Identification and Phylogenetic Analysis of Channa Species from Riverine System of Pakistan Using COI Gene As a DNA Barcoding Marker

Journal of Bioresource Management

Volume 7 Issue 2 Article 10

Identification and Phylogenetic Analysis of Channa Species from Riverine System of Pakistan Using COI Gene as a DNA Barcoding Marker

Muhammad Kamran Department of Zoology, Quaid i Azam University Islamabad, [email protected]

Atif Yaqub Department of Zoology, Government College University, Lahore, Pakistan, [email protected]

Naila Malkani Department of Zoology, Government College University, Lahore, Pakistan, [email protected]

Khalid Mahmood Anjum Department of Wildlife and Ecology, University of Veterinary and Animal Sciences, Lahore, Pakistan, [email protected]

Muhammad Nabeel Awan Department of Zoology, Government College University, Lahore, Pakistan, [email protected]

See next page for additional authors Follow this and additional works at: https://corescholar.libraries.wright.edu/jbm

Part of the Aquaculture and Fisheries Commons, Biodiversity Commons, and the Bioinformatics Commons

Recommended Citation Kamran, M., Yaqub, A., Malkani, N., Anjum, K. M., Awan, M. N., & Paknejad, H. (2020). Identification and Phylogenetic Analysis of Channa Species from Riverine System of Pakistan Using COI Gene as a DNA Barcoding Marker, Journal of Bioresource Management, 7 (2). DOI: https://doi.org/10.35691/JBM.0202.0135 ISSN: 2309-3854 online (Received: Jun 12, 2020; Accepted: Jul 1, 2020; Published: Jul 18, 2020)

This Article is brought to you for free and open access by CORE Scholar. It has been accepted for inclusion in Journal of Bioresource Management by an authorized editor of CORE Scholar. For more information, please contact [email protected]. Identification and Phylogenetic Analysis of Channa Species from Riverine System of Pakistan Using COI Gene as a DNA Barcoding Marker

Authors Muhammad Kamran, Atif Yaqub, Naila Malkani, Khalid Mahmood Anjum, Muhammad Nabeel Awan, and Hamed Paknejad

© Copyrights of all the papers published in Journal of Bioresource Management are with its publisher, Center for Bioresource Research (CBR) Islamabad, Pakistan. This permits anyone to copy, redistribute, remix, transmit and adapt the work for non-commercial purposes provided the original work and source is appropriately cited. Journal of Bioresource Management does not grant you any other rights in relation to this website or the material on this website. In other words, all other rights are reserved. For the avoidance of doubt, you must not adapt, edit, change, transform, publish, republish, distribute, redistribute, broadcast, rebroadcast or show or play in public this website or the material on this website (in any form or media) without appropriately and conspicuously citing the original work and source or Journal of Bioresource Management’s prior written permission.

This article is available in Journal of Bioresource Management: https://corescholar.libraries.wright.edu/jbm/vol7/ iss2/10 Kamran et al. (2020). Phylogeny of Channa Species in Pakistan J Biores Manag. 7 (2): 88-98

IDENTIFICATION AND PHYLOGENETIC ANALYSIS OF CHANNA SPECIES FROM RIVERINE SYSTEM OF PAKISTAN USING COI GENE AS A DNA BARCODING MARKER MUHAMMAD KAMRAN1*, ATIF YAQUB2, NAILA MALKANI2, KHALID MAHMOOD ANJUM3, MUHAMMAD NABEEL AWAN2 AND HAMED PAKNEJAD4 1Department of Zoology, Quaid-i-Azam University, Islamabad, Pakistan 2Department of Zoology, Government College University, Lahore, Pakistan 3Department of Wildlife and Ecology, University of Veterinary and Animal Sciences, Lahore, Pakistan 4Department of Fisheries & Environment Science, Gorgan University of Agricultural Sciences and Natural Resources, Gorgan, Iran *Corresponding author: [email protected] ABSTRACT Channa are the freshwater and important food fish species in Pakistan belonging to family Channidae. However, identification and phylogenetic analysis based on molecular tools of these species in Pakistan was not well known. Herein, the current investigation was conceptualized, which dealt with mitochondrial DNA sequences from three geographically distinct populations of this species from Pakistan’s water system. DNA from fin tissues was extracted. COI region of mtDNA was amplified using universal primers for fish. PCR products were sequenced. Phylogenetic analysis conducted in the present study, i.e. neighbor-joining (NJ) cladogram, maximum likelihood, K2P genetic divergence and histogram suggests that the studied species of family Channidae are genetically different. The K2P intraspecific divergences were lower than interspecific divergences. The clades in the evolutionary tree for three species were clearly separated.

