ORIGINAL RESEARCH ARTICLE published: 26 June 2012 NEURAL CIRCUITS doi: 10.3389/fncir.2012.00037 Developmental coordination of gene expression between synaptic partners during GABAergic circuit assembly in cerebellar cortex
Anirban Paul 1,Ying Cai 2,3, Gurinder S. Atwal 2 and Z. Josh Huang 1*
1 Cold Spring Harbor Laboratory, Neuroscience, Cold Spring Harbor, New York, NY, USA 2 Cold Spring Harbor Laboratory, Quantitative Biology, Cold Spring Harbor, NY, USA 3 Applied Mathematics and Statistics, Stony Brook University, Stony Brook, NY, USA
Edited by: The assembly of neural circuits involves multiple sequential steps such as the specifica- Edward M. Callaway, California tion of cell-types, their migration to proper brain locations, morphological and physiological Institute of Technology, USA differentiation, and the formation and maturation of synaptic connections. This intricate Reviewed by: David J. Margolis, University of and often prolonged process is guided by elaborate genetic mechanisms that regulate Zurich, Switzerland each step. Evidence from numerous systems suggests that each cell-type, once speci- Yuanquan Song, University of fied, is endowed with a genetic program that unfolds in response to, and is regulated by, California San Francisco, USA extrinsic signals, including cell–cell and synaptic interactions. To a large extent, the exe- *Correspondence: cution of this intrinsic program is achieved by the expression of specific sets of genes Z. Josh Huang, Cold Spring Harbor Laboratory, One Bungtown Road, that support distinct developmental processes. Therefore, a comprehensive analysis of Cold Spring Harbor, New York, NY the developmental progression of gene expression in synaptic partners of neurons may 11724, USA. provide a basis for exploring the genetic mechanisms regulating circuit assembly. Here e-mail: [email protected] we examined the developmental gene expression profiles of well-defined cell-types in a stereotyped microcircuit of the cerebellar cortex. We found that the transcriptomes of Purkinje cell and stellate/basket cells are highly dynamic throughout postnatal develop- ment. We revealed “phasic expression” of transcription factors, ion channels, receptors, cell adhesion molecules, gap junction proteins, and identified distinct molecular pathways that might contribute to sequential steps of cerebellar inhibitory circuit formation. We fur- ther revealed a correlation between genomic clustering and developmental co-expression of hundreds of transcripts, suggesting the involvement of chromatin level gene regulation during circuit formation.
Keywords: cerebellum, circuit assembly, development, GABAergic, gene expression, microcircuit, Purkinje cell, stellate basket cell
INTRODUCTION All cerebellar neurons derive from progenitors that prolifer- The cerebellum, a primary center for motor coordination, is an ate in two germinal neuroepithelia: the ventricular zone (VZ) excellent system to study neural circuit assembly in the CNS due generates GABAergic neurons, whereas the rhombic lip is the to its highly stereotyped cytoarchitecture. For example, the cere- origin of glutamatergic neurons. Among VZ-derivatives, GABAer- bellar cortex is organized as a near lattice-like circuit architecture gic projection neurons and interneurons are generated according with a protracted period of circuit formation. At the focal position to different strategies. PC are produced at the onset of cerebel- in cerebellar cortex and as its sole output are the Purkinje neurons, lar neurogenesis by discrete progenitor pools located in distinct which receive multiple sets of excitatory and inhibitory inputs. The VZ microdomains; they are specified within the VZ and acquire glutamatergic parallel fibers synapse onto the slender spines of the mature phenotypes largely according to cell-autonomous pro- distal dendrite, while the climbing fibers prefer the stubby spines grams. On the other hand, the different classes of inhibitory of the more proximal dendrite. In addition, the GABAergic bas- interneurons, including basket (BkC) and stellate (StC) cells, ket interneurons target Purkinje cell (PC) soma and axon initial derive from a single population of precursors that delaminate segments (AIS), whereas the stellate interneurons innervate the into the prospective white matter (PWM), where they continue dendritic shafts. The integration of these excitatory and inhibitory to divide until the end of the first postnatal week (Altman and inputs shapes PC outputs, which are transmitted to deep cerebel- Bayer, 1997; Leto et al., 2012). lar nuclei and regulate motor coordination (D’Angelo et al., 2011). Following their generation in the PWM, basket, and stellate While significant progress have been made in understanding the cells migrate toward cerebellar cortex and reach Purkinje cell layer development of excitatory connectivity (i.e., parallel fibers and (PCL) by approximately P7 and P10, respectively. During the climbing fibers), the development of inhibitory circuitry remains subsequent weeks, PC, BkC, and StC undergo profound morpho- poorly understood. logical and physiological differentiation while establishing specific
Frontiers in Neural Circuits www.frontiersin.org June 2012 | Volume 6 | Article 37 | 1 Paul et al. Cell-type-specific transcriptome during circuit assembly
synaptic connectivity (Cameron et al., 2009). For example, the amplified by two rounds of linear isothermal amplification steps PCs elaborate their dendrites with characteristic branching pat- using the MessageAmpII aRNA amplification kit (Ambion, USA terns while the BskCs extend their axon branches onto PCs. Each Cat#AM1751) followed by biotin labeling. BskC innervates 7–10 PCs at their soma and AIS (Figure 1A). The maturation of BskC axon arbor and pinceau synapses con- GENE EXPRESSION tinue into the fourth postnatal week (Ango et al., 2004, 2008). Labeled aRNA were hybridized to Affymetrix mouse 30 expres- The development of StCs lags behind that of BskCs by a few days. sion array MOE430.2 according to manufacturers fluid han- StC axons extend along the Bergmann glia fibers with characteris- dling, hybridization, and scanning protocols. CEL files from each tic trajectories to innervate PC dendrites. Using a candidate gene hybridization was converted to normalized expression values using approach, we have previously demonstrated that members of the Bioconductor package1 in R2 using GCRMA method. Further L1 family immunoglobulin cell adhesion molecules (IgCAMs), differential analysis, Principal Component Analysis (PCA), cross- neurofascin, and CHL1, contribute to the subcellular organization correlation analysis, and downstream visualization was done in of BskC and StC innervation,respectively (Ango et al.,2004,2008). dCHIP software3. Microarray data submitted to GEO; accession However, the genetic mechanisms that control the concerted dif- GSE37055. ferentiation and synaptic connectivity during inhibitory circuit formation remain poorly understood. IN SITU HYBRIDIZATION To explore the intrinsic genetic program that direct the dif- To generate in situ probes Trizol extracted total mouse brain RNA ferentiation and connectivity between PC and BskC/StC(S/BC) was used to perform RT-PCR using gene specific primers (Super- cells, here we examined the developmental dynamics of their spe- script III, Invitrogen, USA). RT product was subjected to nested cific gene expression profiles. We found (i) phasic developmental PCR with T3 tagged forward and T7 tagged reverse primers (see expression of transcription factors (TFs), ion channels, recep- primer list in Table A2 in Appendix). In vitro transcription using tors, cell adhesion molecules (CAMs), gap junction proteins, and with T7 and T3 driven RNA polymerase and DIG-labeled rNTPs novel cell-type specific transcripts,(ii) distinct molecular pathways generate the probes that was run on Bioanalyzer to ensure sin- that may contribute to different developmental stages for these gle RNA product of expected size. T7 produced antisense probes cell-types; (iii) correlation between genomic clustering and devel- and T3 generated the control sense probes. In situ hybridization opmental co-expression of hundreds of transcripts, suggesting the was performed at 61˚C on 15 µm thick sagittal cryo-sectioned involvement of chromatin level gene regulation during circuit for- brains from C57B6 male animals. Detection was done using anti- mation. Our dataset also provides a valuable resource for further DIG antibody and VectaRed detection reagent (Vector Labs, USA studying the molecular and developmental genetic mechanisms Cat#SK-5100). underlying cerebellar circuit formation. PERMUTATION TEST MATERIALS AND METHODS Permutation test was performed on normalized expression values MANUAL SORTING of PC and S/BC cells to find genes that are differentially expressed Amplified and labeled mRNA were prepared from 50 to 75 PC or across different time points. For each probe, a t-statistic T obs was between 125 and 150 S/BC cells that were manually sorted from computed as each developmental stage. While PCs are 40 µm in diameter and lie along the PCL the StC and the BskC are both 8–10 µm in diam- (Xi) − Xj Tobs = r 2 eter and are distributed in the molecular layer. Although the BskC S2 S i + j cell bodies lie relatively closer to the PC it is not always apparent ni nj since StC and BskC are not uniformly distinct in layer separation. Also there is no molecular marker that distinguishes Bsk from Where
Frontiers in Neural Circuits www.frontiersin.org June 2012 | Volume 6 | Article 37| 2 Paul et al. Cell-type-specific transcriptome during circuit assembly
equal to 10,000. Then the permutation p-value was calculated as loci, though they are not necessarily consecutive. In our analysis, a the following formula. co-localized gene cluster can be detected computationally if some genes that are significantly differentially expressed at a time point p = # {b : |Tm| > |Tobs |} M are within three ORF distances of each other and on the same chromosome. We used our algorithm to scan the chromosomes The above procedures were applied to all probes at each time of Mus musculus using window lengths of three genes, advanc- point to calculate p-values. Raw p-values were adjusted by false ing one gene between two instances of the window so that all discovery rate (FDR) approach to account for multiple hypothe- possible three-gene windows were tested. Consecutive statistically ses testing by controlling the proportion of false positive (Storey significant windows were merged up in only one cluster. Then a and Storey, 2002; Storey, 2003). This approach determines a q- permutation test was used to evaluate whether these significantly value for each test. It controls the number of false discoveries in differentially expressed genes impose a stronger clustering ten- those test that result in a discovery (i.e., a significant result). In dency than would be expected by chance. In such a test,we counted our analysis, any probes with q-values <0.05 were considered as how many clusters can be identified among our co-regulated genes significantly differentially expressed. Then IDs of these probe set at a time point, then repeated the clustering analysis on 10,000 sets were converted to gene symbols. of genes that were randomly selected in the genome to find out how many clusters could be obtained by chance. In the entire dis- PRINCIPAL COMPONENT ANALYSIS tribution of the number of clusters for 10,000 random gene sets, Principal Component Analysis projects multivariate data objects the p-value of clustering tendency can be defined by the portion of onto a lower dimensional space while retaining as much of the cluster numbers that are larger than the cluster number in signif- original variance as possible. Replicates were averaged to obtain icantly expressed genes. It can be expressed as following formula, one vector of expression values for each time point in development for m = 1, ... M, where M is number of random permutations. In and regeneration. We used PCA to project the seven PC and five this study, we set M equal to 10,000, T obs is the number of cluster S/BC samples of the development time series, each consisting of observed in our data, and T m is that number of cluster in random 45,101 variables (probe sets), into a two-dimensional plane. PCA gene sets. Then the permutation p-value was calculated as operation was performed using dCHIP and the first two principal components are plotted. The class labels are used to color the sam- p = # of {|Tm| > |Tobs|} M ples but do not enter the PCA analysis. Each principal component is a linear transformation of the expression values of all genes in a For visualization of co-expressed and co-localized regions gene list. So in effect PCA maps samples in high N dimension (N using UCSC genome browser co-ordinates have been provided as is the number of genes) to two dimension, maximizing the space individual text files in BED format in the Supplementary Material. among the samples. PROMOTER SCANNING PATHWAY ENRICHMENT ANALYSIS PSCAN6 Ver1.2.1 was used for promoter scanning selecting a Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway region −450 to +50 of the input genes using motif descriptors enrichment analyses for significant genes at