Biophysical Characterization of One-, Two-, and Three-Tandem Repeats of Human Mucin (Muc-1) Protein Core1

Total Page:16

File Type:pdf, Size:1020Kb

Biophysical Characterization of One-, Two-, and Three-Tandem Repeats of Human Mucin (Muc-1) Protein Core1 (CANCER RESEARCH 53.5386-5394, November 15. 1993] Biophysical Characterization of One-, Two-, and Three-Tandem Repeats of Human Mucin (muc-1) Protein Core1 J. Darrell Fontenot,2 Nico Tjandra, Dawen Bu, Chien Ho, Ronald C. Montelaro, and Olivera J. Finn Department of Molecular Genetics and Biochemistry, University of Pittsburgh School of Medicine /J. D. F., D. B., R. C. M.. O. J. F.], Pittsburgh 15261, and Department of Biological Science, Carnegie Mellon University fN. T., C. H.¡,Pittsburgh, Pennsylvania 15213 ABSTRACT structural understanding of the precise mucin epitopes present on tumors and normal tissues must be acquired. Until recently mm in tandem repeat protein cores were believed to exist Until recently mucin TR-' protein cores were believed to exist in in random-coil conformations and to attain structure solely by the addi random-coil conformations and to attain structure solely by the addi tion of carbohydrates to serine and threonine residues. Matsushima et al. (Proteins Struct. Funct. Genet., 7: 125-155, 1990) recently proposed a tion of carbohydrates to serine and threonine residues (15). However, model of the secondary structure of proline rich tandem repeat proteins newly acquired information on mucin protein sequences through that has challenged this idea, especially for the case of the human poly complementary DNA cloning has challenged this idea, especially for morphic epithelial mucin encoded by the muc-l gene. We report here the case of human polymorphic epithelial mucin encoded by the results of structural analyses of the muc-1 protein core by using synthetic muc-\ gene. The sequence and amino acid content of the repetitive peptide analogues. Synthetic peptides were prepared to correspond to domain of human muc-\ gene are more compatible with the formation one-, two-, and three-tandem repeats of muc-1. Results of one- and two- of a polyproline ß-turnhelix type of secondary structure (16). It is dimensional 'II NMR correlation spectroscopy on these peptides confirm difficult to accept that a sequence which is repeated faithfully up to that the muc-1 protein core is not in a random-coil secondary structure. 200 times would show no structural preference. It is much easier to Long-lived amide protons are protected in Do. and increasing spectral postulate that a core sequence would in fact be conserved and repeated complexity in the region of the ß-protonsof Asp 2 and His 15 reveals that structural changes are occurring as the number of repeats increases. The in part due to its precise structural and physical properties which are greatest changes occur when the number of repeats increases from one to necessary to construct the entire protein. We recently reported the two. unusual recognition of native muc-1 protein core by T-cell antigen These results are supported by the reactivity of a panel of monoclonal receptors and the subsequent activation of the T-cells, which implied antibodies raised against tumor associated muc-1 with these synthetic that the receptor was recognizing a precise 3-dimensional structure (8, peptides in enzyme-linked immunosorbent assay. The primary immuno- 14, 17). In the current study, we have performed structural character dominant mucin epitope. I'D I UP. does not appear to attain a native ization of muc-1 synthetic peptides of 20, 40. and 60 amino acids in conformation in the single repeat peptide (20 amino acids, starting with P), length, corresponding to one-, two-, and three-tandem repeats, by 'H but is expressed on peptides with multiple repeats. Intrinsic viscosity NMR spectroscopy, CD