Keywords: Channidae, COI, phylogeny, barcode gap, molecular identification.

INTRODUCTION can be considered relatively reliable for both vertebrates and invertebrates (Hebert et al., A better understanding of the 2004; Hajibabaei et al., 2006; Lakra et al., taxonomy of freshwater fish species has 2016). Several successful studies concerning become crucial today because of the serious fish fauna have been reported using this conservation concerns as well as the method particularly for freshwater fisheries importance of fish as a major source of (Ward et al., 2005; Lakra et al., 2011; Landi protein diet available to society (Lakra et al., et al., 2014; Yaqub et al., 2019). 2016; Afridi et al., 2019). Traditionally, Additionally, many of these studies have morphology-based taxonomy has been used contributed to building a large-scale for identification of species which might not collection of barcoding data available at be reliable. Recently, molecular techniques BOLD (Costa et al., 2007; Kamran, 2017). are being used as a reliable and precise However, for a complete and comprehensive approach for systematics (Ward et al., 2009), database, data still needs to be uploaded to especially DNA barcoding for the purpose of the barcode reference library from various identification of species as well as species regions of the world, particularly from discovery (Hajibabaei et al., 2006). The Pakistan. efficacy of this approach is well tested and

Kamran et al. (2020). Phylogeny of Channa Species in Pakistan J Biores Manag. 7 (2): 88-98

In Pakistan, although a key of taxonomic resolution of the family freshwater fishes based on morphological Channidae (Lakra et al., 2009; Lakra et al., characteristics is available (Rafique and 2010; Benziger et al., 2011). Khan, 2012; Yaqub et al., 2019). However, Current investigation focuses on the there are significant problems for accurate identification of snakeheads using molecular species identification of snakehead (Serrao et techniques called DNA barcoding. DNA al., 2014) because updated data based on Barcoding is used for identification and molecular taxonomy is missing. delimitation of new species (Hebert et al., Family Channidae is one of the 2004; Smith et al., 2008; Kerr et al., 2009). In importer families in ichthyofauna. To date, in DNA Barcoding, a fragment of mtDNA, Pakistan four Channa species are found, commonly COI gene (cytochrome oxidase I which includes Channa striata, Channa gene) is used for the purpose of punctata, Channa marulius and Channa identification. COI is a bio-identical marker gachua (Pervaiz et al., 2018). Snakeheads are because it has good discrimination power for not only commercially important fish, but almost all animal phyla due to the following also its population in the wild is at threat important characteristics: it is easy to isolate, (Courtenay and Williams, 2004). Channa high copy number (Cywinska et al., 2006), species have the unusual capability to stay free of recombination, insertion and deletion alive, potentially even out of water for is uncommon, (Daravath et al., 2013), having months, if buried in the moist soil (Zhu et al., minimal variations within species, it seems to 2013a). Snakeheads have evolutionary have sequence uniqueness that is adequate to importance because of their unique behavior separate firmly related species (Hebert et al., (Adamson et al., 2010). Thus, correct 2003; Hebert et al., 2004) and can be identification of snakehead fishes is recovered from degraded as well as small necessary, as they differ in their potential samples (Waugh, 2007). ability and ecological requirements In the current investigation, (Courtenay et al., 2004; Serrao et al., 2014). identification, genetic diversity and For long, the taxonomic position of phylogeny pattern of three species of family snakeheads found in Pakistan has been Channidae belonging to Pakistani region creating trouble for taxonomists. Due to were approached using mtDNA sequence of ambiguities, taxonomy is not resolvable COI region, which might be helpful for through morphology-based identification. effective management and conservation Existing morphological keys provide strategies of Channa species in Pakistan. insufficient identification for the Channidae (Serrao et al., 2014; Conte-Grand et al., METHODOLOGY 2017). Hence, this issue has received Sampling incredible consideration with new species being described day by day (Musikasinthorn, Specimens of snakehead fish were 1998; Geetakumari and Vishwanath, 2010). collected and identified using available fish There is an urgent need to investigate and identification key (Rafique and Khan, 2012) update the taxonomic status of these fishes as representing three populations throughout the clear picture of snakehead diversity in different geographical areas of Pakistan Pakistan remains elusive. Interspecies and (Table 1). Caudal fin tissues were taken from intraspecies analysis of genetic distance and each specimen (50–100 mg each) for barcode gap, can significantly help in subsequent molecular studies.

