DOCSLIB.ORG

The Hinf-P/P220 Cell Cycle Signaling Pathway Controls Nonhistone

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Hinf-P/P220 Cell Cycle Signaling Pathway Controls Nonhistone Research Article The HiNF-P/p220NPAT Cell Cycle Signaling Pathway Controls Nonhistone Target Genes Ricardo Medina, Margaretha van der Deen, Angela Miele-Chamberland, Rong-Lin Xie, Andre J. van Wijnen, Janet L. Stein, and Gary S. Stein Department of Cell Biology and Cancer Center, University of Massachusetts Medical School, Worcester, Massachusetts Abstract Whereas the HiNF-P/p220NPAT pathway plays a key role in HiNF-P and its cofactor p220NPAT are principal factors S-phase entry, the majority of data on cyclin E/CDK2 signaling is regulating histone gene expression at the G -S phase cell centered on the target genes of E2F factors. The E2F proteins had 1 been shown earlier to support S-phase entry and are activated cycle transition. Here,we have investigated whether HiNF-P controls other cell cycle– and cancer-related genes. We used following release from repressive RB-related pocket protein cDNA microarrays to monitor responsiveness of gene expres- complexes through CDK-dependent phosphorylation at the restric- sion to small interfering RNA–mediated depletion of HiNF-P. tion point (10, 11). E2F targets include a number of genes encoding Candidate HiNF-P target genes were examined for the enzymes that are required for nucleotide metabolism as well as presence of HiNF-P recognition motifs, in vitro HiNF-P binding proteins involved in DNA replication and cyclin subunits for CDKs. to DNA,and in vivo association by chromatin immunopreci- The recent realization that cyclin E/CDK2 signaling diverges into pitations and functional reporter gene assays. Of 177 the E2F and HiNF-P pathways (2) necessitates examination of proliferation-related genes we tested,20 are modulated in HiNF-P target genes to gain a more comprehensive understanding HiNF-P–depleted cells and contain putative HiNF-P binding of regulatory events that control the onset of S phase. motifs. We validated that at least three genes (i.e., ATM, To examine the role of HiNF-P in the transcription of nonhistone PRKDC,and CKS2) are HiNF-P dependent and provide data genes, we searched for other genes targeted by HiNF-P in indicating that the DNA damage response is altered in HiNF- asynchronous cells. Here, we have characterized HiNF-P target genes to identify nonhistone cell cycle–related pathways in which P–depleted cells. We conclude that,in addition to histone genes,HiNF-P also regulates expression of nonhistone targets HiNF-P may participate. We have characterized genes that are that influence competency for cell cycle progression. [Cancer modulated in response to HiNF-P small interfering RNA (siRNA) Res 2007;67(21):10334–42] treatment. Genes directly regulated by HiNF-P were defined by in vitro binding assays, reporter gene assays, and chromatin immunoprecipitations that establish binding of HiNF-P to Introduction endogenous chromatin-embedded promoters. One principal result HiNF-P is the gene regulatory end point for the cyclin E/cyclin- of this study is that HiNF-P interacts with divergently transcribed NPAT dependent kinase (CDK)-2/p220 pathway that activates genes encoding proteins that are involved in DNA damage multiple histone H4 genes and supports chromatin packaging of response pathways (e.g., ATM-p220NPAT and PRKDC-MCM4). We nascent DNA (1–7). This pathway may be a key component of a also show that HiNF-P deficiency impairs DNA repair. Based on broader cell cycle checkpoint (‘‘S point’’) defined, in part, by these findings, we suggest that HiNF-P may have important cell HiNF-P–responsive genes that are distinct from those encoding cycle regulatory functions that are complementary to its role in histones. The cell cycle regulatory role of HiNF-P in controlling controlling histone gene expression. histone gene expression is functionally coupled to formation of a HiNF-P/p220NPAT transcriptional coactivation complex (2). Whereas p220NPAT colocalizes with HiNF-P and histone genes at Materials and Methods the G1-S phase transition when transcriptional activation occurs, HiNF-P depletion by siRNA. For siRNA-mediated knockdown of HiNF-P this protein seems to be spatially restricted to two to four large mRNA, human T98G glioblastoma, human HeLa S3 cervical adenocarcino- subnuclear foci (related to Cajal bodies; refs. 2, 4–6). Our ma, or human U-2 OS osteosarcoma cells were transfected in six-well plates immunofluorescence data reveal that a significant fraction of with either siCONTROL Non-Targeting siRNA#1 (Dharmacon), Silencer HiNF-P is also located at a large number of other smaller Negative Control #1 siRNA (Ambion, Inc.), or HiNF-P–specific double- subnuclear foci (2). We have shown that expression of HiNF-P is stranded siRNA oligonucleotides (Ambion, Inc.) with Oligofectamine proliferation related (1, 8, 9). Depletion of HiNF-P decreases histone according to the manufacturer’s instructions (Invitrogen). H4 mRNA levels in asynchronous cells and delays progression into Cell cycle and cancer gene expression arrays. DNA-free total RNA S phase following serum stimulation of quiescent cells (1). These samples isolated from control and HiNF-P siRNA–treated T98G cells were used for probe synthesis in the presence of [a-32P]dCTP according to the data show that HiNF-P is a critical component of the cell cycle– manufacturer’s protocol (SuperArray Bioscience Corp.). This probe was dependent mechanisms that respond to cyclin E/CDK2 to achieve subsequently used to hybridize human cell cycle and cancer GEArray competency for S-phase entry. Q Series cDNA gene arrays following the instructions of the same manu- facturer. Spot intensities were quantified with a Storm 840 PhosphoImager using ImageQuant 5.0 software (Molecular Dynamics) and normalized to Requests for reprints: Gary S. Stein, Department of Cell Biology and Cancer the controls provided in the array. Hierarchical clustering was used to Center, University of Massachusetts Medical School, 55 Lake Avenue North, Worcester, analyze the data, and cDNAs with normalized signal intensity values that MA 01655. Phone: 508-856-5625; Fax: 508-856-6800; E-mail: [email protected]. I2007American Association for Cancer Research. differed by at least 1.4-fold between siCONTROL and HiNF-P siRNA doi:10.1158/0008-5472.CAN-07-1560 oligonucleotides were further investigated. Cancer Res 2007; 67: (21). November 1, 2007 10334 www.aacrjournals.org Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2007 American Association for Cancer Research. Novel Nonhistone HiNF-P Target Genes cDNA synthesis and real-time quantitative PCR. Total RNA from Chromatin immunoprecipitations. T98G cells were washed twice with siCONTROL Non-Targeting siRNA#1 (Dharmacon) and HiNF-P siRNA– ice-cold 1Â PBS and subsequently cross-linked with 1% formaldehyde in treated HeLa cells was either subjected to DNase I digestion and purified by 1Â PBS for 10 min at room temperature with gentle agitation. To quench column chromatography (DNA-free RNA Kit, Zymo Research) or purified the cross-linking reaction, 0.125 M glycine in 1Â PBS was added for 5 min. using the RNeasy Plus Mini Kit (Qiagen) and used to prepare cDNA with the Cells were then washed twice with ice-cold 1Â PBS, scraped in lysis buffer SuperScript First-Strand Synthesis System (Invitrogen). Quantitation was [50 mmol/L Tris-HCl (pH 8.0), 150 mmol/L NaCl, 1% NP40, 2Â Complete determined using a 7000 sequence detection system (Applied Biosystems) protease inhibitor] and incubated on ice for 20 min. Lysates were sonicated and SYBR Green chemistry (SYBR Green PCR Master Mix, Applied to an average DNA size of 100 to 500 bp and then cleared by centrifugation Biosystems). The relative mRNA expression was determined by the DDCT at 14,000 rpm for 15 min at 4jC. Crude rabbit antiserum (3 AL) against method. The following primer pairs were used for human mRNAs HiNF-P, pre-bleed serum (3 AL), or 2 Ag of RNA polymerase II antibody were (in 