DOCSLIB.ORG

Gene Mutations in Members of the PI3K/Akt Signalling Pathway Are

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Gene Mutations in Members of the PI3K/Akt Signalling Pathway Are bioRxiv preprint doi: https://doi.org/10.1101/2020.11.16.385963; this version posted November 17, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Gene mutations in members of the PI3K/Akt signalling pathway 2 are related to immune thrombocytopenia pathogenesis 3 4 Rui-Jie Sun1, Shu-yan Liu1, Xiao-mei Zhang2, Jing-jing Zhu3, Dai Yuan1,3, Ning-ning Shan1,3* 5 6 7 1Department of Hematology, Shandong Provincial Hospital, Cheeloo College of Medicine, 8 Shandong University, Jinan, Shandong, 250021, China. 9 2Department of Hematology, People’s Hospital of Rizhao City, Rizhao, People’s Republic of 10 China 11 3Department of Hematology, Shandong Provincial Hospital Affiliated to Shandong First Medical 12 University, Jinan, Shandong, 250021, China. 13 14 15 16 17 *Correspondence: Ning-ning Shan, M.D., Ph.D. 18 Address: Department of Hematology, Shandong Provincial Hospital Affiliated to Shandong 19 University, 324 Jing Wu Rd, Jinan, Shandong 250021 20 Phone: 86-531-68776350 21 Fax: 86-531-87902606 22 E-mail address: [email protected] 23 24 25 26 27 28 29 30 31 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.16.385963; this version posted November 17, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 32 33 Summary: 34 Immune thrombocytopenic (ITP) is an autoimmune bleeding disease with genetic 35 susceptibility. DNA mutation profile of ITP patient bone marrow samples (n=20) were 36 investigated by using next-generation sequencing (NGS) ，and then confirmed by 37 sanger sequencing method .Our results showed PTEN, INSR and COCH were 38 mutated in all ITP patients. Functional analysis revealed these mutation genes mainly 39 participate PI3K/Akt signaling pathways and platelet activation. These results suggest 40 that genetic alterations might be involved in the pathogenesis of ITP. 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.16.385963; this version posted November 17, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 68 Abstract 69 Purpose: Immune thrombocytopenic (ITP) is an autoimmune bleeding disease with 70 genetic susceptibility. In this research, we conducted an in-depth genomic analysis of 71 a cohort of patients and elucidated the molecular features associated with the 72 pathogenesis of ITP. 73 Method: High-molecular-weight genomic DNA was extracted from freshly frozen 74 bone marrow blood mononuclear cells (BMBMCs) from 20 active ITP patients. Next, 75 the samples were subjected to molecular genetic analysis by whole-exome sequencing 76 (WES), and the results were confirmed by Sanger sequencing. The signalling 77 pathways and cellular processes associated with the mutated genes were identified 78 with gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) 79 pathway analyses. 80 Results: The results of this study revealed 3,998 missense mutations involving 2,269 81 genes in more than 10 individuals. Some unique genetic variants, including 82 phosphatase and tensin homologue (PTEN), insulin receptor (INSR) and coagulation 83 factor C homology (COCH) variants, were the most associated with the pathogenesis 84 of ITP. Functional analysis revealed that these gene mutations mainly affected the 85 phosphoinositide 3 kinase (PI3K)/protein kinase B (Akt) signalling pathways (signal 86 transduction) and platelet activation (immune system). 87 Conclusions: Our findings demonstrate the functional connections between these 88 gene variants and ITP. Although the underlying mechanisms and the impact of these 89 genetic variants remain to be revealed through further investigation, the application of 90 next-generation sequencing in ITP in this paper is valuable for revealing the genetic 91 mechanisms of ITP. 92 93 94 Keywords: Immune thrombocytopenia, whole-exome sequencing, phosphoinositide 3 95 kinase/Akt (PI3K/Akt) signalling pathway, autophagy 96 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.16.385963; this version posted November 17, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 97 1. Introduction 98 Immune thrombocytopenia (ITP) is a complex bleeding disease with autoimmune 99 traits. It is characterized by both decreased platelet production and increased platelet 100 destruction [1]. Patients with ITP present with varying degrees of bleeding tendency, 101 which can cause acute intracranial haemorrhage and life-threatening conditions. Most 102 ITP cases are sporadic, but Rischewski’s group described paediatric ITP cases with a 103 positive family history [2]. Furthermore, genetic susceptibility to ITP has been 104 