spectroscopy, intrinsic viscosity (TI)measure measurements of the peptide containing three repeats indicate that an ments, and reactivity with monoclonal antibodies. We have examined ordered structure present in solution is nul shaped. The circular dichroism spectrum of the same peptide is dominated by proline in the imti\ con the relationship between the tandem repeats and development of higher order structure in the human muc-1 protein core and have formation. These results are all consistent with the prediction that the muc-1 tandem repeat polypeptide core forms a polyproline /Mm u helix. proposed a model that is compatible with the observed antigenicity of this core structure. INTRODUCTION MATERIALS AND METHODS Mucins characteristically are large secreted and/or transmembrane glycoproteins with greater than 50% of their molecular weight derived Synthesis of Tandem Repeat Peptides. All peptides were peptide amides from O-linked carbohydrate attached to serine and threonine residues and were synthesized by a manual solid-phase strategy by using y-fluorenyl- (for a review see Ref. l). The bulk of the glycosylation is contained methyloxycarbonyl-protected amino acids. The procedures for synthesis, pu within a domain composed of tandemly repeated sequences of 10-81 rification, and characterization of the peptide products are described in detail amino acids per repeat (2-6). Mucins are produced by cells of epi elsewhere (18). Briefly, 20-, 40-, and 60-amino acid peptides were synthesized thelial lineage and, recently, expression of certain epitopes has been independently by using a manual Rapid Multiple Peptide Synthesizer apparatus identified as being associated with tumors (7, 8). Studies with mono from Du Pont (Boston. MA). When a peptide chain reached 30 amino acids in length, the total resin was separated into two reaction cartridges, thus allowing clonal antibodies reactive with epithelial tumors and corresponding sufficient space for the growing peptide chains in the cartridge. Once the resins normal tissues reveal that there can be different epitopes associated were divided, the concentration of input amino acid was maintained at 0.5 rnsi with mucins from malignant cells as opposed to normal cells (8-10). in order to drive the coupling reaction to completion with high efficiency. The This is in part due to aberrant glycosylation in certain tumors which products of the synthesis were deprotected and cleaved from the resin support results in the exposure of the mucin tandem repeat protein core on the in concentrated trifluoroacetic acid in the presence of the appropriate scaven cell surface (7, 9, 11-13). The exposure of the protein core of certain gers. The trifluoroacetic acid-soluble products were extracted sequentially in mucins found on malignant cells, combined with the ability of the organic solvents and then transferred to water and lyophilized. The peptides immune system to respond to these structures (8, 14) offers a unique were purified by conventional gel filtration and reverse-phase HPLC. Molecu opportunity to utilize mucin-based vaccines for specific immuno- lar weight characterizations of the peptide products were performed with therapy of tumors. For this approach to be viable, a more detailed electrospray mass spectroscopy. Solid Phase Peptide Enzyme-linked Immunosorbent Assay. Peptides containing one, two, and three tandem repeats were bound to %-wcll plates by Received 4/26/93; accepted 9/9/93. overnight incubation in 0.05 Mbicarbonate buffer. Next, the remaining protein- The cosls of publication of this article were defrayed in part by the payment of page binding sites were blocked with a 1-h, room temperature incubation in 10% charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1This work was supported by NIH Grants RO1CA (O. J. F.), RO1CA 43216 (R. C. M.), GM-26874 (C. H.). and National Science Foundation Grant DMB-8816384 (C. H.). 