Curr Microbiol DOI 10.1007/s00284-012-0129-0 Transcriptional Regulation of the Genes Encoding Chitin and b-1,3-Glucan Synthases from Ustilago maydis Mariana Robledo-Briones • Jose´ Ruiz-Herrera Received: 24 November 2011 / Accepted: 5 April 2012 Ó Springer Science+Business Media, LLC 2012 Abstract Transcriptional regulation of genes encoding In fungi the wall is made of microfibrillar polysaccha- chitin synthases (CHS) and b-1,3-glucan synthase (GLS) rides and cementing compounds of glycoprotein nature. from Ustilago maydis was studied. Transcript levels were The fungal microfibrillar polysaccharides are chitin and measured during the growth curve of yeast and mycelial b-glucans. Chitin is made of N-acetylglucosamine units forms, in response to ionic and osmotic stress, and during joined by b-1,4-linkages, and b-1,3-glucans, the major infection of maize plants. Expression of the single GLS gene polysaccharides of fungal walls, are made of glucose units was constitutive. In contrast, CHS genes expression showed [for reviews see [19], [24]]. differences depending on environmental conditions. Tran- Fungi contain more than one chitin synthase (Chs), a script levels were slightly higher in the mycelial forms, the property that may correspond to a compensatory mechanism highest levels occurring at the log phase. Ionic and osmotic [16, 20], and the number of b-1,3-glucan synthases (Gls) stress induced alterations in the expression of CHS genes, but rarely exceed two. For example, U. maydis possesses eight not following a defined pattern, some genes were induced genes encoding chitin synthases and only one encoding and others repressed by the tested compounds. Changes in b-1,3-glucan synthases [6, 7, 27–29]. Chitin synthases have transcripts were more apparent during the pathogenic pro- been classified in two division and five Classes. Division 1 cess. At early infection stages, only CHS6 gene showed includes Classes I–III, and division 2 Classes IV and V. Each significant transcript levels, whereas at the period of tumor division has different conserved motifs, the enzymes formation CHS7 and CHS8 genes were also were induced. belonging to division 1 have a lower molecular size than division 2 enzymes, and in these the characteristic QXRRW pentapeptide (‘‘signature sequence)’’ is closer to the C ter- Introduction minus [20]. Taking into consideration the importance of chitin and The cell wall is the rigid outer layer that completely covers b-glucans in the construction of the cell wall, and the scant the cells of a large number of organisms, both prokaryotes information on the level of regulation of the genes encoding and eukaryotes. The cell wall has many functions: to pro- their synthases [4, 12, 13, 18, 25] we have proceeded to tect the cell against the difference in osmotic pressure analyze the transcriptional regulation of the genes encoding between the cytoplasm and the environment, to protect the chitin and b-1,3-glucan synthases in U. maydis at different cell against the chemical and biological aggression of the developmental stages, under some stress conditions, and medium, such as the action of lytic enzymes, toxic com- during the invasion of its host. This Basidiomycota fungus is pounds, predators, etc., and to provide the shape to the cell. a specific pathogen of maize that requires its host to complete the sexual life cycle [for reviews see [5], [11], [22], [26]]. The fungus alternates two morphologies, a yeast-like sap- M. Robledo-Briones Á J. Ruiz-Herrera (&) rophytic haploid stage and a dikaryotic mycelial pathogenic Departamento de Ingenierı´a Gene´tica, Unidad Irapuato, form. This dimorphic switch can be reproduced in the lab- Centro de Investigacio´n y de Estudios Avanzados del Instituto Polite´cnico Nacional, Irapuato, GTO, Mexico oratory by control of the external pH [21], by growth in the e-mail: [email protected] presence of fatty acids [10] or by nitrogen deprivation [2]. 123 M. Robledo-Briones, J. Ruiz-Herrera: Transcriptional regulation Materials and Methods and SuperScript II reverse transcriptase (Invitrogene) according to manufacturer’s instructions [9]. PCR reactions Strains, Media, and Growth Conditions proceeded by incubation of an aliquot of cDNA with specific oligonucleotides and DNA polymerase (Invitrogene) using The wild type strains FB1 and FB2 of U. maydis [1] were the following program: an initial cycle of denaturalization at used. The strains were maintained in 50 % glycerol at 94 °C for 2 min followed by about 30 cycles (see below) at -70 °C, and recovered in complex medium (CM; [8]) 94 °C for 15 s, alignment for 30 s, extension at 68 °C for before each experiment. Cells (1 9 10 6 cells/mL) were 1 min; and final extension at 68 °C for 5 min. Considering inoculated in MM liquid medium [8] and incubated in a the conservation of CHS genes, design of oligonucleotides shaking water bath at 28 °C. Yeast or mycelial morphol- for PCR involved the search of specific regions for each gene ogies were obtained following the protocol described in (see Table 1). Optimal temperature of hybridization and the [21]. Stress by salts or sorbitol was induced by concen- number of hybridization cycles to obtain results in the linear trations that produced a growth inhibition of about 30 % range of amplification were determined for each gene. PCR with respect to a control without stress (see ‘‘Results’’). At products were separated by gel electrophoresis on 1 % intervals samples were withdrawn and cells recovered by agarose gels and photographed. Transcript levels were centrifugation. Cell morphology of each sample was determined with the Image J program. The reported results observed by light microscopy, and cell growth was mea- correspond to the average of data from three different growth sured by their optical density (OD) at 600 nm, and data cultures with duplicate samples ± standard deviation. Data were converted to cell protein by use of a standard curve. corresponding to CHS genes expression were related to the values of GLS gene expression that remained constant under Nucleic Acids Techniques all assay conditions. DNA of U. maydis was isolated as described in [3]. Isolation Plant Inoculation of RNA was made with Trizol (Invitrogene) according to the manufacturer instructions. U. maydis gene sequences were Six batches of 10-days-old maize plantlets (10/batch) were obtained from the mips genome page (http://mips.helmholtz- inoculated as described in [14] with 10 lL of a mixture of muenchen.de/genre/proj/ustilago/). RNA concentration was FB1 and FB2 cells (108 cells/mL). Plants were incubated in a measured with a NanoDrop, and its integrity and concen- greenhouse until the disease symptoms developed (chloro- tration were determined by electrophoresis in agarose gels. sis, increased anthocyanin, and tumors). The zones with the Reverse transcription was performed using 1 lg samples of most significant symptoms from three 10-plant batches DNAase-treated RNA. These were incubated with oligo dT were excised after 5 days post-inoculation (showing only Table 1 Sequence of Gene SEQ_ID Primer Primer sequence oligonucleotides used for PCR of CHS and GLS genes CHS1 um10718 F-50 CTTTCAGACGTTGGCGCCAGC R-50 CGAGTGAGCTGGATCTTTTTG CHS2 um04290 F-50 CGAAGCACAGCAACCAACCAC R-50 GATTTGCTGATACTGCTGGCC CHS3 um10120 F-50 GCCTATTATTCGAGACCGGCTT R-50 GCGATACCAGCTGCTCTTCCAA CHS4 um10117 F-50 GCCACCTCGCTACCCATTT R-50 CCCTCTTGAGCGTCTTGTAT CHS5 um10277 F-50 CACGTTGATTCCTGTCTCGAC R-50 CTGTCCAACGTTCCGGTCCTTC CHS6 um10367 F-50 CGCAGGCGGCATCGATGA R-50 CGGATTCGTTGCGTTGAGC CHS7 um05480 F-50 GCGACCAGGAAGTGATTATCGATA R-50 CGATGGCTGTGGTGGATGCTGAT CHS8 um03204 F-50 GGACCGACTATGAAAACGAGC R-50 GAAGGCTGAGGCATGAACCC GLS um01639 F-50 GCCGAGGTCATCTTCCCCATCTGC R-50 AAGCGCGGTTTGTCTCGTCGTG 123 M. Robledo-Briones, J. Ruiz-Herrera: Transcriptional regulation chlorosis) or 10 days post-inoculation (white tumors) were transcript levels of the single GLS gene remained constant in recovered, ground with liquid nitrogen, and used for RNA both conditions throughout the growth curve, same as occur- isolation. Gene expression was measured by RT-PCR as red in all further experiments (not shown). Therefore we described above. Results of the experiment are reported as further used this gene as an internal control to determine the the average of the three 10 plant batches analyzed in dupli- levels of CHS genes expression. In contrast, transcript levels cates ± standard deviation, and expressed as above. of the eight CHS genes showed differences among them- selves, according to the growth conditions used and throughout the growth curve. In the yeast form, in general Results transcript levels of CHS genes were slightly lower than those from mycelium, with the exception of CHS4 (Fig. 1a, b vs. Transcriptional Regulation of CHS and GLS Genes Fig. 1c, d), and genes belonging to Division 1 (for CHS gene During Yeast-like or Mycelial Growth classification see [20]) were lower than those belonging to Division 2 (Fig. 1a, c vs. Fig. 1b, d). In addition, expression of To determine the regulation at the transcriptional level of Division 1 genes suffered only small variations along the U. maydis CHS and GLS genes from cells grown in the yeast or growth curve, in contrast to Division 2 genes that displayed mycelial forms, the fungus was grown in MM of pH 3.0 noticeable alterations under the same conditions. All genes (mycelium) or pH 7.0 (yeasts) at 28 °C under shaking con- showed a maximal expression in the log phase at about ditions. At different times (14, 18, 27, 42 and 50 h) cell