US 2011 O159031A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2011/0159031 A1 Falkner et al. (43) Pub. Date: Jun. 30, 2011

(54) VACCNE TO INFLUENZA AVIRUS Related U.S. Application Data (60) Provisional application No. 61/289.309, filed on Dec. (75) Inventors: Falko G. Falkner, Orth/Donau 22, 2009. (AT); Otfried Kistner, Vienna (AT); Annett Hessel, Orth/Donau Publication Classification (AT); P. Noel Barrett, (51) Int. Cl. Klosterneuburg/Weidling (AT); A 6LX 39/285 (2006.01) Hartmut Ehrlich, Vienna (AT); CI2N 15/63 (2006.01) Georg Holzer, Wiener Neudorf CI2N 5/863 (2006.01) (AT) CI2N 7/01 (2006.01) A6IP37/04 (2006.01) A6IP3 L/16 (2006.01) (73) Assignees: BAXTER INTERNATIONAL INC., Deerfield, IL (US); BAXTER (52) U.S. Cl...... 424/199.1; 435/320.1; 435/235.1 HEALTHCARE S.A., Glattpark (57) ABSTRACT (Opfikon) (CH) The present invention relates, in general, to compositions and methods for administering a vaccine against influenza to a (21) Appl. No.: 12/976,145 Subject, the vaccine comprising a vaccinia virus vector and a hemagglutinin and neuraminidase gene, separate or in com (22) Filed: Dec. 22, 2010 bination, from an influenza A virus. Patent Application Publication Jun. 30, 2011 Sheet 1 of 9 US 2011/O159031 A1

Figure 1.

A) kDa 2 3 4 5 6 7 8 9

kDa

25

20 Patent Application Publication Jun. 30, 2011 Sheet 2 of 9 US 2011/O159031 A1

Figure 2.

3.

& is as 3 C QP { {3 M W 2------ims ims N. NB N N Red N. N.

3 g g &g : - - - - a- - -

2- Y - s x.3 &w w& &w 3. E. a. s s: s s& s &axs s

Figure 3.

A)

8 & 3 Mis--a g 'fi....Ca 40 8 if A Ni -- E3

2 4 3 8 2 & 32224: 83.83332 83 2 3 838 & 2 22:38 283 time after challenge (days) time after challenge (days) Patent Application Publication Jun. 30, 2011 Sheet 3 of 9 US 2011/O159031 A1

Figure 4.

00

&

Fig. 4

Figure 5.

[[] ××

Fig. 5 Patent Application Publication Jun. 30, 2011 Sheet 4 of 9 US 2011/O159031 A1

Figure 6.

e O-or O 25 30 35 40 45 25 30 35 40 45 days days 4. O C

2

O 25 30 35 40 45 25 30 35 40 45 days days -o- Lung, H17CA PP -- Lung, N1/CA PP -e- Spleen, H17CA PP -A- Spleen, N1/CA PP

Patent Application Publication Jun. 30, 2011 Sheet 6 of 9 US 2011/O159031 A1

Figure 9.

VALYSELF AVRGOECI GYANNSTEK WERNW WHAKE) EE THINGKECKN GPEEEGIC SAGWE, GNP ECRLSWE WSY EVEKENP RGCY GS NOYEEKE, SSWKHFEKVK ELPKDRWTOH TTTGGSRACA WSCNPSFFRN WWTKKGSN YEWAKGSYNN TSGEOMLI:W GVHHPNDETE ORTY (NVGT YVSV GTSTN KRSTPC ATR PKWNGCSRM EFSWTEMW NEES ON EAPEY GE'KI SKRGSSGMK 8, GENCE KCQ PGAIN TTLPFHNVHP ET GECPKYV KSEKLYIATG I, RNVPCIQSR ERRRKKRGLF GAAGFEGG WOGMVDGWYG YHHSNCCGSG YAADKESTOK AFIGITNKVN SVIEKMNT OF EAVGKEFSNL ERRENINKK MEDGFLOVW YNAELVME NERTIF HOS NWKN YOKVR MOE, RINVKEI. GNCCFE FY HK CEECMNSWK NGTYYKYE EESKNRNEI KGVKSSVGV YO3. L.A.IYA:W AGSISLAMM AGSEN, CSN GS3...QCRICI* (SEQ ID NO : 5)

Figure 10.

mHS promoter Sg|P promoter

*A, Ca DSR

sWA- H1--Ca

Figure 11.

dark NP lark

------I ------... MW, DA, RSR intergei regio Patent Application Publication Jun. 30, 2011 Sheet 7 of 9 US 2011/O159031 A1

Figure 12.

-A A.

HA2

Figure 13.

O O i

106 10-5 104 MVA wt PBS VVA--N1 Ca

US 2011/O 159031 A1 Jun. 30, 2011

VACCNE TO INFLUENZA AVIRUS newly identified H1N1 strain. Efficient induction of antibod ies and surprisingly high levels of CD8 T cells were induced CROSS REFERENCE TO RELATED against both antigens. APPLICATIONS SUMMARY OF THE INVENTION 0001. This application claims the priority benefit of U.S. Provisional Patent Application No. 61/289.309, filed Dec. 22, 0007. The present invention relates to the preparation and 2009, hereby incorporated by reference in its entirety. use of an antigenic composition or recombinant virus com prising a vaccinia virus vector and polynucleotides encoding FIELD OF THE INVENTION influenza A genes that are relevant in producing an immune response and influenza infection. The antigenic composition 0002 The present invention relates, in general, to compo and recombinant virus are useful as a vaccine to induce an sitions and methods for administering a vaccine against influ immune response in a Subject against the heterologous influ enza to a subject, the vaccine comprising a vaccinia virus enza genes expressed by the virus. vectorandahemagglutinin and neuraminidase gene, separate 0008. In one aspect, the invention provides an antigenic composition comprising a vaccinia virus vector comprising a or in combination, from an influenza A virus. polynucleotide encoding a hemagglutinin protein (HA) from influenza A and a polynucleotide encoding a neuraminidase BACKGROUND OF THE INVENTION protein (NA) from an influenza A virus, wherein the HA is of subtype selected from the group consisting of H1, H2, H3, 0003. The emergence and global spread of the new H1N1 H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, and influenza Subtype in humans has made the development of H16, and wherein the NA is of a subtype selected from the vaccines against pandemic influenza viruses a global health group consisting of N1, N2, N3, N4, N5, N6, N7, N8 and N9. priority. Several strategies are currently followed to produce pandemic vaccines, such as the development of inactivated whole virus vaccines, Subunit vaccines, recombinant viral proteins and live vaccines. Vaccines based on inactivated influenza virus are usually derived from embryonated hens eggs or, more recently, from permanent cell cultures. Protec tive immunity elicited by these vaccines is mainly based on neutralizing antibodies directed against the hemagglutinin gene (HA) (20, 21). 0004 Abroader immune response including efficientanti bodies against the influenza Surface proteins and induction of CD8 T cells, as induced by live vaccines, would be desirable. Attenuated live vaccines based on cold-adapted influenza strains (1,10) or on nonreplicating, NS-1 gene-deleted influ enza virus (12, 18) presumably have these advantages. Intra nasal application of Such pre-pandemic live vaccines, how ever, might result in new reassortant strains by co-infections in the respiratory tract with wild-type influenza strains raising safety concerns. In certain instances, influenza reassortants of the cold-adapted internal gene backbone with avian strains seem to have incompatible gene segments and induce only Subpotent immune responses (6). Only the re-introduction of the polybasic cleavage site into the HA (previously deleted to attenuate the live virus) restored infectivity and immunoge nicity (17). In another case, passaging of the live vaccine in host cells was required to achieve acceptable growth. Passag ing, however, may result in reduced immunogenicity requir 0010. In one embodiment, the polynucleotide encoding ing screening of adequate reassortants (6). Further, the long the HA and the polynucleotide encoding the NA are derived term effect of repeated intranasal administration of high doses from the same virus strain. In another embodiment, the poly of live vaccines on the olfactory system is largely unknown. nucleotide encoding the HA and the polynucleotide encoding 0005 Live vaccines based on poxviral vectors, such as the NA are derived from different virus strains. In a related vaccinia virus vectors, including the highly inactivated modi embodiment, the HA is derived from subtype H1 and the NA fied vaccinia Ankara Vector, are alternatives to prior vaccines derived from subtype N1. In a further embodiment, the HA as these vectors have a long safety record, induce T cell and NA are derived from influenza A strain virus A/Califor responses and are usually administered by demonstrated Sub nia/07/2009. cutaneous or intramuscular routes. 0011. In some embodiments, the H1 HA protein encoded 0006. The purpose of this study was to evaluate the by the polynucleotide is set out in FIG. 8 (SEQID NO: 14) or immune response and the protective potential of vaccinia FIG. 14A (SEQID NO: 16). In a related embodiment, the N1 based influenza vaccines expressing the protective antigens NA protein encoded by the polynucleotide is set out in FIG. hemagglutinin and neuraminidase, as exemplified against a 14B (SEQID NO: 17). US 2011/O 159031 A1 Jun. 30, 2011

