BRCA1 Induces Antioxidant Gene Expression and Resistance to Oxidative Stress
Total Page：16
File Type：pdf, Size：1020Kb
[CANCER RESEARCH 64, 7893–7909, November 1, 2004] BRCA1 Induces Antioxidant Gene Expression and Resistance to Oxidative Stress Insoo Bae,1 Saijun Fan,1 Qinghui Meng,1 Jeong Keun Rih,1 Hee Jong Kim,1 Hyo Jin Kang,1 Jingwen Xu,1 Itzhak D. Goldberg,2 Anil K. Jaiswal,3 and Eliot M. Rosen1 1Department of Oncology, Lombardi Cancer Center, Georgetown University, Washington, DC; 2Department of Radiation Oncology, Long Island Jewish Medical Center, The Long Island Campus for the Albert Einstein College of Medicine, New Hyde Park, New York; and 3Department of Pharmacology, Baylor College of Medicine, Houston, Texas ABSTRACT binding protein), retinoblastoma 1, retinoblastoma 1-associated pro- teins (RbAp46/48), and several histone deaceylases (HDAC-1/2)], Mutations of the breast cancer susceptibility gene 1 (BRCA1), a tumor and/or sequence-specific DNA-binding transcription factors (e.g., suppressor, confer an increased risk for breast, ovarian, and prostate p53, c-Myc, estrogen receptor, and other proteins; refs. 7–12). cancers. To investigate the function of the BRCA1 gene, we performed DNA microarray and confirmatory reverse transcription-PCR analyses to Some of the functions of BRCA1 cited above may be due, in part, identify BRCA1-regulated gene expression changes. We found that to regulation of specific transcriptional pathways by BRCA1, but the BRCA1 up-regulates the expression of multiple genes involved in the linkage of these functions to BRCA1-regulated transcription is not cytoprotective antioxidant response, including glutathione S-transferases, well understood. We used cell culture models of BRCA1 overexpres- oxidoreductases, and other antioxidant genes. Consistent with these find- sion, underexpression, and mutational inactivation to identify patterns ings, BRCA1 overexpression conferred resistance while BRCA1 deficiency of BRCA1-regulated gene expression. The identification of antioxi- conferred sensitivity to several different oxidizing agents (hydrogen per- dant genes as transcriptional targets of BRCA1 led to the findings that oxide and paraquat). In addition, in the setting of oxidative stress (due to BRCA1 regulates the activity of the antioxidant response transcription hydrogen peroxide), BRCA1 shifted the cellular redox balance to a higher factor nuclear factor erythroid-derived 2 like 2 [also called NRF2 ratio of reduced to oxidized glutathione. Finally, BRCA1 stimulated an- (NFE2L2)] and protects cells against oxidative stress. tioxidant response element-driven transcriptional activity and enhanced the activity of the antioxidant response transcription factor nuclear factor erythroid-derived 2 like 2 [also called NRF2 (NFE2L2)]. The ability of BRCA1 to stimulate antioxidant response element-dependent transcrip- MATERIALS AND METHODS tion and to protect cells against oxidative stress was attenuated by inhi- Cell Lines and Culture bition of nuclear factor erythroid-derived 2 like 2. These findings suggest a novel function for BRCA1, i.e., to protect cells against oxidative stress. Human prostate (DU-145, LNCaP) and breast (MCF-7, T47D) cancer cell This function would be consistent with the postulated role of BRCA1 as a lines were obtained from the American Type Culture Collection (Manassas, caretaker gene in preserving genomic integrity. VA) and cultured as described before (12, 13). The stable wild-type BRCA1 (wtBRCA1) and control (Neo) DU-145 cell clones were isolated and charac- INTRODUCTION terized earlier (14, 15). A mouse embryonic fibroblast (MEF) cell line ho- mozygous for a deletion of Brca1 exon 11 and the control wild-type Inherited mutations of the breast cancer susceptibility gene breast (Brca1ϩ/ϩ) MEFs (16) were provided by Dr. Chuxia Deng (National Institutes cancer susceptibility gene 1 (BRCA1) confer an increased risk for of Diabetes, Digestive and Kidney Diseases, Bethesda, MD). All of the above breast, ovarian, and prostate cancers (1, 2). In addition, BRCA1 cell types were grown in DMEM supplemented with 5% (DU-145) or 10% (all expression is often decreased or absent in sporadic breast and ovarian other cell types) v/v fetal calf serum, L-glutamine (5 mmol/L), nonessential amino acids (5 mmol/L), penicillin (100 units/mL), and streptomycin (100 cancers due, in part, to promoter methylation or other causes, sug- g/mL; all obtained from BioWhittaker, Walkersville, MD). gesting a role for BRCA1 in nonhereditary tumors (3, 4). The specific EBV-immortalized peripheral blood lymphocyte cell lines R794 and R1041 functions of the BRCA1 gene that contribute to tumor suppression are were derived from a female BRCA1 (185delAG) and BRCA2 (6174delT) unclear. However, established