DOCSLIB.ORG

Rieck Et Al.- Supplementary Gene List Figure 1- FINAL

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Rieck Et Al.- Supplementary Gene List Figure 1- FINAL Separation of GFP+ and GFP- populations from Mip-GFP mice. (A) SSC (side scatter) is proportional to cell complexity and depends on the number of organelles inside the cell. FSC (forward scatter) correlates with cell size. GFP 530/30-A measures strength of an individual cells GFP intensity. (A-D) Freshly isolated islets from CD1+ female mouse (no GFP expression) were used to calibrate the cell sorter before GFP sorting began. (E) Plotting both SSC and FSC shows all cells collected as shown by the highlighted gate. (F) Only singlet or non-aggregated cells were used for ecient cell sorting. (G-H) Two distinct populations of cells were collected separately for further analysis. Dierentially expressed genes during pregnancy day 14.5 (FC 1.5 and FDR 20%) GeneSymbol Fold Change GeneName C85627 53.11 expressed sequence C85627 Cldn8 51.06 claudin 8 LOC382109 27.98 Hypothetical protein E330023O18 Lrrc55 26.70 leucine rich repeat containing 55 Fbxw14 25.85 F-box and WD-40 domain protein 14 Tph1 19.14 tryptophan hydroxylase 1 Itk 18.16 IL2-inducible T-cell kinase Gdf3 17.91 growth differentiation factor 3 Tph2 12.09 tryptophan hydroxylase 2 Cish 10.88 cytokine inducible SH2-containing protein 8.91 EG382156 8.77 predicted gene, EG382156 1700124P09Rik 8.70 RIKEN cDNA 1700124P09 gene Gpc6 7.29 glypican 6 5830443L24Rik 7.25 RIKEN cDNA 5830443L24 gene Fmo1 7.20 flavin containing monooxygenase 1 5830417I10Rik 7.09 RIKEN cDNA 5830417I10 gene Sftpd 6.98 surfactant associated protein D 6430550H21Rik 6.39 RIKEN cDNA 6430550H21 gene 1810009J06Rik 6.38 RIKEN cDNA 1810009J06 gene Neb 5.84 nebulin Ehhadh 5.71 enoyl-Coenzyme A LOC382106 5.65 hypothetical protein LOC382106 9430069I07Rik 5.58 RIKEN cDNA 9430069I07 gene Crispld2 5.28cysteine-rich secretory protein LCCL domain containing 2 Il1rn 5.14 interleukin 1 receptor antagonist 5.10 ENSMUST00000028318 Pax8 4.87 paired box gene 8 Oas2 4.80 2'-5' oligoadenylate synthetase 2 Rasgrp1 4.77 RAS guanyl releasing protein 1 4933425B16Rik 4.70 RIKEN cDNA 4933425B16 gene Igfbp5 4.40 insulin-like growth factor binding protein 5 Lztr2 4.38 leucine zipper transcription regulator 2 E330037M01Rik 4.31 RIKEN cDNA E330037M01 gene B3galnt1 UDP-GalNAc:betaGlcNAc4.28 beta 1,3-galactosaminyltransferase, polypeptide 1 Fbxw15 4.24 F-box and WD-40 domain protein 15 Chgb 4.19 chromogranin B Dnmt3b 4.19 DNA methyltransferase 3B D5Ertd579e 4.18 DNA segment, Chr 5, ERATO Doi 579, expressed Cspg5 4.15 chondroitin sulfate proteoglycan 5 Apobec1 3.98 apolipoprotein B editing complex 1 Lonrf3 3.97 LON peptidase N-terminal domain and ring finger 3 Krt80 3.91 keratin 80 Txnrd2 3.90 thioredoxin reductase 2 Dnahc8 3.88 dynein, axonemal, heavy chain 8 Matn2 3.59 matrilin 2 Gbp4 3.54 guanylate nucleotide binding protein 4 3.42 Hsbp1 3.38 heat shock factor binding protein 1 Ngfr 3.35nerve growth factor receptor (TNFR superfamily, member 16) Ivd 3.34 isovaleryl coenzyme A dehydrogenase 3.32 Olfr58 3.28 olfactory receptor 58 Trib3 3.27 tribbles homolog 3 (Drosophila) Tnfrsf11b 3.27tumor necrosis factor receptor superfamily, member 11b 3.26 Grem2 3.24gremlin 2 homolog, cysteine knot superfamily (Xenopus laevis) 3.21 3.20 3.19 BC019537 3.19 cDNA sequence BC019537 C030047K22Rik 3.17 RIKEN cDNA C030047K22 gene Ipo11 3.17 importin 11 Angptl6 3.14 angiopoietin-like 6 3.10 Socs2 3.08 suppressor of cytokine signaling 2 Olfr330 3.05 olfactory receptor 330 Slc2a13 solute3.05 carrier family 2 (facilitated glucose transporter), member 13 Hod 3.04 homeobox only domain 4833427G06Rik 3.03 RIKEN cDNA 4833427G06 gene 2900024C23Rik 3.01 RIKEN cDNA 2900024C23 gene