0012. In certain embodiments, the HA is of subtype H2. In derived from subtype N1. In a further embodiment, the HA one embodiment, the amino acid sequence of the H2 protein and NA are derived from influenza A strain virus A/Califor is set out in FIG.9 (SEQID NO: 15) or FIG.15 (SEQID NO: nia/07/2009. 19). 0023. In some embodiments, the H1 HA protein encoded 0013. It is further contemplated that the antigenic compo by the polynucleotide is set out in FIG. 8 (SEQID NO: 14) or sition described herein optionally comprises a polynucleotide FIG. 14A (SEQID NO: 16). In a related embodiment, the N1 encoding an influenza A nucleoprotein (NP) protein. In one NA protein encoded by the polynucleotide is set out in FIG. 14B (SEQID NO: 17). embodiment the amino acid sequence of the NP is set out FIG. 0024. In certain embodiments, the HA is of subtype H2. In 14C (SEQID NO: 18). one embodiment, the amino acid sequence of the H2 protein 0014. In some embodiments, the HA, NA and NP are is set out in FIG.9 (SEQID NO: 15) or FIG.15 (SEQID NO: derived from the same influenza strain or from different influ 19). enza A strains. For example, in Some embodiments the anti 0025. It is further contemplated that the antigenic compo genic composition comprises an HA, NA and NP from one or sition described herein optionally comprises a polynucleotide more of an H1N1, H2N1, H3N2 or H5N1 influenza virus. encoding an influenza A nucleoprotein (NP) protein. In one 0015. In one embodiment, the invention contemplates an embodiment the amino acid sequence of the NP is set out FIG. antigenic composition as described herein comprising poly 14C (SEQID NO: 18). nucleotides encoding an H5, an N1 and an NP protein. 0026. In some embodiments, the HA, NA and NP are 0016. In certain embodiments, the vaccinia virus is derived from the same influenza strain or from different influ selected from the group consisting of modified vaccinia enza Strains. For example, in some embodiments the recom Ankara (MVA), vaccinia virus Lister (VVL), and defective binant virus comprises an HA, NA and NP from one or more vaccinia Lister. Additional vaccinia viruses contemplated or of an H1N1, H2N1, H3N2 or H5N1 influenza virus. use in the invention include, but are not limited to, MVA-575 0027. In one embodiment, the invention contemplates a (ECACCV00120707) and MVA-BN (ECACCV00083008). recombinant virus as described herein comprising polynucle 0017. In some embodiments, the antigenic composition otides encoding an H5, an N1 and an NP protein. described herein is characterized by the ability to propagate in 0028. In certain embodiments, the vaccinia virus is vertebrate cell culture. In related embodiments, the vertebrate selected from the group consisting of modified vaccinia cell is selected from the group consisting of MRC-5, Vero, Ankara (MVA), vaccinia virus Lister (VVL), and defective CV-1, MDCK, MDBK, HEK, H9, CEM, PerC6, BHK-21, vaccinia Lister. Additional vaccinia viruses contemplated or BSC and LLC-MK2, DF-1, QT-35, or primary avian cells, use in the invention include, but are not limited to, MVA-575 Such as primary chicken cells or chicken cell aggregates. In (ECACCV00120707) and MVA-BN (ECACCV00083008). one embodiment, the vertebrate cell is a Vero cell. 0029. In some embodiments, the recombinant virus 0018. In one embodiment, the antigenic composition fur described herein is characterized by the ability to propagate in ther comprises a pharmaceutically acceptable carrier. vertebrate cell culture. In related embodiments, the vertebrate cell is selected from the group consisting of MRC-5, Vero, 0019. In a further embodiment, the HA of the antigenic CV-1, MDCK, MDBK, HEK, H9, CEM, PerC6, BHK-21, composition comprises a polybasic cleavage site. In one BSC and LLC-MK2, DF-1, QT-35, or primary avian cells, embodiment, the polybasic cleavage site has the amino acid Such as primary chicken cells or chicken cell aggregates. In sequence RERRRKKR (SEQ ID NO: 1). It is contemplated one embodiment, the vertebrate cell is a Vero cell. that the HA may naturally express a polybasic cleavage site or 0030. In one embodiment, the recombinant virus further may be altered to include a polybasic cleavage site. For comprises a pharmaceutically acceptable carrier. example, strains H5 and H7 naturally comprise a polybasic 0031. In a further embodiment, the HA of the recombinant cleavage site whereas H1 and other HA proteins do not natu virus comprises a polybasic cleavage site. In one embodi rally express a cleavage site but can be recombinantly engi ment, the polybasic cleavage site has the amino acid sequence neered to contain a polybasic cleavage site. RERRRKKR (SEQID NO: 1). It is contemplated that the HA 0020. In another aspect, the invention contemplates a may naturally express a polybasic cleavage site or may be recombinant vaccinia virus comprising a polynucleotide altered to include a polybasic cleavage site. encoding a hemagglutinin protein (HA) from influenza A and 0032. In a further aspect, the invention provides a vaccine a polynucleotide encoding a neuraminidase protein (NA) comprising: a vaccinia virus vector comprising a polynucle from an influenza A virus, wherein the HA is of subtype otide encoding a hemagglutinin protein (HA) from influenza selected from the group consisting of H1, H2, H3, H4, H5, A and a polynucleotide encoding a neuraminidase protein H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, and H16, (NA) from an influenza A virus, wherein the HA is from a and wherein the NA is of a subtype selected from the group subtype selected from the group consisting of H1, H2, H3, consisting of N1, N2, N3, N4, N5, N6, N7, N8 and N9. Any H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, and combination of the HA or NA subtype as described herein are H16, and wherein the NA is from a subtype selected from the useful in the recombinant virus. group consisting of N1, N2, N3, N4, N5, N6, N7, N8 and N9, 0021 Any combination of the HA or NA subtype as and wherein the polynucleotide encoding the HA and the described herein is useful in the recombinant virus. polynucleotide encoding the NA are operatively linked to 0022. In one embodiment, the polynucleotide encoding allow packaging of the polynucleotides into a virion. the HA and the polynucleotide encoding the NA are derived 0033. In a related aspect, the invention contemplates a from the same virus strain. In another embodiment, the poly vaccine comprising, i) a first vaccinia virus vector comprising nucleotide encoding the HA and the polynucleotide encoding a polynucleotide encoding a hemagglutinin protein (HA) the NA are derived from different virus strains. In a related from influenza A, and ii) a second vaccinia Vector comprising embodiment, the HA is derived from subtype H1 and the NA a polynucleotide encoding a neuraminidase protein (NA) US 2011/O 159031 A1 Jun. 30, 2011

from an influenza A virus, wherein the polynucleotide encod sisting of a vaccinia mH5 promoter, a vaccinia early/late ing the HA and the polynucleotide encoding the NA are promoter, a bacteriophage T7 promoter, a thymidine kinase operatively linked to allow packaging of the polynucleotides promoter, promoter of vaccinia virus gene coding for 7.5K into a virion. polypeptide, a promoter of vaccinia virus gene coding for 0034. Any combination of the HA or NA subtype as 19K polypeptide, a promoter of vaccinia virus gene coding described herein is useful in the vaccine. for 42K polypeptide, a promoter of vaccinia virus gene cod 0035. In one embodiment, the polynucleotide encoding ing for 28K polypeptide, a promoter of vaccinia virus gene the HA and the polynucleotide encoding the NA are derived coding for 11K polypeptide. from the same virus strain. In another embodiment, the poly 0046. In certain embodiments, the vaccine further com nucleotide encoding the HA and the polynucleotide encoding prising an adjuvant. the NA are derived from different virus strains. In a related 0047. In some embodiments, the vaccine is a live vaccine. embodiment, the HA is derived from subtype H1 and the NA 0048. In certain embodiments, it is contemplated that the derived from subtype N1. In a further embodiment, the HA vaccine is administered in a dose having a TCID50 from at and NA are derived from influenza A strain virus A/Califor least 10° to at least 10'. In one embodiment, the TCID50 is nia/07/2009. from at least 10° to 10', from at least 10 to 10, from at least 0036. In some embodiments, the H1 HA protein encoded 10 to 10 or from at least 107 to 10. In another embodiment, by the polynucleotide is set out in FIG. 8 (SEQID NO: 14) or the TCID50 is at least 5x107 or 5x10'. Instill anotherembodi FIG. 14A (SEQID NO: 16). In a related embodiment, the N1 ment, it is contemplated that a dose of the vaccine described NA protein encoded by the polynucleotide is set out in FIG. herein exhibits a TCID50 of at least 10, 10, 10, 10, 10, 14B (SEQID NO: 17). 107, 10, or 10. In one embodiment, the TCID50 is from 10 0037. In certain embodiments, the HA is of subtype H2. In to 10. It is contemplated that the dose is administered in one embodiment, the amino acid sequence of the H2 protein either a single dose or multiple doses. The total dose of is set out in FIG.9 (SEQID NO: 15) or FIG.15 (SEQID NO: vaccine may be split between multiple doses. 19). 0049. In an additional aspect, the invention provides a 0038. It is further contemplated that the vaccine described method for eliciting an immune response against at least one herein optionally comprises a polynucleotide encoding an influenza virus strain in a subject, comprising administering influenza A nucleoprotein (NP) protein. In one embodiment an antigenic composition, a recombinant vaccinia virus or a the amino acid sequence of the NP is set out FIG. 14C (SEQ vaccineas described herein in an amount effective to elicit the ID NO: 18). immune response against at least one influenza virus strain. 0039. In some embodiments, the HA, NA and NP are 0050. It is contemplated that an immune response derived from the same influenza strain or from different influ includes, but is not limited to, antibodies against the influenza enza strains. For example, in Some embodiments the anti proteins as well as induction of influenza-specific T cell genic composition comprises an HA, NA and NP from one or responses. Methods for measuring an immune response are more of an H1N1, H2N1, H3N2 or H5N1 influenza. described in greater detail in the Detailed Description and 0040. In one embodiment, the invention contemplates a Examples. vaccine as described herein comprising polynucleotides encoding an H5, an N1 and an NP protein. 0051. In another aspect, the invention provides a method 0041. In certain embodiments, the vaccinia virus is for preventing infection of a Subject by an influenza virus selected from the group consisting of modified vaccinia comprising, administering to the Subject an effective amount Ankara (MVA), vaccinia virus Lister (VVL), and defective of an antigenic composition, a recombinant vaccinia virus or vaccinia Lister. Additional vaccinia viruses contemplated or a vaccine as described herein in an amount effective to pre use in the invention include, but are not limited to, MVA-575 vent infection of the subject by the influenza virus. (ECACCV00120707) and MVA-BN (ECACCV00083008). 0052. In one embodiment, the influenza strain is a pan 0042. In some embodiments, the vaccine described herein demic strain. In another embodiment, the influenza strain is a is characterized by the ability to propagate in vertebrate cell seasonal influenza strain. culture. In related embodiments, the vertebrate cell is selected 0053. In certain embodiments, the subject is a vertebrate from the group consisting of MRC-5, Vero, CV-1, MDCK, Subject, including mammalian and avian Subjects. In one MDBK, HEK, H9, CEM, PerC6, BHK-21, BSC and LLC embodiment, the Subject is human. MK2, DF-1, QT-35, or primary avian cells, such as primary 0054 The invention further provides, in a further aspect, a chicken cells or chicken cell aggregates. In one embodiment, method of making a vaccine comprising a vaccinia virus the vertebrate cell is a Vero cell. vector and polynucleotide encoding a hemagglutinin protein 0043. In one embodiment, the vaccine further comprises a (HA) from influenza A and a polynucleotide encoding a pharmaceutically acceptable carrier. neuraminidase protein (NA) from an influenza A virus, 0044. In a further embodiment, the HA of the vaccine wherein the HA is of subtype selected from the group con comprises a polybasic cleavage site. In one embodiment, the sisting of H1, H2,H3, H4, H5, H6, H7, H8, H9, H10, H11, polybasic cleavage site has the amino acid sequence H12, H13, H14, H15, and H16, and wherein the NA is of a RERRRKKR (SEQID NO: 1). It is contemplated that the HA subtype selected from the group consisting of N1, N2, N3, may naturally express a polybasic cleavage site or may be N4, N5, N6, N7, N8 and N9, and optionally comprising a altered to include a polybasic cleavage site. polynucleotide encoding an influenza A nucleoprotein (NP) 0045. In still another embodiment, it is contemplated that protein, the method comprising transfecting the HA, NA, and in the vaccine, the polynucleotide encoding the HA, the poly optionally NP polynucleotides into the virus in vertebrate nucleotide encoding the NA and the polynucleotide encoding cells under conditions suitable for growth of the virus. the NP are each operably linked to a promoter. In related 0055 Any combination of the HA or NA subtype as embodiments, the promoter is selected from the group con described herein are useful in the methods. US 2011/O 159031 A1 Jun. 30, 2011

