Curr Microbiol DOI 10.1007/s00284-012-0129-0

Transcriptional Regulation of the Genes Encoding Chitin and b-1,3-Glucan Synthases from Ustilago maydis

Mariana Robledo-Briones • Jose´ Ruiz-Herrera

Received: 24 November 2011 / Accepted: 5 April 2012 Ó Springer Science+Business Media, LLC 2012

Abstract Transcriptional regulation of genes encoding In fungi the wall is made of microfibrillar polysaccha- chitin synthases (CHS) and b-1,3-glucan synthase (GLS) rides and cementing compounds of glycoprotein nature. from Ustilago maydis was studied. Transcript levels were The fungal microfibrillar polysaccharides are chitin and measured during the growth curve of yeast and mycelial b-glucans. Chitin is made of N-acetylglucosamine units forms, in response to ionic and osmotic stress, and during joined by b-1,4-linkages, and b-1,3-glucans, the major infection of maize plants. Expression of the single GLS gene polysaccharides of fungal walls, are made of glucose units was constitutive. In contrast, CHS genes expression showed [for reviews see [19], [24]]. differences depending on environmental conditions. Tran- Fungi contain more than one chitin synthase (Chs), a script levels were slightly higher in the mycelial forms, the property that may correspond to a compensatory mechanism highest levels occurring at the log phase. Ionic and osmotic [16, 20], and the number of b-1,3-glucan synthases (Gls) stress induced alterations in the expression of CHS genes, but rarely exceed two. For example, U. maydis possesses eight not following a defined pattern, some genes were induced genes encoding chitin synthases and only one encoding and others repressed by the tested compounds. Changes in b-1,3-glucan synthases [6, 7, 27–29]. Chitin synthases have transcripts were more apparent during the pathogenic pro- been classified in two division and five Classes. Division 1 cess. At early infection stages, only CHS6 gene showed includes Classes I–III, and division 2 Classes IV and V. Each significant transcript levels, whereas at the period of tumor division has different conserved motifs, the enzymes formation CHS7 and CHS8 genes were also were induced. belonging to division 1 have a lower molecular size than division 2 enzymes, and in these the characteristic QXRRW pentapeptide (‘‘signature sequence)’’ is closer to the C ter- Introduction minus [20]. Taking into consideration the importance of chitin and The cell wall is the rigid outer layer that completely covers b-glucans in the construction of the cell wall, and the scant the cells of a large number of organisms, both prokaryotes information on the level of regulation of the genes encoding and eukaryotes. The cell wall has many functions: to pro- their synthases [4, 12, 13, 18, 25] we have proceeded to tect the cell against the difference in osmotic pressure analyze the transcriptional regulation of the genes encoding between the cytoplasm and the environment, to protect the chitin and b-1,3-glucan synthases in U. maydis at different cell against the chemical and biological aggression of the developmental stages, under some stress conditions, and medium, such as the action of lytic enzymes, toxic com- during the invasion of its host. This Basidiomycota fungus is pounds, predators, etc., and to provide the shape to the cell. a specific pathogen of maize that requires its host to complete the sexual life cycle [for reviews see [5], [11], [22], [26]]. The fungus alternates two morphologies, a yeast-like sap- M. Robledo-Briones J. Ruiz-Herrera (&) rophytic haploid stage and a dikaryotic mycelial pathogenic Departamento de Ingenierı´a Gene´tica, Unidad Irapuato, form. This dimorphic switch can be reproduced in the lab- Centro de Investigacio´n y de Estudios Avanzados del Instituto Polite´cnico Nacional, Irapuato, GTO, Mexico oratory by control of the external pH [21], by growth in the e-mail: [email protected] presence of fatty acids [10] or by nitrogen deprivation [2]. 123 M. Robledo-Briones, J. Ruiz-Herrera: Transcriptional regulation

