DOCSLIB.ORG

Download Thesis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Download Thesis This electronic thesis or dissertation has been downloaded from the King’s Research Portal at https://kclpure.kcl.ac.uk/portal/ Investigating breast cancer O-linked glycosylation changes and their immunotherapeutic potential Picco, Gianfranco Awarding institution: King's College London The copyright of this thesis rests with the author and no quotation from it or information derived from it may be published without proper acknowledgement. END USER LICENCE AGREEMENT Unless another licence is stated on the immediately following page this work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International licence. https://creativecommons.org/licenses/by-nc-nd/4.0/ You are free to copy, distribute and transmit the work Under the following conditions: Attribution: You must attribute the work in the manner specified by the author (but not in any way that suggests that they endorse you or your use of the work). Non Commercial: You may not use this work for commercial purposes. No Derivative Works - You may not alter, transform, or build upon this work. Any of these conditions can be waived if you receive permission from the author. Your fair dealings and other rights are in no way affected by the above. Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 09. Oct. 2021 This electronic theses or dissertation has been downloaded from the King’s Research Portal at https://kclpure.kcl.ac.uk/portal/ Title: Investigating breast cancer O-linked glycosylation changes and their immunotherapeutic potential Author: Gianfranco Picco The copyright of this thesis rests with the author and no quotation from it or information derived from it may be published without proper acknowledgement. END USER LICENSE AGREEMENT This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivs 3.0 Unported License. http://creativecommons.org/licenses/by-nc-nd/3.0/ You are free to: Share: to copy, distribute and transmit the work Under the following conditions: Attribution: You must attribute the work in the manner specified by the author (but not in any way that suggests that they endorse you or your use of the work). Non Commercial: You may not use this work for commercial purposes. No Derivative Works - You may not alter, transform, or build upon this work. Any of these conditions can be waived if you receive permission from the author. Your fair dealings and other rights are in no way affected by the above. Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Investigating breast cancer O-linked glycosylation changes and their immunotherapeutic potential. PhD in Medicine, 2013, Gianfranco Picco. King’s College London 1 Abstract Changes that occur in malignant cells can take a variety of forms and include changes in cellular glycosylation. Aberrant glycosylation is considered to be a universal feature of malignant transformation and tumour progression. Mucins are major carriers of altered glycans in most carcinomas, and mainly belong to the MUC family, with MUC1 considered one of its most prestigious affiliates, as it is upregulated and aberrantly glycosylated in the majority of breast and many other adenocarcinomas. The large domain of the extracellular region of MUC1 is made up of tandemly repeated amino acids that form a scaffold for the attachment of the O- linked glycans. The aberrant glycosylation of MUC1 observed in breast cancer results in the expression of simple, unbranched sugars that are often sialylated and this is partly due to the upregulation of the sialyltransferase, ST3Gal-I. These consistent and conserved changes suggest that aberrant glycosylation is advantageous for the tumour, and data generated by this thesis suggest that indeed this is the case. Attention has been focused on MUC1 as a target molecule for the immunotherapy of cancer. To investigate specific MUC1 tumour-associated glycans, recombinant MUC1 glycoproteins carrying specific and defined O-linked glycans were purified from engineered CHO cells. The immune