each time point were from JASPAR database7. The JASPAR CORE database contains a carried out using the DAVID tool4. Pathways with enrichment p- curated, non-redundant set of profiles, derived from published values <0.05 were considered as significantly enriched. Pathway collections of experimentally defined TF binding sites for eukary- enrichment analyses were performed separately for genes with the otes. For promoter scanning algorithm refer to Zambelli et al. different expression pattern (upregulation or down-regulation). (2009). Genes were considered as upregulated at each time point if the mean of expression values of replicates at one time point is larger RESULTS than the mean of replicates from all other time points, vice versa GENE EXPRESSION PROFILES DISTINGUISHES DIFFERENT GABAergic for down-regulation. The p-values of enriched pathways for both CELL POPULATIONS upregulated and down-regulated genes were combined together to The G42 transgenic GFP reporter line labels PCs, BskCs, and StCs form a p-value matrix. Each element of this matrix represented the throughout their postnatal development (Ango et al., 2004). We p-values of an enriched pathway at a certain time point. The trans- used G42 and a manual sorting procedure (Sugino et al., 2006) to formed p-value matrix was used to construct a heat map using purify BskC and StCs together (S/BCs, see Materials and Methods a Pearson correlation metric with hierarchical clustering using for details) and PCs from the cerebellar cortex from the first to the R5. Two colors were utilized specifically for pathways containing eighth postnatal week. The first time point for PC is P3, soon after upregulated and down-regulated genes. the PCL is formed and the first time point for S/BCis P14 because they do not complete their migration until the second postnatal GENOMIC CO-LOCALIZATION AND CO-EXPRESSION week. Total RNA from ∼50 PC and ∼150 S/BC were amplified by A set of co-regulated genes on the same chromosome in the two rounds of linear amplifications followed by hybridization to genome can be defined to be co-localized at a certain genomic Affymetrix mouse expression array 430.2. At least three biological
4http://david.abcc.ncifcrf.goc/home.jsp 6http://159.149.109.9/pscan/ 5http://www.rproject.org 7http://jaspar.binf.ku.dk/
Frontiers in Neural Circuits www.frontiersin.org June 2012 | Volume 6 | Article 37| 3 Paul et al. Cell-type-specific transcriptome during circuit assembly
replicates were analyzed for each developmental time point for whereas mTOR signaling is involved in local protein synthesis in each cell-type. LTP (Kelleher et al., 2004). The apoptosis pathway was upregu- We performed a PCA (Raychaudhuri et al., 2000) on all post- lated at P14 perhaps reflecting the known developmental death synaptic protein transcripts, GABAergic transcripts as well as the of a subset of PC cells (Dusart et al., 2006). Between P28 and top 1500 highly altered probesets (1943 probesets, 4.2% of total 56, the upregulation of pathways related to “CAMs,”“chondroitin that showed changes in expression greater than 1 standard devi- sulfate biosynthesis,” “focal adhesion,” “cytokine–cytokine recep- ation of mean) across all samples. PCA clearly distinguished PCs tor interaction,” and “extracellular matrix receptor interaction” and S/BCs between ages P14–56, whereas P3 and P7 PCs formed (ECM-interaction) correlate with the maturation and stabilization a separate cluster (Figures 1B–D). Such distinction was abolished of PC connectivity. when unrelated transcripts such as all B-cell activation, blood In S/BCs a number of similar pathways are also activated but glycolipid biosynthesis, or glial expressed transcripts were used delayed compared to PC (Figures 2A,B). For example, “axon (Figures 1E–G). Gene expression profiles were compared between guidance,” “tight junction,” “adherens junction,” “insulin signal- all stages to derive a correlation matrix that indicate the over- ing,” “ErbB,” and “spliceosome” pathways were upregulated in all degree of similarity or relatedness between any two samples P14S/BCs, reflecting the delayed axogenesis of BskC and StC after during circuit development. Gene-wise standardized expression they enter the ML during the second postnatal week. However values of TFs, CAMs, and GABA transmission transcripts were between P28 and 35, similar to PC cells, pathways of “ECM- used to compute the Pearson correlation coefficients between two receptor interaction,”“CAMs,”“cytokine–cytokine receptor inter- samples and the matrix containing all the values were plotted as a action,”“neuroactive ligand receptor interactions,”and“regulation heatmap where the X and Y axis denotes the individual samples of cytoskeleton” were activated; these correlate with the synaptic from each developmental stage. Developmentally PC and S/BC can maturation and consolidation when BskCs elaborate and main- each be segregated into two broad groups based on their expres- tain pinceau synapses to the AIS of PC (Ango et al., 2004) and StC sion of TFs and CAMs (Figures 1H,I) by cross-correlation analysis. make multiple synaptic connections to PC dendrites (Ango et al., Furthermore, the GABAergic transcripts parsed the developmen- 2008). tal trajectory of PCs into three distinct epochs: P3–7, P14–21, and P28–56; the same analysis parsed S/BC trajectory into two CORRELATION BETWEEN CO-EXPRESSED GENES AND THEIR epochs: P14–21 and P28–56 (Figure 1J). Compared to PC, the CHROMOSOME CO-LOCALIZATION S/BC developmental profile are less robust probably due to the Several studies have shown that genes that are co-regulated tend less homogeneous nature of this population. Our cell-type spe- to localize as “clusters” along the chromosome (Boutanaev et al., cific gene expression profiles could readily distinguish the PCs and 2002; Blanco et al., 2008). We therefore examined whether there is S/BCs and further capture the distinct developmental epochs as a correlation between developmental co-regulation and genomic they engage in circuit formation. co-localization in our dataset in PCs and S/BCs. We define a cluster as a set of co-regulated transcripts (upregulated, down- TEMPORAL EXPRESSION PROFILES CAPTURE ELEVATED BIOLOGICAL regulated, and up- and down-regulated with the same develop- PATHWAYS AT DIFFERENT DEVELOPMENTAL STAGES mental profile) located within three ORF distances of each other. We conducted pathway enrichment analysis using KEGG data- The number of the clusters detected in co-regulated genes was base based on developmental gene expression of PCs and S/BCs significantly higher than that would be expected by chance. In (Figure 2A). Interestingly, a number of common biological path- total we detected 4640 clusters in PCs across seven developmen- ways were elevated in both cell populations, but with different tal stages and 1657 in S/BCs across five stages (Figure 3A). The developmental timing that appears to correlate with their dif- clusters varied from 2 to13 genes with a size range from 194 Kb ferent maturation profiles. For example, between P3 and P7 in to 1.37 Mb, with an average of 279 (±79) Kb for PCs and 219 PCs pathways of “axon guidance,”“regulation of actin cytoskele- (±56) for S/BCs (Figures 3B,C). Surprisingly, more clusters were ton,” “gap junction,” and “tight junctions” is highly upregulated identified in the early postnatal ages (combined 2229 clusters in indicating the early steps of circuit integration by PC. This is P3 and P7 PC; 1160 clusters in P14 S/BC) and at adult stage P56 accompanied by an upregulation of other pathways (Figure 2A) (1896 and 440 clusters in PC and S/BC respectively) compared such as insulin signaling, TGF-beta, Hedgehog, and Wnt which to intermediate stages (P21–P35; Figure 3A). Despite the highly are important for axon guidance (Song et al., 2003; Charron correlated expression of TFs, CAMs, and GABAergic transcripts and Tessier-Lavigne, 2007; Scolnick et al., 2008). Upregulation of seen in PCs an S/BCs between P21 and 35 (Figures 1E–G) we GnRH signaling that has an modulatory effect on cerebellar neu- found the co-transcribing genes were not significantly genomically rons (Albertson et al., 2008) and P53 signaling which is important co-localized. for PC survival (Gavino and Richard, 2011) was also observed Within the same cell-type such as PC, 418 gene clusters main- during this time. In P14PCs,pathways related to“long-term poten- tained their co-expression between P3 and P7 (Figure 3D). KEGG tiation,”“long-term depression,”“JAK/STAT,”“VEGF,”and“mTOR pathway analysis of these stable gene pairs identified“regulation of signaling” were elevated, which correlate to the development of actin cytoskeleton,”“pentose phosphate pathway,”and “ribosome” parallel fiber synapses. The JAK/STAT,VGEF pathway is in general to be enriched (Table A1 in Appendix). Interestingly, in both PCs associated with postnatal brain development, differentiation, and and S/BCs from P21 to P35 few or no such stable clusters were survival but recently are also implicated in NMDAR-LTD (De- detected, but these clusters re-emerge at later ages. For example in Fraja et al., 1998; Storkebaum et al., 2005; Nicolas et al., 2012) PC, 234 gene pairs were conserved between P3 and P56 stages and
Frontiers in Neural Circuits www.frontiersin.org June 2012 | Volume 6 | Article 37| 4 Paul et al. Cell-type-specific transcriptome during circuit assembly
A 5.01E - 5.31 5.71E - 0P P3 7P P14 P21 P28, P35, P56
pia
ML
EGL
PCL PCL IGL IGL
VZ/PWM
Deep cerebellar nulcei Inferior Olive Granule cell Purkinje cell Basket cell Stellate cell
B llA stpircsnart htiw 1>DS C citpanys-tsoP stpircsnart D cigreABAG stpircsnart 80 10
10 60
P03 P28 P07 P03 P28 40 P03 5 P56 P28 P07 5 P28P28 P28 P28 P07 P21 P28 P35 P21 P21 P35 P14 P56 P35 P21 P56 P35 P21 20 P14 P56 P21 P14P14 P56 P14 P14 P14 P56P56 P14 P14 P35 P28 P56 P56 P35 P21 P56 P21 P21 P56 P14 P56 P35 P21 P56 P56P21 P28 0 P35 P14 P14 0 P35 0 P21 P28P35 P14 P35P56 P28 P21 P35 P28 P56 P28 P28 P56 P28 P35 P35 P14 P56 P21 P28 P14 P28P21 P14 P21 P35 P14 P28P28P35 P21 P14 P21 P21 P21 -20 P21 P14 P14 P35 P14 P07 P35 P07 P35 P03 principalcomponent 2 P28 P28 principalcomponent 2 principalcomponent 2 -5 P28P28 P07 -40 -5 P03 P07 P03 P56 P07 P56 -60 P07 P56 P03 -10 P03 P03 -80 -10 -80 -60 -40 -20 0 20 40 60 80 -10 -5 0 5 10 -10 -5 0 5 10 principal component 1 principal component 1 principal component 1
E llec-B noitavitca stpircsnart F doolB dipilocylg sisehtnysoib stpircsnart G lailG stpircsnart 10 10
10
5 5 5
P21P35 P56 P56 P14 P21 P03 P14 P14P14P28 P35 P56P14P21 P56 P07 P14 P21 P07 P14 P28P56 P28 P21P35 P07 P03 P07 P28 P14 P21P21P35 P07 P35P21P56P21P28P21 P03 P56 P07 P56 P56P35P28P28 P03 P07 P14 P28 0 P35 P14P14 P28P28 P03 0 P03 P14 P35P35 0 P03 P35P14 P56P56P35P35P56 P14 P14P21P21P21 P21P56 P35P03 P28 P14 P14 P28P21P28P35P56 P14P03 P21P56P07 P28 P14P35P56 P28 P07P35 P21P56 P28 P28 P28 P28P14 P56 P21P35 P21 P21 P35P35 P28 P56 P14 P35P28 P56 P56 P28 P21 principal component 2 principalcomponent 2 principalcomponent 2 -5 -5 -5
-10
-10 -10 -10 -5 0 5 10 -10 -5 0 5 10 -10 -5 0 5 10 principal component 1 principal component 1 principal component 1
H Transcription factors I Cell-adhesion molecules J GABA transmission PC S/BC PC S/BC PC S/BC 03 07 14 21 28 35 56 14 21 28 35 56 03 07 14 21 28 35 56 14 21 28 35 56 03 07 14 21 28 35 56 14 21 28 35 56 30 42 83 61 12 556 35 28 21 14 56 35 28 21 14 07 03 30 42 83 61 12 556 35 28 21 14 56 35 28 21 14 07 03 30 42 83 61 12 556 35 28 21 14 56 35 28 21 14 07 03 CS/BC PC PC CS/BC PC S/BC
0.1--0.75 -0.5 -0.25 0 0.25 0.5 0.75 0.1 0.1- -0.75 -0.5 -0.25 0 0.25 0.5 0.75 0.1 0.1--0.75 -0.5 -0.25 0 0.25 0.5 0.75 0.1
FIGURE 1 | Cell-type and developmental stage-specific gene expression (SD > 1 of mean, p < 0.05) across all time points can clearly segregate PCs profiles in PC and S/BC. (A) Schematic representation of the anatomical (blue) and S/BCs (red) (B). PCA based on all postsynaptic protein transcripts changes during cerebellar development with emphasis on the postnatal (C), encoding membrane proteins such as ion channels, cell adhesion stages. (B-D) PCA on all samples. Transcripts that changed significantly (Continued)
Frontiers in Neural Circuits www.frontiersin.org June 2012 | Volume 6 | Article 37| 5 Paul et al. Cell-type-specific transcriptome during circuit assembly
FIGURE 1 | Continued also subdivided into P14–35 and P56 (H). Cell adhesion molecules molecules, and cell-surface ligand receptors; GABAergic transcripts divides the PC into two broad groups P3–P7 and P14–P56 and further (D) can segregate PCs and S/BCs, Non-specific B-cell activation subdivides the later into 3 epochs (P14–P21, P28–P35, and P56). S/BCs transcripts (E), Blood glycolipid biosynthesis (F), and Glia expressed are also subdivided into 3 epochs P14–P21, P28–P35, and P56 (I). transcripts (G) fails to segregate the samples according to cell-types. GABAergic transcripts subdivide the PCs into three epochs P3–P7, (H–J) Cross-correlation analysis across all samples captures several P14–P21, and P28–P56. S/BCs are roughly split into 2 classes P14–P21 developmental epochs in each cell-type. Transcription factor transcripts and P28–P56. GABAergic transcripts comprised of all murine GABA parse the PC into two distinct P3–P7 and P14–P56 epochs. S/BCs are receptors and transporters (J).