Kamran et al. (2020). Phylogeny of Channa Species in Pakistan J Biores Manag. 7 (2): 88-98

Table 1: Sampling location and geographical coordinates of snakehead population.

Population Collection site Latitude/ longitude Sample size Channa punctata Head Taunsa bridge 30° 42' 20.0052'' N / 70° 39' 03 27.9936'' E Baloki Head works 31°13'20.96"N/ 73°51'59.05"E 03 Head Marala 32° 29' 33.65" N/ 74° 31' 03 52.82" E Channa marulius Head Taunsa bridge 30.705557/ 70.657776 03 Baloki Head works 31°13'20.96"N/ 73°51'59.05"E 03 Head Marala 32° 29' 33.65" N/ 74° 31' 03 52.82" E Channa striata Head Taunsa bridge 30° 42' 20.0052'' N / 70° 39' 03 27.9936'' E Baloki Head works 31°13'20.96"N/ 73°51'59.05"E 03 Head Marala 32° 29' 33.65" N/ 74° 31' 03 52.82" E

DNA extraction and Amplification Modified slat extraction method was used to extract the DNA. Amplification of 655bp barcode region of the mitochondrial DNA was performed with reported primers (Ward et al., 2005). Primers were synthesized from MACROGEN Inc., Seoul, Korea.

Primer Primer sequence (5’- 3’) Fish F1 TCAACCAACCACAAAGACATTGGCAC Fish R1 TAGACTTCTGGGTGGCCAAAGAATCA

PCR reaction was carried out using Q cycler Bioinformatics Analysis using following reaction conditions; an initial denaturing for 4 minutes, 35 cycles of Obtained sequences were edited and amplification (60 seconds denaturation at 94 aligned by using Bioedit software and °C, 45 seconds annealing at 46.3 °C, 60 ClustalW respectively (Thompson et al., seconds extension at 72 °C), and final 1997). The range of difference of sequence extension at 72 ºC then storage at 4 °C. PCR among the different species of family was followed by confirmation of product at Chandidae were calculated. For phylogenetic 1.5 % agarose gel. Bands showing good analysis, the Neighbor joining (NJ) and quality of PCR were sent to MACROGEN, Maximum likelihood (ML) cladogram as Korea for sequencing using forward and well as to calculate the pair-wise genetic reverse primers. distance based on Kimura-2-parameter (K2P) model the MEGA version X was used

Kamran et al. (2020). Phylogeny of Channa Species in Pakistan J Biores Manag. 7 (2): 88-98