3 The abbreviations used are: TR. tandem repeat: NMR. nuclear magnetic resonance; - Present address: Theoretical Biology and Biophysics. Los Alamos National Labora CD, circular dichroism; HPLC. high-pressure liquid chromatography; PBS. phosphate- tory, T-10 Mail Stop-K710. Los Alamos, NM 87544. buffered saline: DSS. 2.2-dimethyl-2-silapentane-5-sulfonate. 53Xf> Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 1993 American Association for Cancer Research. SECONDARY STRUCTURE OF MUCÕN muc-1 PROTEIN CORE Carnation non-fat dry milk in PUS at pH 7.4. The plates were then incubated The TR domains of human mucins muc-1. 2, 3, 4 were also modeled with 50 fxl of the appropriately diluted monoclonal antibodies for 1-h at room according to the rules of Chou and Pasman (25) for secondary structure prediction. Surface potential was predicted by using the "SurfaccPlot" algo temperature. The plates were then washed 3 times with PBS. followed by a 1-h incubation with 50 ftl of the secondary antibody consisting of anti-mouse IgG rithm as described (26). Potential amphipathic a-helical regions were predicted by using the "Amphi" algorithm of Margalit et al. (27). The results of these or anti-mouse IgM conjugated to alkaline phosphatase and diluted 1/3000 in 10% Carnation nonfat dry milk in phosphate-buffered saline at pH 7.4. The analyses were used to construct conformational models (results not shown). plates were then washed 3 times with PBS. Detection was accomplished with The number of predicted turns per repeat is summarized in Table 1. 3 mg/ml phosphatase substrate in 0.25 M diethanolamine with 68 ¿¿M MgCI2-6H2O at pH 9.8. The absorbance at 405 nm was read at 5-min intervals. RESULTS The reactivity is the slope of the change in absorbance over time. Nonspecific antibodies yield a slope of 0-2 and so we considered anything with a slope over Sequence Analysis of Human Mucins. Sequence analysis of the 5 to be positive. repetitive sequences of human mucins reveals that fundamental dif 'H NMR Spectroscopy of TR Peptides. 'H NMR analyses were per ferences exist between the peptide sequences predicted by the muc-l formed by using HPLC-purified and lyophilized peptides. The concentrations gene and the genes of muc-2, -3, and -4 (Table 1) (2^1, 6). The proline used were from f>-7.5 mm in 0.1 M phosphate buffer, pH 5.9, with either level is 4 times higher in muc-\ than in muc-3 and muc-4, and the H2O/D2O (90%/10%) or D2O (99.9%).
Recommended publications
  • 140503 IPF Signatures Supplement Withfigs Thorax
    Supplementary material for Heterogeneous gene expression signatures correspond to distinct lung pathologies and biomarkers of disease severity in idiopathic pulmonary fibrosis Daryle J. DePianto1*, Sanjay Chandriani1⌘*, Alexander R. Abbas1, Guiquan Jia1, Elsa N. N’Diaye1, Patrick Caplazi1, Steven E. Kauder1, Sabyasachi Biswas1, Satyajit K. Karnik1#, Connie Ha1, Zora Modrusan1, Michael A. Matthay2, Jasleen Kukreja3, Harold R. Collard2, Jackson G. Egen1, Paul J. Wolters2§, and Joseph R. Arron1§ 1Genentech Research and Early Development, South San Francisco, CA 2Department of Medicine, University of California, San Francisco, CA 3Department of Surgery, University of California, San Francisco, CA ⌘Current address: Novartis Institutes for Biomedical Research, Emeryville, CA. #Current address: Gilead Sciences, Foster City, CA. *DJD and SC contributed equally to this manuscript §PJW and JRA co-directed this project Address correspondence to Paul J. Wolters, MD University of California, San Francisco Department of Medicine Box 0111 San Francisco, CA 94143-0111 [email protected] or Joseph R. Arron, MD, PhD Genentech, Inc. MS 231C 1 DNA Way South San Francisco, CA 94080 [email protected] 1 METHODS Human lung tissue