Materials and Methods and SuperScript II reverse transcriptase (Invitrogene) according to manufacturer’s instructions [9]. PCR reactions Strains, Media, and Growth Conditions proceeded by incubation of an aliquot of cDNA with specific oligonucleotides and DNA polymerase (Invitrogene) using The wild type strains FB1 and FB2 of U. maydis [1] were the following program: an initial cycle of denaturalization at used. The strains were maintained in 50 % glycerol at 94 °C for 2 min followed by about 30 cycles (see below) at -70 °C, and recovered in complex medium (CM; [8]) 94 °C for 15 s, alignment for 30 s, extension at 68 °C for before each experiment. Cells (1 9 10 6 cells/mL) were 1 min; and final extension at 68 °C for 5 min. Considering inoculated in MM liquid medium [8] and incubated in a the conservation of CHS genes, design of oligonucleotides shaking water bath at 28 °C. Yeast or mycelial morphol- for PCR involved the search of specific regions for each gene ogies were obtained following the protocol described in (see Table 1). Optimal temperature of hybridization and the [21]. Stress by salts or sorbitol was induced by concen- number of hybridization cycles to obtain results in the linear trations that produced a growth inhibition of about 30 % range of amplification were determined for each gene. PCR with respect to a control without stress (see ‘‘Results’’). At products were separated by gel electrophoresis on 1 % intervals samples were withdrawn and cells recovered by agarose gels and photographed. Transcript levels were centrifugation. Cell morphology of each sample was determined with the Image J program. The reported results observed by light microscopy, and cell growth was mea- correspond to the average of data from three different growth sured by their optical density (OD) at 600 nm, and data cultures with duplicate samples ± standard deviation. Data were converted to cell protein by use of a standard curve. corresponding to CHS genes expression were related to the values of GLS gene expression that remained constant under Nucleic Acids Techniques all assay conditions.

DNA of U. maydis was isolated as described in [3]. Isolation Plant Inoculation of RNA was made with Trizol (Invitrogene) according to the manufacturer instructions. U. maydis gene sequences were Six batches of 10-days-old maize plantlets (10/batch) were obtained from the mips genome page (http://mips.helmholtz- inoculated as described in [14] with 10 lL of a mixture of muenchen.de/genre/proj/ustilago/). RNA concentration was FB1 and FB2 cells (108 cells/mL). Plants were incubated in a measured with a NanoDrop, and its integrity and concen- greenhouse until the disease symptoms developed (chloro- tration were determined by electrophoresis in agarose gels. sis, increased anthocyanin, and tumors). The zones with the Reverse transcription was performed using 1 lg samples of most significant symptoms from three 10-plant batches DNAase-treated RNA. These were incubated with oligo dT were excised after 5 days post-inoculation (showing only

Table 1 Sequence of Gene SEQ_ID Primer Primer sequence oligonucleotides used for PCR of CHS and GLS genes CHS1 um10718 F-50 CTTTCAGACGTTGGCGCCAGC R-50 CGAGTGAGCTGGATCTTTTTG CHS2 um04290 F-50 CGAAGCACAGCAACCAACCAC R-50 GATTTGCTGATACTGCTGGCC CHS3 um10120 F-50 GCCTATTATTCGAGACCGGCTT R-50 GCGATACCAGCTGCTCTTCCAA CHS4 um10117 F-50 GCCACCTCGCTACCCATTT R-50 CCCTCTTGAGCGTCTTGTAT CHS5 um10277 F-50 CACGTTGATTCCTGTCTCGAC R-50 CTGTCCAACGTTCCGGTCCTTC CHS6 um10367 F-50 CGCAGGCGGCATCGATGA R-50 CGGATTCGTTGCGTTGAGC CHS7 um05480 F-50 GCGACCAGGAAGTGATTATCGATA R-50 CGATGGCTGTGGTGGATGCTGAT CHS8 um03204 F-50 GGACCGACTATGAAAACGAGC R-50 GAAGGCTGAGGCATGAACCC GLS um01639 F-50 GCCGAGGTCATCTTCCCCATCTGC R-50 AAGCGCGGTTTGTCTCGTCGTG