5¶-3¶ direction): HiNF-P forward, GAGGAGGATGACCCACTTGA, and added and rotated at 4jC overnight. One-tenth volume of protein A/G reverse, TCAGCTTGGTGTGGTAGCAG; H4/n forward AGCTGTCTATCG- beads (Santa Cruz Biotechnology) was added for 1 h at 4jC. Beads were GGCTCCAG, and reverse, CCTTTGCCTAAGCCTTTTCC; ATM forward, then washed consecutively with the following buffers: low-salt [20 mmol/L CTGTGGTGGAGGGAAGATGT, and reverse, GTTGATGAGGGGATTGCTGT; Tris-HCl (pH 8.0), 150 mmol/L NaCl, 1% Triton X-100, 2 mmol/L EDTA, p220NPAT forward, TCCAGCCTGCTTACTGTCCT, and reverse, AGCAAA- 1Â Complete protease inhibitor], high-salt [20 mmol/L Tris-HCl (pH 8.0), CCTTGGGGAACTTT; PRKDC forward, TGCAGCTGATTCACTGGTTC, and 500 mmol/L NaCl, 1% Triton X-100, 2 mmol/L EDTA], LiCl [10 mmol/L reverse, TCGAATACACCGACCACAAA; MCM4 forward, TGAAGCCATT- Tris-HCl (pH 8.0), 250 mmol/L LiCl, 1% deoxycholate, 1% NP40, 1 mmol/L GATGTGGAAG, and reverse, GGCACTCATCCCCGTAGTAA; CKS2 forward, EDTA], and three washes with Tris-EDTA [10 mmol/L Tris-HCl (pH 8.0), ACCGGCATGTTATGTTACCC, and reverse, TGTGGTTCTGGCTCATGAAT; 1 mmol/L EDTA]. Protein/DNA complexes were eluted twice with elution and RB1 forward, TTCACCCTTACGGATTCCTG, and reverse, AGTCCC- buffer (1% SDS, 100 mmol/L NaHCO3) at room temperature. One-tenth GAATGATTCACCAA. volume of 3 mol/L sodium acetate (pH 5.2) was added and samples were Differences in RNA levels between control and HiNF-P–specific siRNA incubated at 65jC overnight to reverse cross-links. Genomic DNA was oligonucleotides were elevated using general linear mixed models (12). purified by phenol-chloroform extraction followed by isopropanol precip- Models were fit by restricted maximum likelihood estimation (13) using the itation with 5 to 20 Ag of glycogen carrier and dissolved in resuspension SAS Proc Mixed procedure (14). In the presence of significant differences buffer (10 mmol/L Tris-HCl, pH 8.0). among means, pairwise comparisons were made using Fisher’s least Analysis of chromatin immunoprecipitations by real-time quanti- significant difference test using the estimated covariance matrix to account tative PCR.
Load more

Recommended publications
  • Early Growth Response 1 Regulates Hematopoietic Support and Proliferation in Human Primary Bone Marrow Stromal Cells
    Hematopoiesis SUPPLEMENTARY APPENDIX Early growth response 1 regulates hematopoietic support and proliferation in human primary bone marrow stromal cells Hongzhe Li, 1,2 Hooi-Ching Lim, 1,2 Dimitra Zacharaki, 1,2 Xiaojie Xian, 2,3 Keane J.G. Kenswil, 4 Sandro Bräunig, 1,2 Marc H.G.P. Raaijmakers, 4 Niels-Bjarne Woods, 2,3 Jenny Hansson, 1,2 and Stefan Scheding 1,2,5 1Division of Molecular Hematology, Department of Laboratory Medicine, Lund University, Lund, Sweden; 2Lund Stem Cell Center, Depart - ment of Laboratory Medicine, Lund University, Lund, Sweden; 3Division of Molecular Medicine and Gene Therapy, Department of Labora - tory Medicine, Lund University, Lund, Sweden; 4Department of Hematology, Erasmus MC Cancer Institute, Rotterdam, the Netherlands and 5Department of Hematology, Skåne University Hospital Lund, Skåne, Sweden ©2020 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol. 2019.216648 Received: January 14, 2019. Accepted: July 19, 2019. Pre-published: August 1, 2019. Correspondence: STEFAN SCHEDING - [email protected] Li et al.: Supplemental data 1. Supplemental Materials and Methods BM-MNC isolation Bone marrow mononuclear cells (BM-MNC) from BM aspiration samples were isolated by density gradient centrifugation (LSM 1077 Lymphocyte, PAA, Pasching, Austria) either with or without prior incubation with RosetteSep Human Mesenchymal Stem Cell Enrichment Cocktail (STEMCELL Technologies, Vancouver, Canada) for lineage depletion (CD3, CD14, CD19, CD38, CD66b, glycophorin A). BM-MNCs from fetal long bones and adult hip bones were isolated as reported previously 1 by gently crushing bones (femora, tibiae, fibulae, humeri, radii and ulna) in PBS+0.5% FCS subsequent passing of the cell suspension through a 40-µm filter.