functional roles for BRCA1 include the mutation carrier, respectively. These lymphoblastoid cell lines were provided regulation of cell cycle progression, DNA damage signaling and by the Tissue Culture Shared Resource of the Lombardi Comprehensive repair, maintenance of genomic integrity, and the regulation of vari- Cancer Center. The genotypes of the cells were confirmed by the Familial ous transcriptional pathways [reviewed by Rosen et al. (5)]. Cancer Registry of the Lombardi Comprehensive Cancer Center. A role for BRCA1 in transcriptional regulation was first suggested by the finding that BRCA1 has a conserved acidic COOH-terminal BRCA1 Expression Vectors and Transfections transcriptional activation domain (6). Although BRCA1 is not known For transient expression experiments, cells were transfected with a wild- to bind to specific DNA sequences, it may regulate transcription type BRCA1 expression vector (wtBRCA1) consisting of the full-length through protein:protein interactions with components of the basal BRCA1 cDNA within the pcDNA3 mammalian expression vector (Invitrogen, transcription factor (e.g., RNA helicase A and RNA pol II), transcrip- Carlsbad, CA) or within the pCMV-Tag2B vector (Stratagene, La Jolla, CA), tional coactivators and corepressors [e.g., p300 and its functional which allows expression of the full-length protein containing a NH2-terminal homologue CBP (the cAMP-responsive element binding protein- FLAG epitope tag. Both the untagged and the FLAG-tagged proteins are expressed well and exhibit identical biological activities (13). Methodologies used for transient transfections have been reported previously (13, 15) and are Received 4/6/04; revised 7/16/04; accepted 8/16/04. Grant support: USPHS Grants R01-CA80000, R01-CA82599, and R01-ES09169, also briefly described below. Susan G. Komen Breast Cancer Foundation Grant BCTR0201295 (E. Rosen) and United States Army Idea Award DAMD17-02-1-0525 (I. Bae). Small Interfering (si) RNAs The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with The BRCA1 and control (scrambled-sequence) siRNAs were described earlier 18 U.S.C. Section 1734 solely to indicate this fact. Note: Supplementary data for this article can be found at Cancer Research Online (15). All siRNAs were chemically synthesized by Dharmacon, Inc. (Lafayette, (http://cancerres.aacrjournals.org). CO). For siRNA treatments, subconfluent proliferating cells were treated with Requests for reprints: Eliot M. Rosen, Department of Oncology, Lombardi Cancer each siRNA (50 nmol/L), with siPORT Amine reagent (Ambion, Austin, TX). The Center, Georgetown University, 3970 Reservoir Road, NW, Box 571469, Washington, cells were incubated with siRNA for 72 hours (to reduce BRCA1 protein levels to DC 20057-1469. Phone: (202) 687-7695; Fax: (202) 687-7256; E-mail: emr36@ Ͻ georgetown.edu. 25% of control) before the start of the experiment. The control siRNA has no ©2004 American Association for Cancer Research. effect on BRCA1 levels (15), and neither siRNA is toxic to the cells under these 7893 Downloaded from cancerres.aacrjournals.org on September 29, 2021. © 2004 American Association for Cancer Research. BRCA1, GENE EXPRESSION, AND OXIDATIVE STRESS Table 1 PCR primers and expected product sizes for semi-quantitative reverse transcription-PCR analyses Gene name Symbol Primer sequences (5Ј33Ј) Genbank accession no. Product size (bp) Breast cancer susceptibility gene 1 BRCA1 F: ttgcgggaggaaaatgggtagtta U14680 292 B: tgtgccaagggtgaatgatgaaag Annexin 1 ANX1 F: agtcatccaaggtggtcccgg NM_000700 539 B: ggccctggcatctgaatcagcc Mesoderm specific transcript homologue MEST F: actatttcctaaaatcacaggacattaagg NM_002402 411 B: atcacttaataatcctgctttgactaagac Microphthalmia-associated transcription factor MITF F: ctaacctgtacaacaactctcgatctc XM_010977 486 B: atcacttaataatcctgctttgactaagac Microsomal GST1 MGSTI F: aaaagaccacgagctcagga AY368173 346 B: 5 aaagacctgacccaaaacЈ Cardiac ankyrin repeat protein CARP F: gtgttgtgaagatgtacctaatgaagtt XM_051726 297 B: taatcagccctctcttaaaaactcttac Coch-5B2 COCH1 F: aaagcagatgtcctctgcccaggggg XM_007471 300 B: tttcctgtattggaattaccccctctg Brain-derived neutrophic factor BDNF F: gattcataaggatagacacttcttgtg XM_006027 287 B: aaggaatgtaatgcagactttttaagtt G0-S transition 2 G0S2 F: gctgttttttatttggacttaacttcagag M72885 531 B: ccttttgatgttaaaatgctaaatctcacg Tumor necrosis factor ␣ TNFA F: tacagatgaatgtatttatttgggagac M10988 198 B: atcagcattgtttagacaacttaatcag Prostacyclin-stimulating factor F: gtatctcctctaagtaaggaagatgctg S75725 299 B: tgtgatctttattttgtatttctctgtg Expressed sequence tags, weakly similar to TAL-6 F: ttcttctggtactggagaataataacaac R16604 249 B: aatcccataagcctagaatctgtaaggaaac Ceruloplasmin CP F: tatagttctgatgtctttgacattttcc XM_011006 293 B: atgcttccagtcttcttttaatgtttat Tumor necrosis