samples Tissues were obtained at UCSF from clinical samples from IPF patients at the time of biopsy or lung transplantation. All patients were seen at UCSF and the diagnosis of IPF was established through multidisciplinary review of clinical, radiological, and pathological data according to criteria established by the consensus classification of the American Thoracic Society (ATS) and European Respiratory Society (ERS), Japanese Respiratory Society (JRS), and the Latin American Thoracic Association (ALAT) (ref. 5 in main text). Non-diseased normal lung tissues were procured from lungs not used by the Northern California Transplant Donor Network.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Cloud-Clone 16-17
    Cloud-Clone - 2016-17 Catalog Description Pack Size Supplier Rupee(RS) ACB028Hu CLIA Kit for Anti-Albumin Antibody (AAA) 96T Cloud-Clone 74750 AEA044Hu ELISA Kit for Anti-Growth Hormone Antibody (Anti-GHAb) 96T Cloud-Clone 74750 AEA255Hu ELISA Kit for Anti-Apolipoprotein Antibodies (AAHA) 96T Cloud-Clone 74750 AEA417Hu ELISA Kit for Anti-Proteolipid Protein 1, Myelin Antibody (Anti-PLP1) 96T Cloud-Clone 74750 AEA421Hu ELISA Kit for Anti-Myelin Oligodendrocyte Glycoprotein Antibody (Anti- 96T Cloud-Clone 74750 MOG) AEA465Hu ELISA Kit for Anti-Sperm Antibody (AsAb) 96T Cloud-Clone 74750 AEA539Hu ELISA Kit for Anti-Myelin Basic Protein Antibody (Anti-MBP) 96T Cloud-Clone 71250 AEA546Hu ELISA Kit for Anti-IgA Antibody 96T Cloud-Clone 71250 AEA601Hu ELISA Kit for Anti-Myeloperoxidase Antibody (Anti-MPO) 96T Cloud-Clone 71250 AEA747Hu ELISA Kit for Anti-Complement 1q Antibody (Anti-C1q) 96T Cloud-Clone 74750 AEA821Hu ELISA Kit for Anti-C Reactive Protein Antibody (Anti-CRP) 96T Cloud-Clone 74750 AEA895Hu ELISA Kit for Anti-Insulin Receptor Antibody (AIRA) 96T Cloud-Clone 74750 AEB028Hu ELISA Kit for Anti-Albumin Antibody (AAA) 96T Cloud-Clone 71250 AEB264Hu ELISA Kit for Insulin Autoantibody (IAA) 96T Cloud-Clone 74750 AEB480Hu ELISA Kit for Anti-Mannose Binding Lectin Antibody (Anti-MBL) 96T Cloud-Clone 88575 AED245Hu ELISA Kit for Anti-Glutamic Acid Decarboxylase Antibodies (Anti-GAD) 96T Cloud-Clone 71250 AEK505Hu ELISA Kit for Anti-Heparin/Platelet Factor 4 Antibodies (Anti-HPF4) 96T Cloud-Clone 71250 CCA005Hu CLIA Kit for Angiotensin II
    [Show full text]
  • Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant
    Appendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7,
    [Show full text]
  • Identification of Key Pathways and Genes in Dementia Via Integrated Bioinformatics Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.18.440371; this version posted July 19, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Identification of Key Pathways and Genes in Dementia via Integrated Bioinformatics Analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karnataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2021.04.18.440371; this version posted July 19, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract To provide a better understanding of dementia at the molecular level, this study aimed to identify the genes and key pathways associated with dementia by using integrated bioinformatics analysis. Based on the expression profiling by high throughput sequencing dataset GSE153960 derived from the Gene Expression Omnibus (GEO), the differentially expressed genes (DEGs) between patients with dementia and healthy controls were identified. With DEGs, we performed a series of functional enrichment analyses. Then, a protein–protein interaction (PPI) network, modules, miRNA-hub gene regulatory network and TF-hub gene regulatory network was constructed, analyzed and visualized, with which the hub genes miRNAs and TFs nodes were screened out. Finally, validation of hub genes was performed by using receiver operating characteristic curve (ROC) analysis.