    [Show full text]
  • Direct Interaction Between Hnrnp-M and CDC5L/PLRG1 Proteins Affects Alternative Splice Site Choice
    Direct interaction between hnRNP-M and CDC5L/PLRG1 proteins affects alternative splice site choice David Llères, Marco Denegri, Marco Biggiogera, Paul Ajuh, Angus Lamond To cite this version: David Llères, Marco Denegri, Marco Biggiogera, Paul Ajuh, Angus Lamond. Direct interaction be- tween hnRNP-M and CDC5L/PLRG1 proteins affects alternative splice site choice. EMBO Reports, EMBO Press, 2010, 11 (6), pp.445 - 451. 10.1038/embor.2010.64. hal-03027049 HAL Id: hal-03027049 https://hal.archives-ouvertes.fr/hal-03027049 Submitted on 26 Nov 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. scientificscientificreport report Direct interaction between hnRNP-M and CDC5L/ PLRG1 proteins affects alternative splice site choice David Lle`res1*, Marco Denegri1*w,MarcoBiggiogera2,PaulAjuh1z & Angus I. Lamond1+ 1Wellcome Trust Centre for Gene Regulation & Expression, College of Life Sciences, University of Dundee, Dundee, UK, and 2LaboratoriodiBiologiaCellulareandCentrodiStudioperl’IstochimicadelCNR,DipartimentodiBiologiaAnimale, Universita’ di Pavia, Pavia, Italy Heterogeneous nuclear ribonucleoprotein-M (hnRNP-M) is an and affect the fate of heterogeneous nuclear RNAs by influencing their abundant nuclear protein that binds to pre-mRNA and is a structure and/or by facilitating or hindering the interaction of their component of the spliceosome complex.
    [Show full text]
  • Pcagopromoter - an R Package for Biological and Regulatory Interpretation of Principal Components in Genome-Wide Gene Expression Data
    Roskilde University pcaGoPromoter - An R Package for Biological and Regulatory Interpretation of Principal Components in Genome-Wide Gene Expression Data Hansen, Morten; Gerds, Thomas Alexander; Sedelin, Jacob Benedikt; Troelsen, Jesper; Olsen, Jørgen Published in: P L o S One DOI: 10.1371/journal.pone.0032394 Publication date: 2012 Document Version Publisher's PDF, also known as Version of record Citation for published version (APA): Hansen, M., Gerds, T. A., Sedelin, J. B., Troelsen, J., & Olsen, J. (2012). pcaGoPromoter - An R Package for Biological and Regulatory Interpretation of Principal Components in Genome-Wide Gene Expression Data. P L o S One, 7(2), e32394. https://doi.org/10.1371/journal.pone.0032394 General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain. • You may freely distribute the URL identifying the publication in the public portal. Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 28. Sep. 2021
    [Show full text]
  • Suppl. Fig. 1 the Gene Ontology Annotations of Up- and Down-Regulated Genes of Strain CCAP 1055/1