responses to these MUC1 glycoforms were analysed using wild-type and MUC1 transgenic mice. Different tumour-associated glycoforms elicited different immune responses, with MUC1 carrying the disaccharide known as T inducing a cellular response in MUC1 Tg mice, while the MUC1-ST glycoform was incapable of inducing an immune response in MUC1 Tg mice or even wild-type mice. To determine whether the changes in glycosylation, observed in breast carcinomas, confer an advantage to cancer cells, we generated transgenic mice over-expressing ST3Gal-I in the mammary gland and other epithelial tissues, and crossed these with mice that develop spontaneous mammary tumours. The tumours that developed from the ST3Gal-I mice appeared significantly earlier than the controls. Thus over- expression of ST3Gal-I in the mammary gland promotes tumorigenesis in this model, and the MUC1-ST glycoform formed by the action of ST3Gal-I on the T antigen is not immunogenic and may even inhibit an immune response. 2 Acknowledgements It is a pleasure to thank those who made this thesis possible, and dedicate it in memory of my late dad Ferruccio and mum Marcella. Listed below are some of the people who have helped in its conception and development. A special mention must be made for my supervisor, Professor Joy Burchell, who has been hugely supportive and patient, and Dr John Maher and Professor Joyce Taylor Papadimitriou for their guidance throughout this work. First Supervisor: Professor Joy Burchell Second Supervisor: Dr John Maher Dr Richard Beatson Dr Julia Coleman Dr Angela Barrett Dr Sylvain Julien Dr Rosalind Graham Professor Henrik Clausen Professor Gunnar Hansson Professor Sarah Pinder Professor Anne Dell Professor Inka Brockhausen Professor Paul Crocker Dr Scott Wilkie. Dr Marc Davies Laura Chiapero-Stanke Dr Sophie Burbridge Daisy Sproviero Deanna Bueti Steven Catchpole Debbie Hall Gursharn Hutchins Dr Ana Parente Pereira 3 Lucienne Cooper Sjoukje Van Der Stegen Janet MacDonald Most importantly my sponsor: Cancer Research UK. King’s College London. And last but not least: My family, wife Leanne, sons Marco and Luca and daughter Mia, who have been prepared to give up so much of our time for this work and without whose support this would never have happened. 4 Contents Abstract………………………………………………………………………………………………...2 Acknowledgements………………………………………………………………………………….....3 Table of Contents……………………………………………………………………………………...5 Abbreviations…………………………………………………………………………………………11 Chapter 1 Introduction 1.1 General introduction……………………………………………………………………….15 1.2 Breast cancer………………………………………………………………………………..17 1.2.1 Current treatment of breast cancer……………………………………………...20 Radiotherapy……………………………………………………………………...21 Chemotherapy…………………………………………………………………….21 Endocrine therapy………………………………………………………………...22 Targeted therapy………………………………………………………………….22 Immunotherapy…………………………………………………………………...23 1.3 Glycosylation………………………………………………………………………………..24 1.3.1 Glycosylation of glycolipids………………………………………………………24 1.3.2 Glycosylation of proteoglycans…………………………………………………...26 1.3.3 N-linked glycosylation…………………………………………………………….27 1.3.4 O-linked glycosylation…………………………………………………………….28 O-linked GlcNAc………………………………………………………………….29 O-linked mannose…………………………………………………………………30 O-linked fucose……………………………………………………………………31 O-linked glucose…………………………………………………………………..32 O-linked galactose………………………………………………………………...33 Mucin-type O-linked glycoproteins...……………………………………………33 1.4 Mucins………………………………………………………………………………………35 1.4.1 Secreted mucins…………………………………………………………………...37 1.4.2 Membrane bound mucins………………………………………………………...37 1.4.3 MUC1……………………………………………………………………………...38 MUC1 protein structure………………………………………………………….39 Expression…………………………………………………………………………41 1.4.4 Signalling function of MUC1 and other membrane mucins……………………42 1.5 Aberrant glycosylation in cancer………………………………………………………….45 1.5.1 Aberrant glycosylation of MUC1 in breast cancer………………………………46 1.5.2 Impact of aberrant glycosylation on the function of glycan carrying molecules48 1.6 Mechanisms attributed to the altered O-glycan profils...