0056. In certain embodiments, the method is characterized 0065 FIG. 2 shows lung titers in Balb/c mice. The dots by viruses ability to propagate in vertebrate cell culture. In represent the lung titers of individual mice vaccinated with related embodiments, the vertebrate cell is selected from the the different experimental vaccines or control preparations. group consisting of MRC-5, Vero, CV-1, MDCK, MDBK, Mice vaccinated with the controls (PBS, wild-type MVA HEK, H9, CEM, PerC6, BHK-21, BSC and LLC-MK2, (MVA wt) or Lister (VV-L wt) were not protected showing DF-1, QT-35, or primary avian cells, such as primary chicken average log10 TCID50 titers of 5.2, 4.9 and 5.4, respectively. cells or chicken cell aggregates. In one embodiment, the Mice vaccinated with inactivated vaccine (inactivated vertebrate cell is a Vero cell. H1N1), or two different doses (10°, 107 pfu) of MVA-H1-Ca 0057. In some embodiments, the vaccinia virus is selected or VV-L-H1-Ca were fully protected (86-100%). Partial pro from the group consisting of modified vaccinia Ankara tection was achieved with two dosages of the MVA (MVA), vaccinia virus Lister (VVL), and defective vaccinia neuraminidase viruses (MVA-N1-Ca), while full protection Lister. Additional vaccinia viruses contemplated or use in the was seen with the Lister-based neuramindase virus (VV-L- invention include, but are not limited to, MVA-575 (ECACC N1-Ca). The dotted line represents the detection limit of log V00120707) and MVA-BN (ECACCV00083008). 102.21. Low titers in the range of log 10>2.21 to 3.0 were 0058. In one embodiment, the polynucleotide encoding confirmed by a passage assay of the lung samples in MDCK the HA and the polynucleotide encoding the NA are derived cells. The numerical titers are shown in Table 3. from the same virus strain. In another embodiment, the poly 0066 FIG. 3 shows the survival of SCID mice after pas nucleotide encoding the HA and the polynucleotide encoding sive transfer of influenza immune sera. (A) Groups of three the NA are derived from different virus strains. In a related mice were infected intranasally with doses of H1N1 wild embodiment, the HA is derived from subtype H1 and the NA type virus in the range of 10° to 10 TCID50 per animal and derived from subtype N1. In a further embodiment, the HA monitored over a 32 day period. The 10' and 10 doses were and NA are derived from influenza A strain virus A/Califor fully lethal. With the lower doses, mice survived the moni nia/07/2009. toring period. (B) Passive transfer of mouse sera. All SCID 0059. In some embodiments, the H1 HA protein encoded mice receiving the sera of Balb/c mice vaccinated with MVA by the polynucleotide is set out in FIG. 8 (SEQID NO: 14) or H1-Ca were protected, while the MVA-wt controls all died. FIG. 14A (SEQID NO: 16). In a related embodiment, the N1 0067 FIG. 4 shows T cell induction by the hemagglutinin NA protein encoded by the polynucleotide is set out in FIG. constructs. (A) Frequencies of influenza antigen specific 14B (SEQID NO: 17). IFN-y+ CD4 T-cells after immunizing two times with hemag 0060. In certain embodiments, the HA is of subtype H2. In glutinin constructs MVA-H1-CA (black bars), rVV-L-H1 one embodiment, the amino acid sequence of the H2 protein CA (white bars) or inactivated vaccine (dotted bars) and is set out in FIG.9 (SEQID NO: 15) or FIG.15 (SEQID NO: stimulation with different antigens and peptides (shown on 19). X-axis). Splenocytes were stimulated with protein antigens 0061. It is further contemplated that the method optionally (formalin-inactivated monovalent bulk material) of the influ comprises a polynucleotide encoding an influenza A nucle enza strains H1N1 California (H1N1/CA), H1N1 Brisbane oprotein (NP) protein. In one embodiment the amino acid (H1N1/BR), H1N1 North Carolina (H1N1/NC), H5N1 Viet sequence of the NP is set out FIG. 14C (SEQID NO: 18). nam 1203 (H5N1/VN) and with peptide pools of overlapping 0062. In some embodiments, the HA, NA and NP are 15-mer peptides of the swine flu hemagglutinin (H1/CA-PP) derived from the same influenza strain or from different influ or neuraminidase (N1/CA-PP) antigens. (B) Frequencies of enza Strains. For example, in some embodiments the methods influenza hemagglutinin antigen specific IFN-y+ CD8 T-cells of the invention comprise an HA, NA and NP from one or after two dosages of vaccine. Splenocytes were stimulated more of an H1N1, H2N1, H3N2 or H5N1 influenza. with the peptide pools indicated above. The data are mean 0063. In one embodiment, the methods contemplate a values (+/-SEM) of two independent experiments. recombinant virus as described herein comprising polynucle 0068 FIG. 5 shows T cell induction by neuraminidase otides encoding an H5, an N1 and an NP protein. constructs. (A) Frequencies of influenza antigen specific IFN-y+ CD4 T-cells after immunizing two times with MVA BRIEF DESCRIPTION OF THE DRAWINGS N1-CA (black bars), rVV-L-N1-CA (white bars) or inacti 0064 FIG. 1 illustrates expression of hemagglutinin and vated vaccine (dotted bars) and stimulation with different neuraminidase from the vaccinia virus vector. (A) Western antigens and peptides (shown on X-axis). Splenocytes were blots of chicken cell (DF-1) lysates probed for hemagglutinin stimulated with protein antigens as described in FIG. 4. (B) expression. Lane 1, marker size in kDa. Lane 2, formalin Frequencies of influenza neuraminidase-specific IFN-y+ inactivated purified H1N1 influenza virus. Lane 3, negative CD8 T-cells after two dosages of vaccine. Splenocytes were control lysate, replicating wt vaccinia virus. Lane 4, replicat stimulated with the peptide pools indicated in FIG. 4. The ing virus rVVL-H1-CA, no trypsin treatment. Lane 5, repli data are mean values (+/-SEM) of two independent experi cating virus rVVL-H1-CA, with trypsin treatment. Lane 6, mentS. MVA-H1-CA, no trypsin treatment. Lane 7, MVA-H1-CA, 0069 FIG. 6 illustrates T cell induction by the hemagglu with trypsin treatment. Lane 8, negative control lysate, MVA tinin expressing live vaccines in the lungs. Frequencies of wt virus. Lane 9, uninfected cell lysate. HAO, unprocessed influenza antigen specific IFN-y+ CD4 T-cells (A, C) and hemagglutinin; HA1 and HA2, the two processed HA sub CD8 T-cells (B, D) after immunizing two times with hemag units. (B) Western blot of DF-1 cell lysates probed for glutinin constructs MVA-H1-Ca (A, B) or rVVL-H1-Ca (C. neuraminidase expression. Lanes 1-3, samples as above. D) and stimulation with hemagglutinin (H1/CA-PP) or Lane 4, replicating virus rVVL-N1-CA. Lane 5, MVA-N1 neuraminidase (N1/CA-PP) peptide pools. The filled (open) CA. Lane 6 and 7, negative controls, lysates of MVA wt virus circles indicate lung (spleen) cells stimulated with the hemag and non-infected cells. The band around 75 kDa represents glutinin peptide pool H1/CA PP. The filled (open) triangles the neuramidase (NA). indicate lung (spleen) cells stimulated with the neuramini US 2011/O 159031 A1 Jun. 30, 2011