suggested. One study found that inflammation-related single-nucleotide 105 polymorphisms (SNPs) may be genetic risk factors associated with the disease 106 severity and treatment response of ITP [3]. These results inspired us to use bone 107 marrow blood mononuclear cells (BMBMCs) from a group of primary acute ITP 108 inpatients for whole-exome sequencing (WES) to elucidate the gene variants related 109 to ITP. 110 The phosphoinositide 3-kinase (PI3K)/protein kinase B (Akt) signalling pathway 111 plays a critical role in regulating the immune response and the release of 112 inflammatory factors in vivo and in vitro by regulating the activation of downstream 113 signalling molecules [4, 5]. In recent years, experimental and clinical evidence has 114 associated perturbations of the PI3K/Akt signal transduction pathway with a number 115 of neoplastic and autoimmune diseases, such as lymphomas[6], chronic and acute 116 lymphocytic leukaemias [7, 8], endometrial cancer [9], bladder cancer [10], 117 rheumatoid arthritis (RA) [11] and ITP [12]. Platelet autophagy is regulated through 118 the PI3K/Akt/mTOR signalling pathway by phosphatase and tensin homologue 119 (PTEN) in ITP. Elevated platelet autophagy may prolong the life span of platelets 120 from ITP patients by inhibiting platelet apoptosis and improving platelet viability 121 [12]. 122 In this study, we identified several genes harbouring an excess number of rare 123 damaging mutations in patients with ITP: PTEN, insulin receptor (INSR) and 124 coagulation factor C homology (COCH). Interestingly, these genes are collectively 125 involved in the signal transduction of the PI3K/Akt signalling pathway and play an bioRxiv preprint doi: https://doi.org/10.1101/2020.11.16.385963; this version posted November 17, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 126 important immunomodulatory role in platelet activation. By identifying genetic 127 alterations in ITP patients, our study further enriches the understanding of the 128 pathology of ITP and promotes the identification of potential diagnostic and 129 therapeutic biomarkers for ITP. 130 2. Methods 131 2.1 Patient sample collection and preparation 132 The study was approved by the Medical Ethical Committee of Shandong Provincial 133 Hospital Affiliated to Shandong University and Shandong Provincial Hospital 134 Affiliated to Shandong First Medical University. Signed informed consent forms were 135 obtained from all participating patients. Twenty newly diagnosed active primary ITP 136 patients, including 12 females and 8 males (age range 17–77 years, median 48 years), 137 seen at the Department of Haematology, Shandong Provincial Hospital, Jinan, China, 138 between May 2017 and November 2018 were enrolled in this study. The diagnosis of 139 ITP was made according to recently published criteria, including patient history, 140 complete blood count, physical examination and peripheral blood smear examination 141 [13]. The platelet counts of patients ranged between 1 and 29 × 109/l, with a median 142 count of 10 × 109/l (Table 1). All the patients required treatment because of clinically 143 significant bleeding. None had been treated with glucocorticosteroids, 144 immunoglobulin or immunosuppressants prior to sampling. Bone marrow blood was 145 collected into heparin-anticoagulant-containing vacutainer tubes. According to the 146 manufacturer’s instructions, mononuclear cells were isolated from heparinized blood 147 by gradient centrifugation with Ficoll-Paque (Pharmacia Diagnostics, Uppsala, 148 Sweden). 149 2.2 Targeted exon capture 150 Genomic DNA was isolated from BMBMCs from 20 active ITP patients using a 151 QIAamp DNA Blood Mini kit (Qiagen, Hilden, Germany) according to the 152 manufacturer’s instructions. Each genomic DNA sample was fragmented using a 153 Covaris LE220 ultrasonicator (Massachusetts, USA) to a fragment size of 154 approximately 200 bp-250 bp. After fragmentation, DNA fragments were end-paired bioRxiv preprint doi: https://doi.org/10.1101/2020.11.16.385963; this version posted November 17, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 155 and phosphorylated at the 5′ end and successively adenylated at the 3′ end (following 156 Illumina paired-end protocols), and the libraries ligated to the
Load more

Recommended publications
  • 140503 IPF Signatures Supplement Withfigs Thorax