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • Table SII. Significantly Differentially Expressed Mrnas of GSE23558 Data Series with the Criteria of Adjusted P<0.05 And
    Table SII. Significantly differentially expressed mRNAs of GSE23558 data series with the criteria of adjusted P<0.05 and logFC>1.5. Probe ID Adjusted P-value logFC Gene symbol Gene title A_23_P157793 1.52x10-5 6.91 CA9 carbonic anhydrase 9 A_23_P161698 1.14x10-4 5.86 MMP3 matrix metallopeptidase 3 A_23_P25150 1.49x10-9 5.67 HOXC9 homeobox C9 A_23_P13094 3.26x10-4 5.56 MMP10 matrix metallopeptidase 10 A_23_P48570 2.36x10-5 5.48 DHRS2 dehydrogenase A_23_P125278 3.03x10-3 5.40 CXCL11 C-X-C motif chemokine ligand 11 A_23_P321501 1.63x10-5 5.38 DHRS2 dehydrogenase A_23_P431388 2.27x10-6 5.33 SPOCD1 SPOC domain containing 1 A_24_P20607 5.13x10-4 5.32 CXCL11 C-X-C motif chemokine ligand 11 A_24_P11061 3.70x10-3 5.30 CSAG1 chondrosarcoma associated gene 1 A_23_P87700 1.03x10-4 5.25 MFAP5 microfibrillar associated protein 5 A_23_P150979 1.81x10-2 5.25 MUCL1 mucin like 1 A_23_P1691 2.71x10-8 5.12 MMP1 matrix metallopeptidase 1 A_23_P350005 2.53x10-4 5.12 TRIML2 tripartite motif family like 2 A_24_P303091 1.23x10-3 4.99 CXCL10 C-X-C motif chemokine ligand 10 A_24_P923612 1.60x10-5 4.95 PTHLH parathyroid hormone like hormone A_23_P7313 6.03x10-5 4.94 SPP1 secreted phosphoprotein 1 A_23_P122924 2.45x10-8 4.93 INHBA inhibin A subunit A_32_P155460 6.56x10-3 4.91 PICSAR P38 inhibited cutaneous squamous cell carcinoma associated lincRNA A_24_P686965 8.75x10-7 4.82 SH2D5 SH2 domain containing 5 A_23_P105475 7.74x10-3 4.70 SLCO1B3 solute carrier organic anion transporter family member 1B3 A_24_P85099 4.82x10-5 4.67 HMGA2 high mobility group AT-hook 2 A_24_P101651
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7
    [Show full text]
  • Supplemental Table 1
    Carlisle et al. 1 Supplementary Table 1. Primers for PCR amplification of bacterial 16S rRNA. Primers for Group A TA-27FMID1 CGTATCGCCTCCCTCGCGCCATCAGACGAGTGCGTAGAGTTTGATCCTGGCTCAG TA-27FMID2 CGTATCGCCTCCCTCGCGCCATCAGACGCTCGACAAGAGTTTGATCCTGGCTCAG TA-27FMID3 CGTATCGCCTCCCTCGCGCCATCAGAGACGCACTCAGAGTTTGATCCTGGCTCAG TA-27FMID4 CGTATCGCCTCCCTCGCGCCATCAGAGCACTGTAGAGAGTTTGATCCTGGCTCAG TA-27FMID5 CGTATCGCCTCCCTCGCGCCATCAGATCAGACACGAGAGTTTGATCCTGGCTCAG TA-27FMID6 CGTATCGCCTCCCTCGCGCCATCAGATATCGCGAGAGAGTTTGATCCTGGCTCAG TA-27FMID7 CGTATCGCCTCCCTCGCGCCATCAGCGTGTCTCTAAGAGTTTGATCCTGGCTCAG TA-27FMID8 CGTATCGCCTCCCTCGCGCCATCAGCTCGCGTGTCAGAGTTTGATCCTGGCTCAG TA-27FMID9 CGTATCGCCTCCCTCGCGCCATCAGTAGTATCAGCAGAGTTTGATCCTGGCTCAG TA-27FMID10 CGTATCGCCTCCCTCGCGCCATCAGTCTCTATGCGAGAGTTTGATCCTGGCTCAG TA-27FMID11 CGTATCGCCTCCCTCGCGCCATCAGTGATACGTCTAGAGTTTGATCCTGGCTCAG TA-27FMID13 