dase peptide pool used as negative controls. Representative 0080. Unless otherwise defined, all technical and scien results of two independent experiments are shown. tific terms used herein have the same meaning as commonly 0070 FIG. 7 illustrates the modified HA cleavage site of understood by one of ordinary skill in the art to which this the H1 of the A/California/07/2009(H1N1) strain (A) (SEQ invention belongs. The following references provide one of ID NOs: 10 and 11) and the modified HA cleavage site of the skill with a general definition of many of the terms used in this H2 of the A/Singapore/1/57(H2N2) strain (B) (SEQID NOs: invention: Singleton, et al., DICTIONARY OF MICROBI 12 and 13). OLOGY AND MOLECULAR BIOLOGY (2d ed. 1994): 0071 FIG. 8 shows the amino acid sequence of the modi THE CAMBRIDGE DICTIONARY OF SCIENCE AND fied H1 of the A/California/07/2009(H1N1) strain (SEQ ID TECHNOLOGY (Walker ed., 1988): THE GLOSSARY OF NO: 14). The polybasic cleavage site is underlined. GENETICS, 5TH ED., R. Rieger, et al. (eds.), Springer Ver 0072 FIG.9 shows the amino acid sequence of the modi lag (1991); and Hale and Marham, THE HARPER COLLINS fied H2 of the A/Singapore/1/57(H2N2) strain (SEQID NO: DICTIONARY OF BIOLOGY (1991). 15). The polybasic cleavage site is underlined. I0081. Each publication, patent application, patent, and 0073 FIG. 10 is a schematic representation of the inser other reference cited herein is incorporated by reference in its tion of a HA-NA double gene cassette into the MVA genome entirety to the extent that it is not inconsistent with the present using the D4R/D5R intergenic region as integration locus. disclosure. 0074 FIG. 11 is a schematic representation of the struc I0082 It is noted here that, as used in this specification and ture of the MVA-H1-N1-NP virus. The H1 and N1 gene the appended claims, the singular forms “a,” “an and “the cassette are inserted in the D4R/D5R intergenic region. The include plural reference unless the context clearly dictates NP gene cassette is inserted in the del III region. otherwise. 0075 FIG. 12 shows a Western blot of infected CEC cell I0083. As used herein, the following terms have the mean lysates probed for influenza antigens. A) Hemagglutinin ings ascribed to them unless specified otherwise expression. Lane 1, marker (sizes in kDa). Lane 2, formalin 0084. The term “vaccinia virus vector” as used herein inactivated purified H1N1 influenza virus. Lane 3, recombi refers to a vaccinia virus genome useful as a vector to incor nant MVA-H1-Ca. Lane 4, recombinant MVA-H1-N1ca. porate heterologous DNA, such as one or more polynucle Lane 5, negative control lysate infected with wt MVA. Lane 6, otides encoding influenza A proteins, including but not lim uninfected control lysate. HAO, unprocessed hemagglutinin; ited to, the HA, NA. NP M1 and M2 or PB1 proteins. The HA1 and HA2, the two processed HA subunits. B) vaccinia virus vector also refers to the vaccinia virus particles Neuraminidase expression. Lanes 1-3, 5 and 6, Samples as which are assembled by the viral genome, and which com above. Lane 4, MVA-N1-Ca. NA, neuraminidase. prises packaged proteins translated from the heterologous 0076 FIG. 13 illustrates lung titers of virus in Balb/c mice DNA as well as from homologous DNA. Exemplary vaccinia vaccinated with the MVA-H1-N1 virus. The dots represent virus vectors useful in the invention include, but are not the lung titers of individual mice vaccinated with the different limited to, modified vaccinia Ankara (MVA), vaccinia virus doses (10, 10, 10 pful per animal) of MVA-H1-N1ca or Lister (VVL), defective vaccinia Lister, MVA-575 (ECACC control preparations. Mice vaccinated with the controls V00120707), and MVA-BN (ECACCV00083008). (wild-type MVA (MVA wt) or PBS) were not protected show 0085. A “recombinant vaccinia virus' refers to a vaccinia ing average log 10 TCIDs titers of 5.3 or 4.7. Mice vacci virus particle comprising heterologous DNA, such as one or nated with 10 pful of MVA-H1-N1-Ca were fully protected. more polynucleotides encoding influenza A proteins, includ Partial protection was achieved with 10 and 10 pfu MVA ing but not limited to, the HA, NA. NP M1, M2 or PB1 H1-N1-Ca. The dotted line represents the detection limit of proteins. Accordingly, the term recombinant vaccinia virus is log 10, 2.21. used interchangeably with aspects of the term vaccinia virus 0077 FIG. 14 shows the amino acid sequence of the wild vector as the term vaccinia virus vector relates to vaccinia type of the A/California/07/2009 (H1N1) strain. (A) wild virus particles which are assembled by the viral genome, and type H1 (SEQID NO: 16); (B) wild-type N1 sequence (SEQ which comprises packaged proteins translated from the het ID NO: 17); (C) wild-type NP sequence (SEQ ID NO: 18). erologous DNA. 0078 FIG. 15 shows the amino acid sequence of the wild I0086. The term "derived from is used to indicate a paren type H2 of the A/Singapore/1/57 (H2N2) strain (SEQID NO: tal source for all or a portion of a polynucleotide or polypep 19). The single arginine used as cleavage is underlined. tide sequence that is altered or mutated from a starting poly nucleotide or polypeptide, including for example a wild-type DETAILED DESCRIPTION or naturally-occurring polynucleotide or polypeptide 007.9 The present invention is directed to vaccines com sequence. In other words, a polynucleotide or polypeptide is prising hemagglutinin and neuraminidase genes of the influ derived from a parental wildtype sequence which is altered in enza A Subtype in a vaccinia virus vector. In some embodi one or more bases or amino acids such that the resulting ments, the vaccine also comprises an influenza A polynucleotide or polypeptide no longer has the same nucleoprotein gene. The vaccine is useful to induce immunity sequence as the parental wild-type sequence. to any influenza Strain, and in certain aspects, is useful to I0087. The term “subtype” as used herein refers to the induce protection to seasonal influenza, as well as pandemic different groupings of influenza A strains that can be divided influenza strains such as H1N1, H2N1, H5N1 and other pan and classified based on the HA and NA genes that are demic strains. Vaccinia based influenza vaccines of the expressed in the virus strain. The influenza A Subtype nomen present invention provide improved protection compared to clature is based on the HA subtype, e.g., the Subtype is any egg-based influenza vaccines since the vaccinia vector pro one of the 16 different HA genes known in the art, and the NA vides a more stable vector with reduced antigenic drift of the subtype, e.g., any of the 9 different NA genes known in the art. influenza genes, and provides improved activation of the Exemplary subtypes, include but are not limited to, H5N1, humoral and cellular immune systems. H1N1, H3N2, and many more known in the art. US 2011/O 159031 A1 Jun. 30, 2011

0088. The term “strain” as used herein refers to the par terminus and/or the carboxy terminus of the full-length ticular virus variant of a given species, e.g., influenza A or B polypeptide. Accordingly, “fragments' are a Subset of dele species, and Subtype in an influenza A virus. For example, the tion analogs described below. virus A/California/7/2009 is an Influenza A virus, subtype (0095. An “analogue,” “analog”or “derivative,” which are H1N1, with the strain name A/California/7/2009. used interchangeably, refers to a compound, e.g., a peptide or 0089. The term “antigenic composition” refers to a com polypeptide, Substantially similar in structure and having the position comprising material which stimulates the immune same biological activity, albeit in certain instances to a dif system and elicits an immune response in a host or subject. fering degree, to a naturally-occurring molecule. Analogs The term “elicit an immune response' refers to the stimula differ in the composition of their amino acid sequences com tion of immune cells in vivo in response to a stimulus, such as pared to the naturally-occurring polypeptide from which the an antigen. The immune response consists of both cellular analog is derived, based on one or more mutations involving immune response, e.g., T cell and macrophage stimulation, (i) deletion of one or more amino acid residues at one or more and humoral immune response, e.g., B cell and complement termini of the polypeptide and/or one or more internal regions stimulation and antibody production. The cellular and of the naturally-occurring polypeptide sequence, (ii) inser humoral immune response are not mutually exclusive, and it tion or addition of one or more amino acids at one or more is contemplated that one or both are stimulated by an anti termini (typically an “addition analog) of the polypeptide genic composition, virus or vaccine as described herein. and/or one or more internal regions (typically an “insertion” Immune response may be measured using techniques well analog) of the naturally-occurring polypeptide sequence or known in the art, including, but not limited to, antibody immunoassays, proliferation assays, and others described in (iii) Substitution of one or more amino acids for other amino greater detail in the Detailed Description and Examples. acids in the naturally-occurring polypeptide sequence. It is contemplated that a recombinant virus of the invention com 0090. The term “attenuated' is used to describe a virus or antigenic composition which demonstrates reduced virulence prises an analog of a viral gene, including any one or more (compared to a wild-type virus). Attenuated virus is typically than one of an HA, NA, PB1, PB2, PA, M (M1 and M2), NS but not always administered intranasally. (NS1 and NS2) and NP gene. 0091. The term “inactivated is used herein to describe a 0096. In one aspect, an analog exhibits about 70% virus that is also known in the art as a "killed’ or “dead virus. sequence similarity but less than 100% sequence similarity An inactivated virus is a whole virus without virulent prop with the wild-type or naturally-occurring sequence, e.g., a erties and is produced from a “live' virus, regardless of peptide. Such analogs or derivatives are, in one aspect, com whether the virus has been previously attenuated in any man prised of non-naturally occurring amino acid residues, ner. Inactivated virus is typically, but not always, adminis including by way of example and not limitation, homoargin tered via intramuscular injection. Administration of an inac ine, ornithine, penicillamine, and norvaline, as well as natu tivated virus is contemplated via any route described herein. rally occurring amino acid residues. Such analogs or deriva 0092. The term “vaccine” as used herein refers to a com tives are, in another aspect, composed of one or a plurality of position comprising a recombinant virus as described herein, D-amino acid residues, or contain non-peptide interlinkages which is useful to establish immunity to the virus in the between two or more amino acid residues. In one embodi Subject. It is contemplated that the vaccine comprises a phar ment, the analog or derivative may be a fragment of a maceutically acceptable carrier and/or an adjuvant. It is con polypeptide, wherein the fragment is Substantially homolo templated that vaccines are prophylactic or therapeutic. A gous (i.e., at least 70%, at least 75%, at least 80%, at least “prophylactic' treatment is a treatment administered to a 85%, at least 90%, or at least 95% homologous) over a length subject who does not exhibit signs of a disease or exhibits of at least 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 amino acids only early signs for the purpose of decreasing the risk of of the wild-type polypeptide. developing pathology. The compounds of the invention may 0097 Substitutions are conservative or non-conservative be given as a prophylactic treatment to reduce the likelihood based on the physico-chemical or functional relatedness of of developing a pathology or to minimize the severity of the the amino acid that is being replaced and the amino acid pathology, if developed. A “therapeutic' treatment is a treat replacing it. Substitutions of this type are well known in the ment administered to a Subject who exhibits signs or symp art. Alternatively, the invention embraces substitutions that toms of pathology for the purpose of diminishing or elimi are also non-conservative. Exemplary conservative Substitu nating those signs or symptoms. The signs or symptoms may tions are described in Lehninger, Biochemistry, 2nd Edition; be biochemical, cellular, histological, functional, Subjective Worth Publishers, Inc., New York (1975), pp.71-77 and set or objective. out below. 0093. The term “live vaccine” as used herein refers to a vaccine comprising a live virus, which are typically attenu ated in Some manner, but that retain their immunogenic prop CONSERVATIVESUBSTITUTIONS erties. A live virus can infect cells, but can be either a repli cation-deficient live virus, Such that it cannot replicate and SIDE CHAIN produce additional viral particles, or replication-competent CHARACTERISTIC AMINO ACID W1US. Non-polar (hydrophobic): 0094. A “fragment of a polypeptide refers to any portion A. Aliphatic A LIVP of the polypeptide smaller than the full-length polypeptide or B. Aromatic FW protein expression product. Fragments are, in one aspect, C. Sulfur-containing M deletion analogs of the full-length polypeptide wherein one or D. Borderline G more amino acid residues have been removed from the amino US 2011/O 159031 A1 Jun. 30, 2011