Mup1 2.99 major urinary protein 1 2810055F11Rik 2.99 RIKEN cDNA 2810055F11 gene 1810044A24Rik 2.96 RIKEN cDNA 1810044A24 gene 4930527E24Rik 2.93 RIKEN cDNA 4930527E24 gene Pycr1 2.92 pyrroline-5-carboxylate reductase 1 Acta2 2.91 actin, alpha 2, smooth muscle, aorta Otoa 2.91 otoancorin Slc40a1 2.88solute carrier family 40 (iron-regulated transporter), member 1 A230106N23Rik 2.88 RIKEN cDNA A230106N23 gene Car15 2.85 carbonic anhydrase 15 2.83 Mbc2 2.81 membrane bound C2 domain containing protein 4933437F05Rik 2.78 RIKEN cDNA 4933437F05 gene Kl 2.78 klotho Grhl1 2.77 grainyhead-like 1 (Drosophila) D830013H12 2.76 hypothetical protein D830013H12 BC057170 2.76 cDNA sequence BC057170 1110018M03Rik 2.75 RIKEN cDNA 1110018M03 gene BC006662 2.75 cDNA sequence BC006662 Fmo4 2.75 flavin containing monooxygenase 4 4930488P18Rik 2.74 RIKEN cDNA 4930488P18 gene Ugt1a6b 2.74UDP glucuronosyltransferase 1 family, polypeptide A6B Tbc1d4 2.73 TBC1 domain family, member 4 Kirrel3 2.73 kin of IRRE like 3 (Drosophila) Bmp1 2.73 bone morphogenetic protein 1 Birc5 2.73 baculoviral IAP repeat-containing 5 Epb4.1l3 2.72 erythrocyte protein band 4.1-like 3 4930502E18Rik 2.70 RIKEN cDNA 4930502E18 gene Aqp4 2.70 aquaporin 4 2.69 B3galt1 UDP-Gal:betaGlcNAc2.66 beta 1,3-galactosyltransferase, polypeptide 1 Wipi1 2.66 WD repeat domain, phosphoinositide interacting 1 B630006K09Rik 2.65 RIKEN cDNA B630006K09 gene 5430401F13Rik 2.64 RIKEN cDNA 5430401F13 gene V1rc32 2.62 vomeronasal 1 receptor, C32 Prlr 2.62 prolactin receptor Myo3a 2.61 myosin IIIA C77713 2.61 expressed sequence C77713 Map3k13 2.60 mitogen-activated protein kinase kinase kinase 13 Hemk1 2.59 HemK methyltransferase family member 1 Cnn1 2.59 calponin 1 2.58 Clec1b 2.58 C-type lectin domain family 1, member b Derl3 2.57 Der1-like domain family, member 3 Zmynd10 2.57 zinc finger, MYND domain containing 10 Galt 2.57 galactose-1-phosphate uridyl transferase Neil3 2.57 nei like 3 (E. coli) Palld 2.56 palladin, cytoskeletal associated protein 2.56 Rbp7 2.56 retinol binding protein 7, cellular Aqp3 2.55 aquaporin 3 MGC118210 2.55 similar to XMR Gpr83 2.54 G protein-coupled receptor 83 Atf5 2.53 activating transcription factor 5 C3 2.53 complement component 3 C6 2.53 complement component 6 9430071P14Rik 2.52 RIKEN cDNA 9430071P14 gene Rbmx2 2.52 RNA binding motif protein, X-linked 2 Syce2 2.51 synaptonemal complex central element protein 2 2610209C05Rik 2.51 RIKEN cDNA 2610209C05 gene Serinc5 2.51 serine incorporator 5 Igfals 2.50insulin-like growth factor binding protein, acid labile subunit Enpp2 2.50ectonucleotide pyrophosphatase/phosphodiesterase 2 Lsm6 LSM62.48 homolog, U6 small nuclear RNA associated (S. cerevisiae) 2.48 2.48 E330009P21Rik 2.47 RIKEN cDNA E330009P21 gene Cpxm2 2.47 carboxypeptidase X 2 (M14 family) Abhd2 2.46 abhydrolase domain containing 2 Acvr1c 2.46 activin A receptor, type IC Lrrc8c 2.44 leucine rich repeat containing 8 family, member C Chac1 2.43 ChaC, cation transport regulator-like 1 (E. coli) Aass 2.42 aminoadipate-semialdehyde synthase Cldn2 2.42 claudin 2 Has2 2.41 hyaluronan synthase 2 Emilin1 2.40 elastin microfibril interfacer 1 Hapln4 2.40 hyaluronan and proteoglycan link protein 4 Dct 2.40 dopachrome tautomerase Mrpplf4 2.40 mitogen regulated protein, proliferin 4 C730048C13Rik 2.39 RIKEN cDNA C730048C13 gene Rims3 2.38 regulating synaptic membrane exocytosis 3 Il18bp 2.38 interleukin 18 binding protein Il18bp 2.36 interleukin 18 binding protein EG330097 2.36 predicted gene, EG330097 Creg1 2.35 cellular repressor of E1A-stimulated genes 1 V1rc14 2.35 vomeronasal 1 receptor, C14 Angptl7 2.34 angiopoietin-like 7 Olfr25 2.34 olfactory receptor 25 Tubb6 2.32 tubulin, beta 6 Slc2a6 solute2.32 carrier family 2 (facilitated glucose