CGTATCGCCTCCCTCGCGCCATCAGCATAGTAGTGAGAGTTTGATCCTGGCTCAG TA-27FMID14 CGTATCGCCTCCCTCGCGCCATCAGCGAGAGATACAGAGTTTGATCCTGGCTCAG TB-338R CTATGCGCCTTGCCAGCCCGCTCAGTGCTGCCTCCCGTAGGAGT Primers for Group B TB-27FMID1 CTATGCGCCTTGCCAGCCCGCTCAGACGAGTGCGTAGAGTTTGATCCTGGCTCAG TB-27FMID2 CTATGCGCCTTGCCAGCCCGCTCAGACGCTCGACAAGAGTTTGATCCTGGCTCAG TB-27FMID3 CTATGCGCCTTGCCAGCCCGCTCAGAGACGCACTCAGAGTTTGATCCTGGCTCAG TB-27FMID4 CTATGCGCCTTGCCAGCCCGCTCAGAGCACTGTAGAGAGTTTGATCCTGGCTCAG TB-27FMID5 CTATGCGCCTTGCCAGCCCGCTCAGATCAGACACGAGAGTTTGATCCTGGCTCAG TB-27FMID6 CTATGCGCCTTGCCAGCCCGCTCAGATATCGCGAGAGAGTTTGATCCTGGCTCAG TB-27FMID7 CTATGCGCCTTGCCAGCCCGCTCAGCGTGTCTCTAAGAGTTTGATCCTGGCTCAG TB-27FMID8 CTATGCGCCTTGCCAGCCCGCTCAGCTCGCGTGTCAGAGTTTGATCCTGGCTCAG
    [Show full text]
  • University of Hyogo Analysis of the Mucin Pathway of The
    UNIVERSITY OF HYOGO ANALYSIS OF THE MUCIN PATHWAY OF THE MAMMALIAN GOLGI STRESS RESPONSE MOHAMAD IKHWAN BIN JAMALUDIN Thesis submitted in fulfilment of the requirements for the degree of Doctor of Philosophy 2020 Laboratory of Biochemistry and Molecular Biology II Leading Program in Doctoral Education Department of Picobiology Graduate School of Life Science ABSTRACT The Golgi plays a central role for post-translational modifications of properly folded proteins from the ER (e.g. glycosylation and sulfation) as well as vesicular transport of correctly modified proteins to their final destination. When the synthesis of secretory or membrane proteins is increased and overwhelms the functional capacity of the Golgi apparatus (Golgi stress), eukaryotic cells activate a homeostatic mechanism called the Golgi stress response in order to upregulate the capacity of the Golgi. Recent studies have revealed five Golgi stress response pathways such as the TFE3, CREB3, HSP47, MAPK-ETS and proteoglycan pathways, which regulates the general function of the Golgi, apoptosis, cell survival, spliceosome and cell death, and glycosylation of proteoglycans, respectively. Here, we have uncovered a novel response pathway, named the mucin pathway, that enhances the expression of glycosylation enzymes for mucins (such as GALNT5, GALNT8 and GALNT18) to compensate for the insufficiency in mucin-type glycosylation in the Golgi (mucin-type Golgi stress). Unexpectedly, we found that TFE3, a key transcription factor regulating the TFE3 pathway, was also induced and activated upon mucin-type Golgi stress, suggesting that the mucin pathway transmits a crosstalk signal to the TFE3 pathway. Promoter analysis of the human TFE3 gene revealed a novel enhancer element that regulates transcriptional induction of the TFE3 gene in response to mucin-type Golgi stress, of which consensus sequence is ACTTCC(N9)TCCCCA.