(Kumar et al., 2018). Tajima's Neutrality Test tree revealed three clades, which is clearly was also performed using above mentioned showing the three separate species. In the tool. Automatic Barcode Gap Discovery and present study, Maximum likelihood based on Barcode Gap analysis software was used to K2P model was also constructed (Figure 2). calculate the histogram of genetic and ranked Both the approaches (NJ and ML) showed distances that there is an identical phylogenetic (http://wwwabi.snv.jussieu.fr/public/abgd/ab relationship among the studied species. The gdweb.html). analyses of histogram of genetic and ranked distances revealed a clear gap between RESULTS conspecific and congeneric species (Figure Barcode sequences having region of 3). 655bp for 27 specimens from family Based on K2P model, the Channidae were generated during the study. intraspecific divergence for three species BLAST results showed that sequences of ranged from 0.00-0.023 and interspecific studied specimen were previously uploaded divergence 0.182-0.195 (Table 2). The and available at Gene Bank data. But there highest genetic distance was observed were no barcode records from Pakistan for between C. striata and C. marulius and the Snakeheads in Gene Bank or BOLD. lowest distance was observed between C. The constructed Neighbor Joining punctata and C. marulius (Table 3). Results (NJ) tree based on K2P model for twenty- from Tajima's Neutrality Test are presented seven specimens belonging to three species in Table 4. The estimated of Chandidae family is shown in Figure 1. NJ transition/transversion bias (R) (2.62) was calculated based on K2P Model.

Kamran et al. (2020). Phylogeny of Channa Species in Pakistan J Biores Manag. 7 (2): 88-98

Figure 1: Neighbor joining Phylogenetic tree of COI gene sequences derived from snakehead based on the K2P distances.

Kamran et al. (2020). Phylogeny of Channa Species in Pakistan J Biores Manag. 7 (2): 88-98

Figure 2: Maximum likelihood Phylogenetic tree of COI gene sequences derived from snakehead based on the K2P distances.

Kamran et al. (2020). Phylogeny of Channa Species in Pakistan J Biores Manag. 7 (2): 88-98

Figure 3: Histogram of genetic distances for Family Channidae from Pakistan (A) and ranked distances (B) created using ABGD and BGA.

Table 2: Kimura-2-parameter (K2P) distances between Species of family Channidae

Comparison within species Comparison between species Min.% Max. % Mean% S.E % Min.% Max. % Mean% S.E % 0.0 0.023 0.0017 0.00325 0.182 0.195 0.189 0.0055

Table 03: Estimates of Evolutionary Divergence over Sequence Pairs between Groups

Channa punctata Channa marulius Channa striata

Channa punctata 0.023 Channa marulius 0.182 0.012 Channa striata 0.192 0.195 0.009

Table 04: Results from Tajima's Neutrality Test.

m S Ps Θ π D 27 137 0.235395189 0.061071499 0.114048227 3.39422347 m = number of sequences, n = total number of sites, S = Number of segregating sites, ps = S/n, Θ = ps/a1, π = nucleotide diversity, and D is the Tajima test statistic.

Kamran et al. (2020). Phylogeny of Channa Species in Pakistan J Biores Manag. 7 (2): 88-98