transporter), member 6 Creb3l3 2.32 cAMP responsive element binding protein 3-like 3 Gas5 2.31 growth arrest specific 5 Gja5 2.31 gap junction membrane channel protein alpha 5 Prkcm 2.30 protein kinase C, mu Fgl2 2.30 fibrinogen-like protein 2 Ott 2.28 ovary testis transcribed Nupr1 2.27 nuclear protein 1 2.27 Wnt9a 2.27 wingless-type MMTV integration site 9A 2.27 Lgals12 2.25 lectin, galactose binding, soluble 12 Wdr63 2.25 WD repeat domain 63 LOC638895 2.25 similar to vomeronasal 2, receptor, 1 Bnip3 2.25 BCL2/adenovirus E1B interacting protein 1, NIP3 Gna14 2.23 guanine nucleotide binding protein, alpha 14 Hecw2 HECT,2.23 C2 and WW domain containing E3 ubiquitin protein ligase 2 Phgdh 2.23 3-phosphoglycerate dehydrogenase Dpysl3 2.23 dihydropyrimidinase-like 3 Gabrp 2.23 gamma-aminobutyric acid (GABA-A) receptor, pi D2Ertd750e 2.23 DNA segment, Chr 2, ERATO Doi 750, expressed Mocos 2.22 molybdenum cofactor sulfurase LOC674214 2.22 hypothetical protein LOC674214 Sh3gl3 2.20 SH3-domain GRB2-like 3 Adamts9a disintegrin-like2.20 and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 9 Dppa3 2.20 developmental pluripotency-associated 3 Isg20 2.19 interferon-stimulated protein Id4 2.19 inhibitor of DNA binding 4 AI132189 2.17 expressed sequence AI132189 Npcd 2.17 neuronal pentraxin with chromo domain Aicda 2.17 activation-induced cytidine deaminase Lsm6 LSM62.16 homolog, U6 small nuclear RNA associated (S. cerevisiae) Olfr987 2.16 olfactory receptor 987 Pdlim4 2.16 PDZ and LIM domain 4 4933409K07Rik 2.16 RIKEN cDNA 4933409K07 gene B830017H08Rik 2.16 RIKEN cDNA B830017H08 gene 4933405D12Rik 2.16 RIKEN cDNA 4933405D12 gene Ovol2 2.16 ovo-like 2 (Drosophila) B930046C15Rik 2.15 RIKEN cDNA B930046C15 gene Gm1077 2.15 gene model 1077, (NCBI) Gm459 2.15 gene model 459, (NCBI) Oprs1 2.15 opioid receptor, sigma 1 2810026P18Rik 2.15 RIKEN cDNA 2810026P18 gene 2.14 Fhad1 2.13forkhead-associated (FHA) phosphopeptide binding domain 1 C8g 2.13 complement component 8, gamma subunit Ikzf4 2.12 IKAROS family zinc finger 4 LOC664837 2.12 similar to RIKEN cDNA 5031410I06 2.12 Tmem40 2.11 transmembrane protein 40 AU040320 2.11 expressed sequence AU040320 Cars 2.11 cysteinyl-tRNA synthetase D17H6S56E-5 2.11 DNA
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • The Global Architecture Shaping the Heterogeneity and Tissue-Dependency of the MHC Class I Immunopeptidome Is Evolutionarily Conserved
    bioRxiv preprint doi: https://doi.org/10.1101/2020.09.28.317750; this version posted September 29, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The Global Architecture Shaping the Heterogeneity and Tissue-Dependency of the MHC Class I Immunopeptidome is Evolutionarily Conserved Authors Peter Kubiniok†1, Ana Marcu†2,3, Leon Bichmann†2,4, Leon Kuchenbecker4, Heiko Schuster1,5, David Hamelin1, Jérome Despault1, Kevin Kovalchik1, Laura Wessling1, Oliver Kohlbacher4,7,8,9,10 Stefan Stevanovic2,3,6, Hans-Georg Rammensee2,3,6, Marian C. Neidert11, Isabelle Sirois1, Etienne Caron1,12* Affiliations *Corresponding and Leading author: Etienne Caron ([email protected]) †Equal contribution to this work 1CHU Sainte-Justine Research Center, Montreal, QC H3T 1C5, Canada 2Department of Immunology, Interfaculty Institute for Cell Biology, University of Tübingen, Tübingen, Baden-Württemberg, 72076, Germany. 3Cluster of Excellence iFIT (EXC 2180) "Image-Guided and Functionally Instructed Tumor Therapies", University of Tübingen, Tübingen, Baden-Württemberg, 72076, Germany. 4Applied Bioinformatics, Dept. of Computer Science, University of Tübingen, Tübingen, Baden- Württemberg, 72074, Germany. 5Immatics Biotechnologies GmbH, Tübingen, 72076, Baden-Württemberg, Germany. 6DKFZ Partner Site Tübingen, German Cancer Consortium (DKTK), Tübingen, Baden- Württemberg, 72076, Germany. 7Institute for Bioinformatics and Medical Informatics,