123 M. Robledo-Briones, J. Ruiz-Herrera: Transcriptional regulation chlorosis) or 10 days post-inoculation (white tumors) were transcript levels of the single GLS gene remained constant in recovered, ground with liquid nitrogen, and used for RNA both conditions throughout the growth curve, same as occur- isolation. Gene expression was measured by RT-PCR as red in all further experiments (not shown). Therefore we described above. Results of the experiment are reported as further used this gene as an internal control to determine the the average of the three 10 plant batches analyzed in dupli- levels of CHS genes expression. In contrast, transcript levels cates ± standard deviation, and expressed as above. of the eight CHS genes showed differences among them- selves, according to the growth conditions used and throughout the growth curve. In the yeast form, in general Results transcript levels of CHS genes were slightly lower than those from mycelium, with the exception of CHS4 (Fig. 1a, b vs. Transcriptional Regulation of CHS and GLS Genes Fig. 1c, d), and genes belonging to Division 1 (for CHS gene During Yeast-like or Mycelial Growth classification see [20]) were lower than those belonging to Division 2 (Fig. 1a, c vs. Fig. 1b, d). In addition, expression of To determine the regulation at the transcriptional level of Division 1 genes suffered only small variations along the U. maydis CHS and GLS genes from cells grown in the yeast or growth curve, in contrast to Division 2 genes that displayed mycelial forms, the fungus was grown in MM of pH 3.0 noticeable alterations under the same conditions. All genes (mycelium) or pH 7.0 (yeasts) at 28 °C under shaking con- showed a maximal expression in the log phase at about ditions. At different times (14, 18, 27, 42 and 50 h) cell growth 14–18 h of incubation, with a further decline in expression, and morphology were determined as described above, cells more noticeable for Division 2 genes. Genes CHS2, CHS7, were recovered by centrifugation, RNA was isolated, and and CHS8 showed a late increase in transcription at the sta- subjected to analysis by RT-PCR. It was observed that tionary phase in both yeast and mycelial cells.

a 1.2 µg/ 1.2 mL b 1 500 1

0.8 400 0.8

0.6 300 0.6

0.4 200 0.4 Relative Expression 0.2 100 Relative Expression 0.2

0 0 0 1020304050 01020304050 Time (h) Time (h)

c 1.2 µg/ 1.2 mL d 1 500 1

0.8 400 0.8

0.6 300 0.6

0.4 200 0.4 Relative Expression 0.2 100 Relative Expression 0.2

0 0 01020304050 01020304050 Time (h) Time (h)

Fig. 1 Transcripts levels of CHS genes of U. maydis during the Data represent average values from three different cultures analyzed growth curve in the yeast or mycelial forms. The fungus was grown in in duplicate ± standard deviation and are expressed relative to values MM pH 7 (a, b yeast-like form), or MM pH 3 (c, d, mycelial form), of GLS gene transcription that remained constant through all the and at different incubation times samples were withdrawn, growth experiment. a, c CHS genes belonging to Division 1, diamonds CHS1; was measured by OD at 600 nm, and data transformed into cell squares CHS2; triangles CHS3; circles CHS4. b, d CHS genes protein by a standard curve. Cell morphology was checked by belonging to Division 2, diamonds CHS5; squares CHS6; empty microscopic observations. Cells were recovered by centrifugations, triangles CHS7; circles CHS8.Ina and c growth of the cultures in lg RNA was isolated and used to measure gene expression by RT-PCR. protein/mL are shown (black triangles)

123 M. Robledo-Briones, J. Ruiz-Herrera: Transcriptional regulation

Changes in the Transcription Levels of CHS and GLS 10 mM LiCl originated ca. 30 % growth inhibition, Genes in Response to Salt or Osmotic Stress whereas NaCl, KCl or sorbitol required a 1 M concentra- tion to cause a similar inhibitory effect (not shown). U. maydis is particularly sensitive to osmotic and salt stress Nevertheless Li? effect on CHS transcription was different: [3]. Accordingly, we measured the effect of monovalent it inhibited only 3 genes in the yeast form and 2 in the cations and sorbitol on the expression of CHS and GLS genes mycelium, and stimulated transcription of two genes in using concentrations that reduced growth by about 30 % as yeast and four in mycelium form, whereas Na? inhibited 5 compared to a control without inhibitors measuring the effect genes in yeast and 4 in mycelium, stimulating 3 and of different concentrations of the compounds on cell growth. 2 genes in yeast or mycelium respectively. K? inhibited Cells were incubated as described above in pH 3 or pH 7 MM 5 yeast and 3 mycelium genes and stimulated 3 genes in in the presence of 1 M NaCl, 1 M KCl, 1 M sorbitol, or yeast and 4 in mycelium. Finally, sorbitol inhibited 4 genes 10 mM LiCl. A culture without additions was used as a and stimulated 2 genes in either form. control. After 20 h cells were harvested, RNA was extracted, and gene transcription was measured by RT-PCR. As indi- Transcription of CHS and GLS Genes During Infection cated above, GLS transcription was constitutive (not shown). of Maize Seedlings In contrast, transcription of CHS genes, showed noticeable differences, although the response was not homogeneous, Maize seedlings were inoculated with mixture of FB1 and the same substance producing inhibitory or stimulatory FB2 U. maydis strains as described in methods. The first effects on the transcription of the two different genes. symptoms observed in infected maize are development of Additionally, a different response was observed for the yeast chlorosis and increased anthocyanin formation. After- and mycelial forms, a higher inhibitory effect being observed wards, formation of tumors containing pleomorphic in yeasts (see Fig. 2a, b). mycelium that later on gives raise to teliospores occurs. Based on the concentrations required to inhibit growth, When chlorosis developed, leaf zones with the symptoms Li? was the most toxic of the tested compounds since were cut and processed to obtain RNA. Later on, when