0101 The term “pharmaceutical composition” refers to a -continued composition Suitable for administration to a subject animal, including humans and mammals. A pharmaceutical compo CONSERVATIVESUBSTITUTIONS sition comprises a pharmacologically effective amount of a SIDE CHAIN virus or antigenic composition of the invention and also com CHARACTERISTIC AMINO ACID prises a pharmaceutically acceptable carrier. A pharmaceuti cal composition encompasses a composition comprising the Uncharged-polar: active ingredient(s), and the inert ingredient(s) that make up A. Hydroxyl STY the pharmaceutically acceptable carrier, as well as any prod B. Amides NQ uct which results, directly or indirectly, from combination, C. Sulfhydryl C complexation or aggregation of any two or more of the ingre D. Borderline G Positively charged (basic) KRH dients. Accordingly, the pharmaceutical compositions of the Negatively charged (acidic) DE present invention encompass any composition made by admixing a compound or conjugate of the present invention and a pharmaceutically acceptable carrier. 0098. Alternatively, exemplary conservative substitutions 0102 The term “pharmaceutically acceptable carrier' are set out immediately below. include any and all clinically useful solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, and excipients, such CONSERVATIVESUBSTITUTIONS II as a phosphate buffered saline solution, 5% aqueous solution of dextrose or mannitol, and emulsions, such as an oil/water EXEMPLARY or water/oil emulsion, and various types of wetting agents ORIGINAL RESIDUE SUBSTITUTION and/or adjuvants. Suitable pharmaceutical carriers and for Ala (A) Val, Leu, Ile mulations are described in Remington's Pharmaceutical Sci Arg (R) Lys, Gln, ASn ences, 19th Ed. (Mack Publishing Co., Easton, 1995). Phar ASn (N) Gln, His, Lys, Arg Asp (D) Glu maceutical carriers useful for the composition depend upon Cys (C) Ser the intended mode of administration of the active agent. Typi Glin (Q) ASn cal modes of administration include, but are not limited to, Glu (E) Asp enteral (e.g., oral) or parenteral (e.g., Subcutaneous, intra His (H) ASn, Gln, Lys, Arg muscular, intravenous or intraperitoneal injection; or topical, Ile (I) Leu, Val, Met, Ala, Phe, Leu (L) Ile, Val, Met, Ala, Phe transdermal, or transmucosal administration). A pharma Lys (K) Arg, Gln, ASn ceutically acceptable salt' is a salt that can beformulated into Met (M) Leu, Phe, Ile a compound or conjugate for pharmaceutical use including, Phe (F) Leu, Val, Ile, Ala Pro (P) Gly e.g., metal salts (sodium, potassium, magnesium, calcium, Ser (S) Thr etc.) and salts of ammonia or organic amines. Thr (T) Ser 0103) The term “pharmaceutically acceptable' or “phar Trp (W) Tyr macologically acceptable” refers to a material which is not Tyr (Y) Trp, Phe, Thr, Ser biologically or otherwise undesirable, i.e., the material may Val (V) Ile, Leu, Met, Phe, Ala be administered to an individual without causing any unde sirable biological effects or interacting in a deleterious man 0099. The term “isolated as used herein refers to a virus ner with any of the components of the composition in which orantigenic composition that is removed from its native envi it is contained, or when administered using routes well ronment. Thus, an isolated biological material is free of some or all cellular components, i.e., components of the cells in known in the art, as described below. which the native material occurs naturally (e.g., cytoplasmic or membrane component). In one aspect, a virus or antigenic Influenza Genes composition is deemed isolated if it is present in a cell extract 0104 Influenza viruses are segmented negative-strand or Supernatant. In the case of nucleic acid molecules, an RNA viruses and belong to the Orthomyxoviridae family. isolated nucleic acid includes a PCR product, an isolated Influenza A virus consists of nine structural proteins and mRNA, a cDNA, or a restriction fragment. codes additionally for one nonstructural NS1 protein with 0100. The term “purified as used herein refers to a virus regulatory functions. The influenza virus segmented genome or antigenic composition that has been isolated under condi contains eight negative-sense RNA (nsRNA) gene segments tions that reduce or eliminate the presence of unrelated mate (PB2, PB1, PA, NP, M, NS, HA and NA) that encode at least rials, i.e., contaminants, including endogenous materials ten polypeptides, including RNA-directed RNA polymerase from which the composition is obtained. By way of example, proteins (PB2, PB1 and PA), nucleoprotein (NP), neuramini and without limitation, a purified virion is substantially free dase (NA), hemagglutinin (subunits HA1 and HA2), the of host cell or culture components, including tissue culture or matrix proteins (M1 and M2) and the non-structural proteins egg proteins and non-specific pathogens. In various embodi (NS1 and NS2) (Kruget al. In The Influenza Viruses, R. M. ments, purified material Substantially free of contaminants is Krug, ed., Plenum Press, N.Y., 1989, pp. 89 152). at least 50% pure; at least 60%, at least 70%, at least 80%, at 0105 Influenza virus ability to cause widespread disease least 90%, at least 95%, at least 96%, at least 97%, at least is due to its ability to evade the immune system by undergoing 98% or even at least 99% pure. Purity can be evaluated by antigenic change, which is believed to occur when a host is chromatography, gel electrophoresis, immunoassay, compo infected simultaneously with both an animal influenza virus sition analysis, biological assay, and other methods known in and a human influenza virus. During mutation and reassort the art. ment in the host, the virus may incorporate an HA and/or NA US 2011/O 159031 A1 Jun. 30, 2011

Surface protein gene from another virus into its genome, inserted into the gene in order to induce cleavage of the HAO thereby producing a new influenza Subtype and evading the protein into the HA1 and HA2 proteins. In certain embodi immune system. ments, the cleavage site has the sequence RERRRKKR (SEQ Hemagglutinin ID NO: 1). 0106 HA is a viral surface glycoprotein comprising Neuraminidase approximately 560 amino acids and representing 25% of the total virus protein. It is responsible for adhesion of the viral 0112 Neuraminidase is a second membrane glycoprotein particle to, and its penetration into, a host cell in the early of the influenza A viruses. The presence of viral NA has been stages of infection. There are 16 known HA Subtypes, catego shown to be important for generating a multi-faceted protec rized as an H1, H2,H3, H4, H5, H6, H7, H8, H9, H10, H11, tive immune response against an infecting virus. NA is a 413 H12, H13, H14, H15 or H16 subtype. amino acid protein encoded by a gene of 1413 nucleotides. 0107 Cleavage of the virus HAO precursor into the HA1 Nine different NA subtypes have been identified in influenza and HA2 subfragments is a necessary step in order for the viruses (N1, N2, N3, N4, N5, N6, N7, N8 and N9), all of virus to infect a cell. Thus, cleavage is required in order to which have been found among wildbirds. NA is involved in convert new virus particles in the host cells into virions the destruction of the cellular receptor for the viral HA by capable of infecting new cells. Cleavage is known to occur cleaving terminal neuraminic acid (also called sialic acid) during transport of the integral HAO membrane protein from residues from carbohydrate moieties on the surfaces of the endoplasmic reticulum of the infected cell to the plasma infected cells. NA also cleaves sialic acid residues from viral membrane. In the course of transport, hemagglutinin under proteins, preventing aggregation of viruses. Using this goes a series of co- and post-translational modifications mechanism, it is hypothesized that NA facilitates release of including proteolytic cleavage of the precursor HA into the viral progeny by preventing newly formed viral particles from amino-terminal fragment HA1 and the carboxy terminal accumulating along the cell membrane, as well as by promot HA2. One of the primary difficulties in growing influenza ing transportation of the virus through the mucus present on strains in primary tissue culture or established cell lines arises from the requirement for proteolytic cleavage activation of the mucosal Surface. NA is an important antigenic determi the influenza hemagglutinin in the host cell. nant that is Subject to antigenic variation. 0108. Although it is known that an uncleaved HA can 0113 Administration of chemical inhibitors of neuramini mediate attachment of the virus to its neuraminic acid-con dase limits the severity and spread of viral infections. taining receptors on a cell Surface, it is not capable of the next Neuraminidase inhibitors combat influenza infection by pre step in the infectious cycle, which is fusion. It has been venting the virus from budding from the host cell. Exemplary reported that exposure of the hydrophobic amino terminus of NA inhibitors include, but are not limited to, Zanamivir, the HA2 by cleavage is required so that it can be inserted into administered by inhalation; oseltamivir, administered orally; the target cell, thereby forming a bridge between virus and and peramivir administered parenterally. target cell membrane. This process is followed by fusion of the two membranes and entry of the virus into the target cell. Internal Genes of Influenza 0109 Proteolytic activation of HA involves cleavage at an arginine residue by a trypsin-like endoprotease, which is 0114. In addition to the surface proteins HA and NA, often an intracellular enzyme that is calcium dependent and influenza virus comprises six additional internal genes, which has a neutral pH optimum. Since the activating proteases are give rise to eight different proteins, including polymerase cellular enzymes, the infected cell type determines whether genes PB1, PB2 and PA, matrix proteins M1 and M2, nucle the HA is cleaved. The HA of the mammalian influenza oprotein (NP), and non-structural proteins NS1 and NS2 viruses and the nonpathogenic avian influenza viruses are (Horimoto et al., Clin Microbiol Rev. 14(1): 129-49, 2001). Susceptible to proteolytic cleavage only in a restricted number 0.115. In order to be packaged into progeny virions, viral of cell types. On the other hand, HA of pathogenic avian RNA is transported from the nucleus as a ribonucleoprotein viruses among the H5 and H7 subtypes are cleaved by pro complex composed of the three influenza virus polymerase teases present in a broad range of different host cells. Thus, proteins, the nucleoprotein (NP), and the viral RNA, in asso there are differences in host range resulting from differences ciation with the influenza virus matrix 1 (M1) protein and in hemagglutinin cleavability which are correlated with the nuclear export protein (Marsh et al., J Virol, 82:2295-2304. pathogenic properties of the virus. 2008). The M1 protein that lies within the envelope is thought 0110. The differences in cleavability are due to differences to function in assembly and budding. in the amino acid sequence of the cleavage site of the HA. 0116. A limited number of M2 proteins are integrated into Sequence analyses show that the HA1 and HA2 fragments of the virions (Zebedee, J. Virol. 62:2762-2772, 1988). They the HA molecule of the non-pathogenic avian and all mam form tetramers having H+ ion channel activity, and, when malian influenza viruses are linked by a single arginine. In activated by the low pH in endosomes, acidify the inside of contrast, the pathogenic avian Strains have a sequence of the virion, facilitating its uncoating (Pinto et al., Cell 69:517 several basic amino acids at the cleavage site with the com 528, 1992). Amantadine is an anti-influenza drug that pre mon denominator being lysine-arginine or arginine-arginine, vents viral infection by interfering with M2 ion channel activ e.g., RRRK (see e.g., SEQ ID NO: 1). H5 and H7 subtypes ity, thus inhibiting virus uncoating. exhibit the polybasic cleavage sites. The hemagglutinins of 0117 NS1 protein, a nonstructural protein, has multiple all influenza viruses are cleaved by the same general mecha functions, including regulation of splicing and nuclear export nism resulting in the elimination of the basic amino acids. of cellular mRNAs as well as stimulation of translation. The 0111. In some embodiments, in HA genes that do not major function of NS1 seems to be to counteract the inter exhibit a polybasic cleavage site, a polybasic cleavage site is feron activity of the host, since an NS1 knockout virus was US 2011/O 159031 A1 Jun. 30, 2011 viable although it grew less efficiently than the parent virus in ment it is contemplated that an influenza virus having any of interferon-nondefective cells (Garcia-Sastre, Virology 252: NA subtypes N1 to N9 is useful for the invention. In various 324-330, 1998). embodiments, the influenza genes are derived from either a 0118 NS2 protein has been detected in virus particles. The seasonal influenza strain or a pandemic influenza strain. average number of NS2 proteins in a virus particle was esti 0.124. In certain embodiments, it is contemplated that mated to be 130-200 molecules. An in vitro binding assay when generating a recombinant vaccinia virus, antigenic shows direct protein-protein contact between M1 and NS2. composition or vaccine of the invention, the HA and NA NS2-M1 complexes were also detected by immunoprecipita subtype are derived from different strains. In other embodi tion in virus-infected cell lysates (Yasuda et al., Virology ments, it is contemplated that when generating a recombinant 196:249-55, 1993). The NS2 protein, known to exist in viri vaccinia virus, antigenic composition or vaccine of the inven ons (Richardson et al., Arch. Virol. 116:69-80, 1991; Yasuda tion, the HA and NA subtype are derived from the same strain, et al., Virology 196:249-255, 1993), is thought to play a role and optionally the NP is derived from the same strain of in the export of RNP from the nucleus through interaction influenza virus. Exemplary combinations include, but are not with M1 protein (Ward et al., Arch. Virol. 140:2067-2073, limited to, e.g., H1 and N1 insertions having H1 and N1 genes 1995). from the same or different H1N1 virus strains, or H2 and N1 inserts having H2 and N1 genes from the same or different Influenza Genes in Vaccinia Vectors H2N1 virus strains. 0119 Pandemics of influenza emerge from the aquatic bird reservoir, adapt to humans, modify their severity, and cause seasonal influenza. The catastrophic Spanish H1N1 virus may have obtained all of its eight gene segments from the avian reservoir, whereas the Asian H2N2 and the Hong Kong H3N2 pandemics emerged by reassortment between the circulating human virus and an avian H2 or H3 donor. Of the 16 hemagglutinin subtypes, the H2, H5, H6, H7, and H9 viruses are considered to have pandemic potential (32). 0120. The major antigen of influenza virus is the hemag glutinin located on the surface of the virion. It induces the majority of neutralizing antibodies. Therefore, in standard inactivated vaccines, only the HA is quantified and dosing is based on HA content. 0121 The neuraminidase (NA) is the second most impor tant antigen followed by the nucleoprotein (NP). The NA induces antibodies that inhibit neuraminidase activity of the NA molecule, required for efficient release of the virus from the cell. Inhibition of NA function, and therefore release of the virus from infected cells, means reduction of virus titer. 0122) The nucleoprotein (NP) is the type antigen (the A antigen, of the influenza A type viruses) and is highly con O 1 served in influenza virus. This antigen contains dominant T cell epitopes including CD8 T cell epitopes (21). 0123. In one embodiment, influenza genes of the influenza A subtypes are useful in the methods and compositions of the invention. For example, influenza A virus having any HA subtype is contemplated, including any of the H1 to H16 subtypes, excluding the H5 subtype. In a still further embodi