………………………………..53 5 Changes in expression of glycosyltransferases………………………………….53 Changes in Golgi pH……………………………………………………………...56 Relocation of pGalNAc-Ts………………………………………………………..57 Mutation in the Cosmc gene……………………………………………………...57 1.7 Tumour immunology……………………………………………………………………….58 1.8 Immune evasion…………………………………………………………………………….60 1.9 Tumour microenvironment………………………………………………………………..61 1.10 MUC1 in immunotherapy………………………………………………………………….64 1.11 The known immunological effects to cancer associated MUC1 glycoforms……………65 MUC1-Tn………………………………………………………………………….65 MUC1-STn………………………………………………………………………...66 MUC1-T…………………………………………………………………………...66 MUC1-ST………………………………………………………………………….67 Undefined tumour-associated MUC1 glycoforms………………………………68 Chapter 2 Materials and methods Materials and methods used in chapter 3 2.1 Enterokinase cleavage of murine IgG2aFc domain…………………………….70 2.2 Anion exchange chromatography………………………………………………..70 2.3 Affinity chromatography (MUC1 without glycans and Tn)...............................71 2.4 Neuraminidase treatment of purified recombinant MUC1-ST………………..72 2.5 SDS-PAGE………………………………………………………………………...72 2.6 Silver
Load more

Recommended publications
  • Mucin Family Genes Are Downregulated in Colorectal
    ooggeenneessii iinn ss && rrcc aa MM CC uu tt ff aa Journal ofJournal of oo gg Aziz et al., J Carcinogene Mutagene 2014, S10 ll ee ee aa aa nn nn nn nn ee ee rr rr ss ss uu uu ii ii ss ss oo oo DOI: 4172/2157-2518.S10-009 JJ JJ ISSN: 2157-2518 CarCarcinogenesiscinogenesis & Mutagenesis Research Article Article OpenOpen Access Access Mucin Family Genes are Downregulated in Colorectal Cancer Patients Mohammad Azhar Aziz*, Majed AlOtaibi, Abdulkareem AlAbdulrahman, Mohammed AlDrees and Ibrahim AlAbdulkarim Department of Medical Genomics, KIng Abdullah Intl. Med. Res. Ctr., King Saud Bin Abdul Aziz University for Health Sciences, Riyadh, Saudi Arabia Abstract Mucins are very well known to be associated with different types of cancer. Their role in colorectal cancer has been extensively studied without direct correlation with their change in expression levels. In the present study we employed the human exon array from Affymetrix to provide evidence that mucin family genes are downregulated in colorectal cancer tumor samples. We analyzed 92 samples taken from normal and tumor tissues. All mucin family genes except MUCL1 were downregulated with the fold change value ranging from -3.53 to 1.78 as calculated using AltAnalyze software. Maximum drop in RNA transcripts were observed for MUC2 with a fold change of -3.53. Further, we carried out Integromics analysis to analyze mucin genes using hierarchical clustering. MUC1 and MUC4 were found to be potential biomarkers for human colorectal cancer. Top upstream regulators were identified for mucin genes. Network analyses were carried out to further our understanding about potential mechanisms by which mucins can be involved in causing colorectal cancer.
    [Show full text]
  • 140503 IPF Signatures Supplement Withfigs Thorax
    Supplementary material for Heterogeneous gene expression signatures correspond to distinct lung pathologies and biomarkers of disease severity in idiopathic pulmonary fibrosis Daryle J. DePianto1*, Sanjay Chandriani1⌘*, Alexander R. Abbas1, Guiquan Jia1, Elsa N. N’Diaye1, Patrick Caplazi1, Steven E. Kauder1, Sabyasachi Biswas1, Satyajit K. Karnik1#, Connie Ha1, Zora Modrusan1, Michael A. Matthay2, Jasleen Kukreja3, Harold R. Collard2, Jackson G. Egen1, Paul J. Wolters2§, and Joseph R. Arron1§ 1Genentech Research and Early Development, South San Francisco, CA 2Department of Medicine, University of California, San Francisco, CA 3Department of Surgery, University of California, San Francisco, CA ⌘Current address: Novartis Institutes for Biomedical Research, Emeryville, CA. #Current address: Gilead Sciences, Foster City, CA. *DJD and SC contributed equally to this manuscript §PJW and JRA co-directed this project Address correspondence to Paul J. Wolters, MD University of California, San