    Supplementary material for Heterogeneous gene expression signatures correspond to distinct lung pathologies and biomarkers of disease severity in idiopathic pulmonary fibrosis Daryle J. DePianto1*, Sanjay Chandriani1⌘*, Alexander R. Abbas1, Guiquan Jia1, Elsa N. N’Diaye1, Patrick Caplazi1, Steven E. Kauder1, Sabyasachi Biswas1, Satyajit K. Karnik1#, Connie Ha1, Zora Modrusan1, Michael A. Matthay2, Jasleen Kukreja3, Harold R. Collard2, Jackson G. Egen1, Paul J. Wolters2§, and Joseph R. Arron1§ 1Genentech Research and Early Development, South San Francisco, CA 2Department of Medicine, University of California, San Francisco, CA 3Department of Surgery, University of California, San Francisco, CA ⌘Current address: Novartis Institutes for Biomedical Research, Emeryville, CA. #Current address: Gilead Sciences, Foster City, CA. *DJD and SC contributed equally to this manuscript §PJW and JRA co-directed this project Address correspondence to Paul J. Wolters, MD University of California, San Francisco Department of Medicine Box 0111 San Francisco, CA 94143-0111 [email protected] or Joseph R. Arron, MD, PhD Genentech, Inc. MS 231C 1 DNA Way South San Francisco, CA 94080 [email protected] 1 METHODS Human lung tissue samples Tissues were obtained at UCSF from clinical samples from IPF patients at the time of biopsy or lung transplantation. All patients were seen at UCSF and the diagnosis of IPF was established through multidisciplinary review of clinical, radiological, and pathological data according to criteria established by the consensus classification of the American Thoracic Society (ATS) and European Respiratory Society (ERS), Japanese Respiratory Society (JRS), and the Latin American Thoracic Association (ALAT) (ref. 5 in main text). Non-diseased normal lung tissues were procured from lungs not used by the Northern California Transplant Donor Network.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Cloud-Clone 16-17
    Cloud-Clone - 2016-17 Catalog Description Pack Size Supplier Rupee(RS) ACB028Hu CLIA Kit for Anti-Albumin Antibody (AAA) 96T Cloud-Clone 74750 AEA044Hu ELISA Kit for Anti-Growth Hormone Antibody (Anti-GHAb) 96T Cloud-Clone 74750 AEA255Hu ELISA Kit for Anti-Apolipoprotein Antibodies (AAHA) 96T Cloud-Clone 74750 AEA417Hu ELISA Kit for Anti-Proteolipid Protein 1, Myelin Antibody (Anti-PLP1) 96T Cloud-Clone 74750 AEA421Hu ELISA Kit for Anti-Myelin Oligodendrocyte Glycoprotein Antibody (Anti- 96T Cloud-Clone 74750 MOG) AEA465Hu ELISA Kit for Anti-Sperm Antibody (AsAb) 96T Cloud-Clone 74750 AEA539Hu ELISA Kit for Anti-Myelin Basic Protein Antibody (Anti-MBP) 96T Cloud-Clone 71250 AEA546Hu ELISA Kit for Anti-IgA Antibody 96T Cloud-Clone 71250 AEA601Hu ELISA Kit for Anti-Myeloperoxidase Antibody (Anti-MPO) 96T Cloud-Clone 71250 AEA747Hu ELISA Kit for Anti-Complement 1q Antibody (Anti-C1q) 96T Cloud-Clone 74750 AEA821Hu ELISA Kit for Anti-C Reactive Protein Antibody (Anti-CRP) 96T Cloud-Clone 74750 AEA895Hu ELISA Kit for Anti-Insulin Receptor Antibody (AIRA) 96T Cloud-Clone 74750 AEB028Hu ELISA Kit for Anti-Albumin Antibody (AAA) 96T Cloud-Clone 71250 AEB264Hu ELISA Kit for Insulin Autoantibody (IAA) 96T Cloud-Clone 74750 AEB480Hu ELISA Kit for Anti-Mannose Binding Lectin Antibody (Anti-MBL) 96T Cloud-Clone 88575 AED245Hu ELISA Kit for Anti-Glutamic Acid Decarboxylase Antibodies (Anti-GAD) 96T Cloud-Clone 71250 AEK505Hu ELISA Kit for Anti-Heparin/Platelet Factor 4 Antibodies (Anti-HPF4) 96T Cloud-Clone 71250 CCA005Hu CLIA Kit for Angiotensin II
    [Show full text]
  • Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant
    Appendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7,
    [Show full text]
  • Identification of Key Pathways and Genes in Dementia Via Integrated Bioinformatics Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.18.440371; this version posted July 19, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Identification of Key Pathways and Genes in Dementia via Integrated Bioinformatics Analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karnataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2021.04.18.440371; this version posted July 19, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract To provide a better understanding of dementia at the molecular level, this study aimed to identify the genes and key pathways associated with dementia by using integrated bioinformatics analysis. Based on the expression profiling by high throughput sequencing dataset GSE153960 derived from the Gene Expression Omnibus (GEO), the differentially expressed genes (DEGs) between patients with dementia and healthy controls were identified. With DEGs, we performed a series of functional enrichment analyses. Then, a protein–protein interaction (PPI) network, modules, miRNA-hub gene regulatory network and TF-hub gene regulatory network was constructed, analyzed and visualized, with which the hub genes miRNAs and TFs nodes were screened out. Finally, validation of hub genes was performed by using receiver operating characteristic curve (ROC) analysis.