TABLE 1

Gene Accession Subtype No. Hemagglutinin Genes H1 NC 002017 Influenza A virus (APuerto Rico.8/34(H1N1)) segment 4, complete sequence H1 FJ966952 Influenza A virus (A/California/05/2009(H1N1)) segment 4 hemagglutinin (HA) gene, complete cols. H2 L20410 Influenza A virus (A/Singapore? 1/1957(H2N2) hemagglutinin (HA)gene, complete cols. H2 L11126 Influenza A virus (A/Berlin/3/64 (H2N2)) hemagglutinin (HA) gene, complete cols. H3 CY050836 Influenza A virus (A/New York/3487/2009(H3N2)) segment 4, complete sequence. H3 CYO08628 Influenza A virus (A/Canterbury/257/2005 (H3N2)) segment 4, complete sequence. H4 M25290 Influenza A virus (A?turkey/Minnesota 833/1980(H4N2) hemagglutinin (HA) gene, complete cols. H4 FJ428.583 Influenza A virus (A?mallard Poyang Lake/15/2007(H4N6)) segment 4 hemagglutinin (HA) gene, complete cols. HS EFS41403 Influenza A virus (AVietNam 1203/2004(H5N1)) segment 4 hemagglutinin (HA) gene, complete cols. HS AFO82O3S Influenza A virus (A/Chicken/Hong Kong/786/97 (H5N1)) hemagglutinin H5 mRNA, complete cols. H6 GQ117282 Influenza A virus (Airing-billed gull/GA421733/2001 (H6N4)) segment 4 hemagglutinin (HA) gene, complete cols. H6 CYO45343 Influenza A virus (A northern shoveleriCalifornia/K138/2005 (H6N2)) segment 4, complete sequence. US 2011/O 159031 A1 Jun. 30, 2011 10

TABLE 1-continued

Gene Accession Subtype No. H7 EF576989 influenza A virus (Aduck AB/AFLBs8734c16/2007(H7)) segment 4, complete sequence. H7 AY24O925 influenza A virus (Atavian/NY/73063-6700 (H7N2)) hemagglutinin (HA) gene, complete cols. H3 CYO43848 influenza A virus (A?mallard/Netherlands/1/2006(H8N4)) segment 4, complete sequence. H3 AB4SO435 influenza A virus (Aduck/Alaska 702/1991 (H8N7)) HA gene for haemagglutinin, complete cols. H9 GUO71984 l fluenza A virus (A'chicken/Iran/THLBM868/2007(H9N2)) segment 4 hemagglutinin (HA) gene, complete cds. H9 CYO23992 influenza A virus (Aduck Shantou?3577/2003(H9N2)) segment 4 sequence. H10 EU1242O7 l fluenza A virus (A/Duck/Indonesia, Jakarta Utara1631-29, 2006(H10)) segment 4 hemagglutinin (HA) gene, complete cols. H10 M21647 influenza A virus (A'chicken/Germany/N/1949(H1ON7)) hemagglutinin precursor, gene, complete cds. H11 CYO21437 influenza A virus (A/environment Delaware/235/2005 (H11N6)) segment 4, complete sequence. H11 D90306 influenza A virus (Aduc k/England, 1/1956(H11N6)) gene for hemagglutinin precursor, complete cols. H12 CYO21877 influenza A virus (A?mallard Maryland 1131/2005(H12N5)) segment 4, complete sequence. H12 AB288,334 influenza A virus (Aduc k/Alberta 60/1976(H12N5)) HA gene for haemagglutinin, complete cds. H13 EU835900 influenza A virus (Agul /Astrakhan 1818, 1998(H13N6)) hemagglutinin (HA) gene, complete cols. H13 AB292664 influenza A virus (Agul /Maryland 704f1977(H13N6)) HA gene for haemagglutinin, complete cols. H14 FJ975075 influenza A virus (A?herring gull Astrakhan 267/1982(H14N5)) segment 4 hemagglutinin (HA) gene, complete cods. H14 AM92216S influenza A virus (A?ma. ard/Gur? 263/82(H14N3)) partial HA gene for hemagglutinin, genomic RNA. H15 439.17 influenza A virus (A?shearwater West Australia, 2576/79 (H15N9)) hemagglutinin mRNA, complete cols. H15 CYOO6032 l fluenza A virus (AAustralian shelduck/Western Australia 1756/1983(H15N2) segment 4, complete sequence. H16 EU1486OO influenza A virus (A?ma. ard/Gurjev 785/83 (H16N3)) hemagglutinin precursor (HA) gene, complete cols. H16 EUS64109 influenza A virus (AFulica atra Volga? 635/1986(H16N3)) segment 4 hemagglutinin (HA) gene, complete cols. Neuraminidase Genes N FJ969.517 influenza A virus (A/California/04/2009(H1N1)) segment 6 neuraminidase (NA) gene, complete cds. N CYO3O233 influenza A virus (A/Brisbane/59/2007 (H1N1)) segment 6 sequence. N2 EU19942O influenza A virus (A/Brisbane/10/2007 (H3N2) segment 6 neuraminidase (NA) gene, complete cols. N2 GUO52.277 influenza A virus (A?turkey/England 1969 (H3N2)) segment 6 neuraminidase (NA) gene, complete cols. fluenza A virus (Aseal/Massachusetts/3911/1992(H3N3)) segment 6 neuraminidase (NA) gene, complete cols. N3 GUOS2831 l fluenza A virus (A/environment California 508249/2007(H5N3)) segment 6 neuraminidase (NA) gene, complete cols. N4 CYO39550 influenza A virus (A northern shoveleriCalifornia/AKS273/2007(H8N4)) segment 6 sequence. N4 EU557563 influenza A virus (A/nor hern pintail/Alaska/44204-158/2006(H6N4) segment 6 neuraminidase (NA) gene, complete cols. N5 EU871915 influenza A virus (Amal lard/MN 105/2000(H5N5)) segment 6 neuraminidase (NA) gene, complete cols. N5 CYO33334 influenza A virus (Ainor hern shoveler California/HKWF1046/2007 (H3N5)) segment 6 sequence. N6 GUOS1165 influenza A virus (A?rud y turnstone/New Jersey/950/2005 (H3N6)) segment 6 neuraminidase (NA) gene, complete cols. N6 GUOS3454 influenza A virus (Amal ard/Ohio/684/2002(H4N6)) segment 6 neuraminidase (NA) gene, complete cols. N7 FJS17261 influenza A virus (Afshorebird/DE/1346/2001 (H5N7)) segment 6 neuraminidase (NA) gene, complete cols. N7 GUOS1509 influenza A virus (A?mallard/Minnesota 17/1999(H7N7)) segment 6 neuraminidase (NA) gene, complete cols. N8 CYO15091 influenza A virus (A?turkey/Ireland 1378/1983(H5N8)) segment 6, complete sequence. N8 CYO43810 influenza A virus (Airing-necked duck, California K90/2005 (H6N8)) segment 6, complete sequence. N9 AB292782 influenza A virus (Aduck Hong Kong/562/1979(H1ON9))NA gene for neuraminidase, complete cols. N9 GUOS3360 l fluenza A virus (A/blue-winged teal/Ohio/467/2001 (H11N9) segment 6 neuraminidase (NA) gene, complete cols.