FIGURE 2 | Pathway enrichment analysis of developmentally developmental stages that are either upregulated (red), down-regulated co-regulated transcripts in PC and S/BCs. (A) Pathways enriched at (blue), or non-significant enrichment (gray). (B) Comparison between PC and specific developmental stages in PCs (left) and S/BCs (right). Each colored S/BCs shows delayed elevation of pathways involved in early postnatal box represents significant p-values of the associated pathway across the development in S/BCs.
311 between P7 and P56 (Figure 3E). Furthermore, we also identi- MOLECULAR SIGNATURES OF DEVELOPING PCs AND S/BCs fied conserved and co-expressed gene clusters between cell-types, We examined whether different classes of genes are coordinately such as 212 common gene pairs between P14 S/BCs and P3 PCs expressed in PCs and S/BCs that correlate with their developmental as well as157 pairs between P14 S/BCs and P7 PCs (Figure 3F). and physiological phenotypes. However, 119 common gene pairs were found between mature PCs and S/BCs at P56 (Figure 3G). It is possible that these co- GABA transmission transcripts expressed genomic clusters may constitute common “regulatory In PC cells, we detected the known sharp changes in GABA(A) modules” across cell-types that encode components of functional receptor subunits (a shift from α2 to α1) between P7 and P14 pathways and are subjected to chromatin regulation during neural (Figures 4A1 and A2 in Appendix), with a simultaneous upregu- development and the relatively lower common clusters between lation of α2 at P14 followed by increase in α4 transcript. These tem- cell-type in adults reflects the post-maturation state. poral patterns correlate with the increase of GABAergic synaptic
Frontiers in Neural Circuits www.frontiersin.org June 2012 | Volume 6 | Article 37| 6 Paul et al. Cell-type-specific transcriptome during circuit assembly
A B C PC PC S/BC S/BC
PC S/BC
D Chr:14 P3 PC P7 UCSC genes
Chr:17 P3 PC P7 UCSC genes
E Chr:5 P3 PC P7 P56 UCSC genes
Chr:12 P3 PC P7 P56 UCSC genes
F Chr:8 P3 PC P7 S/BC P14 UCSC genes
Chr:13 P3 PC P7 S/BC P14 UCSC genes
G Chr:14 PC P56 S/BC P56 UCSC genes
Chr:7 PC P56 S/BC P56 UCSC genes
FIGURE 3 | Co-expressed transcripts are often co-localized on the and ending ORFs in UCSC genome browser (see UCSC track files in BED genome. (A) Distribution of total number of co-expressed and co-localized formatTable S1 in Supplementary Material for PC andTable S2 in transcript between PC and S/BCs during development. (B) Frequency Supplementary Material for S/BC). Certain cluster groups are stable between distribution of the different co-localized clusters. (C) Size distribution of developmental stages P3 and P7 in PCs [(D), see alsoTableA1 in Appendix]. different co-localized clusters in PC and S/BCs. Average size of all clusters Co-localized clusters can re-emerge in late-developmental stages as shown in across all time points for PC and S/BCs shown in inset. (D–G) Representative PC cell by comparing the P3 and P7 time points with P56 (E). Representative chromosomal distribution of co-localized and co-expressed transcripts at common clusters across cell-types during early postnatal developmental specific developmental stages. The region harboring co-expressed and stage (F). Few such clusters are common between cell-types in late-adult co-localized clusters are depicted as black bar spanning across the starting stages suggesting the maintenance of a “locked-in” differentiated state (G).
Frontiers in Neural Circuits www.frontiersin.org June 2012 | Volume 6 | Article 37| 7 Paul et al. Cell-type-specific transcriptome during circuit assembly
innervation and transmission from BskCs and StCs during this developmental expression of CAMs in PCs and S/BCs might con- period. Gabra4 is known to be responsive to positive GABA tribute to the formation, maturation, and maintenance of pre- and modulatory neurosteroids (Zhou and Smith,2009),mediate extra- post-synaptic components (Figures 4B2,B3). In S/BCAstn1,impli- synaptic inhibition (Chandra et al., 2006), and has been implicated cated in neuronal migration (Zheng et al., 1996), peaked at P14 in regulating inhibitory tone (Smith and Gong, 2005). In S/BCs, which correlates with their migration during this period. Interest- the Gabrb3 subunit is upregulated at P21 followed by Gabra3 and ingly cadherins and protocadherins showed interesting temporal the extra-synaptic receptors Gabre and Gabrq at P35. The high- patterns as well and we also found developmental co-expression of affinity Gabrb3 (GABA-A b3) is also extra-synaptic and is involved the same cadherins (e.g., Cdh10 and Cdh22) and protocadherins in slower tonic inhibition, affecting neuronal excitability, and net- (e.g., Pcdh20, Pcdh7, and Pcdh9) between PC and S/BC. work activity (Huntsman et al.,1999; Nusser et al.,2001; Hentschke et al.,2009). Finally at P56 Gabrb1,Gabra4,Gabrg1 are upregulated Glutamate receptors (Figure 4A3). Past studies suggested the absence of functional NMDA recep- tors in PC cells (Farrant and Cull-Candy, 1991; Llano et al., Cell adhesion molecules 1991), however in agreement with recent observations we detect CAMs are expressed in two broad groups in PCs and S/BCs, the expression of Grin2b between P3 and 7, Grin2a and Grin2c respectively (Figure 4B1). In PC, Cdh13, and Cdh4 are expressed between P14 and 35 and the obligatory Grin1 from P14 onwards during the early postnatal stages; Col18a1, Bcar1, Cntnap2, Aatf, in PC (Casado et al., 2002; Piochon et al., 2007, 2010; Renzi et al., Adam23 continue expression up until P56. Nid1, Cd9, Mfged8, 2007; Bidoret et al., 2009; Figure 4C). In S/BCs we further detected and Mia1 are restricted to S/BC. In situ data on eight transcripts in specific expression of Grin3a and Grin3b subunits, which are the Allen Brain Atlas (ABA) developmental mouse ISH database8 known to have atypical channel properties (Sucher et al., 1996; matched our findings (Figures A1 and A2 in Appendix). Distinct Matsuda et al., 2002; Figure A3 in Appendix). Metabotropic glu- tamate receptorsGrm1 and Grm7 are expressed at high levels in PC 8http://developingmouse.brain-map.org/ whereas S/BC expressed Grm3 between P14 and 56 (Figure 4D),
FIGURE 4 | Cell-type specific phasic temporal profiles of several molecules (CAMs) transcripts, (B2,B3) PC and SB specific individual classes of transcripts. (A1) Cell-type specific GABAergic profiles are shown. (C) Cell-type specific expression of NMDA transcripts between cell-types, (A2,A3) PC and SB individual receptors, (D) AMPA receptors, (E) Calcium channels, and (F) Gap temporal profiles are shown. (B1) Cell-type specific cell adhesion junction molecules.