Francisco Department of Medicine Box 0111 San Francisco, CA 94143-0111 [email protected] or Joseph R. Arron, MD, PhD Genentech, Inc. MS 231C 1 DNA Way South San Francisco, CA 94080 [email protected] 1 METHODS Human lung tissue samples Tissues were obtained at UCSF from clinical samples from IPF patients at the time of biopsy or lung transplantation. All patients were seen at UCSF and the diagnosis of IPF was established through multidisciplinary review of clinical, radiological, and pathological data according to criteria established by the consensus classification of the American Thoracic Society (ATS) and European Respiratory Society (ERS), Japanese Respiratory Society (JRS), and the Latin American Thoracic Association (ALAT) (ref. 5 in main text). Non-diseased normal lung tissues were procured from lungs not used by the Northern California Transplant Donor Network.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Cloud-Clone 16-17
    Cloud-Clone - 2016-17 Catalog Description Pack Size Supplier Rupee(RS) ACB028Hu CLIA Kit for Anti-Albumin Antibody (AAA) 96T Cloud-Clone 74750 AEA044Hu ELISA Kit for Anti-Growth Hormone Antibody (Anti-GHAb) 96T Cloud-Clone 74750 AEA255Hu ELISA Kit for Anti-Apolipoprotein Antibodies (AAHA) 96T Cloud-Clone 74750 AEA417Hu ELISA Kit for Anti-Proteolipid Protein 1, Myelin Antibody (Anti-PLP1) 96T Cloud-Clone 74750 AEA421Hu ELISA Kit for Anti-Myelin Oligodendrocyte Glycoprotein Antibody (Anti- 96T Cloud-Clone 74750 MOG) AEA465Hu ELISA Kit for Anti-Sperm Antibody (AsAb) 96T Cloud-Clone 74750 AEA539Hu ELISA Kit for Anti-Myelin Basic Protein Antibody (Anti-MBP) 96T Cloud-Clone 71250 AEA546Hu ELISA Kit for Anti-IgA Antibody 96T Cloud-Clone 71250 AEA601Hu ELISA Kit for Anti-Myeloperoxidase Antibody (Anti-MPO) 96T Cloud-Clone 71250 AEA747Hu ELISA Kit for Anti-Complement 1q Antibody (Anti-C1q) 96T Cloud-Clone 74750 AEA821Hu ELISA Kit for Anti-C Reactive Protein Antibody (Anti-CRP) 96T Cloud-Clone 74750 AEA895Hu ELISA Kit for Anti-Insulin Receptor Antibody (AIRA) 96T Cloud-Clone 74750 AEB028Hu ELISA Kit for Anti-Albumin Antibody (AAA) 96T Cloud-Clone 71250 AEB264Hu ELISA Kit for Insulin Autoantibody (IAA) 96T Cloud-Clone 74750 AEB480Hu ELISA Kit for Anti-Mannose Binding Lectin Antibody (Anti-MBL) 96T Cloud-Clone 88575 AED245Hu ELISA Kit for Anti-Glutamic Acid Decarboxylase Antibodies (Anti-GAD) 96T Cloud-Clone 71250 AEK505Hu ELISA Kit for Anti-Heparin/Platelet Factor 4 Antibodies (Anti-HPF4) 96T Cloud-Clone 71250 CCA005Hu CLIA Kit for Angiotensin II
    [Show full text]
  • Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant
    Appendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7,
    [Show full text]
  • Identification of Key Pathways and Genes in Dementia Via Integrated Bioinformatics Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.18.440371; this version posted July 19, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Identification of Key Pathways and Genes in Dementia via Integrated Bioinformatics Analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karnataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2021.04.18.440371; this version posted July 19, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract To provide a better understanding of dementia at the molecular level, this study aimed to identify the genes and key pathways associated with dementia by using integrated bioinformatics analysis. Based on the expression profiling by high throughput sequencing dataset GSE153960 derived from the Gene Expression Omnibus (GEO), the differentially expressed genes (DEGs) between patients with dementia and healthy controls were identified. With DEGs, we performed a series of functional enrichment analyses. Then, a protein–protein interaction (PPI) network, modules, miRNA-hub gene regulatory network and TF-hub gene regulatory network was constructed, analyzed and visualized, with which the hub genes miRNAs and TFs nodes were screened out. Finally, validation of hub genes was performed by using receiver operating characteristic curve (ROC) analysis.