    [Show full text]
  • Human Leukemic Myeloblasts and Myeloblastoid Cells Contain the Enzyme Cytidine 5 -Monophosphate-Jv-Acetylneuraminic Acid:Galãÿl- 3Galnaca(2-3)-Sialyltransferase1
    [CANCER RESEARCH 50. 5003-5007. August 15. 1990] Human Leukemic Myeloblasts and Myeloblastoid Cells Contain the Enzyme Cytidine 5 -Monophosphate-jV-acetylneuraminic Acid:Galßl- 3GalNAca(2-3)-sialyltransferase1 Amita Kanani, D. Robert Sutherland, Eitan Fibach, Kushi L. Matta, Alex Hindenburg, Inka Brockhausen, William Kuhns, Robert N. Taub, Dirk H. van den Eijnden, and Michael A. Baker2 Department of Medicine, Toronto General Hospital, University of Toronto, Ontario M5G 2C4, Canada [A. K., D. R. S., M. A. BJ; Department of Haematology, Hadassah Hospital, Hebrew university, Jerusalem, Israel, IL-91120 [E. F.]; Department of Medicine, Columbia University, New York, New York 10032 [R. N. T.J; Department of Biochemistry, Hospital for Sick Children, Toronto, Ontario, Canada MSG 1X8 [I. B., W. K.J; Roswell Park Memorial Institute, Buffalo, New York 14263 [K. L. MJ; Division of Oncology-Hematology, Winthrop University Hospital, Mineóla, Long Island, New York 11501 [A. H.]; and Department of Medical Chemistry, Vrije Universiteit, Amsterdam, The Netherlands, NL-1007 MC [D. H. v. d. E.J ABSTRACT CML compared to normals have demonstrated decreased ad hesiveness (6), decreased chemotaxis (7), and reduced mem We have examined the role of CMP-NeuAc:Gal£I-3GalNAc-R o(2- brane binding of the chemotactic peptide /V-formylmethionyl- 3)-sialyltransferase in fresh leukemia cells and leukemia-derived cell leucylphenylalanine (8). These altered functions are partially lines. Enzyme activity in normal granulocytes using Gal$l-3GalNAca- reversible by removal of membrane sialic acid with neuramini- o-nitrophenyl as substrate was 1.5 ±0.7 nmol/mg/h whereas activity in morphologically mature granulocytes from 6 patients with chronic mye- dase, suggesting a role for aberrant sialylation in the abnormal logenous leukemia (CML) was 4.2 ±1.6 nmol/mg/h (/' < 0.05).
    [Show full text]
  • Milger Et Al. Pulmonary CCR2+CD4+ T Cells Are Immune Regulatory And
    Milger et al. Pulmonary CCR2+CD4+ T cells are immune regulatory and attenuate lung fibrosis development Supplemental Table S1 List of significantly regulated mRNAs between CCR2+ and CCR2- CD4+ Tcells on Affymetrix Mouse Gene ST 1.0 array. Genewise testing for differential expression by limma t-test and Benjamini-Hochberg multiple testing correction (FDR < 10%). Ratio, significant FDR<10% Probeset Gene symbol or ID Gene Title Entrez rawp BH (1680) 10590631 Ccr2 chemokine (C-C motif) receptor 2 12772 3.27E-09 1.33E-05 9.72 10547590 Klrg1 killer cell lectin-like receptor subfamily G, member 1 50928 1.17E-07 1.23E-04 6.57 10450154 H2-Aa histocompatibility 2, class II antigen A, alpha 14960 2.83E-07 1.71E-04 6.31 10590628 Ccr3 chemokine (C-C motif) receptor 3 12771 1.46E-07 1.30E-04 5.93 10519983 Fgl2 fibrinogen-like protein 2 14190 9.18E-08 1.09E-04 5.49 10349603 Il10 interleukin 10 16153 7.67E-06 1.29E-03 5.28 10590635 Ccr5 chemokine (C-C motif) receptor 5 /// chemokine (C-C motif) receptor 2 12774 5.64E-08 7.64E-05 5.02 10598013 Ccr5 chemokine (C-C motif) receptor 5 /// chemokine (C-C motif) receptor 2 12774 5.64E-08 7.64E-05 5.02 10475517 AA467197 expressed sequence AA467197 /// microRNA 147 433470 7.32E-04 2.68E-02 4.96 10503098 Lyn Yamaguchi sarcoma viral (v-yes-1) oncogene homolog 17096 3.98E-08 6.65E-05 4.89 10345791 Il1rl1 interleukin 1 receptor-like 1 17082 6.25E-08 8.08E-05 4.78 10580077 Rln3 relaxin 3 212108 7.77E-04 2.81E-02 4.77 10523156 Cxcl2 chemokine (C-X-C motif) ligand 2 20310 6.00E-04 2.35E-02 4.55 10456005 Cd74 CD74 antigen
    [Show full text]