DISCUSSION the K2P distances as shown in figure 1 and 2. As shown in NJ tree the C punctata found For evolutionary and ecological closely with C. marulius, the findings of this process, the phylogeny of species is playing study corroborate with previously reported an important role due to its fitness in studies (Serrao et al., 2014; Conte-Grand et ecological function (Baisvar et al., 2019). al., 2017). This may be due to their nucleotide The genetic diversity is an important element divergence as different studies show that in species conservation (Almeida et al., 2003; congeneric species were found clustered Baisvar et al., 2019). Unfortunately, as far as together in NJ tree (Ward et al., 2009; Lakra aquatic ecosystem of Pakistan is concern, no et al., 2016). validated data about genetic variability of Figure 3 is showing the genetic and Family Channidae is available. Therefore, in ranked distances based on barcode gap. The current investigation, efforts were made to barcode gap in DNA barcoding is considered identify and evaluate the genetic an important parameter for accurate species distance/phylogeny of species within family declination. In DNA barcoding the barcode Channidae based on COI sequences. gap is considered effective when interspecific In the current investigation, based on distances are higher than intraspecific the COI sequences, for three studied species distances derived from COI gene (Austerlitz of family Channidae, a total of 27 individuals et al., 2009; Puillandre et al., 2012). Our were identified and their genetic diversity results clearly showed considerable barcode was calculated. There was no overlap gap between the genetic distances from intra detected between the interspecies and and interspecific. Taxonomists have been intraspecies distance and current study was in using barcode gap as a first set of species agreement with the previously reported hypotheses (Puillandre et al., 2012). findings (Barrett and Hebert, 2005; Zhu et al., Further study of the barcode is needed 2013b). K2P divergence within species was in resolving the identification issues of all the calculated from 0.00-0.027 and the fish species in Pakistan. The genetic strategy divergence between species ranged from for an identification purposes are an excellent 0.182-0.195. K2P divergence in this study shorthand to build a database of fish species were showed a high degree of resemblance of Pakistan. This type of genetic data is with similar observations reported by essential for the purpose of improvement in previous studies (Zhu et al., 2013b; Serrao et fish biodiversity of Pakistan. al., 2014). Our results were similar to previously reported study by Herbert et al. CONCLUSION (2004) that the species can be defined on the basis of intraspecific and interspecific The current scenario has shown divergence. They suggested that intraspecific effectiveness of COI gene region of mtDNA dissimilarity ought to be lower than in molecular identification of the freshwater interspecific similarity. fish species of Pakistan. The undertaken COI gene based phylogenetic study is useful for broadening of the analysis revealed that the twenty-seven Linnaean framework and can be used to sequences belonged to three different species improve the conservation strategies of of family Channidae. The NJ and ML Channa species in Pakistan. cladogram showed the three species CONFLICT OF INTEREST separately. The branch length of species tends to be much deeper than within species All authors have no conflict of leading to gap between snakeheads based on interest.

Kamran et al. (2020). Phylogeny of Channa Species in Pakistan J Biores Manag. 7 (2): 88-98

ETHICAL APPROVAL Baisvar VS, Singh M and Kumar R (2019). Population structuring of Channa All the research work was carried out striata from Indian waters using after the approval of Bioethical committee of control region of mtDNA. Faculty of Science and Technology, GC Mitochondrial DNA Part A., 30 (3): University Lahore. All applicable 414-23. international, national, and/or institutional Barrett RD and Hebert PD (2005). guidelines for the care and use of animals Identifying spiders through DNA were followed. barcodes. Can J Zoolog., 83 (3): 481- REFERENCES 91. Benziger A, Philip S, Raghavan R, Ali PH, Adamson EA, Hurwood DA and Mather PB Sukumaran M, Tharian JC, (2010). A reappraisal of the evolution Dahanukar N, Baby F, Peter R, Devi of Asian snakehead fishes (Pisces, KR and Radhakrishnan KV (2011). Channidae) using molecular data Unraveling a 146 years old taxonomic from multiple genes and fossil puzzle: validation of Malabar calibration. Mol Phylogenet Evol., 56 snakehead, species-status and its (2): 707-717. relevance for channid systematics and Afridi AJ, Zuberi A, Yousafzai AM, Kamran evolution. PLoS One., 6 (6): e21272. M and Ullah S (2019). Hemp Conte-Grand C, Britz R, Dahanukar N, (Marijuana) reverted Copper-induced Raghavan R, Pethiyagoda R, Tan HH, toxic effects on the essential fatty acid Hadiaty RK, Yaakob NS and Rüber L profile of Labeo rohita and Cirrhinus (2017). Barcoding snakeheads mrigala. Mol Biol Rep., 46 (1): 391- (Teleostei, Channidae) revisited: 401. Discovering greater species diversity Almeida FS, Sodré LM and Contel EP and resolving perpetuated taxonomic (2003). Population structure analysis confusions. PloS One., 12 of Pimelodus maculatus (Pisces, (9):e0184017. Siluriformes) from the Tietê and Costa FO, DeWaard JR, Boutillier J, Paranapanema rivers (Brazil). Genet Ratnasingham S, Dooh RT, Mol Biol., 26 (3): 301-5. Hajibabaei M and Hebert PD (2007). Amir I, Zuberi A, Kamran M and Imran M Biological identifications through (2019). Evaluation of commercial DNA barcodes: the case of the application of dietary encapsulated Crustacea. Can J Fish Aquat Sci., 64 probiotic (Geotrichum candidum (2): 272-95. QAUGC01): Effect on growth and Courtenay WR and Williams JD (2004). immunological indices of rohu Snakeheads (Pisces, Channidae): a (Labeo rohita, Hamilton 1822) in biological synopsis and risk semi-intensive culture system. Fish assessment. US Geological Survey. ShellFish Immun., 95: 464-72. DOI: 10.3133/cir1251 Austerlitz F, David O, Schaeffer B, Bleakley Courtenay WR, Williams JD, Britz R, K, Olteanu M, Leblois R, Veuille M Yamamoto MN and Loiselle PV and Laredo C (2009). DNA barcode (2004). Identity of introduced analysis: a comparison of snakeheads (Pisces, Channidae) in phylogenetic and statistical Hawaii and Madagascar, with classification methods. BMC comments on ecological concerns. Bioinformatics., 10 (S14): S10.

