficult to consider how DNA or RNA, in any conceivable form, could provide a direct template for the side-chains of the twenty standard amino acids. What any structure was likely to have was a specific pattern of atomic groups that could form hydrogen bonds. I therefore proposed a theory in which there were twenty tRNAs (one for each amino acid), together with twenty aminoacyl-tRNA synthetases. Each aminoacyl-tRNA synthetase would join one particular amino acid to its own special tRNA. This combination would then diffuse to the RNA template. An tRNA molecule could fit in only those places on the nucleic acid template where it could form the necessary hydrogen bonds to hold it in place. Sitting there, it would have carried its amino acid to just the right place where it was needed.”
adaptor = tRNA special enzymes = aminoacyl-tRNA synthetases Heinrich Matthaei
Marshall W. Nirenberg (born 1927) Experimental approach
• Cell-free protein synthesis system • Measure incorporation of 14C-amino acids
• First aim: To confirm the existence of mRNA – Check for stimulation of protein synthesis by the addition of RNA or DNA Experimental tricks
• Condition for freezing of active extracts were established • DNase pretreatment removes much of the background • TCA precipitation was performed on filters In vitro incorporation of 14C-amino acids into protein
Incorporation of 14C—labeled valine into protein in Escherichia coli extracts. Endogenous incorporation of radioactive amino acids into protein in E. coli extracts was high. However, amino acid incorporation ceased after incubation for ,40 min with DNase I. I found that I could freeze E. coli extracts and thaw them without loss of activity, so I incubated E. coli extracts in the absence of radioactive amino acids for 40 min, divided the extracts into small aliquots and froze them for use later in different experiments. Endogenous incorporation of radioactive amino acids was greatly reduced in such extracts, and addition of mRNA preparations from ribosomes clearly stimulated amino acid incorporation into protein.
Further results -RNA but not DNA stimulates activity -yeast rRNA shows activity -tobacco mosaic virus 30 to 50-fold more active than yeast rRNA Towards the identification of the first codon
• Poly-U (UUU corresponds to Phe) • 20 solutions containing 19 unlabeled and one radioactive amino acid each • Poly-U directs insertion of radioactive Phe only Poly-U selectively stimulates the synthesis of poly-Phe 14C-Phe incorporation Poly-U selectively stimulates the synthesis of poly-Phe
poly-14C-Phe poly-U First ever antisense experiment
Addition of poly(A) completely inhibits the mRNA activity of poly(U) by the formation of double-stranded helices. By contrast, addition of poly(C) has little effect on the mRNA activity of poly(U). This experiment, done in 1961, was the first anti-sense RNA experiment.
-template must be single strand Characterization of radioactive reaction product
• Poly-phenylalanine is insoluble in almost everything • It will dissolve in 15% hydrobromic acid dissolved in concentrated acetic acid • Radioactive poly-phenylalanine behaves like authentic poly-phenlyalanine Polynucleotide phosphorylase
- probable in vivo role: exonuclease Polynucleotide phosphorylase
• Allows the in vitro synthesis of randomly ordered oligonucleotide depending an the added nucleotides
• If only A and C are added the enzymatic reaction the frequency of each possible codon containing A and C depends on the A/C ratio and can be predicted
Example: if A is 75% and C 25% the frequency of AAC will be 0.75 x 0.75 x 0.25 = 0.141 A=75% C=25%
2A1C codons (AAC, ACA, CAA)
14.1% 0.75x0.75x0.25=0.141 2A1C
25% of C A=25% C=75%
2A1C codons (AAC, ACA, CAA)
0.25x0.25x0.75=0.047
4.7% 2A1C
75% of C Predicted codon for Asn must have 2A and 1C either AAC/ACA or CAA
Real codons for Asn are AAC/AAU A=75% C=25%
3A1C codons
0.75x0.75x0.75x0.25=0.105
Codons must be tripletts 10.0% 3A1C
25% of C A=75% C=25%
1A1C duplets 18.8% 0.75x0.25=0.188 2A1C +1A2C 2A1C or 1A1C 0.75x0.75x0.25=0.141 1A2C 0.75x0.25x0.25=0.047
2A1C+1A2C=0.188
25% of C Two codons for Thr must be composed of 2A1C and 1A2C, respectively
Codons for Thr are ACC/ACA/ACU/ACG Experimental approach to determine the sequence of the triplets
• Prepare triplets of defined sequences
• Triplet-induced binding of aminoacyl- tRNA to the ribosome Discovery of the tRNA Triplet-induced binding of aminoacyl- tRNA to the ribosome Deciphered 1961-1966