Fig. 2 Effect of stress by salts a or sorbitol on transcription of CHS genes of U. maydis in the yeast (a) or mycelium (b) forms. Cells were grown in MM medium added of 1 M NaCl. 1 M KCl, 1 M sorbitol or 10 mM Li?. A control without addition was included. After 20 h, growth and cell morphology were determined as described in Fig. 1. RNA was isolated and used to measure gene expression by RT-PCR. Data represent average values from three different cultures CHS1 CHS2 CHS3 CHS4 CHS5 CHS6 CHS7 CHS8 analyzed in duplicate ± standard deviation and are b expressed relative to values of GLS gene transcription that remained constant through all the experiment. Gray bars control; white bars NaCl; bars with inclined lines KCl; black bars LiCl; bars with horizontal lines sorbitol

CHS1 CHS2 CHS3 CHS4 CHS5 CHS6 CHS7 CHS8

123 M. Robledo-Briones, J. Ruiz-Herrera: Transcriptional regulation

1.2 during dimorphism in Paracoccidioides brasiliensis [23]. Also up-regulation of the homologue FKS1 gene was 1 observed in Lentinus edodes in response to addition of olive 0.8 mill waste waters [18]. Regulation of CHS genes has been shown to occur at the 0.6 transcriptional and post-transcriptional levels. Transcrip- 0.4 tional regulation was reported to take place during the dimorphic transition of Candida albicans [4], Mucor cir- Relative Expression 0.2 cinelloides [13] and Paracoccidioides brasiliensis [17], 0 where in general mycelial genes were up-regulated. In the CHS1 CHS2 CHS3 CHS4 CHS5 CHS6 CHS7 CHS8 present study, we observed slightly higher transcript levels in mycelium, the exception being CHS4. These results Fig. 3 Transcript levels of CHS genes of U. maydis during the infection of maize seedlings. Six batches of 10 maize seedlings each agree with Weber et al. [29], who observed that U. maydis were inoculated with a mixture of FB1 and FB2 strains. At the stage CHS genes in the dikaryotic mycelium obtained in vitro of the chlorosis, and initial tumors, zones with defined symptoms were up-regulated with the exception of CHS7. Regulation were isolated from three batches, and RNA was obtained, and used to of CHS genes under salt or osmotic stress indicated a lack measure RT-PCR. Data represent average values from three different 10-plant batches analyzed in duplicate ± standard deviation and are of relationship between inhibition of cell growth and wall expressed relative to values of GLS gene transcription that remained synthesis. Accordingly, LiCl was the most toxic agent for constant through all the experiment. Black bars chlorosis stage; white growth, but using concentrations that caused the same level bars immature tumor stage of growth inhibition, its effect on CHS gene expression was minor than that brought about by NaCl, KCl, or sorbitol. white (initial) tumors were formed, these were excised and Also interesting was the absence of a regular pattern of RNA was also obtained. Afterwards, transcript levels of behavior of the several salts and sorbitol on gene expres- CHS and GLS genes were measured by RT-PCR as above. sion. Accordingly, the compounds inhibited some genes Again, no variation in transcript levels of GLS was and stimulated others that did not coincide in the yeast and observed during the pathogenic process (not shown). In mycelial forms. This diverse response may be due to subtle contrast, expression of CHS genes showed noticeable differences in the regulatory regions of the several CHS changes (Fig. 3). During the chlorosis stage, no transcripts genes. The possibility that an effect of pH besides dimor- of genes CHS1, CHS2, and CHS8 were detected, whereas phic transition is involved in gene regulation cannot be CHS3, CHS4, and CHS7 showed low levels of transcrip- dismissed at this time. tion; but interestingly, high transcript levels of CHS6 were Important data were obtained when measuring regula- detected. At the stage of white tumors, transcription of tion of CHS genes during U. maydis infection of maize genes CHS1, CHS2, and CHS3 remained repressed, same seedling. The observation that at the chlorosis stage only as occurred with CHS5, while CHS6, CHS7, and CHS8 CHS6 showed significant expression can be related with the were expressed to high levels. report that U. maydis chs6 mutants were avirulent, the fungus being eliminated from the plants at early periods of the infection [6]. In the stage of white tumor, high tran- Discussion script levels of CHS6, CHS7, and CHS8 genes were observed agreeing with the observation that chs6 and chs8 The observation that transcription of the single GLS gene of mutants are not able to induce tumors [6, 29], and that chs7 U. maydis was constitutive, and its expression did not change mutants form only small tumors [29]. These results suggest under any of the conditions here tested, became a surprise that CHS6 is responsible for chitin formation at the early since it constituted the first observation of this behavior of the stages of infection, and that together with CHS8 it is b-1,3-glucan-encoding genes in fungi. In Saccharomyces indispensable for continuing invasion of the plant and cerevisiae, probably the best studied system, the two genes tumor formation, whereas CHS7 has a role, though not encoding b-1,3-glucan synthases: FKS1 and FKS2 are highly decisive, in the formation of tumors. The rest of CHS genes regulated. FKS1 is expressed predominantly during the cell apparently have no role during maize infection, and pos- cycle. On the contrary, FKS2 is expressed at low levels in the sibly at other stages of fungal development their functions optimal growth conditions, and its expression is increased may be interchangeable [27, 28]. under restricted growth conditions or in fks1 mutants [15]. In In conclusion, our data suggest that in U. maydis, Beauveria bassiana, transcriptional regulation of GLS genes alterations in CHS, but not in GLS genes regulation, are is determinant for remodeling of the cell wall [25], and dif- important for remodeling of the cell wall in response to ferential regulation of the homologous gene was observed different changes in the environmental conditions. 123 M. Robledo-Briones, J. Ruiz-Herrera: Transcriptional regulation