    P. tricornutum Suppl. Fig. 1 The gene ontology annotations of up- and down-regulated genes of strain CCAP 1055/1. Suppl. Table 1 Permutational MANOVA (Permutational Multivariate Analysis of Variance Using Distance Matrices) of fatty acid content per cell between the two treatment groups (control and grazing) among all strains Suppl. Table 2 Coefficients of linear discriminants of linear discriminant analysis (LDA) on the contents in each fatty acid Suppl. Table 3 Two-way ANOVA on LDA results of the contents in each fatty acid Suppl. Table 4 Statistics of clean reads alignment from paired-end sequencing on 9L cultures of strain CCAP 1055/1 Suppl. Table 5 Significantly differential expressed genes in treatment pairs of 9L cultures of strain CCAP 1055/1 Suppl. Table 6 Pathway enrichment analyses on significantly differential expressed genes Suppl. Fig. 1 Suppl. Table 1 PUFA(Polyunsaturated fatty acids) Permutational Multivariate Number of significant Number of significant Strain Analysis of Variance Using different fatty acids different total amount 16:2n4 16:3n4 18:2n6t 18:2n6c (LA) 18 R2 P value (NSD) of fatty acid(NSDT) χ2 df P value χ2 df P value χ2 df P value χ2 df P value χ2 9L Sets of CCAP 1055/1 R2(1,5)=0.25745 0.3 1 0 NAN 1 NA 3.9706 1 0.0463 NAN 1 NA 2.3333 1 0.1266 0 150 ml Sets of CCAP 1055/1 R2(1,5)=0.27538 0.2 3 1 1 1 0.3173 0 1 1 1 1 0.3173 2.3333 1 0.1266 1.3441 CCAP 632 R2(1,5)=0.39474 0.2 4 0 2.4 1 0.1213 NAN 1 NA NAN 1 NA 1.1905 1 0.2752 3.8571 CCAP 2557 R2(1,5)=0.19544 0.6 0 0 NAN 1 NA 0.066667 1 0.7963 NAN 1 NA 1.1905
    [Show full text]
  • Bioinformatics Analysis of Hereditary Disease Gene Set to Identify Key Modulators of Myocardial Remodeling During Heart Regeneration in Zebrafish
    EPiC Series in Computing Volume 70, 2020, Pages 226{237 Proceedings of the 12th International Conference on Bioinformatics and Computational Biology Bioinformatics analysis of hereditary disease gene set to identify key modulators of myocardial remodeling during heart regeneration in zebrafish Lawrence Yu-Min Liu1,2, Zih-Yin Lai1, Min-Hsuan Lin1, Yu Shih3 and Yung-Jen Chuang1 1 Department of Medical Science & Institute of Bioinformatics and Structural Biology, National Tsing Hua University, Hsinchu, 30013, Taiwan 2 Division of Cardiology, Department of Internal Medicine, Hsinchu Mackay Memorial Hospital, Hsinchu, 30071, Taiwan 3 Interdisciplinary Program of Life Science, National Tsing Hua University, Hsinchu, 30013, Taiwan [email protected], [email protected], [email protected], [email protected], [email protected] Abstract Unlike mammals, adult zebrafish hearts retain a remarkable capacity to regenerate after injury. Since regeneration shares many common molecular pathways with embryonic development, we investigated myocardial remodeling genes and pathways by performing a comparative transcriptomic analysis of zebrafish heart regeneration using a set of known human hereditary heart disease genes related to myocardial hypertrophy during development. We cross-matched human hypertrophic cardiomyopathy-associated genes with a time-course microarray dataset of adult zebrafish heart regeneration. Genes in the expression profiles that were highly elevated in the early phases of myocardial repair and remodeling after injury in zebrafish were identified. These genes were further analyzed with web-based bioinformatics tools to construct a regulatory network revealing potential transcription factors and their upstream receptors. In silico functional analysis of these genes showed that they are involved in cardiomyocyte proliferation and differentiation, angiogenesis, and inflammation-related pathways.