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • Table SII. Significantly Differentially Expressed Mrnas of GSE23558 Data Series with the Criteria of Adjusted P<0.05 And
    Table SII. Significantly differentially expressed mRNAs of GSE23558 data series with the criteria of adjusted P<0.05 and logFC>1.5. Probe ID Adjusted P-value logFC Gene symbol Gene title A_23_P157793 1.52x10-5 6.91 CA9 carbonic anhydrase 9 A_23_P161698 1.14x10-4 5.86 MMP3 matrix metallopeptidase 3 A_23_P25150 1.49x10-9 5.67 HOXC9 homeobox C9 A_23_P13094 3.26x10-4 5.56 MMP10 matrix metallopeptidase 10 A_23_P48570 2.36x10-5 5.48 DHRS2 dehydrogenase A_23_P125278 3.03x10-3 5.40 CXCL11 C-X-C motif chemokine ligand 11 A_23_P321501 1.63x10-5 5.38 DHRS2 dehydrogenase A_23_P431388 2.27x10-6 5.33 SPOCD1 SPOC domain containing 1 A_24_P20607 5.13x10-4 5.32 CXCL11 C-X-C motif chemokine ligand 11 A_24_P11061 3.70x10-3 5.30 CSAG1 chondrosarcoma associated gene 1 A_23_P87700 1.03x10-4 5.25 MFAP5 microfibrillar associated protein 5 A_23_P150979 1.81x10-2 5.25 MUCL1 mucin like 1 A_23_P1691 2.71x10-8 5.12 MMP1 matrix metallopeptidase 1 A_23_P350005 2.53x10-4 5.12 TRIML2 tripartite motif family like 2 A_24_P303091 1.23x10-3 4.99 CXCL10 C-X-C motif chemokine ligand 10 A_24_P923612 1.60x10-5 4.95 PTHLH parathyroid hormone like hormone A_23_P7313 6.03x10-5 4.94 SPP1 secreted phosphoprotein 1 A_23_P122924 2.45x10-8 4.93 INHBA inhibin A subunit A_32_P155460 6.56x10-3 4.91 PICSAR P38 inhibited cutaneous squamous cell carcinoma associated lincRNA A_24_P686965 8.75x10-7 4.82 SH2D5 SH2 domain containing 5 A_23_P105475 7.74x10-3 4.70 SLCO1B3 solute carrier organic anion transporter family member 1B3 A_24_P85099 4.82x10-5 4.67 HMGA2 high mobility group AT-hook 2 A_24_P101651
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7
    [Show full text]
  • Biophysical Characterization of One-, Two-, and Three-Tandem Repeats of Human Mucin (Muc-1) Protein Core1
    (CANCER RESEARCH 53.5386-5394, November 15. 1993] Biophysical Characterization of One-, Two-, and Three-Tandem Repeats of Human Mucin (muc-1) Protein Core1 J. Darrell Fontenot,2 Nico Tjandra, Dawen Bu, Chien Ho, Ronald C. Montelaro, and Olivera J. Finn Department of Molecular Genetics and Biochemistry, University of Pittsburgh School of Medicine /J. D. F., D. B., R. C. M.. O. J. F.], Pittsburgh 15261, and Department of Biological Science, Carnegie Mellon University fN. T., C. H.¡,Pittsburgh, Pennsylvania 15213 ABSTRACT structural understanding of the precise mucin epitopes present on tumors and normal tissues must be acquired. Until recently mm in tandem repeat protein cores were believed to exist Until recently mucin TR-' protein cores were believed to exist in in random-coil conformations and to attain structure solely by the addi random-coil conformations and to attain structure solely by the addi tion of carbohydrates to serine and threonine residues. Matsushima et al. (Proteins Struct. Funct. Genet., 7: 125-155, 1990) recently proposed a tion of carbohydrates to serine and threonine residues (15). However, model of the secondary structure of proline rich tandem repeat proteins newly acquired information on mucin protein sequences through that has challenged this idea, especially for the case of the human poly complementary DNA cloning has challenged this idea, especially for morphic epithelial mucin encoded by the muc-l gene. We report here the case of human polymorphic epithelial mucin encoded by the results of structural analyses of the muc-1 protein core by using synthetic muc-\ gene. The sequence and amino acid content of the repetitive peptide analogues.