Acknowledgments This study was partially supported by Consejo 15. Mazur P, Morin N, Baginsky W, el-Sherbeini M, Clemas JA, Nacional de Ciencia y Tecnologı´a (CONACYT), Me´xico. MRB is a Nielsen JB, Foor F (1995) Differential expression and function of D. Sc. student supported by a fellowship from CONACYT. Thanks two homologous subunits of yeast 1,3-b-D-glucan synthase. Mol are given to Claudia Leo´n-Ramı´rez for her help during this Cell Biol 15:5671–5681 investigation. 16. Merz RA, Horsch M, Nyhle´n LE, Rast D (1999) Biochemistry of chitin synthase. In: Jolles P, Muzzarelli RAA (eds) Chitin and chitinases. Birkhauser Verlag, Basel, pp 9–37 References 17. Nin˜o-Vega GA, Munro CA, San-Blas G, Gooday GW, Gow NA (2000) Differential expression of chitin synthase genes during temperature-induced dimorphic transitions in Paracoccidioides 1. Banuett F, Herskowitz I (1989) Different a alleles of Ustilago brasiliensis. Med Mycol 38:31–39 maydis are necessary for maintenance of filamentous growth but 18. Reverberi M, Di Mario F, Tomati U (2004) b-Glucan synthase not for meiosis. Proc Natl Acad Sci USA 86:5878–5882 induction in mushrooms grown on olive mill wastewaters. Appl 2. Banuett F, Herskowitz I (1994) Morphological transitions in the Microbiol Biotechnol 66:217–225 life cycle of Ustilago maydis and their genetic control by the a 19. Ruiz-Herrera J, Elorza MV, Alvarez PE, Sentandreu R (2004) and b loci. Exp Mycol 18:247–266 Biosynthesis of the fungal cell wall. In: San-Blas G, Calderone 3. Cervantes-Cha´vez JA, Ortiz-Castellanos L, Tejeda-Sartorius M, NA (eds) Pathogenic fungi, structural: biology and taxonomy. Gold S, Ruiz-Herrera J (2010) Functional analysis of the pH Caister Academic Press, Wymondham, pp 41–99 responsive pathway Pal/Rim in the phytopathogenic basidiomy- 20. Ruiz-Herrera J, Gonza´lez-Prieto JM, Ruiz-Medrano R (2001) cete Ustilago maydis. Fungal Genet Biol 47:446–457 Evolution and phylogenetic relationships of chitin synthases from 4. Chen-Wu JL, Zwicker J, Bowen AR, Robbins PW (1992) yeasts and fungi. FEMS Yeast Res 1:247–256 Expression of chitin synthase genes during yeast and hyphal 21. Ruiz-Herrera J, Leo´n CG, Guevara-Olvera L, Carabez-Trejo A growth phases of Candida albicans. Mol Microbiol 6:497–502 (1995) Yeast-mycelial dimorphism of haploid and diploid strains 5. Feldbru¨gge M, Ka¨mper J, Steinberg G, Kahmann R (2004) of Ustilago maydis. Microbiology 141:695–770 Regulation of mating and pathogenic development in Ustilago 22. Ruiz-Herrera J, Martı´nez-Espinoza AD (1998) The fungus Usti- maydis. Curr Opin Microbiol 7:666–672 lago maydis, from the aztec cuisine to the research laboratory. Int 6. Garcera´-Teruel A, Xoconostle-Ca´zares B, Rosas-Quijano R, Microbiol 1:149–158 Ortiz L, Leo´n-Ramı´rez C, Specht CA, Sentandreu R, Ruiz-Her- 23. San-Blas G, Nin˜o-Vega G, Iturriaga T (2002) Paracoccidioides rera J (2004) Loss of virulence in Ustilago maydis by Umchs6 brasiliensis and paracoccidioidomycosis: molecular approaches to gene disruption. Res Microbiol 155:87–97 morphogenesis, diagnosis, epidemiology, taxonomy, and genetics. 