Frontiers in Neural Circuits www.frontiersin.org June 2012 | Volume 6 | Article 37| 8 Paul et al. Cell-type-specific transcriptome during circuit assembly
which has a relatively weaker expression in StC compared to Golgi best studied in immune system and chondrocytes differentiation cells (Ohishi et al., 1993; Figure A3 in Appendix). The functional (Horsley and Pavlath, 2002) but their role in neuronal differen- significance of these expression patterns should be examined by tiation is less clear. On the other hand at least five TFs appear electrophysiology experiments. S/BC specific, Sox1, Sox2, Klf4, Epas1, and Rorb. The postmitotic expression of Sox1, Sox2, Myst4, and Klf4 transcripts in S/BC is Calcium channels surprising as they maintain neuronal progenitor identity and neu- We found high level expression of Cacna1a (Westenbroek et al., rogenesis in early development (Graham et al., 2003). However 1995), Cacna1g (Talley et al., 1999), Cacna1h, and Cacnb4 tran- recent evidence suggest that continued postmitotic expression of scripts in PCs (Figure 4E; Figure A4 in Appendix). While the P/Q Sox1 is necessary for maintaining cell-fate (Ekonomou et al.,2005). type calcium channel Cacna1a (Cav2.1) is characteristic of PC We also detected 35 TFs that had early (P3–P7) expression in PC (Hashimoto et al., 2011), the T-type channels (such as Cacna1g or, but later became specifically enriched in S/BC from P14 to P56; Cav3.1 and Cacna1h or, Cav3.2) are expressed in cells with pace- these includeTcfap2b, Btbd11, Esrrg, Klf12, and Egr1 which showed maker activity (Yunker et al., 2003; Engbers et al., 2012), can play a high level and tightly restricted expression. key role at the AIS in generating spike bursts (Bender and Trussell, We noticed co-expressed transcripts in virtually all- 2009) and implicated in rebound potentiation of inhibitory synap- developmental stages of PC and S/BC, suggesting the possibil- tic signals in cerebellar PCs (Kano et al., 1992; Tempia and Kon- ity that these transcripts may be regulated by common TFs nerth, 1994; Cueni et al., 2009). On the other hand, the expression (Figure 5B). We reasoned that by scanning promoters of co- of L-type calcium channel subunits Cacna1c, Cacna1d, and associ- expressed genes for known TF binding motifs we could identify ated gamma subunit Cacng4 appear restricted to S/BCs. Cacna1c the relevant TFs in PCs and S/BCs. We investigated upstream (Cav1.2) and Cacna1d (Cav1.3) are often co-expressed in the (−450 bp) and immediate downstream (+50 bp) regions relative same cell on dendrites and dendritic spines with slow activa- to the transcription start site for statistically significant enrichment tion kinetics and large conductance (Lipscombe et al., 2004). They of TF binding sites using PSCAN (Zambelli et al., 2009) that looks regulate a multitude of neuronal processes including gene expres- for over-represented binding motifs from public JASPAR database sion, neuronal survival, synaptic efficacy, suppressing spontaneous (Sandelin et al., 2004; Bryne et al., 2008). In S/BCs, we found 13 intracellular calcium oscillations, and slow rhythmic firing. TFs at P14 and 6 TFs at P56. In PCs, we found two TF at P14 and four TFs at P56 (Table 1). We were limited by motif database (130 Gap junction proteins TF for mouse), which is a fraction of the currently known 1675 Gap junctions create a direct cytoplasmic connection between mouse TFs from the Riken-TFdb. Cross comparison against our neurons and form electrical synapses that contribute to various microarray data revealed that seven TFs predicted by PSCAN were network rhythmic activities (LeBeau et al., 2003; Middleton et al., also detected in microarray to be S/BC specific:Egr1 at both P14 2008). We found gap junction transcripts Sgsm3 (Rutbc3) and and 56; Elk4 at P14; Zfx, Sp1, Klf4, and Tcfap2a at P56 (Figure 5C). Gja8 (CX50) in PCs, and Tjp2 and Gjc3 in S/BC at adult stages In PCs, Gabpa expression was in agreement with P56 microarray (Figure 4F; Figure A4 in Appendix). Gjd2 (CX36), Gjc1 (CX45), data. Gjb3, and Panx1 are expressed in PCs in the first week and in S/BCs from P14 onward. CX36 and CX45 shape the spontaneous firing NOVEL SUBTYPE SPECIFIC TRANSCRIPTS IN STELLATE/BASKET CELLS during retina development (Blankenship et al., 2011) and might We detected not only genes previously shown to be expressed in play a similar role in cerebellar circuit formation. PCs and/or S/BCs (Figure 6A), but also novel S/BC specific tran- We found co-expression of GABA-B receptors, mGluR1, P/Q scripts. For example, while the Kit ligand (Kit-l) was known to be type and T-type calcium channels, and cytohesins in PC. Inter- expressed in PCs, we found that the transcript for its receptor, the estingly postsynaptic GABA-B receptors, P/Q and T-type can Kit oncogene (c-Kit), was restricted to S/BCs (Morii et al., 1992), functionally interact with mGluR1-mediated excitatory transmis- suggesting the involvement of this ligand receptor system in PC- sion at PF-PC synapses (Hirono et al., 2001; Gugger et al., 2012), S/BC interactions. In S/BCs, we found 38 new transcripts, of which where as cytohesins, a group of guanine nucleotide exchange fac- 19 are not expressed in PCs (Figure 6A). Eight of these were vali- tors (GEFs), also forms a postsynaptic complex with mGluR1 dated (Figures 6B–J) by in situ hybridization. These appear to be (Kitano et al., 2003). primarily expressed in basket cells and could potentially serve as specific markers. Acam and Arhgap21 signal was not appreciably DIFFERENTIAL EXPRESSION OF TRANSCRIPTION FACTORS BETWEEN down-regulated at P56 in S/BC compared to earlier stages which CELL-TYPES could be due to the chromogenic detection method that causes a We queried 1266 out of 1675 non-redundant TFs (∼75.5%) from loss in dynamic range. the Riken Transcription Factor Database (TFdb; Kanamori et al., 2004) in our expression dataset and found 79 to be differen- DISCUSSION tially expressed between PCs and S/BCs and during development Previous studies have assayed gene expression of whole cerebellum (Figure 5A). Twenty-nine TFs were highly expressed in PCs, such using tissue homogenates (Kagami and Furuichi, 2001; Kanamori as Ebf1 (Olf1), Ebf2, Ebf3 (Malgaretti et al., 1997; Croci et al., 2006), et al., 2004; Sato et al., 2008). Due to cellular heterogeneity, these Lhx1 (Zhao et al., 2007), FoxP2 (Fujita and Sugihara, 2012), and results are difficult to interpret in the context of cerebellar circuit Plagl1 (Zac1; Chung et al., 2011). Other PC restricted TFs are novel organization and development. Individual neuron types are both such as Fem1c, Sh3d19, Aatf, Ankrd6, Ank1, Otf1 (Pou2f1), Gas7, the building blocks of neural circuits and the basic units of gene Nfatc2 (Nfat1),Nptxr (Npr),Gtf2h4,and Bcll2a (Ctip1). NFATsare regulation. Here we purified two major GABAergic cell-types of
Frontiers in Neural Circuits www.frontiersin.org June 2012 | Volume 6 | Article 37| 9 Paul et al. Cell-type-specific transcriptome during circuit assembly
FIGURE 5 | Cell-type specific expression ofTFs. (A) Phasic transcripts at each time points in both PC and S/BCs. (C) Promoter expression of TFs between PC and S/BCs. (B,C) Identification of scanning for binding motifs of temporally co-regulated transcripts cell-type specific TFs by promoter scanning of co-regulated transcripts correctly identifies S/BC and PC TFs that match with cell-type specific during development. (B) Observed cell-type specific co-regulated microarray data. the cerebellar cortex and measured the developmental progression ribosomal proteins but often require careful optimization of speci- in their transcriptomes from neonatal to mature ages. ficity and pooling of multiple tissue samples (Heiman et al., 2008; Several methods have been used to achieve cell-type-based Sanz et al., 2009). Manual sorting has the advantage that even a gene expression profiling in mice through cell specific expres- small number or fraction of fluorescence-labeled neurons among sion of fluorescence reporters (e.g., FACS, manual sorting) or dissociated cells can be visually identified and purified. Compared molecular tags (e.g., TRAP, Ribo-Tag; Okaty et al., 2011). The with FACS, manual sorting exerts less physical manipulation of TRAP and Ribo-Tag methods allow direct immunoprecipitation dissociated neurons and allows direct evaluation of the sorting of cell specific mRNAs from tissue homogenates using GFP-tagged process by the experimenter. For example, although there are no
Frontiers in Neural Circuits www.frontiersin.org June 2012 | Volume 6 | Article 37| 10 Paul et al. Cell-type-specific transcriptome during circuit assembly
Table 1 | PSCAN results for PC and S/BC showingTF enriched among activity (Reiss et al., 2006). We found that PCs preferentially the co-expressed transcripts at P14 and P56 time points. expressed Adam23, which might regulate co-expressed Pcdh and modulate cell–cell adhesion. Finally, the CAMs Cntnap2 (Caspr2) Cell-type TF name Z -score P-value Bonferonni is repressed by the TF Foxp2 (Fujita and Sugihara, 2012) through and age P-value direct binding at the Cntnap2 promoter (Vernes et al., 2008). We PCs at P14 MIZF 5.65792 6.11E−09 7.94E−07 found that the rise ofFoxp2expression at P14 in PCs (Figure 5A) HIF1A:ARNT 4.79104 7.31E−07 9.50E−05 precisely correlated to the abrupt drop in Cntnap2 transcript PCs at P56 ELK1 8.90068 1.37E−19 1.79E−17 (Figure 4B1). GABPA 8.77248 4.42E−19 5.74E−17 During the characteristic shift of GABA-A receptor subunit MIZF 5.97238 8.54E−10 1.11E−07 from α2 to α1 in PCs between P7 and 14, we found an upreg- ARNT:AHR 4.52425 2.61E−06 3.40E−04 ulation in the Slc32a1 (VGAT) and Slc6a1 (GAT1) in the S/BCs S/BCs at P14 EGR1 12.8264 2.19E−44 2.85E−42 (Figures 4A1 and A2 in Appendix), suggesting coordinated regu- KLF4 11.5272 9.02E−36 1.17E−33 lation of post- and pre-synaptic components, respectively. On the NFKB1 8.13968 4.59E−19 5.96E−17 other hand, PCs are also postsynaptic to glutamatergic parallel PAX5 7.95113 2.31E−18 3.00E−16 fibers and climbing fibers; they are also presynaptic to multi- CTCF 7.437 2.19E−16 2.85E−14 ple neurons (especially those in the deep cerebellar nuclei). In E2F1 7.29049 8.92E−16 1.16E−13 addition, S/BCs are postsynaptic to glutamatergic and GABAer- ARNT 6.35681 1.29E−12 1.68E−10 gic inputs. Therefore, gene expression profiles in PCs and S/BCs NHLH1 6.05526 1.98E−11 2.57E−09 may contain multiple pathways, each contributing to distinct pre- TCFCP2L1 5.85053 8.88E−11 1.15E−08 and post-synaptic development. Identifying the molecules and RREB1 4.72247 1.15E−07 1.49E−05 relevant pathways in PCs and S/BCs profiles that contribute to MAFB 4.37757 8.97E−07 1.17E−04 S/BC → PC GABAergic synapses would require careful valida- MYF 4.24664 1.78E−06 2.32E−04 tion of their subcellular localization and function. Even though ELK4 4.21708 2.00E−06 2.59E−04 this study treats S/BC as a group, there are known differences in S/BCs at P56 KLF4 5.64019 6.24E−09 8.12E−07 morphology and subcellular synapse targeting between BskC-PC SP1 5.46909 1.77E−08 2.30E−06 and StC-PC, which could be molecularly distinct. However such HIF1A:ARNT 4.79591 6.37E−07 8.28E−05 unique molecular correlates can only be discovered upon sorting EGR1 4.28222 7.55E−06 9.81E−04 the two cell-types to purity. TFAP2A 4.60855 1.73E−06 2.25E−04 Several studies have shown that genes that are co-regulated ZFX 4.44252 3.70E−06 4.82E−04 tend to localize as clusters along the chromosome (Boutanaev et al., 2002; Blanco et al., 2008). Here we provide evidence that, in developing cerebellar GABAergic neurons, groups of co- specific reporters that differentially label PCs, BskCs, and StCs, we expressed genes also tend co-localize as clusters in the genome, were able to readily distinguish PCs and S/BCs simply by their ranging from two genes to large stretches of 13 genes. We inter- cell sizes using the G42 line that labels both. A caveat of the cell pret these naturally arising co-transcribing gene clusters during sorting method, whether FACS or manual, is that certain aspect key developmental stages to be the transcript level readout of of gene expression might be altered by the dissociation procedure epigenetic control. Interestingly, a significant fraction of such (see Okaty et al., 2011 for a discussion). clusters are co-expressed in both PCs and S/BCs, although at dif- A major motivation in analyzing the development progres- ferent postnatal ages. In addition, many of the clusters appear to sion of gene expression in PCs and S/BCs is that StC and BskC be co-regulated during development: for example, in PCs they interneurons establish GABAergic synaptic transmission with PC are turned on in the first postnatal week, turned off in subse- cells during the postnatal period. In this context our study may quent weeks, and turned back on in the mature age (P56). Such reveal coordinated expression programs in postsynaptic PCs and developmental co-expression in different cell-types suggest that presynaptic S/BCs that direct the formation and transmission of certain groups of genes which localize as genomic clusters may these inhibitory synapses. We noted developmental co-expression constitute “chromosome regulatory modules” that encode com- of members of cadherins and protocadherins in PC and S/BC. ponents of functional pathways; they are deployed in different Cdh10 and Cdh22 showed strikingly similar expression pattern cell-types at the appropriate stage to support the relevant neural in PC and S/BC. Cdh10 expression rose gradually, peaked at developmental events. In this context the discovery of abun- P28, and declined at P35. Cdh22 has two expression peaks: the dant levels of 5-methylcytosine, an unusual nuclear DNA base early peak (P3–P14) may correlate to the initial interactions in PC (Kriaucionis and Heintz, 2009) and its correlation with between S/BC and PCs and the late peak(P28) might contribute to gene expression (Ficz et al., 2011) is intriguing and need to be GABAergic synapse maturation and maintenance (Figure 4B2). further explored by informatics analysis and by experimental The involvement of Pcdhα in Reelin signaling is well-known (Sen- validation. zaki et al., 1999). Here we found that members of non-clustered In PCs a sharp change in expression profile was noted from Pcdh (Pcdhδ) family (Pcdh20, Pcdh7, and Pcdh9) are comparably P7 to P14, which might reflect the abrupt changes in morphol- co-expressed in PC and S/BC (Figure 4B2). Pcdhs are proteolyti- ogy, positioning, physiology, and connectivity of the PCs during cally cleaved by disintegrins, such as ADAMs with metalloprotease this period (Dusart and Flamant, 2012). Pathway terms such as
Frontiers in Neural Circuits www.frontiersin.org June 2012 | Volume 6 | Article 37| 11 Paul et al. Cell-type-specific transcriptome during circuit assembly
A PC S/BC B C Acam P21 Acam P56 Acam Ctrl P3 P7 P14 P21 P28 P35 P56 P14 P21 P28 P35 P56
D Arhgap21 P21 Arhgap21 P56 Arhgap21 Ctrl
ml M pcl gcl L wm
E Kirrel-3 P21 Kirrel-3 P56 Kirrel-3 Ctrl nissil stain Purkinje cells
Stellate cells
Basket cells
Granule cells F Lgi-3 P21 Lgi-3 P56 Lgi3 Ctrl
wm gcl ml pcl
G Phyhip P21 Phyhip P56 Phyhip Ctrl H Lypd6 P21 Lypd6 P56 Lypd6 Ctrl
I Kirrel-1 P21 Kirrel-1 P56 Kirrel-1 Ctrl J Tmem178 P21 Tmem178 P56 Tmem178 Ctrl
FIGURE 6 | Expression of PC and S/BCs specific transcripts. hybridization panels of the novel S/BC transcripts validating the microarray (A) Heatmap showing novel cell-type specific transcripts and their data. Each panel shows two time points P21, P56, and control probes. developmental profiles. (B) Schematic diagram of the cerebellar and nissl Abbreviations: gcl, granule cell layer; ml, molecular layer; pcl, Purkinje cell stained cerebellum section indicating respective layers. (C–J) In situ layer; wm, white matter; M, medial; L, lateral.