    [Show full text]
  • Supplemental Table 1
    Carlisle et al. 1 Supplementary Table 1. Primers for PCR amplification of bacterial 16S rRNA. Primers for Group A TA-27FMID1 CGTATCGCCTCCCTCGCGCCATCAGACGAGTGCGTAGAGTTTGATCCTGGCTCAG TA-27FMID2 CGTATCGCCTCCCTCGCGCCATCAGACGCTCGACAAGAGTTTGATCCTGGCTCAG TA-27FMID3 CGTATCGCCTCCCTCGCGCCATCAGAGACGCACTCAGAGTTTGATCCTGGCTCAG TA-27FMID4 CGTATCGCCTCCCTCGCGCCATCAGAGCACTGTAGAGAGTTTGATCCTGGCTCAG TA-27FMID5 CGTATCGCCTCCCTCGCGCCATCAGATCAGACACGAGAGTTTGATCCTGGCTCAG TA-27FMID6 CGTATCGCCTCCCTCGCGCCATCAGATATCGCGAGAGAGTTTGATCCTGGCTCAG TA-27FMID7 CGTATCGCCTCCCTCGCGCCATCAGCGTGTCTCTAAGAGTTTGATCCTGGCTCAG TA-27FMID8 CGTATCGCCTCCCTCGCGCCATCAGCTCGCGTGTCAGAGTTTGATCCTGGCTCAG TA-27FMID9 CGTATCGCCTCCCTCGCGCCATCAGTAGTATCAGCAGAGTTTGATCCTGGCTCAG TA-27FMID10 CGTATCGCCTCCCTCGCGCCATCAGTCTCTATGCGAGAGTTTGATCCTGGCTCAG TA-27FMID11 CGTATCGCCTCCCTCGCGCCATCAGTGATACGTCTAGAGTTTGATCCTGGCTCAG TA-27FMID13 CGTATCGCCTCCCTCGCGCCATCAGCATAGTAGTGAGAGTTTGATCCTGGCTCAG TA-27FMID14 CGTATCGCCTCCCTCGCGCCATCAGCGAGAGATACAGAGTTTGATCCTGGCTCAG TB-338R CTATGCGCCTTGCCAGCCCGCTCAGTGCTGCCTCCCGTAGGAGT Primers for Group B TB-27FMID1 CTATGCGCCTTGCCAGCCCGCTCAGACGAGTGCGTAGAGTTTGATCCTGGCTCAG TB-27FMID2 CTATGCGCCTTGCCAGCCCGCTCAGACGCTCGACAAGAGTTTGATCCTGGCTCAG TB-27FMID3 CTATGCGCCTTGCCAGCCCGCTCAGAGACGCACTCAGAGTTTGATCCTGGCTCAG TB-27FMID4 CTATGCGCCTTGCCAGCCCGCTCAGAGCACTGTAGAGAGTTTGATCCTGGCTCAG TB-27FMID5 CTATGCGCCTTGCCAGCCCGCTCAGATCAGACACGAGAGTTTGATCCTGGCTCAG TB-27FMID6 CTATGCGCCTTGCCAGCCCGCTCAGATATCGCGAGAGAGTTTGATCCTGGCTCAG TB-27FMID7 CTATGCGCCTTGCCAGCCCGCTCAGCGTGTCTCTAAGAGTTTGATCCTGGCTCAG TB-27FMID8 CTATGCGCCTTGCCAGCCCGCTCAGCTCGCGTGTCAGAGTTTGATCCTGGCTCAG
    [Show full text]
  • University of Hyogo Analysis of the Mucin Pathway of The
    UNIVERSITY OF HYOGO ANALYSIS OF THE MUCIN PATHWAY OF THE MAMMALIAN GOLGI STRESS RESPONSE MOHAMAD IKHWAN BIN JAMALUDIN Thesis submitted in fulfilment of the requirements for the degree of Doctor of Philosophy 2020 Laboratory of Biochemistry and Molecular Biology II Leading Program in Doctoral Education Department of Picobiology Graduate School of Life Science ABSTRACT The Golgi plays a central role for post-translational modifications of properly folded proteins from the ER (e.g. glycosylation and sulfation) as well as vesicular transport of correctly modified proteins to their final destination. When the synthesis of secretory or membrane proteins is increased and overwhelms the functional capacity of the Golgi apparatus (Golgi stress), eukaryotic cells activate a homeostatic mechanism called the Golgi stress response in order to upregulate the capacity of the Golgi. Recent studies have revealed five Golgi stress response pathways such as the TFE3, CREB3, HSP47, MAPK-ETS and proteoglycan pathways, which regulates the general function of the Golgi, apoptosis, cell survival, spliceosome and cell death, and