0126. Additional influenza A viruses contemplated and isolated are also useful in the invention. Accordingly, any include, but are not limited to, A/Brisbane/59/2007 (H1N1): strain specifically exemplified in the specification and those A/Brisbane/10/2007 (H3N2); A/Solomon Islands/3/2006 known or after discovered in the art are amenable to the (H1N1); A/Uruguay/716/2007: A/Wisconsin/67/2005 recombinant vaccinia virus, antigenic composition, vaccine (H3N2), A/New Caledonia/20/99(H1N1); A/California/7/ and methods of the invention. 2004(H3N2); A/New York/55/2004; A/Wellington/1/2004 0128. In certain embodiments, a recombinant live vaccine (H3N2); A/Fujian/411/2002(H3N2); A/Moscow/10/99 minimally contains the HA molecule. Due to its dominant (H3N2); A/Panama/2007/99: A/Sydney/5/97 (H3N2); role, expression of HA is sufficient for vaccine function. In A/Beijing/262/95 (H1N1); and viruses having like properties related embodiments, to induce a broader immune response to any of the above viruses. U.S. Patent Publication No. (concerning cross protection and functional antibody func 20090010962, incorporated herein by reference, describes tion), the NA gene is inserted into the vaccinia vector. influenza A H1N1 viruses useful in the invention. I0129. Optionally, the NP gene is inserted into the vaccinia 0127. A list of identified Influenza A strains, including vector comprising any of the above-mentioned HA and/or NA influenza A H1N1 strains is available from the World Health genes. The NP is minimally protective on its own, however, it Organization (WHO) and United States Centers for Disease induces efficient CD8 T cell responses that are important for Control (CDC) databases of Influenza A subtypes. The clearance of virus from infected cells and thus contribute to a National Centerfor Biotechnology Information (NCBI) data positive clinical course of the infection. A live vaccine con base maintained by the United States National Library of taining HA, NA and NP provides broad protection and can Medicine also maintains an updated database describing the induce cross protection to additional influenza viruses. length and sequence of HA and NA genes of identified viruses of influenza A species. Strains listed by these organizations Vaccinia Vectors and viral strains described in other commercial and academic databases, or in literature publications and known in the art, 0.130 Vaccinia viruses belong to the family of poxviruses. are contemplated for use in the invention. It is also contem A modified vaccinia Ankara virus (MVA) was obtained by plated that additional influenza A strains hereafter identified mutation and selection of the original vaccinia virus Ankara US 2011/O 159031 A1 Jun. 30, 2011

after 575 passages in chicken embryo fibroblast cultures. The following references: Molecular Cloning. A laboratory safety of this MVA is reflected by biological, chemical and Manual. 2" Edition. Sambrook, et al., Cold Spring Harbor physical characteristics. MVA has a reduced molecular Laboratory Press. (1989); Virology Methods Manual. Mahy weight, six primary deletions in the genome (approximately et al., Academic Press. (1996); Molecular Virology: A Prac 31 kB, or 10% of its genome), and is highly attenuated for tical Approach. Davison and Elliott. IRL Press at Oxford most mammalian cells, i.e. DNA and protein is synthesized University Press. Oxford (1993). Chapter 9 Expression of but essentially no viable viral particles are produced due to a genes by Vaccinia virus vectors: Current Protocols in limited ability to replicate efficiently in primate cells. Despite Molecular Biology. John Wiley and Son Inc. (1998). Chapter its limited replication, MVA has been shown to be a highly 16, section IV: Expression of proteins in mammalian cells effective expression vector (Sutter et al., Proc. Natl. Acad. using Vaccinia viral vector. Sci. USA 89:10847-10851, 1992), raising protective immune 0.135 The inserted DNA can be linear or circular, e.g., a responses in primates for parainfluenza virus (Durbinet al. J. plasmid. It is contemplated that the DNA contains at least one Infect. Dis. 179:1345-1351, 1999), measles (Stittelaaretal.J. partial sequence from a non-essential segment of the vaccinia Virol. 74:4236-4243, 2000), and immunodeficiency viruses virus DNA. Non-essential segments of the vaccinia virus (Barouch et al., J. Virol. 75:5151-5158, 2001: Ourmanov et DNA are known to those skilled in the art. One example of a al., J. Virol. 74:2740-2751, 2000). The relatively high immu non-essential segment of this type is the thymidine kinase nogenicity of MVA has been attributed in part to the loss of gene and its adjacent regions (Weir et al., J. Virol. 46:530-537, several viral anti-immune defense genes (Blanchard et al., J. 1983). Gen. Virol. 79: 1159-1167, 1998). See also US Patent Publi 0.136 The heterologous DNA can be introduced into the cation No. 2007004.8861. The modified vaccinia virus Ankara cells by means of homologous recombination using a plasmid developed by Anton Mayr was deposited at the European construct. The plasmid is transfected into host cell, for Collection of Cell Cultures (ECACC), Salisbury, UK, under example by means of calcium phosphate precipitation, elec depository No. V 94012707. Additional methods and modi troporation, liposomes, microinjection, or by other methods fied vaccinia viruses are described in U.S. Pat. Nos. 5,185, known to those skilled in the art. 146, 6,682,743, and US Patent Publication No. 0.137 In certain embodiments, the vaccinia vector further 20090311746. comprises at least one marker or selection gene. Selection 0131 The genomic organization of the MVA genome has genes transduce a particular resistance to a cell, whereby a been described in Antoine et al., (Virology 244:365-396, certain selection method becomes possible. Selection genes 1998). The 178 kb genome of MVA comprises 193 individual are well-known to one of ordinary skill in the art, including open reading frames (ORFs), which code for proteins of at but not limited to, neomycin resistance gene (NPT) or phos least 63 amino acids in length. In comparison with the highly phoribosyltransferase gene (gpt). infectious Variola virus and also the prototype of Vaccinia virus, namely the strain Copenhagen, many ORFs of MVA 0.138 Marker genes induce a color reaction in transduced are fragmented or truncated (Antoine et al., Supra). However, cells, which can be used to identify transduced cells. The nearly all ORFs, including the fragmented and truncated skilled practitioner is familiar with a variety of marker genes, ORFs, get transcribed and translated into proteins. U.S. which can be used in a poxviral system, including but not Patent Publ. No. 20090311746 describes new insertion sites limited to, B-Galactosidase (B-gal), 3-Glucosidase (B-glu), for insertion of heterologous DNA into the MVA genome, Green Fluorescence protein (GFP) or Blue Fluorescence Pro which are located in the intergenic regions (IGRs) of the viral tein. 0.139. In still a further embodiment, the exogenous DNA genome, which are, in turn, located between or are flanked by sequence comprises a spacer sequence, which separates a two adjacent open reading frames (ORFs) of the MVA poxviral transcription control element and/or coding genome. sequence in the exogenous DNA sequence from the stop 0.132. In some embodiments, influenza genes are inserted codon and/or the start codon of the adjacent ORFs. This into nonreplicating poxviral vectors and used as live vaccines. spacer sequence between the stop/start codon of the adjacent An exemplary vaccinia Strain used is the modified vaccinia Ankara strain. Another nonreplicating vaccinia Vector is the ORF and the inserted coding sequence in the exogenous DNA defective vaccinia virus growing only in complementing cell has the advantage to stabilize the inserted exogenous DNA lines (28) that may be used alternatively to MVA. Expression and, thus, any resulting recombinant virus. The size of the of the H5 hemagglutinin and protection of animals after lethal spacer sequence is variable as long as the sequence is without challenge with virulent H5N1 viruses has been recently own coding or regulatory function. shown in this system (29). Cells Lines 0.133 MVA are well known and available in the art. MVA strains useful for the present invention include, but are not 0140 Vertebrate cell lines are useful for culture and limited to, MVA-575 (deposited at the European Collection growth of vaccinia virus including MVA. Exemplary verte of Animal Cell Cultures under the deposition number brate cells useful to culture virus for the preparation of vac ECACC V00120707), MVA-BN (ECACC V00083008). In cine include, but are not limited to: MRC-5, MRC-9, Vero and some embodiments, the MVA isolate is obtained from the CV-1 (African Green monkey): HEK (human embryonic kid National Institutes of Health (Bethesda, Md.), MVA1974NIH ney), PerC6 (human retinoblast); BHK-21 cells (baby ham clone 1, an isolate of 1974 that has no history of spongiform ster kidney), BSC (monkey kidney cell) and LLC-MK2 encephalopathies. (monkey kidney), avian cell lines including DF-1, QT-35 and 0134 Methods to introduce exogenous DNA sequences primary avian cell cultures, such as primary chicken cells, by a plasmid vector into a vaccinia genome and methods to chicken cell aggregates. obtain recombinant vaccinia are well known to the person 0141 Vero cells are an accepted cell line for production of skilled in the art and, additionally, are deducible from the vaccine according to the World Health Organization. In one US 2011/O 159031 A1 Jun. 30, 2011