“LTD,” “LTP,” “VEGF signaling,” “JAK/STAT signaling,” “mTOR AUTHOR CONTRIBUTIONS signaling,” and “apoptosis” are all sharply upregulated at P14 cor- Anirban Paul and Z. Josh Huang designed research; Anirban Paul relating to the elimination of PCs, rapid dendritic maturation, performed all experiments; Anirban Paul, Ying Cai, and Gurinder beginning of inhibitory synaptogenesis and the increased demand S. Atwal analyzed data; Anirban Paul and Z. Josh Huang wrote the for local protein synthesis associated with LTP and LTD events paper. (Figure 2A). Concomitantly there is a decline in pathway terms “chemokine signaling,”“Hedgehog signaling,”and“axon guidance” ACKNOWLEDGMENTS (Figures 2A,B). We thank Christopher Johns and Sohail Khan at the Cold Spring Although numerous PC specific genes have been identified, few Harbor Laboratory, microarray core facility for technical sup- such genes have been found for BskC and StCs. In our study we port; Pragya Kakani and Akash Abbi for her help in RNA in situ. grouped StC and BskC due the lack of molecular markers but This work is in part funded by the Robertson Neuroscience Fund our microarray and in situ data suggests candidate genes that at CSHL. can be exploited for such purpose. Our results on S/BC specific transcripts present opportunities for discovering subtype specific SUPPLEMENTARY MATERIAL genes for generating Cre-driver mice that can separately target StCs The Supplementary Material for this article can be found and BskCs, as have been implemented for cortical interneurons online at http://www.frontiersin.org/Neural_Circuits/10.3389/ (Taniguchi et al., 2011). fncir.2012.00037/abstract
Frontiers in Neural Circuits www.frontiersin.org June 2012 | Volume 6 | Article 37| 12 Paul et al. Cell-type-specific transcriptome during circuit assembly
REFERENCES Cameron, D. B., Kasai, K., Jiang, Y., second postnatal weeks: a meta- Hashimoto, K., Tsujita, M., Miyazaki, Albertson, A. J., Talbott, H., Wang, Hu, T., Saeki, Y., and Komuro, morphosis? Front. Neuroanat. 6:11. T., Kitamura, K.,Yamazaki,M., Shin, Q., Jensen, D., and Skinner, D. C. H. (2009). Four distinct phases of doi:10.3389/fnana.2012.00011 H.-S., Watanabe, M., Sakimura, K., (2008). The gonadotropin-releasing basket/stellate cell migration after Dusart, I., Guenet, J. L., and Sotelo, and Kano, M. (2011). Postsynaptic hormone type I receptor is expressed entering their final destination (the C. (2006). Purkinje cell death: dif- P/Q-type Ca2+ channel in Purkinje in the mouse cerebellum. Cerebellum molecular layer) in the develop- ferences between developmental cell cell mediates synaptic competition 7, 379–384. ing cerebellum. Dev. Biol. 332, death and neurodegenerative death and elimination in developing cere- Altman, J., and Bayer, S. A. (1997). 309–324. in mutant mice. Cerebellum 5, bellum. Proc. Natl. Acad. Sci. U.S.A. Development of the Cerebellar Sys- Casado, M., Isope, P., and Ascher, 163–173. 108, 9987–9992. tem: In Relation to its Evolu- P. (2002). Involvement of presy- Ekonomou, A., Kazanis, I., Malas, S., Heiman, M., Schaefer, A., Gong, S., tion, Structure, and Functions. New naptic N-methyl-D-aspartate Wood, H., Alifragis, P., Denaxa, Peterson, J. D., Day, M., Ramsey, Hampshire: CRC Press. receptors in cerebellar long- M., Karagogeos, D., Constanti, A., K. E., Suárez-Fariñas, M., Schwarz, Ango, F., di Cristo, G., Higashiyama, term depression. Neuron 33, Lovell-Badge, R., and Episkopou, C., Stephan, D. A., Surmeier, D. H., Bennett, V., Wu, P., and Huang, 123–130. V. (2005). Neuronal migration J., Greengard, P., and Heintz, N. Z. J. (2004). Ankyrin-based sub- Chandra, D., Jia, F., Liang, J., Peng, and ventral subtype identity (2008). A translational profiling cellular gradient of neurofascin, Z., Suryanarayanan, A., Werner, in the telencephalon depend approach for the molecular charac- an immunoglobulin family protein, D. F., Spigelman, I., Houser, C. on SOX1. PLoS Biol. 3, e186. terization of CNS cell types. Cell 135, directs GABAergic innervation at R., Olsen, R. W., Harrison, N. doi:10.1371/journal.pbio.0030186 738–748. Purkinje axon initial segment. Cell L., and Homanics, G. E. (2006). Engbers, J. D. T., Anderson, D., Asmara, Hentschke, H., Benkwitz, C., Banks, 119, 257–272. GABAA receptor alpha 4 sub- H., Rehak, R., Mehaffey, W. H., M. I., Perkins, M. G., Homan- Ango, F., Wu, C., Van der Want, units mediate extrasynaptic inhi- Hameed, S., McKay, B. E., Kruskic, ics, G. E., and Pearce, R. A. J. J., Wu, P., Schachner, M., and bition in thalamus and dentate M., Zamponi, G. W., and Turner, (2009). Altered GABAA,slow inhi- Huang, Z. J. (2008). Bergmann gyrus and the action of gaboxadol. R. W. (2012). Intermediate con- bition and network oscillations in glia and the recognition molecule Proc. Natl. Acad. Sci. U.S.A. 103, ductance calcium-activated potas- mice lacking the GABAA receptor CHL1 organize GABAergic axons 15230–15235. sium channels modulate summation beta3 subunit. J. Neurophysiol. 102, and direct innervation of Purkinje Charron, F., and Tessier-Lavigne, of parallel fiber input in cerebellar 3643–3655. cell dendrites. PLoS Biol. 6, e103. M. (2007). The Hedgehog, TGF- Purkinje cells. Proc. Natl. Acad. Sci. Hirono, M., Yoshioka, T., and Kon- doi:10.1371/journal.pbio.0060103 beta/BMP and Wnt families U.S.A. 109, 2601–2606. ishi, S. (2001). GABAB recep- Bender, K. J., and Trussell, L. O. (2009). of morphogens in axon guid- Farrant, M., and Cull-Candy, S. G. tor activation enhances mGluR- Axon initial segment Ca2+ chan- ance. Adv. Exp. Med. Biol. 621, (1991). Excitatory amino acid mediated responses at cerebellar nels influence action potential gen- 116–133. receptor-channels in Purkinje cells excitatory synapses. Nat. Neurosci. 4, eration and timing. Neuron 61, Chung,S.-H.,Marzban,H.,Aldinger,K., in thin cerebellar slices. Proc. Biol. 1207–1216. 259–271. Dixit,R.,Millen,K.,Schuurmans,C., Sci. 244, 179–184. Horsley, V., and Pavlath, G. K. (2002). Bidoret, C., Ayon, A., Barbour, B., and Hawkes, R. (2011). Zac1 plays a Ficz, G., Branco, M. R., Seisenberger, S., NFAT: ubiquitous regulator of cell and Casado, M. (2009). Presynaptic key role in the development of spe- Santos, F., Krueger, F., Hore, T. A., differentiation and adaptation. J. NR2A-containing NMDA receptors cific neuronal subsets in the mouse Marques,C. J.,Andrews,S.,and Reik, Cell Biol. 156, 771–774. implement a high-pass filter synap- cerebellum. Neural Dev. 6, 25. W. (2011). Dynamic regulation of Huntsman, M. M., Porcello, D. M., tic plasticity rule. Proc. Natl. Acad. Croci, L., Chung, S.-H., Masserdotti, G., 5-hydroxymethylcytosine in mouse Homanics, G. E., DeLorey, T. Sci. U.S.A. 106, 14126–14131. Gianola, S., Bizzoca, A., Gennarini, ES cells and during differentiation. M., and Huguenard, J. R. (1999). Blanco, E., Pignatelli, M., Beltran, S., G., Corradi, A., Rossi, F., Hawkes, R., Nature 473, 398–402. Reciprocal inhibitory connections Punset, A., Pérez-Lluch, S., Ser- and Consalez, G. G. (2006). A key Fujita, H., and Sugihara, I. (2012). and network synchrony in the ras, F., Guigó, R., and Corominas, role for the HLH transcription factor FoxP2 expression in the cerebellum mammalian thalamus. Science 283, M. (2008). Conserved chromoso- EBF2COE2,O/E-3 in Purkinje neu- and inferior olive: development of 541–543. mal clustering of genes governed by ron migration and cerebellar cor- the transverse stripe-shaped expres- Kagami, Y., and Furuichi, T. (2001). chromatin regulators in Drosophila. tical topography. Development 133, sion pattern in the mouse cerebel- Investigation of differentially Genome Biol. 9, R134. 2719–2729. lar cortex. J. Comp. Neurol. 520, expressed genes during the devel- Blankenship, A. G., Hamby, A. M., Firl, Cueni, L., Canepari, M., Adelman, 656–677. opment of mouse cerebellum. A., Vyas, S., Maxeiner, S., Willecke, J., and Lüthi, A. (2009). Ca2+ Gavino, C., and Richard, S. (2011). Loss Brain Res. Gene Expr. Patterns 1, K., and Feller, M. B. (2011). The role signaling by T-type Ca2+ chan- of p53 in quaking viable mice leads 39–59. of neuronal connexins 36 and 45 in nels in neurons. Pflugers Arch. 457, to Purkinje cell defects and reduced Kanamori, M., Konno, H., Osato, shaping spontaneous firing patterns 1161–1172. survival. Sci. Rep. 1, 84. N., Kawai, J., Hayashizaki, Y., and in the developing retina. J. Neurosci. D’Angelo, E., Mazzarello, P., Prestori, Graham, V., Khudyakov, J., Ellis, Suzuki, H. (2004). A genome-wide 31, 9998–10008. F., Mapelli, J., Solinas, S., Lombardo, P., and Pevny, L. (2003). SOX2 and nonredundant mouse tran- Boutanaev, A. M., Kalmykova, A. I., P., Cesana, E., Gandolfi, D., and functions to maintain neural scription factor database. Biochem. Shevelyov, Y. Y., and Nurmin- Congi, L. (2011). The cerebellar net- progenitor identity. Neuron 39, Biophys. Res. Commun. 322, sky, D. I. (2002). Large clus- work: from structure to function and 749–765. 787–793. ters of co-expressed genes in the dynamics. Brain Res. Rev. 66, 5–15. Gugger, O. S., Hartmann, J., Birn- Kano, M., Rexhausen, U., Dreessen, J., Drosophila genome. Nature 420, De-Fraja, C., Conti, L., Magrassi, L., baumer, L., and Kapfhammer, J. and Konnerth, A. (1992). Synap- 666–669. Govoni, S., and Cattaneo, E. (1998). P. (2012). P/Q type and T type tic excitation produces a long- Bryne, J. C., Valen, E., Tang, M.-H. Members of the JAK/STAT pro- calcium channels, but not type 3 lasting rebound potentiation of E., Marstrand, T., Winther, O., da teins are expressed and regulated transient receptor potential cation inhibitory synaptic signals in cere- Piedade, I., Krogh, A., Lenhard, during development in the mam- channels, are involved in inhi- bellar Purkinje cells. Nature 356, B., and Sandelin, A. (2008). JAS- malian forebrain. J. Neurosci. Res. 54, bition of dendritic growth after 601–604. PAR, the open access database of 320–330. chronic metabotropic glutamate Kelleher, R. J. III, Govindarajan, A., and transcription factor-binding pro- Dusart, I., and Flamant, F. (2012). receptor type 1 and protein kinase Tonegawa, S. (2004). Translational files: new content and tools in the Profound morphological and func- C activation in cerebellar Purk- regulatory mechanisms in persistent 2008 update. Nucleic Acids Res. 36, tional changes of rodent Purkinje inje cells. Eur. J. Neurosci. 35, forms of synaptic plasticity. Neuron D102–D106. cells between the first and the 20–33. 44, 59–73.