    [Show full text]
  • Identification of the Binding Partners for Hspb2 and Cryab Reveals
    Brigham Young University BYU ScholarsArchive Theses and Dissertations 2013-12-12 Identification of the Binding arP tners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non- Redundant Roles for Small Heat Shock Proteins Kelsey Murphey Langston Brigham Young University - Provo Follow this and additional works at: https://scholarsarchive.byu.edu/etd Part of the Microbiology Commons BYU ScholarsArchive Citation Langston, Kelsey Murphey, "Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins" (2013). Theses and Dissertations. 3822. https://scholarsarchive.byu.edu/etd/3822 This Thesis is brought to you for free and open access by BYU ScholarsArchive. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston A thesis submitted to the faculty of Brigham Young University in partial fulfillment of the requirements for the degree of Master of Science Julianne H. Grose, Chair William R. McCleary Brian Poole Department of Microbiology and Molecular Biology Brigham Young University December 2013 Copyright © 2013 Kelsey Langston All Rights Reserved ABSTRACT Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactors and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston Department of Microbiology and Molecular Biology, BYU Master of Science Small Heat Shock Proteins (sHSP) are molecular chaperones that play protective roles in cell survival and have been shown to possess chaperone activity.
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Tnfa-Induced Mucin 4 Expression Elicits Trastuzumab Resistance in HER2-Positive Breast Cancer María F
    Published OnlineFirst October 3, 2016; DOI: 10.1158/1078-0432.CCR-16-0970 Cancer Therapy: Clinical Clinical Cancer Research TNFa-Induced Mucin 4 Expression Elicits Trastuzumab Resistance in HER2-Positive Breast Cancer María F. Mercogliano1, Mara De Martino1, Leandro Venturutti1, Martín A. Rivas2, Cecilia J. Proietti1, Gloria Inurrigarro3, Isabel Frahm3, Daniel H. Allemand4, Ernesto Gil Deza5, Sandra Ares5, Felipe G. Gercovich5, Pablo Guzman 6, Juan C. Roa6,7, Patricia V. Elizalde1, and Roxana Schillaci1 Abstract Purpose: Although trastuzumab administration improved the Results: TNFa overexpression turned trastuzumab-sensitive outcome of HER2-positive breast cancer patients, resistance cells and tumors into resistant ones. Histopathologic findings events hamper its clinical benefits. We demonstrated that TNFa revealed mucin foci in TNFa-producing tumors. TNFa induced stimulation in vitro induces trastuzumab resistance in HER2- upregulation of MUC4 that reduced trastuzumab binding to its positive breast cancer cell lines. Here, we explored the mechanism epitope and impaired ADCC. Silencing MUC4 enhanced trastu- of TNFa-induced trastuzumab resistance and the therapeutic zumab binding, increased ADCC, and overcame trastuzumab and strategies to overcome it. trastuzumab-emtansine antiproliferative effects in TNFa-overex- Experimental Design: Trastuzumab-sensitive breast cancer pressing cells. Accordingly, administration of TNFa-blocking cells, genetically engineered to stably overexpress TNFa,and antibodies downregulated MUC4 and sensitized de novo trastu- de novo trastuzumab-resistant tumors, were used to evaluate zumab-resistant breast cancer cells and tumors to trastuzumab. In trastuzumab response and TNFa-blocking antibodies effective- HER2-positive breast cancer samples, MUC4 expression was ness respectively. Immunohistochemistry and antibody-depen- found to be an independent predictor of poor disease-free survival dent cell cytotoxicity (ADCC), together with siRNA strategy, (P ¼ 0.008).