    [Show full text]
  • Characterization of the Tandem CWCH2 Sequence Motif: a Hallmark of Inter-Zinc Finger Interactions Minoru Hatayama1, Jun Aruga1,2*
    Hatayama and Aruga BMC Evolutionary Biology 2010, 10:53 http://www.biomedcentral.com/1471-2148/10/53 RESEARCH ARTICLE Open Access Characterization of the tandem CWCH2 sequence motif: a hallmark of inter-zinc finger interactions Minoru Hatayama1, Jun Aruga1,2* Abstract Background: The C2H2 zinc finger (ZF) domain is widely conserved among eukaryotic proteins. In Zic/Gli/Zap1 C2H2 ZF proteins, the two N-terminal ZFs form a single structural unit by sharing a hydrophobic core. This structural unit defines a new motif comprised of two tryptophan side chains at the center of the hydrophobic core. Because each tryptophan residue is located between the two cysteine residues of the C2H2 motif, we have named this structure the tandem CWCH2 (tCWCH2) motif. Results: Here, we characterized 587 tCWCH2-containing genes using data derived from public databases. We categorized genes into 11 classes including Zic/Gli/Glis, Arid2/Rsc9, PacC, Mizf, Aebp2, Zap1/ZafA, Fungl, Zfp106, Twincl, Clr1, and Fungl-4ZF, based on sequence similarity, domain organization, and functional similarities. tCWCH2 motifs are mostly found in organisms belonging to the Opisthokonta (metazoa, fungi, and choanoflagellates) and Amoebozoa (amoeba, Dictyostelium discoideum). By comparison, the C2H2 ZF motif is distributed widely among the eukaryotes. The structure and organization of the tCWCH2 motif, its phylogenetic distribution, and molecular phylogenetic analysis suggest that prototypical tCWCH2 genes existed in the Opisthokonta ancestor. Within-group or between-group comparisons of the tCWCH2 amino acid sequence identified three additional sequence features (site-specific amino acid frequencies, longer linker sequence between two C2H2 ZFs, and frequent extra-sequences within C2H2 ZF motifs).
    [Show full text]
  • Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors
    University of Cincinnati Date: 12/20/2010 I, Arturo R Maldonado , hereby submit this original work as part of the requirements for the degree of Doctor of Philosophy in Developmental Biology. It is entitled: Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors Student's name: Arturo R Maldonado This work and its defense approved by: Committee chair: Jeffrey Whitsett Committee member: Timothy Crombleholme, MD Committee member: Dan Wiginton, PhD Committee member: Rhonda Cardin, PhD Committee member: Tim Cripe 1297 Last Printed:1/11/2011 Document Of Defense Form Molecular Targeting and Enhancing Anticancer Efficacy of Oncolytic HSV-1 to Midkine Expressing Tumors A dissertation submitted to the Graduate School of the University of Cincinnati College of Medicine in partial fulfillment of the requirements for the degree of DOCTORATE OF PHILOSOPHY (PH.D.) in the Division of Molecular & Developmental Biology 2010 By Arturo Rafael Maldonado B.A., University of Miami, Coral Gables, Florida June 1993 M.D., New Jersey Medical School, Newark, New Jersey June 1999 Committee Chair: Jeffrey A. Whitsett, M.D. Advisor: Timothy M. Crombleholme, M.D. Timothy P. Cripe, M.D. Ph.D. Dan Wiginton, Ph.D. Rhonda D. Cardin, Ph.D. ABSTRACT Since 1999, cancer has surpassed heart disease as the number one cause of death in the US for people under the age of 85. Malignant Peripheral Nerve Sheath Tumor (MPNST), a common malignancy in patients with Neurofibromatosis, and colorectal cancer are midkine- producing tumors with high mortality rates. In vitro and preclinical xenograft models of MPNST were utilized in this dissertation to study the role of midkine (MDK), a tumor-specific gene over- expressed in these tumors and to test the efficacy of a MDK-transcriptionally targeted oncolytic HSV-1 (oHSV).