Frontiers in Neural Circuits www.frontiersin.org June 2012 | Volume 6 | Article 37| 13 Paul et al. Cell-type-specific transcriptome during circuit assembly
Kitano, J., Yamazaki, Y., Kimura, K., Nicolas, C. S., Peineau, S., Amici, M., B. (2004). JASPAR: an open- Trends Pharmacol. Sci. 17, 348–355. Masukado, T., Nakajima, Y., and Csaba, Z., Fafouri, A., Javalet, C., access database for eukaryotic Sugino, K., Hempel, C. M., Miller, M. Nakanishi, S. (2003). Tamalin is Collett,V. J., Hildebrandt, L., Seaton, transcription factor binding N., Hattox, A. M., Shapiro, P., Wu, a scaffold protein that interacts G., Choi, S.-L., Sim, S. E., Bradley, profiles. Nucleic Acids Res. 32, C., Huang, Z. J., and Nelson, S. with multiple neuronal proteins in C., Lee, K., Zhuo, M., Kaang, B. K., D91–D94. B. (2006). Molecular taxonomy of distinct modes of protein-protein Gressens, P., Dournaud, P., Fitzjohn, Sanz, E., Yang, L., Su, T., Mor- major neuronal classes in the adult association. J. Biol. Chem. 278, S. M., Bortolotto, Z. A., Cho, K., ris, D. R., McKnight, G. S., and mouse forebrain. Nat. Neurosci. 9, 14762–14768. and Collingridge, G. L. (2012). Amieux, P. S. (2009). Cell-type- 99–107. Kriaucionis, S., and Heintz, N. The JAK/STAT pathway is involved specific isolation of ribosome- Talley, E. M., Cribbs, L. L., Lee, J. (2009). The nuclear DNA base in synaptic plasticity. Neuron 73, associated mRNA from complex tis- H., Daud, A., Perez-Reyes, E., and 5-hydroxymethylcytosine is present 374–390. sues. Proc. Natl. Acad. Sci. U.S.A. 106, Bayliss, D. A. (1999). Differential in Purkinje neurons and the brain. Nusser, Z., Kay, L. M., Laurent, G., 13939–13944. distribution of three members of a Science 324, 929–930. Homanics, G. E., and Mody, I. Sato, A., Sekine, Y., Saruta, C., Nishibe, gene family encoding low voltage- LeBeau, F. E. N., Traub, R. D., Monyer, (2001). Disruption of GABA(A) H., Morita, N., Sato, Y., Sadakata, activated (T-type) calcium channels. H., Whittington, M. A., and Buhl, receptors on GABAergic interneu- T., Shinoda, Y., Kojima, T., and J. Neurosci. 19, 1895–1911. E. H. (2003). The role of elec- rons leads to increased oscil- Furuichi, T. (2008). Cerebellar Taniguchi, H., He, M., Wu, P., Kim, trical signaling via gap junctions latory power in the olfactory development transcriptome data- S., Paik, R., Sugino, K., Kvitsiani, in the generation of fast network bulb network. J. Neurophysiol. 86, base (CDT-DB): profiling of spatio- D., Kvitsani, D., Fu, Y., Lu, J., Lin, oscillations. Brain Res. Bull. 62, 2823–2833. temporal gene expression dur- Y., Miyoshi, G., Shima, Y., Fishell, 3–13. Ohishi, H., Shigemoto, R., Nakanishi, S., ing the postnatal development of G., Nelson, S. B., and Huang, Z. J. Leto, K., Rolando, C., and Rossi, and Mizuno, N. (1993). Distribution mouse cerebellum. Neural. Netw. 21, (2011). A resource of Cre driver lines F. (2012). The genesis of cere- of the mRNA for a metabotropic 1056–1069. for genetic targeting of GABAergic bellar GABAergic neurons: fate glutamate receptor (mGluR3) in the Scolnick, J. A., Cui, K., Duggan, C. D., neurons in cerebral cortex. Neuron potential and specification mech- rat brain: an in situ hybridiza- Xuan, S.,Yuan,X.-B., Efstratiadis,A., 71, 995–1013. anisms. Front. Neuroanat. 6:6. tion study. J. Comp. Neurol. 335, and Ngai, J. (2008). Role of IGF sig- Tempia, F., and Konnerth, A. (1994). doi:10.3389/fnana.2012.00006 252–266. naling in olfactory sensory map for- Calcium requirement of long-term Lipscombe, D., Helton, T. D., and Xu, Okaty, B. W., Sugino, K., and Nel- mation and axon guidance. Neuron depression and rebound potentia- W. (2004). L-Type calcium channels: son, S. B. (2011). A quanti- 57, 847–857. tion in cerebellar Purkinje neurons. the low down. J. Neurophysiol. 92, tative comparison of cell-type- Senzaki, K., Ogawa, M., and Yagi, T. Semin. Cell Biol. 5, 243–250. 2633–2641. specific microarray gene expres- (1999). Proteins of the CNR family Vernes, S. C., Newbury, D. F., Abra- Llano, I., Marty, A., Armstrong, C. M., sion profiling methods in the are multiple receptors for reelin. Cell hams, B. S., Winchester, L., Nicod, and Konnerth, A. (1991). Synaptic- mouse brain. PLoS ONE 6, e16493. 99, 635–647. J., Groszer, M., Alarcón, M., Oliver, and agonist-induced excitatory cur- doi:10.1371/journal.pone.0016493 Smith, S. S., and Gong, Q. H. (2005). P. L., Davies, K. E., Geschwind, D. rents of Purkinje cells in rat Piochon, C., Irinopoulou, T., Brus- Neurosteroid administration and H., Monaco, A. P., and Fisher, S. cerebellar slices. J. Physiol. 434, ciano, D., Bailly, Y., Mariani, J., withdrawal alter GABAA receptor E. (2008). A functional genetic link 183–213. and Levenes, C. (2007). NMDA kinetics in CA1 hippocampus of between distinct developmental lan- Malgaretti, N., Pozzoli, O., Bosetti, A., receptor contribution to the climb- female rats. J. Physiol. (Lond.) 564, guage disorders. N. Engl. J. Med. 359, Corradi, A., Ciarmatori, S., Pani- ing fiber response in the adult 421–436. 2337–2345. gada, M., Bianchi, M. E., Martinez, mouse Purkinje cell. J. Neurosci. 27, Song, J., Wu, L., Chen, Z., Kohanski, R. Westenbroek, R. E., Sakurai, T., Elliott, S., and Consalez, G. G. (1997). 10797–10809. A., and Pick, L. (2003). Axons guided E. M., Hell, J. W., Starr, T. V.,Snutch, Mmot1,a new helix-loop-helix tran- Piochon, C., Levenes, C., Ohtsuki, G., by insulin receptor in Drosophila T. P., and Catterall, W. A. (1995). scription factor gene displaying a and Hansel, C. (2010). Purkinje visual system. Science 300, 502–505. Immunochemical identification and sharp expression boundary in the cell NMDA receptors assume a key Storey, J. D. (2003). The positive false subcellular distribution of the alpha embryonic mouse brain. J. Biol. role in synaptic gain control in the discovery rate: a Bayesian interpre- 1A subunits of brain calcium chan- Chem. 272, 17632–17639. mature cerebellum. J. Neurosci. 30, tation and the q-value. Ann. Stat. 31, nels. J. Neurosci. 15, 6403–6418. Matsuda, K., Kamiya, Y., Matsuda, S., 15330–15335. 2013–2035. Yunker, A. M. R., Sharp, A. H., Sundar- and Yuzaki, M. (2002). Cloning and Raychaudhuri, S., Stuart, J. M., and Storey, J. D., and Storey, J. D. (2002). raj, S., Ranganathan, V., Copeland, characterization of a novel NMDA Altman, R. B. (2000). Principal A direct approach to false discovery T. D., and McEnery, M. W. (2003). receptor subunit NR3B: a dominant components analysis to sum- rates, a direct approach to false dis- Immunological characterization subunit that reduces calcium perme- marize microarray experiments: covery rates. J. R. Stat. Soc. Series B of T-type voltage-dependent cal- ability. Brain Res. Mol. Brain Res. 100, application to sporulation time Stat. Methodol. 64, 479–498. cium channel CaV3.1 (alpha1G) 43–52. series. Pac. Symp. Biocomput. 5, Storkebaum, E., Lambrechts, D., Dew- and CaV3.3 (alpha1I) isoforms Middleton, S. J., Racca, C., Cunning- 455–466. erchin, M., Moreno-Murciano, M.- reveal differences in their local- ham, M. O., Traub, R. D., Monyer, Reiss, K., Maretzky, T., Haas, I. P., Appelmans, S., Oh, H., Van ization, expression, and neural H., Knöpfel, T., Schofield, I. S., G., Schulte, M., Ludwig, A., Damme, P., Rutten, B., Man, W. development. Neuroscience 117, Jenkins, A., and Whittington, M. Frank, M., and Saftig, P. (2006). Y., De Mol, M., Wyns, S., Manka, 321–335. A. (2008). High-frequency network Regulated ADAM10-dependent D., Vermeulen, K., Van Den Bosch, Zambelli, F., Pesole, G., and Pavesi, oscillations in cerebellar cortex. ectodomain shedding of γ- L., Mertens, N., Schmitz, C., Rob- G. (2009). Pscan: finding over- Neuron 58, 763–774. protocadherin C3 modulates berecht, W., Conway, E. M., Collen, represented transcription factor Morii, E., Hirota, S., Kim, H. M., cell-cell adhesion. J. Biol. Chem. 281, D., Moons, L., and Carmeliet, P. binding site motifs in sequences Mikoshiba, K., Nishimune, Y., Kita- 21735–21744. (2005). Treatment of motoneuron from co-regulated or co-expressed mura, Y., and Nomura, S. (1992). Renzi, M., Farrant, M., and Cull-Candy, degeneration by intracerebroven- genes. Nucleic Acids Res. 37, Spatial expression of genes encod- S. G. (2007). Climbing-fibre activa- tricular delivery of VEGF in a rat W247–W252. ing c-kit receptors and their lig- tion of NMDA receptors in Purkinje model of ALS. Nat. Neurosci. 8, Zhao, Y., Kwan, K.-M., Mailloux, C. ands in mouse cerebellum as cells of adult mice. J. Physiol. (Lond.) 85–92. M., Lee, W.-K., Grinberg, A., Wurst, revealed by in situ hybridization. 585, 91–101. Sucher, N. J., Awobuluyi, M., Choi, Y. W., Behringer, R. R., and West- Brain Res. Dev. Brain Res. 65, Sandelin, A., Alkema, W., Engström, P., B., and Lipton, S. A. (1996). NMDA phal, H. (2007). LIM-homeodomain 123–126. Wasserman, W. W., and Lenhard, receptors: from genes to channels. proteins Lhx1 and Lhx5, and their
Frontiers in Neural Circuits www.frontiersin.org June 2012 | Volume 6 | Article 37| 14 Paul et al. Cell-type-specific transcriptome during circuit assembly
cofactor Ldb1, control Purkinje cell subunit of the GABA(A) recep- could be construed as a potential con- circuit assembly in cerebellar cor- differentiation in the developing tor in differentiated neuroblastoma flict of interest. tex. Front. Neural Circuits 6:37. doi: cerebellum. Proc. Natl. Acad. Sci. cells are correlated with GABA- 10.3389/fncir.2012.00037 U.S.A. 104, 13182–13186. gated current. Neuropharmacology Received: 03 May 2012; paper pend- Copyright © 2012 Paul, Cai, Atwal and Zheng, C., Heintz, N., and Hatten, 56, 1041–1053. ing published: 21 May 2012; accepted: Huang. This is an open-access article M. E. (1996). CNS gene encod- 01 June 2012; published online: 26 June distributed under the terms of the Cre- ing astrotactin, which supports neu- 2012. ative Commons Attribution Non Com- ronal migration along glial fibers. Conflict of Interest Statement: The Citation: Paul A, Cai Y, Atwal GS mercial License, which permits non- Science 272, 417–419. authors declare that the research was and Huang ZJ (2012) Developmental commercial use, distribution, and repro- Zhou, X., and Smith, S. S. (2009). conducted in the absence of any com- coordination of gene expression between duction in other forums, provided the Expression levels of the alpha4 mercial or financial relationships that synaptic partners during GABAergic original authors and source are credited.