glycosylation of proteoglycans, respectively. Here, we have uncovered a novel response pathway, named the mucin pathway, that enhances the expression of glycosylation enzymes for mucins (such as GALNT5, GALNT8 and GALNT18) to compensate for the insufficiency in mucin-type glycosylation in the Golgi (mucin-type Golgi stress). Unexpectedly, we found that TFE3, a key transcription factor regulating the TFE3 pathway, was also induced and activated upon mucin-type Golgi stress, suggesting that the mucin pathway transmits a crosstalk signal to the TFE3 pathway. Promoter analysis of the human TFE3 gene revealed a novel enhancer element that regulates transcriptional induction of the TFE3 gene in response to mucin-type Golgi stress, of which consensus sequence is ACTTCC(N9)TCCCCA.
    [Show full text]
  • Human Leukemic Myeloblasts and Myeloblastoid Cells Contain the Enzyme Cytidine 5 -Monophosphate-Jv-Acetylneuraminic Acid:Galãÿl- 3Galnaca(2-3)-Sialyltransferase1
    [CANCER RESEARCH 50. 5003-5007. August 15. 1990] Human Leukemic Myeloblasts and Myeloblastoid Cells Contain the Enzyme Cytidine 5 -Monophosphate-jV-acetylneuraminic Acid:Galßl- 3GalNAca(2-3)-sialyltransferase1 Amita Kanani, D. Robert Sutherland, Eitan Fibach, Kushi L. Matta, Alex Hindenburg, Inka Brockhausen, William Kuhns, Robert N. Taub, Dirk H. van den Eijnden, and Michael A. Baker2 Department of Medicine, Toronto General Hospital, University of Toronto, Ontario M5G 2C4, Canada [A. K., D. R. S., M. A. BJ; Department of Haematology, Hadassah Hospital, Hebrew university, Jerusalem, Israel, IL-91120 [E. F.]; Department of Medicine, Columbia University, New York, New York 10032 [R. N. T.J; Department of Biochemistry, Hospital for Sick Children, Toronto, Ontario, Canada MSG 1X8 [I. B., W. K.J; Roswell Park Memorial Institute, Buffalo, New York 14263 [K. L. MJ; Division of Oncology-Hematology, Winthrop University Hospital, Mineóla, Long Island, New York 11501 [A. H.]; and Department of Medical Chemistry, Vrije Universiteit, Amsterdam, The Netherlands, NL-1007 MC [D. H. v. d. E.J ABSTRACT CML compared to normals have demonstrated decreased ad hesiveness (6), decreased chemotaxis (7), and reduced mem We have examined the role of CMP-NeuAc:Gal£I-3GalNAc-R o(2- brane binding of the chemotactic peptide /V-formylmethionyl- 3)-sialyltransferase in fresh leukemia cells and leukemia-derived cell leucylphenylalanine (8). These altered functions are partially lines. Enzyme activity in normal granulocytes using Gal$l-3GalNAca- reversible by removal of membrane sialic acid with neuramini- o-nitrophenyl as substrate was 1.5 ±0.7 nmol/mg/h whereas activity in morphologically mature granulocytes from 6 patients with chronic mye- dase, suggesting a role for aberrant sialylation in the abnormal logenous leukemia (CML) was 4.2 ±1.6 nmol/mg/h (/' < 0.05).
    [Show full text]