Kamran et al. (2020). Phylogeny of Channa Species in Pakistan J Biores Manag. 7 (2): 88-98

Retrieved from: Kamran M (2017). Cytochrome oxidase-i https://www.academia.edu/26285721/I based identification of fish (family dentity_of_introduced_snakeheads_Pis channidae) from River Ravi. B.Sc ces_Channidae_in_Hawaii_and_Madag (Hons) thesis (unpublished). Zool. ascar_with_comments_on_ecological_c Deptt., GC Univ., Lahore oncerns Kerr KC, Lijtmaer DA, Barreira AS, Hebert Cywinska A, Hunter FF and Hebert PD PD and Tubaro PL (2009). Probing (2006). Identifying Canadian evolutionary patterns in Neotropical mosquito species through DNA birds through DNA barcodes. PLoS barcodes. Med Vet Entomol., 20 (4): One., 4 (2): e4379. 413-424. Kumar S, Stecher G, Li M, Knyaz C and Daravath S, Yadav MM, Chakrapani P and Tamura K. (2018) MEGA X: Naik BR (2013). Molecular Molecular evolutionary genetics Identification of Aedesalbopictus analysis across computing platforms. (Diptera: Culicidae) and Quantitative Mol Boil Evol., 35 (6): 1547-9. Analysis of COI Gene in South- Lakra WS, Goswami M, Gopalakrishnan A, Indian Species. Int J Cr Mic app Sci., Singh DP, Singh A and Nagpure NS 2 (8): 102-9. (2010). Genetic relatedness among Geetakumari K and Vishwanath W (2010). fish species of genus Channa using Channa melanostigma, a new species mitochondrial DNA genes. Biochem of freshwater snakehead from north- Syst Ecol., 38 (6): 1212-1219. east India (Teleostei: Channidae). J Lakra WS, Verma MS, Goswami M, Lal KK, Bom Nat Hist S., 107 (3): 231. Mohindra V, Punia P, Hajibabaei M, Janzen DH, Burns JM, Gopalakrishnan A, Singh KV, Ward Hallwachs W and Hebert PD (2006). RD and Hebert P (2011). DNA DNA barcodes distinguish species of barcoding Indian marine fishes. Mol tropical Lepidoptera. P Natl Acad Sci. Ecol Resour., 11(1): 60-71. USA., 103 (4): 968-71. Lakra WS, Singh M, Goswami M, Hebert PD, Cywinska A and Ball SL (2003). Gopalakrishnan A, Lal KK, Biological identifications through Mohindra V, Sarkar UK, Punia PP, DNA barcodes. P Roy Soc Lond B Singh KV, Bhatt JP and Ayyappan S Bio., 270 : 313-321. (2016). DNA barcoding Indian Hebert PD, Penton EH, Burns JM, Janzen freshwater fishes. Mitochondrial DH and Hallwachs W (2004). Ten DNA Part A., 27 (6): 4510-7. species in one: DNA barcoding Lakra WS, Goswami M and Gopalakrishnan reveals cryptic species in the A (2009). Molecular identification neotropical skipper butterfly and phylogenetic relationships of Astraptes fulgerator. P Natl Acad Sci. seven Indian Sciaenids (Pisces: USA., 101 (41): 14812-14817. Perciformes, Sciaenidae) based on Hebert PD, Cywinska A, Ball SL and 16S rRNA and cytochrome c oxidase Dewaard JR (2007). Comparative subunit I mitochondrial genes. Mol distribution and invasion risk of Biol Rep., 36 (5): 831-839. snakehead (Channidae) and Asian Landi M, Dimech M, Arculeo M, Biondo G, carp (Cyprinidae) species in North Martins R, Carneiro M, Carvalho GR, America. Can J Fish Aquat Sci., 270 Brutto SL and Costa FO (2014). DNA (1512): 313-321. barcoding for species assignment: the