Frontiers in Neural Circuits www.frontiersin.org June 2012 | Volume 6 | Article 37| 15 Paul et al. Cell-type-specific transcriptome during circuit assembly
APPENDIX
FIGURE A1 | Representative RNA in-situs from Allen Brain developing mouse brain images showing the expression of cell adhesion molecule transcripts, Col18a1, Bcar1, Nrxn1, and L1cam. Expression changes matched with microarray developmental profiles.
Frontiers in Neural Circuits www.frontiersin.org June 2012 | Volume 6 | Article 37| 16 Paul et al. Cell-type-specific transcriptome during circuit assembly
FIGURE A2 | Representative RNA in-situs from Allen Brain mouse brain (only P56 time point available) images showing the PC specific expression of cell adhesion molecule transcripts, Cntnap2, Cyth3, Adam23, and Opcml; S/BC specific expression of Cdh22 and Cntn4.
Frontiers in Neural Circuits www.frontiersin.org June 2012 | Volume 6 | Article 37| 17 Paul et al. Cell-type-specific transcriptome during circuit assembly
FIGURE A3 | Representative RNA in-situs from Allen Brain developing Expression changes matched with microarray developmental profiles. mouse brain images showing the expression of NMDA and AMPA Grm3 signal is weaker than Golgi cells as has been reported in Ohishi transcripts; S/BC restricted Grin3a and Grm3; PC restricted Grm7. et al.(1993).
Frontiers in Neural Circuits www.frontiersin.org June 2012 | Volume 6 | Article 37| 18 Paul et al. Cell-type-specific transcriptome during circuit assembly
FIGURE A4 | Representative RNA in-situs from Allen Brain mouse brain Cacnb2, and Cacnb4; S/BC specific expression of Cacna1d, Cacna2d3, (only P56 time point available) images showing the PC specific and Cacnb3. Also showing the expression of gap junction proteins Gjd2 and expression of voltage-gated calcium channel transcripts, Cacana1a, Gjc1 in S/BC.
Frontiers in Neural Circuits www.frontiersin.org June 2012 | Volume 6 | Article 37| 19 Paul et al. Cell-type-specific transcriptome during circuit assembly 06 01 01 01 01 01 01 01 01 01 − − − − − − − − − − 01 3.88E 01 4.45E 01 5.52E 01 6.12E 01 5.74E 01 5.20E 06 9.79E 01 1.47E 01 4.04E 01 3.43E − − − − − − − − − − Bonferroni Benjamini Fold enrichment Pop total Pop hits total 297 326 13588 2.67 3.88E 297 442 13588 2.28 6.92E 297 515 13588 2.13297 7.88E 292 13588 2.51 9.60E 297 161 13588 3.13 9.91E 297 218 13588 2.73 9.94E 297 247 13588 2.59 9.94E 132 89 5738 6.84 9.79E 132 217 5738 2.40 7.16E RPL23, RPS29, RPL31, RPL8, RPS13, RPL37A, RPL12, RPS11 RHOU, SHH, THY1, SS18, NDEL1, EPB4.1L1, SGCG, EPS8, TMSB4X, STMN1, DIAP3, SYNPO, MYH10 SFXN1, ANXA6, KCTD9, ATP2B2, P2RX4, CACNA1D, KCNG4, CACNA1B SFXN1, ANXA6, KCTD9, ATP2B2, P2RX4, KCTD15, STEAP2, CACNA1D, KCNG4, CACNA1B CTNNA2, THY1, ATP2B2, NDEL1, ANK3, STMN1, SS18L1, APC, MYH10 SLC24A5, CACNB3, SFXN1, STEAP2, CACNA1D, CACNA1B CTNNA2, NDEL1, ANK3, STMN1, SS18L1, MYH10, APC PRKCD, SHH, NR2C2, HDGFRP3, ANXA7, NDEL1, NCOR2, CUL1, MYH10 ATP2B3, KCNT1, CACNA1G, KCTD15, STEAP2, ATP2B3, KCNT1, ATP5S, SLC41A3, CACNA1G, TMEM38A, SLC24A5, ATP1A1, CACNB3, TMSB4X, ITGA3, ITGB2, DIAP3, MYH10, APC TMEM38A, SLC24A5, ATP1A1, CACNB3, 08 RPL26, RPL35, RPL27, RPL23A, RPS18, RPS27, 04 ABLIM2, MTSS1, ENAH, CAP2, PDGFA, GAS7, 03 ALDOC, PGD, PFKP,TKT, PRPS1 132 2604 5738 KCNMB4, SCN1A, SCN1B, SCN3A, 8.36 SCN2B, 2.73E 03 ANXA6, P2RX4, ATP2B2, ATP2B3, CACNA1G, 03 WNT5A, PDGFA, NASP,CREBBP,ITGB2, 04 KCNMB4, SCN1A, SCN1B, SCN2B, SCN3A, 03 ENAH, KLF7,VAX2, PRKG1, GAS7, SHH, 02 ACTB, ENAH, PDGFA, PAK3, SOS1, SSH2, 03 KLF7, ENAH, VAX2, EN2, PRKG1, GAS7, SHH, − − − − − − − − − − -value Genes List P 19 4.556 2.89E 5 1.199 2.63E 22 5.276 6.94E 12 2.878 1.04E 24 5.755 9.14E 16 3.837 1.89E 11 2.638 2.78E 13 3.118 3.01E 14 3.357 3.02E cell neuron cation metal cytoskeleton neuron di-, ∼ ∼ ∼ ∼ ∼ ∼ ∼ organization phosphate pathway ion transport of actin cytoskeleton transport development tri-valent inorganic cation transport projection development proliferation PC P3 Vs P7 STABLE CLUSTER ENRICHMENT PATHWAY PC P3 Vs P7 STABLE CLUSTER BIOLOGICAL PROCESSTERMS ENRICHMENT Category TermKEGG_PATHWAY mmu03010:Ribosome 14KEGG_PATHWAY mmu00030:Pentose 3.357 8.09E Count % GOTERM_BP_FAT GO:0007010 GOTERM_BP_FAT GO:0030001 KEGG_PATHWAY mmu04810:Regulation GOTERM_BP_FAT GO:0006812 GOTERM_BP_FAT GO:0048666 GOTERM_BP_FAT GO:0015674 GOTERM_BP_FAT GO:0031175 GOTERM_BP_FAT GO:0008283 TableA1 | Pathway and gene ontology terms enriched in PC, P3-P7 stable clusters.