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • Serine Proteases with Altered Sensitivity to Activity-Modulating
    (19) & (11) EP 2 045 321 A2 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 08.04.2009 Bulletin 2009/15 C12N 9/00 (2006.01) C12N 15/00 (2006.01) C12Q 1/37 (2006.01) (21) Application number: 09150549.5 (22) Date of filing: 26.05.2006 (84) Designated Contracting States: • Haupts, Ulrich AT BE BG CH CY CZ DE DK EE ES FI FR GB GR 51519 Odenthal (DE) HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI • Coco, Wayne SK TR 50737 Köln (DE) •Tebbe, Jan (30) Priority: 27.05.2005 EP 05104543 50733 Köln (DE) • Votsmeier, Christian (62) Document number(s) of the earlier application(s) in 50259 Pulheim (DE) accordance with Art. 76 EPC: • Scheidig, Andreas 06763303.2 / 1 883 696 50823 Köln (DE) (71) Applicant: Direvo Biotech AG (74) Representative: von Kreisler Selting Werner 50829 Köln (DE) Patentanwälte P.O. Box 10 22 41 (72) Inventors: 50462 Köln (DE) • Koltermann, André 82057 Icking (DE) Remarks: • Kettling, Ulrich This application was filed on 14-01-2009 as a 81477 München (DE) divisional application to the application mentioned under INID code 62. (54) Serine proteases with altered sensitivity to activity-modulating substances (57) The present invention provides variants of ser- screening of the library in the presence of one or several ine proteases of the S1 class with altered sensitivity to activity-modulating substances, selection of variants with one or more activity-modulating substances. A method altered sensitivity to one or several activity-modulating for the generation of such proteases is disclosed, com- substances and isolation of those polynucleotide se- prising the provision of a protease library encoding poly- quences that encode for the selected variants.
    [Show full text]
  • A Stealth Cloak for Cancer Cells
    BMB Rep. 2021; 54(7): 344-355 BMB www.bmbreports.org Reports Invited Mini Review Mucin in cancer: a stealth cloak for cancer cells Dong-Han Wi1, Jong-Ho Cha2,3 & Youn-Sang Jung1,* 1Department of Life Science, Chung-Ang University, Seoul, 06974, 2Department of Biomedical Sciences, College of Medicine, Inha University, Incheon 22212, 3Department of Biomedical Science, Program in Biomedical Science and Engineering, Graduate school, Inha University, Incheon 22212, Korea Mucins are high molecular-weight epithelial glycoproteins and mucinous colorectal carcinoma (MCC) (3). Since tumor growth are implicated in many physiological processes, including epit- sites induce inhospitable conditions for them to survive, helial cell protection, signaling transduction, and tissue home- mucins are suggested as an oncogenic microenvironment that ostasis. Abnormality of mucus expression and structure contri- avoids hypoxia, acidic, and other biological hurdles. The com- butes to biological properties related to human cancer progress- position and structure of mucins enable them to mimic the ion. Tumor growth sites induce inhospitable conditions. Many surface of tumor cells like the surface of normal epithelial cells kinds of research suggest that mucins provide a microenviron- (4). Additionally, the mucus layer captures growth factors or ment to avoid hypoxia, acidic, and other biological conditions cytokines, contributing to cell growth of the tumor. Alter- that promote cancer progression. Given that the mucus layer natively, these properties interfere with the interaction bet- captures growth factors or cytokines, we propose that mucin ween the immune system and tumor cells. Indeed, a high helps to ameliorate inhospitable conditions in tumor-growing concentration of soluble mucins downregulates the motility sites.