7. Gold SE, Kronstad JW (1994) Disruption of two genes for chitin Med Mycol 40:225–242 synthase in the phytopathogenic fungus Ustilago maydis. Mol 24. Sentandreu R, Elorza MV, Valentı´n E, Ruiz-Herrera J (2004) The Microbiol 11:897–902 structure and composition of fungal cell wall. In: San-Blas G, 8. Holliday R (1961) The genetics of Ustilago maydis. Genet Res Calderone NA (eds) Pathogenic fungi: structural, biology, and 2:204–230 taxonomy. Caister Academic Press, Wymondham, pp 3–27 9. Huang Z, Fasco MJ, Kaminsky LS (1996) Optimization of 25. Tartar A, Shapiro AM, Scharf DW, Boucias DG (2005) Differ- DNAse I removal of contaminating DNA from RNA for use in ential expression of chitin synthase (CHS) and glucan synthase quantitative RNA-PCR. Biotechniques 20:1012–1020 (FKS) genes correlates with the formation of a modified, thinner 10. Klose J, de Sa´ MM, Kronstad JW (2004) Lipid-induced fila- cell wall in in vivo produced Beauveria bassiana cells. Myco- mentous growth in Ustilago maydis. Mol Microbiol 52(823):835 pathologia 160:303–314 11. Klosterman SJ, Perlin MH, Garcia-Pedrajas M, Covert SF, Gold 26. Vollmeister E, Schipper K, Baumann S, Haag C, Pohlmann T, SE (2007) Genetics of morphogenesis and pathogenic develop- Stock J, Feldbru¨gge M (2012). Fungal development of the plant ment of Ustilago maydis. Adv Genet 57:1–47 pathogen Ustilago maydis. FEMS Microbiol Rev 36:59–77 12. Liu H, Kauffman S, Becker JM, Szaniszlo PJ (2004) Wangiella 27. Xoconostle-Cazares B, Leon-Ramirez C, Ruiz-Herrera J (1996) (Exophiala) dermatitidis WdChs5p, a class V chitin synthase, is Two chitin synthase genes from Ustilago maydis. Microbiology essential for sustained cell growth at temperature of infection. 142:377–387 Eukaryot Cell 3:40–51 28. Xoconostle-Ca´zares B, Specht CA, Robbins PW, Liu Y, Leo´nC, 13. Lo´pez-Matas MA, Eslava AP, Diaz-Minguez JM (2000) Mcchs1, Ruiz-Herrera J (1997) Umchs5, a gene coding for a class IV chitin a member of a chitin synthase gene family in Mucor circinello- synthase in Ustilago maydis. Fungal Genet Biol 22:199–208 ides, is differentially expressed during dimorphism. Curr Micro- 29. Weber I, Assmann D, Thines E, Steinberg G (2006) Polar biol 40:169–175 localizing class V myosin chitin synthases are essential during 14. Martinez-Espinoza AD, Leo´n C, Elizarraraz G, Ruiz-Herrera J early plant infection in the plant pathogenic fungus Ustilago (1997) Monomorphic non-pathogenic mutants of Ustilago may- maydis. Plant Cell 18:225–242 dis. Phytopathology 87:259–265

123