Frontiers in Neural Circuits www.frontiersin.org June 2012 | Volume 6 | Article 37| 20 Paul et al. Cell-type-specific transcriptome during circuit assembly 01 02 01 01 01 01 02 − − − − − − − (Continued) 01 6.04E 02 9.26E 01 2.38E 01 2.38E 00 6.09E 00 5.90E 01 7.03E − − − − + + − 297 319 13588 2.29 9.99E 288 95 12504 4.57 9.26E 297 121 13588 3.40 1.00E 288 192 12504288 3.17 1919 1.36E 12504 1.43 5.57E 297 176 13588 2.86 1.00E 288 1919 12504 1.43 5.57E GAS7, SHH, CTNNA2, ATP2B2, NDEL1, ANK3, STMN1, SS18L1, APC, MYH10 KCTD15, CACNB3, CACNA1D, KCNG4, CACNA1B SLC24A5, CACNB3, CACNA1D, CACNA1B CITED2, MTAP6, BRD4, RPL12, SS18L1, RND1, NDEL1, SGCG, SPAG5, FNBP1L, RPS13, RPL31, SOS1, RPL8, APC, SYNPO, ACTB, ZFP346, CENPO, NF2, CREBBP,RPL26, RPL27, RPL23A, COTL1, GAS7, MLF1IP,DOCK4, EPB4.1L1, EPS8, RPL23, RPL37A, H3F3B, FEZ1, CALM1, MYH10 RPL23, RPS29, RPL31, RPL8, RPS13, RPL37A, RPL12, RPS11 GAS7, SHH, MYH10, CTNNA2, APC CITED2, MTAP6, BRD4, RPL12, SS18L1, RND1, NDEL1, SGCG, SPAG5, FNBP1L, RPS13, RPL31, SOS1, RPL8, APC, SYNPO, ACTB, ZFP346, CENPO, NF2, CREBBP,RPL26, RPL27, RPL23A, COTL1, GAS7, MLF1IP,DOCK4, EPB4.1L1, EPS8, RPL23, RPL37A, H3F3B, FEZ1, CALM1, MYH10 ANKS1B, NOL7,TANC1, CTNNA2, SS18, RPS18, ANKS1B, NOL7,TANC1, CTNNA2, SS18, RPS18, TTLL7,TTLL1, RHOU, 2310008H09RIK, LATS2, TMSB4X, STMN1, RPS11, ABLIM2, HMGB3, YPEL4, SSH2, RPL35, CORO2B, RPS27, RPS29, TTLL7,TTLL1, RHOU, 2310008H09RIK, LATS2, TMSB4X, STMN1, RPS11, ABLIM2, HMGB3, YPEL4, SSH2, RPL35, CORO2B, RPS27, RPS29, 03 MTSS1, KLF7, ENAH, PDGFA, VAX2, PRKG1, 04 KCTD9, KCNMB4, SCN1A, SCN3A, CACNA1G, 03 ANXA6, P2RX4, ATP2B2, ATP2B3, CACNA1G, 03 MTSS1, ENAH, PPP2R5A, CEP76, MLPH, 04 RPL26, RPL35, RPL27, RPL23A, RPS18, RPS27, 03 KLF7, ENAH, NDEL1, ANK3, VAX2, STMN1, 03 MTSS1, ENAH, PPP2R5A, CEP76, MLPH, − − − − − − − 16 3.837 4.35E 10 2.398 3.26E 9 2.158 4.96E 63 15.11 2.73E 11 2.638 5.24E 63 15.11 2.73E cell ribosome 14 3.357 4.89E cation non- calcium neuron ∼ ∼ ∼ ∼ ∼ ∼ ∼ projection organization channel complex ion transport intracellular non- membrane-bounded organelle projection morphogenesis membrane-bounded organelle PC P3 Vs P7 STABLE CLUSTER CELLULAR COMPARTMENTTERMS ENRICHMENT GOTERM_BP_FAT GO:0030030 GOTERM_CC_FAT GO:0034703 GOTERM_BP_FAT GO:0006816 GOTERM_CC_FAT GO:0043232 GOTERM_CC_FAT GO:0005840 GOTERM_BP_FAT GO:0048812 GOTERM_CC_FAT GO:0043228
Frontiers in Neural Circuits www.frontiersin.org June 2012 | Volume 6 | Article 37| 21 Paul et al. Cell-type-specific transcriptome during circuit assembly 01 03 01 01 01 01 01 01 01 01 03 − − − − − − − − − − − 01 2.02E 01 1.89E 01 1.05E 01 2.10E 01 2.42E 01 1.34E 01 1.26E 02 6.82E 01 1.98E 03 7.31E 01 1.98E − − − − − − − − − − − Bonferroni Benjamini Fold enrichment Pop total Pop hits total 288 106 12504 3.69 5.94E 294 414 13288 2.73 7.31E 294 151 13288 4.19 1.36E 294 290 13288 2.65 2.84E 294 248 13288 2.73 4.38E 294 281 13288 2.57 4.91E 288 158 12504 3.02 6.49E 288 117288 12504 3.34 123 12504 3.18 8.07E 8.91E CORO2B, PACSIN3, PACSIN2, MTAP6, SYNPO, EPB4.1L1, SPAG5, TMSB4X, STMN1, DIAP3, MYH10, FEZ1 RPL23, RPS29, RPL31, RPL8, RPS13, RPL37A, RPL12, RPS11 CACNA1D, KCNG4, CACNA1B CACNA1G, KCTD15, CACNA1D, KCNG4, CACNA1B CLIC6, CACNA1G, KCTD15, CACNA1D, KCNG4, CACNA1B CXADR, RHOU, CTNNA2 CACNA1G, KCTD15, CACNB3, CACNA1D, KCNG4, CACNA1B MYH10, SYNPO, CACNA1B CXADR, RHOU, CTNNA2 APC, CAP2, NF2, COTL1, GAS7, GMFB, NDEL1, ATP2B3, KCNT1, CACNA1G, KCTD15, TMEM38A, CACNB3, ATP2B2, P2RX4, KCTD9, TMEM38A, CACNB3, P2RX4, KCTD9, KCNT1, TMEM38A, CACNB3, P2RX4, KCTD9, KCNT1, 03 ENAH, NF2, PKP3, SSH2, LMO7, SSX2IP, 03 KCTD9, KCNMB4, SCN1A, SCN3A, CLIC6, 03 CACNA1G, CACNB3, CACNA1D, CACNA1B 288 15 12504 11.58 7.34E 03 CACNA1G, CACNB3, CACNA1D, CACNA1B 288 15 12504 11.58 7.34E 05 RPL26, RPL35, RPL27, RPL23A, RPS18, RPS27, 03 ATP2B2, SCN1A, SOS1, NRSN2, PPT1, TTLL7, 05 ABLIM2, MTSS1, ENAH, MLPH, SSH2, LMO7, 03 KCNMB4, SCN1A, SCN1B, SCN3A, SCN2B, 03 KCNMB4, SCN1A, SCN1B, SCN3A, SCN2B, 03 ENAH, NF2, PKP3, SSH2, LMO7, SSX2IP, 04 KCNMB4, SCN1A, SCN1B, SCN3A, SCN2B, − − − − − − − − − − − -value Genes List P 911 2.158 3.02E 2.638 3.51E 25 5.995 1.58E 4 0.959 4.44E 4 0.959 4.44E 14 3.357 2.95E 17 4.077 7.19E 99 2.158 5.51E 2.158 7.40E 15 3.597 1.24E 16 3.837 1.46E cytoskeletal voltage- structural cation ion calcium metal cell gated adherens anchoring ∼ ∼ ∼ ∼ ∼ ∼ ∼ ∼ ∼ ∼ ∼ junction channel complex protein binding channel complex gated calcium channel complex constituent of ribosome ion transmembrane transporter activity soma junction channel activity channel activity PC P3 Vs P7 STABLE CLUSTER MOLECULAR FUNCTIONTERMS ENRICHMENT CategoryGOTERM_CC_FAT GO:0005912 TermGOTERM_CC_FAT GO:0034702 Count % GOTERM_MF_FAT GO:0008092 GOTERM_CC_FAT GO:0034704 GOTERM_CC_FAT GO:0005891 GOTERM_MF_FAT GO:0003735 GOTERM_MF_FAT GO:0046873 GOTERM_CC_FAT GO:0043025 GOTERM_CC_FAT GO:0070161 GOTERM_MF_FAT GO:0005261 GOTERM_MF_FAT GO:0022836 TableA1 | Continued
Frontiers in Neural Circuits www.frontiersin.org June 2012 | Volume 6 | Article 37| 22 Paul et al. Cell-type-specific transcriptome during circuit assembly 01 01 01 01 01 − − − − − 01 1.30E 01 2.39E 01 2.20E 01 1.49E 01 1.49E − − − − − 294 179 13288294 3.03 179 6.19E 13288294 3.03 128 6.19E 13288294 3.53 349 6.24E 13288 2.20 8.88E CLIC6, CACNA1G, KCTD15, CACNB3, CACNA1D, KCNG4, CACNA1B CLIC6, CACNA1G, KCTD15, CACNB3, CACNA1D, KCNG4, CACNA1B KCTD15, CACNB3, CACNA1D, KCNG4, CACNA1B KCNT1, CLIC6, CACNA1G, KCTD15, CACNA1D, KCNG4, CACNA1B TMEM38A, CACNB3, FXYD6, P2RX4, KCTD9, 03 KCTD9, SCN1A, SCN1B, SCN3A, SCN2B, 03 KCTD9, SCN1A, SCN1B, SCN3A, SCN2B, 03 KCNMB4, SCN1A, SCN1B, SCN3A, SCN2B, 03 NPTN, ITGB2, NEO1, CTNNA2 294 16 13288 11.30 8.93E 03 KCTD9, SCN1A, SCN3A, SCN2B, CACNA1G, − − − − − 12 2.878 2.08E 10 2.398 2.10E 12 2.878 2.08E 17 4.077 4.71E 4 0.959 4.80E voltage- voltage- voltage- cell ion ∼ ∼ ∼ ∼ ∼ gated channel activity gated cation channel activity gated ion channel activity channel activity adhesion molecule binding GOTERM_MF_FAT GO:0005244 GOTERM_MF_FAT GO:0022832 GOTERM_MF_FAT GO:0022843 GOTERM_MF_FAT GO:0005216 GOTERM_MF_FAT GO:0050839
Frontiers in Neural Circuits www.frontiersin.org June 2012 | Volume 6 | Article 37| 23 Paul et al. Cell-type-specific transcriptome during circuit assembly
TableA2 | List of RNA in situ hybridization primers.
Primer name Sequence 50 > 30
Pvalb(AP)-F GGATGTCGATGACAGACGTG Pvalb(AP)-R TTGTTTCTCCAGCATTTCCA Pvalb(AP)-T7-R taatacgactcactatagggTTGTTTCTCCAGCATTTCCA Pvalb(AP)-T3-F aattaaccctcactaaagggGGATGTCGATGACAGACGTG Lypd6-F TGACCATGGGAAGTTATCTGTG Lypd6-R AAGTCAGGCCTAGAGGTTTTCC Lypd6-T3-F aattaaccctcactaaagggTGACCATGGGAAGTTATCTGTG Lypd6-T7-R taatacgactcactatagggAAGTCAGGCCTAGAGGTTTTCC ACAM-F GCTCATTTTCCTCCTGATATGG ACAM-R CTTCTTGACTGTGGTGACTTGC ACAM-T7-R taatacgactcactatagggCTTCTTGACTGTGGTGACTTGC ACAM-T3-F aattaaccctcactaaagggGCTCATTTTCCTCCTGATATGG Kirrel3-F GCCTCCTCTTCCCACCAT Kirrel3-R AGGAAGGGAGAACACGGG Kirrel3-T7-R taatacgactcactatagggAGGAAGGGAGAACACGGG Kirrel3-T3-F aattaaccctcactaaagggGCCTCCTCTTCCCACCAT Lgi3-F CAGTGTCCAGGCTCTCTATGTG Lgi3-R CTCAGGCTGTCTCAGGATTCTT Lgi3-T7-R taatacgactcactatagggCTCAGGCTGTCTCAGGATTCTT Lgi3-T3-F aattaaccctcactaaagggCAGTGTCCAGGCTCTCTATGTG Erbb2ip-F GGATCCAGAACTTGGATTTAGC Erbb2ip-R TAACAAGGACACCGCTTGC Erbb2ip-T7-R taatacgactcactatagggTAACAAGGACACCGCTTGC Erbb2ip-T3-F aattaaccctcactaaagggGGATCCAGAACTTGGATTTAGC Kirrel1-F GAAGGCGAGCGTGTCATT Kirrel1-R CGATTCACCGTCTCCACC Kirrel1-T7-R taatacgactcactatagggCGATTCACCGTCTCCACC Kirrel1-T3-F aattaaccctcactaaagggGAAGGCGAGCGTGTCATT Phyhip-F CTTCTGTCGTGACCGGCT Phyhip-R GGAGGGATGGACGGTTCT Phyhip-T7-R taatacgactcactatagggGGAGGGATGGACGGTTCT Phyhip-T3-F aattaaccctcactaaagggCTTCTGTCGTGACCGGCT Lphn3-F CCGAGAACACAGTCATGTGG Lphn3-R TCCACTCTGTGAGGGAGCTT Lphn3-T7-R taatacgactcactatagggTCCACTCTGTGAGGGAGCTT Lphn3-T3-F aattaaccctcactaaagggCCGAGAACACAGTCATGTGG Arhgap21-F AAGAAGTCTGCTCGCTTCAAGT Arhgap21-R GGCTAGACCCAGCTTAAAGTCA Arhgap21-T7-R taatacgactcactatagggGGCTAGACCCAGCTTAAAGTCA Arhgap21-T3-F aattaaccctcactaaagggAAGAAGTCTGCTCGCTTCAAGT
Frontiers in Neural Circuits www.frontiersin.org June 2012 | Volume 6 | Article 37| 24