    [Show full text]
  • Role of Active Contraction and Tropomodulins in Regulating Actin Filament Length and Sarcomere Structure in Developing Zebrafish Skeletal Muscle
    ORIGINAL RESEARCH published: 31 March 2016 doi: 10.3389/fphys.2016.00091 Role of Active Contraction and Tropomodulins in Regulating Actin Filament Length and Sarcomere Structure in Developing Zebrafish Skeletal Muscle Lise Mazelet 1, Matthew O. Parker 2, Mei Li 3, Anders Arner 3 and Rachel Ashworth 4* 1 School of Biological and Chemical Sciences, Queen Mary, University of London, London, UK, 2 School of Health Sciences and Social Work, University of Portsmouth, Portsmouth, UK, 3 Department of Physiology and Pharmacology, Karolinska Institutet, Stockholm, Sweden, 4 The Blizard Institute/Institute of Health Sciences Education, Barts and The London School of Medicine and Dentistry, London, UK Whilst it is recognized that contraction plays an important part in maintaining the structure and function of mature skeletal muscle, its role during development remains undefined. In this study the role of movement in skeletal muscle maturation was investigated in intact zebrafish embryos using a combination of genetic and pharmacological approaches. An immotile mutant line (cacnb1ts25) which lacks functional voltage-gated calcium channels (dihydropyridine receptors) in the muscle and pharmacological immobilization of embryos Edited by: with a reversible anesthetic (Tricaine), allowed the study of paralysis (in mutants and Catherine Coirault, anesthetized fish) and recovery of movement (reversal of anesthetic treatment). The Institut National de la Santé et de la Recherche Médicale, France effect of paralysis in early embryos (aged between 17 and 24 hours post-fertilization, hpf) Reviewed by: on skeletal muscle structure at both myofibrillar and myofilament level was determined Corrado Poggesi, using both immunostaining with confocal microscopy and small angle X-ray diffraction.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Weber 37 Supplementary Data
    Supplementary Data Metallothionein Family Gene Gene Name logFC P. Value False Discovery Rate MT1G Metallothionein 1G 2.62 1.19E-10 4.66E-08 MT1H Metallothionein 1H 2.58 4.87E-08 7.12E-06 MT1M Metallothionein 1M 2.23 1.18E-07 1.44E-05 MT1X Metallothionein 1X 2.21 2.64E-11 1.25E-08 MT2A Metallothionein 2A 1.82 1.38E-12 1.26E-09 MT1E Metallothionein 1E 1.51 2.41E-11 1.18E-08 MT1F Metallothionein 1F 1.47 1.85E-09 4.09E-07 Unfolded Protein Response Gene Gene Name logFC P. Value False Discovery Rate AMFR autocrine motility factor receptor -0.20 9.94E-01 1.00 ASK1 mitogen-activated protein kinase kinase kinase 5 0.27 8.11E-01 1.00 ATF4 activating transcription factor 4 0.22 9.67E-01 1.00 ATF6 activating transcription factor 6 0.01 1.00 1.00 BCL2 BCL2, apoptosis regulator -0.43 4.80E-02 4.24E-01 BIP heat shock protein family A (Hsp70) member 5 0.13 1.00 1.00 CALR calreticulin 0.12 1.00 1.00 CANX calnexin 0.12 1.00 1.00 CHOP DNA damage inducible transcript 3 0.25 7.99E-01 1.00 EDEM ER degradation enhancing alpha-mannosidase like protein 1 0.37 1.88E-01 1.00 EIFA eukaryotic translation initiation factor 2A 0.06 1.00 1.00 ERO1LB endoplasmic reticulum oxidoreductase 1 beta -0.29 5.69E-01 1.00 GADD34 protein phosphatase 1 regulatory subunit 15A 1.18 3.66E-11 1.62E-08 GRP94 heat shock protein 90 beta family member 1 0.16 9.98E-01 1.00 HSPH1 heat shock protein family H (Hsp110) member 1 0.62 9.70E-06 5.12E-04 INSIG1 insulin induced gene 1 1.69 8.47E-18 3.88E-14 IRE1 endoplasmic reticulum to nucleus signaling 1 0.26 8.13E-01 1.00 JNK1 mitogen-activated
    [Show full text]