    [Show full text]
  • The Changing Chromatome As a Driver of Disease: a Panoramic View from Different Methodologies
    The changing chromatome as a driver of disease: A panoramic view from different methodologies Isabel Espejo1, Luciano Di Croce,1,2,3 and Sergi Aranda1 1. Centre for Genomic Regulation (CRG), Barcelona Institute of Science and Technology, Dr. Aiguader 88, Barcelona 08003, Spain 2. Universitat Pompeu Fabra (UPF), Barcelona, Spain 3. ICREA, Pg. Lluis Companys 23, Barcelona 08010, Spain *Corresponding authors: Luciano Di Croce ([email protected]) Sergi Aranda ([email protected]) 1 GRAPHICAL ABSTRACT Chromatin-bound proteins regulate gene expression, replicate and repair DNA, and transmit epigenetic information. Several human diseases are highly influenced by alterations in the chromatin- bound proteome. Thus, biochemical approaches for the systematic characterization of the chromatome could contribute to identifying new regulators of cellular functionality, including those that are relevant to human disorders. 2 SUMMARY Chromatin-bound proteins underlie several fundamental cellular functions, such as control of gene expression and the faithful transmission of genetic and epigenetic information. Components of the chromatin proteome (the “chromatome”) are essential in human life, and mutations in chromatin-bound proteins are frequently drivers of human diseases, such as cancer. Proteomic characterization of chromatin and de novo identification of chromatin interactors could thus reveal important and perhaps unexpected players implicated in human physiology and disease. Recently, intensive research efforts have focused on developing strategies to characterize the chromatome composition. In this review, we provide an overview of the dynamic composition of the chromatome, highlight the importance of its alterations as a driving force in human disease (and particularly in cancer), and discuss the different approaches to systematically characterize the chromatin-bound proteome in a global manner.
    [Show full text]
  • Risk Variants Disrupting Enhancers of TH1 and TREG Cells in Type 1 Diabetes
    Risk variants disrupting enhancers of TH1 and TREG cells in type 1 diabetes Peng Gaoa,b,c,1, Yasin Uzuna,b,c,1, Bing Hea,b,c, Sarah E. Salamatid, Julie K. M. Coffeyd, Eva Tsalikiand, and Kai Tana,b,c,e,f,g,2 aDivision of Oncology, Children’s Hospital of Philadelphia, Philadelphia, PA 19104; bCenter for Childhood Cancer Research, Children’s Hospital of Philadelphia, Philadelphia, PA 19104; cDepartment of Biomedical and Health Informatics, Children’s Hospital of Philadelphia, Philadelphia, PA 19104; dStead Family Department of Pediatrics, University of Iowa Carver College of Medicine, Iowa City, IA 52242; eDepartment of Pediatrics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 19104; fDepartment of Genetics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 19104; and gDepartment of Cell and Developmental Biology, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 19104 Edited by Wing Hung Wong, Stanford University, Stanford, CA, and approved March 1, 2019 (received for review September 5, 2018) Genome-wide association studies (GWASs) have revealed 59 geno- patients, despite of the pivotal roles of TH1 and TREG cells in the mic loci associated with type 1 diabetes (T1D). Functional inter- pathogenesis of T1D. In this study, we conducted epigenomic pretation of the SNPs located in the noncoding region of these loci and transcriptomic profiling of TH1 and TREG cells isolated from remains challenging. We perform epigenomic profiling of two a cohort of five healthy donors and six newly diagnosed T1D enhancer marks, H3K4me1 and H3K27ac, using primary TH1 and patients. Our data (8) reveal significant alteration in the en- TREG cells isolated from healthy and T1D subjects.
    [Show full text]
  • © 2016 Ying Li ALL RIGHTS RESERVED
    © 2016 Ying Li ALL RIGHTS RESERVED GENE REGULATION DURING CENTRAL NERVOUS SYSTEM DEVELOPMENT AND POST-INJURY REGENERATION By YING LI A dissertation submitted to the Graduate School-New Brunswick Rutgers, the State University of New Jersey and The Graduate School of Biomedical Sciences In partial fulfillment of the requirements For the degree of Doctor of Philosophy Graduate Program in Biomedical Engineering Written under the direction of Li Cai, Ph.D. And approved by ________________________________________ ________________________________________ ________________________________________ ________________________________________ New Brunswick, New Jersey January 2016 ABSTRACT OF THE DISSERTATION Gene Regulation during Central Nervous System Development and Post-Injury Regeneration By Ying Li Dissertation Director: Li Cai, Ph.D. Central nervous system (CNS) development and post-injury neurogenesis require accurate coordination of neural stem cell proliferation, progenitor cell differentiation, neuron, glia migration and maturation, and synapse formation between axons and dendrites. Such systems with high complexity require strict temporal and spatial control via several levels of regulation, in which the transcription regulation is one of the most critical steps. The developmental and injury-repair process involves over 18,000 genes, for majority of which the molecular mechanism governing their transcription remains largely unknown. In an attempt to address this question, four projects were conducted focusing on two levels of transcription regulation: i.e., chromatin modification, and the interaction of cis-acting regulatory sequences with trans-acting protein factors. Computational methods were adopted to analyze the sequences of the cis-elements and ii make predictions for their interacting transcription factors (TFs). The functional roles of these cis- and trans-elements were further determined in vivo and in vitro.