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • Gene Expression Signature for Biliary Atresia and a Role for Interleukin-8
    SUPPLEMENTARY “PATIENTS AND METHODS” “Gene expression signature for biliary atresia and a role for Interleukin-8 in pathogenesis of experimental disease” Bessho K, et al. PATIENTS AND METHODS Patients. Liver biopsies, serum samples and clinical data were obtained from infants with cholestasis enrolled into a prospective study (ClinicalTrials.gov Identifier: NCT00061828) of the NIDDK-funded Childhood Liver Disease Research and Education Network (www.childrennetwork.org) or from infants evaluated at Cincinnati Children’s Hospital Medical Center. For subjects with biliary atresia (BA), liver biopsies were obtained from 64 infants during the preoperative workup or at the time of intraoperative cholangiogram, with ages ranging from 22-169 days after birth (Supplementary Table 7). For subjects with intrahepatic cholestasis (serving as diseased controls, and referred to as non- BA), liver biopsy samples were obtained percutaneously or intraoperatively from 14 infants at the time of diagnostic evaluation, with ages ranging from 19-189 days. Their diagnosis were Alagille syndrome (N=1), multidrug resistance protein-3 deficiency (N=2), alpha-1-antitrypsin deficiency (N=2) and cholestasis with unknown etiology (N=9) (Supplementary Table 7). Representative liver biopsy photomicrographs are shown in Supplementary Figure 6A-D. A third group of normal controls (NC) consisted of liver biopsy samples obtained from 7 deceased-donor children aged 22-42 months as described previously (1). This group serves as a reference cohort, with the median levels of gene expression used to normalize gene expression across all patients in the BA and non-BA groups. This greatly facilitates the visual identification of key differences in gene expression levels between BA and non-BA groups.
    [Show full text]
  • Table SII. Significantly Differentially Expressed Mrnas of GSE23558 Data Series with the Criteria of Adjusted P<0.05 And
    Table SII. Significantly differentially expressed mRNAs of GSE23558 data series with the criteria of adjusted P<0.05 and logFC>1.5. Probe ID Adjusted P-value logFC Gene symbol Gene title A_23_P157793 1.52x10-5 6.91 CA9 carbonic anhydrase 9 A_23_P161698 1.14x10-4 5.86 MMP3 matrix metallopeptidase 3 A_23_P25150 1.49x10-9 5.67 HOXC9 homeobox C9 A_23_P13094 3.26x10-4 5.56 MMP10 matrix metallopeptidase 10 A_23_P48570 2.36x10-5 5.48 DHRS2 dehydrogenase A_23_P125278 3.03x10-3 5.40 CXCL11 C-X-C motif chemokine ligand 11 A_23_P321501 1.63x10-5 5.38 DHRS2 dehydrogenase A_23_P431388 2.27x10-6 5.33 SPOCD1 SPOC domain containing 1 A_24_P20607 5.13x10-4 5.32 CXCL11 C-X-C motif chemokine ligand 11 A_24_P11061 3.70x10-3 5.30 CSAG1 chondrosarcoma associated gene 1 A_23_P87700 1.03x10-4 5.25 MFAP5 microfibrillar associated protein 5 A_23_P150979 1.81x10-2 5.25 MUCL1 mucin like 1 A_23_P1691 2.71x10-8 5.12 MMP1 matrix metallopeptidase 1 A_23_P350005 2.53x10-4 5.12 TRIML2 tripartite motif family like 2 A_24_P303091 1.23x10-3 4.99 CXCL10 C-X-C motif chemokine ligand 10 A_24_P923612 1.60x10-5 4.95 PTHLH parathyroid hormone like hormone A_23_P7313 6.03x10-5 4.94 SPP1 secreted phosphoprotein 1 A_23_P122924 2.45x10-8 4.93 INHBA inhibin A subunit A_32_P155460 6.56x10-3 4.91 PICSAR P38 inhibited cutaneous squamous cell carcinoma associated lincRNA A_24_P686965 8.75x10-7 4.82 SH2D5 SH2 domain containing 5 A_23_P105475 7.74x10-3 4.70 SLCO1B3 solute carrier organic anion transporter family member 1B3 A_24_P85099 4.82x10-5 4.67 HMGA2 high mobility group AT-hook 2 A_24_P101651
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7
    [Show full text]
  • MUC3 (Mucin 3) Antibody - with BSA and Azide Mouse Monoclonal Antibody [Clone MUC3/1154 ] Catalog # AH11897