Kamran et al. (2020). Phylogeny of Channa Species in Pakistan J Biores Manag. 7 (2): 88-98

case of Mediterranean marine fishes. quality analysis tools. Nucleic Acids PLoS One., 9 (9):e106135. Res., 25 (24): 4876-82. Musikasinthorn P (1998). Channa panaw, a Ward RD, Zemlak TS, Innes BH, Last PR new channid fish from the Irrawaddy and Hebert PD (2005). DNA and Sittang River basins, Myanmar. barcoding Australia's fish species. Ichthyol Res., 45 (4): 355-62. Philos T Roy Soc B., 360 (1462): Pervaiz K, Mirza Z S, Siddiqui S, Naghma K, 1847-57. Waheed S H and Usman K (2018). Ward RD, Hanner R and Hebert PD (2009). Studies on the fish biodiversity of The campaign to DNA barcode all River Ravi in Punjab Pakistan. J fishes, FISH‐BOL. J Fish Biol., 74 Entomol Zoo., 6 (01): 1442-1448. (2): 329-56. Puillandre N, Lambert A, Brouillet S and Waugh J (2007). DNA barcoding in animal Achaz G (2012). ABGD, Automatic species: progress, potential and Barcode Gap Discovery for primary pitfalls. BioEssays., 29 (2):188-97. species delimitation. Mol Ecol., 21 Yaqub A, Kamran M, Malkani N, Anjum (8): 1864-77. KM, Faheem M, Iqbal M and Khan Rafique M and Khan NU (2012). Distribution RU (2019). Mitochondrial COI gene and status of significant freshwater based molecular identification and fishes of Pakistan. Rec Zool Surv phylogenetic analysis in exotic fish Pakistan., 21: 90-5. (Oreochromis mossambicus) of Serrao NR, Steinke D and Hanner RH (2014). Pakistan. J Anim Plant Sci., 29 (5): Calibrating snakehead diversity with 1501-1518. DNA barcodes: expanding taxonomic Zhu SR, Fu JJ, Wang Q and Li JL (2013a). coverage to enable identification of Identification of Channa species potential and established invasive using the partial cytochrome c species. PloS One., 9(6):e99546. oxidase subunit I (COI) gene as a Smith PJ, McVeagh SM and Steinke D DNA barcoding marker. Biochem (2008). DNA barcoding for the Syst Ecol., 51: 117-22. identification of smoked fish Zhu SR, Ma KY, Xing ZJ, Xie N, Wang YX, products. J Fish Biol., 72 (2): 464- Wang Q and Li JL (2013b). The 471. complete mitochondrial genome of Thompson JD, Gibson TJ, Plewniak F, Channa argus, Channa maculata and Jeanmougin F and Higgins DG hybrid snakehead fish [Channa (1997). The CLUSTAL_X windows maculata (♀)× Channa argus (♂)]. interface: flexible strategies for Mitochondrial DNA., 24 (3): 217- multiple sequence alignment aided by 218.