    [Show full text]
  • Identifying and Mapping Cell-Type-Specific Chromatin PNAS PLUS Programming of Gene Expression
    Identifying and mapping cell-type-specific chromatin PNAS PLUS programming of gene expression Troels T. Marstranda and John D. Storeya,b,1 aLewis-Sigler Institute for Integrative Genomics, and bDepartment of Molecular Biology, Princeton University, Princeton, NJ 08544 Edited by Wing Hung Wong, Stanford University, Stanford, CA, and approved January 2, 2014 (received for review July 2, 2013) A problem of substantial interest is to systematically map variation Relating DHS to gene-expression levels across multiple cell in chromatin structure to gene-expression regulation across con- types is challenging because the DHS represents a continuous ditions, environments, or differentiated cell types. We developed variable along the genome not bound to any specific region, and and applied a quantitative framework for determining the exis- the relationship between DHS and gene expression is largely tence, strength, and type of relationship between high-resolution uncharacterized. To exploit variation across cell types and test chromatin structure in terms of DNaseI hypersensitivity and genome- for cell-type-specific relationships between DHS and gene expres- wide gene-expression levels in 20 diverse human cell types. We sion, the measurement units must be placed on a common scale, show that ∼25% of genes show cell-type-specific expression ex- the continuous DHS measure associated to each gene in a well- plained by alterations in chromatin structure. We find that distal defined manner, and all measurements considered simultaneously. regions of chromatin structure (e.g., ±200 kb) capture more genes Moreover, the chromatin and gene-expression relationship may with this relationship than local regions (e.g., ±2.5 kb), yet the local only manifest in a single cell type, making standard measures of regions show a more pronounced effect.
    [Show full text]
  • Supporting Information
    Supporting Information Portales-Casamar et al. 10.1073/pnas.1009158107 SI Materials and Methods less than 1,000 bp of conserved nonexonic nucleotides (Fig. S2D), The general methods used have been described previously (1). with an average of 330 bp of conserved sequence per gene for Below are only reported modifications or additions specificto genes scoring within the top 20th percentile. this work. Features of genes with the highest, average, and lowest regulatory resolution. The ADCK5 locus was assigned the highest regulatory Regulatory Resolution Score Characterization. Identification of genomic resolution score due to the presence of a single 1,277-bp highly sequence boundaries for regulatory resolution scoring. For regulatory conserved region within the upstream intergenic region (Fig. resolution scoring of each gene in the Ensembl human genome S3A). Two smaller conserved regions directly upstream of database (version 46) (2), we define the transcription start site (TSS) ADCK5 in the “17-Way Most Cons” track are excluded from the as the start position of the 5′-most exon annotated for the gene. We analysis. The larger of the two overlaps with human mRNAs, then determine the boundaries of the region to be analyzed relative wheras the smaller conserved element is only 10 bp long (Fig. to the TSS as follows. In most cases, the upstream boundary is S3A). The low baseline conservation level across the entire region defined as the start/end position of the upstream gene (depending further contributed to the high score. The ELOVL3 locus (Fig. on the upstream orientation of the gene). If the upstream gene is S3B) is an example of an average gene, receiving the mean score less than 1 kb from the TSS of the gene of interest, we extend the of 0.35.
    [Show full text]