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 MUC3 (Mucin 3) Antibody - With BSA and Azide Mouse Monoclonal Antibody [Clone MUC3/1154 ] Catalog # AH11897 Specification MUC3 (Mucin 3) Antibody - With BSA and Azide - Product Information Application ,2,3,4, Primary Accession Q02505 Other Accession 4584, 57876, 744422, 744530, Q9H195 Reactivity Human Host Mouse Clonality Monoclonal Isotype Mouse / IgG2a, kappa Calculated MW 1100kDa KDa Formalin-fixed, paraffin-embedded human Gastric Carcinoma stained with MUC3 MUC3 (Mucin 3) Antibody - With BSA and Azide - Additional Information Monoclonal Antibody (MUC3/1154). Gene ID 4584 Other Names Mucin-3A, MUC-3A, Intestinal mucin-3A, MUC3A, MUC3 Storage Store at 2 to 8°C.Antibody is stable for 24 months. Precautions MUC3 (Mucin 3) Antibody - With BSA and Azide is for research use only and not for Formalin-fixed, paraffin-embedded human use in diagnostic or therapeutic procedures. Gastric Carcinoma stained with MUC3 Monoclonal Antibody (MUC3/1154). MUC3 (Mucin 3) Antibody - With BSA and Azide - Protein Information Name MUC3A (HGNC:7513) Function Major glycoprotein component of a variety of mucus gels. Thought to provide a protective, lubricating barrier against particles and infectious agents at mucosal surfaces. May be involved in ligand binding and intracellular signaling. Page 1/2 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 Cellular Location Formalin-fixed, paraffin-embedded human [Isoform 1]: Membrane; Single-pass Colon Carcinoma stained with MUC3 membrane protein [Isoform 3]: Secreted Monoclonal Antibody (MUC3/1154). [Isoform 5]: Secreted. Tissue Location MUC3 (Mucin 3) Antibody - With BSA and Broad specificity; small intestine, colon, Azide - Background colonic tumors, heart, liver, thymus, prostate, pancreas and gall bladder It recognizes a protein of HMW, identified as mucin 3 glycoprotein (MUC3).
    [Show full text]
  • Biophysical Characterization of One-, Two-, and Three-Tandem Repeats of Human Mucin (Muc-1) Protein Core1
    (CANCER RESEARCH 53.5386-5394, November 15. 1993] Biophysical Characterization of One-, Two-, and Three-Tandem Repeats of Human Mucin (muc-1) Protein Core1 J. Darrell Fontenot,2 Nico Tjandra, Dawen Bu, Chien Ho, Ronald C. Montelaro, and Olivera J. Finn Department of Molecular Genetics and Biochemistry, University of Pittsburgh School of Medicine /J. D. F., D. B., R. C. M.. O. J. F.], Pittsburgh 15261, and Department of Biological Science, Carnegie Mellon University fN. T., C. H.¡,Pittsburgh, Pennsylvania 15213 ABSTRACT structural understanding of the precise mucin epitopes present on tumors and normal tissues must be acquired. Until recently mm in tandem repeat protein cores were believed to exist Until recently mucin TR-' protein cores were believed to exist in in random-coil conformations and to attain structure solely by the addi random-coil conformations and to attain structure solely by the addi tion of carbohydrates to serine and threonine residues. Matsushima et al. (Proteins Struct. Funct. Genet., 7: 125-155, 1990) recently proposed a tion of carbohydrates to serine and threonine residues (15). However, model of the secondary structure of proline rich tandem repeat proteins newly acquired information on mucin protein sequences through that has challenged this idea, especially for the case of the human poly complementary DNA cloning has challenged this idea, especially for morphic epithelial mucin encoded by the muc-l gene. We report here the case of human polymorphic epithelial mucin encoded by the results of structural analyses of the muc-1 protein core by using synthetic muc-\ gene. The sequence and amino acid content of the repetitive peptide analogues.
    [Show full text]