embodiment, viruses of the present invention are grown in and have been suggested to be useful as adjuvant composi Vero cells as described in the Examples below. tions (EP3998.43; WO95/17210, U.S. Patent Publication No. 20080014217). In one embodiment, the metabolizable oil is Vaccines present in an amount of 0.5% to 20% (final concentration) of 0142. It is contemplated that desired influenza A genes the total Volume of the antigenic composition or isolated from a virus Strain are used to produce a recombinant vaccinia virus, at an amount of 1.0% to 10% of the total volume, or in virus vaccine that leads to increased immune response to the an amount of 2.0% to 6.0% of the total volume. influenza viral proteins. Many types of viral vaccines are 0.148. In some embodiments, oil-in-water emulsion sys known, including but not limited to, attenuated, inactivated, tems useful as adjuvant have a small oil droplet size. In certain Subunit, and split vaccines. embodiments, the droplet sizes will be in the range 120 to 750 0143 Attenuated vaccines are live viral vaccines that have nm, or from 120 to 600 nm in diameter. been altered in Some manner to reduce pathogenicity and no 0149. In order for any oil in water composition to be suit longer cause disease. Attenuated viruses are produced in sev able for human administration, the oil phase of the emulsion eral ways, including growth in tissue culture for repeated system comprises a metabolizable oil. The oil may be any generations and genetic manipulation to mutate or remove vegetable oil, fish oil, animal oil or synthetic oil, which is not genes involved in pathogenicity. For example, in one embodi toxic to the recipient and is capable of being transformed by ment, viral genes and/or proteins identified as involved in metabolism. Nuts, seeds, and grains are common Sources of pathogenicity or involved in the disease manifestation, are vegetable oils. Synthetic oils are also part of this invention mutated or changed such that the virus is still able to infect and can include commercially available oils such as and replicate within a cell, but it cannot cause disease. Attenu NEOBEER) and others. A particularly suitable metabolizable ation of virus has also been Successful by insertion of a oil is squalene. Squalene (2,6,10,15,19,23-Hexamethyl-2.6, foreign epitope into a viral gene segment or by deletion of 10,14, 18.22-tetracosahexaene) is an unsaturated oil which is genome segments necessary for viral replication, via recom found in large quantities in shark-liver oil, and in lower quan binant methods or serial passage in cell culture, resulting in a tities in olive oil, wheat germ oil, rice bran oil, and yeast, and replication deficient virus. is a particularly Suitable oil for use in this invention. Squalene 0144. Subunit vaccines are killed vaccines. Production of is a metabolizable oil by virtue of the fact that it is an inter Subunit vaccine involves isolating a portion of the virus that mediate in the biosynthesis of cholesterol (Merck index, 10th activates the immune system. In the case of influenza, Subunit Edition, entry no. 8619). Exemplary oils useful for an oil in vaccines have been prepared using purified HA and NA, but water emulsion, include, but are not limited to, sterols, tocols, any mixture of viral proteins is used to produce a subunit and alpha-tocopherol. vaccine. Generally, the viral protein, such as HA is extracted 0150. In additional embodiments, immune system stimu from recombinant virus forms and the subunit vaccine is lants are added to the vaccine and/or pharmaceutical compo formulated to contain a mixture of these viral proteins from sition. Immune stimulants include: cytokines, growth factors, different strains. chemokines, Supernatants from cell cultures of lymphocytes, 0145. In certain embodiments, a vaccine as described monocytes, or cells from lymphoid organs, cell preparations herein is prepared using standard adjuvants and vaccine and/or extracts from plants, cell preparation and, or extracts preparations known in the art. Adjuvants include, but are not from bacteria (e.g., BCG, mycobacterium, Corynebacte limited to, Saponin, non-ionic detergents, vegetable oil, min rium), parasites, or mitogens, and novel nucleic acids derived eral gels such as aluminum hydroxide, Surface active Sub from other viruses, or other sources (e.g. double stranded stances such as lysolecithin, pluronic polyols, polyanions, RNA, CpG) block co-polymers, nano-beads, or other com peptides, oil or hydrocarbon emulsions, keyhole limpet pounds known in the art, used alone or in combination. hemocyanins, and potentially useful human adjuvants such as 0151 Particular examples of adjuvants and other immune N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP). stimulants include, but are not limited to, lysolecithin; glyco N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine, N-acetyl sides (e.g., Saponin and saponin derivatives such as Quil A muramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-di (QS7 and QS21) or GPI-0100); cationic surfactants (e.g. palmitoyl-s-n-glycero-3-hydroxyphosphoryloxy)-ethy DDA); quaternary hydrocarbon ammonium halogenides; lamine, BCG (bacille Calmette-Guerin) Corynebacterium pluronic polyols; polyanions and polyatomic ions; poly parvum, ISCOMs, nano-beads, squalene, and block copoly acrylic acids, non-ionic block polymers (e.g., Pluronic mers, which are contemplated for use alone or in combina F-127); and 3D-MPL (3 de-O-acylated monophosphoryl tion. lipidA). See e.g., U.S. Patent Publication Nos. 200801875.46 0146 ISCOM is an acronym for Immune Stimulating and 20080014217. Complex, described initially in Morein et al. (Nature 308: 457-460, 1984). ISCOM’s area novel vaccine delivery system Immunoassays and are unlike conventional adjuvants. An ISCOM is formed in two ways. In some embodiments, the antigen is physically 0152 Various techniques are known in the art for detecting incorporated in the structure during its formulation. In other immunospecific binding of an antibody to an antigen which embodiments, an ISCOM-matrix (as supplied by, for are useful to detect the antigenicity and induction of an example, Isconova) does not contain antigen but is mixed immune response of a recombinant virus, antigenic compo with the antigen of choice by the end-user prior to immuni sition or vaccine of the present invention. An early method of Zation. After mixing, the antigens are present in Solution with detecting interaction between an antigen and an antibody the ISCOM-matrix but are not physically incorporated into involved detection and analysis of the complex by precipita the structure. tion in gels. A further method of detecting an antigen-anti 0147 In one embodiment, the adjuvant is an oil in water body binding pair includes the use of radioiodinated detector emulsion. Oil in water emulsions are well known in the art, antibodies or a radioiodinated protein which is reactive with US 2011/O 159031 A1 Jun. 30, 2011

IgG, such as Protein A. These early methods are well known 0158. A vaccine or composition of the present invention is to persons skilled in the art, as reviewed in Methods in Enzy physiologically significant if its presence results in a detect mology 70:166-198, 1980. able change in the physiology of a recipient patient that 0153. Serological assays are widely used in the determi enhances at least one primary or secondary humoral or cel nation of influenza diagnosis as well as in research studies lular immune response against at least one strain of an infec regarding the epidemiology and antigenicity of viral Strains. tious influenza virus. The vaccine composition is adminis In particular, the hemagglutinin inhibition (HI or HAI) assay tered to protect against viral infection. The “protection' need is widely used (Meisner et al., J. Virol. 82:5079-83, 2008: not be absolute, i.e., the influenza infection need not be totally Couchet al., Vaccine. 25:7656-63, 2007). The HI assay is also prevented or eradicated, if there is a statistically significant useful to show the antigenicity of the modified HA molecule, improvement compared with a control population or set of and assist in the characterization of the modified HA protein patients. Protection may be limited to reducing the severity or as more or less antigenic than a non-modified HA protein. rapidity of onset of symptoms of the influenza virus infection. 0154 The HI assay determines the ability of antibodies 0159. In one embodiment, an attenuated or inactivated from a serum sample to bind with a standardized reference. In vaccine composition of the present invention is provided the HI assay, serial dilutions (titers) of serum sample are either before the onset of infection (so as to prevent or attenu mixed with standard amounts of erythrocytes and their asso ate an anticipated infection) or after the initiation of an actual ciation into complexes is detected visually. The lowest level infection, and thereby protects against viral infection. of titered serum that results in a visible complex is the assay 0160. In one aspect, methods of the invention include a result. step of administration of a pharmaceutical composition. The 0155. A single radial diffusion (SRD) assay was devel virus, antigenic composition or vaccine is administered in any oped by Wood et al. (J Biol Standardization 5:237-47, 1997) means known in the art, including via inhalation, intranasally, which determines the level of HA antigen in a sample. The orally, and parenterally. Examples of parental routes of SRDassay compares the Zone of diffusion sites of a reference administration include intradermal, intramuscular, intrave antigen and a test antigen (e.g., a vaccine) when the antigen nous, intraperitoneal and Subcutaneous administration. are bound by HA-specific antibodies. 0.161. In one embodiment, influenza vaccine administra tion is based on the viral titer of the vaccine sample. In some 0156 Detection of antigen specific T cell responses are embodiments, the dose of vaccine is based on the viral also contemplated to analyze the antigenicity of the modified TCID50, e.g., the median tissue culture infective dose; the virus vectors and the vaccines described herein. In one amount of a pathogenic agent that will produce pathological embodiment, induction of CD4 and/or CD8 T cells are mea change in 50% of cell cultures inoculated. It is contemplated sured. The levels of active T cells are analyzed in organs or that the TCID50 is from 10° to 109, from 10 to 10, from 10 tissues of the Subject, including, but not limited to, lung, to 10 or from 107 to 10. In another embodiment, the TCID50 spleen, and lymph node. Additionally, it is contemplated that is 5x107 or 5x10'. In still another embodiment, it is contem levels of cytokines secreted by T cells are analyzed to detect plated that a dose of the vaccine described herein exhibits a antigen specific T cell activation. In one embodiment, the TCID50 of at least 10°, 10, 10, 10, 10°, 107, 10, or 10. It cytokine is interferon-Y (IFN-Y). In an exemplary embodi is contemplate that the dose is administered in either a single ment, the levels of antigen specific T cell activation is reduced dose or multiple doses. The total dose of vaccine may be split in subjects receiving a vaccine described herein. Methods of between multiple doses. measuring the above parameters are carried out using etech 0162. In a related embodiment, if a replication competent nicques well-known in the art, including, but not limited to, vaccinia is used, a vaccine composition of the present inven cell proliferation assays, FACS analysis of cytokine or cell tion comprises from about 10 to 10 plaque forming units levels, and ELISA or ELISPOT methods. In another exem (PFU)/ml, or any range or value therein, where the virus is plary embodiment, levels of activated CD4 cells and/or acti attenuated. In some embodiments, the vaccine composition vated CD8 cells are reduced in subjects receiving a vaccine comprises about 10, about 10, about 10, about 10, about described herein. In a further embodiment, levels of IFN-Y are 10, about 107, about 10 or about 10 PFU/ml. It is further reduced in Subjects receiving a vaccine described herein. contemplated that the vaccine composition comprises from 10° to about 10 PFU/ml, from about 10 to about 10 PFU/ Pharmaceutical Formulations and Administration ml, or from about 10° to about 10 PFU/ml. 0157. The administration of the vaccine composition is 0163. It is contemplated that, in some embodiments, the generally for prophylactic purposes. The prophylactic admin dose of vaccine is adjusted based on the adjuvant used for istration of the composition serves to prevent or attenuate any vaccine preparation. Subsequent infection. A "pharmacologically acceptable' 0164. Accordingly, it is contemplated that single vaccine composition is one tolerated by a recipient patient. It is con dosages include those having a TCID50 as described herein templated that an effective amount of the vaccine is adminis and are provided in single or multiple dosages at the same or tered. An "effective amount' is an amount sufficient to different amount of viral titer. achieve a desired biological effect such as to induce enough 0.165. When administered as a solution, the vaccine is humoral or cellular immunity. This may be dependent upon prepared in the form of an aqueous solution. Such formula the type of vaccine, the age, sex, health, and weight of the tions are known the art, and are prepared by dissolution of the recipient. Examples of desired biological effects include, but antigen and other appropriate additives in the appropriate are not limited to, production of no symptoms, reduction in solvent. Such solvents include water, saline, ethanol, ethylene symptoms, reduction in virus titer in tissues or nasal Secre glycol, and glycerol, for example. Suitable additives include tions, complete protection against infection by influenza certified dyes and antimicrobial preservatives, such as thime virus, and partial protection against infection by influenza rosal (sodium ethylmercuithiosalicylate). Such solutions may W1US. be stabilized using standard methods, for example, by addi US 2011/O 159031 A1 Jun. 30, 2011 tion of partially hydrolyzed gelatin, sorbitol, or cell culture 5% fetal calf serum (FCS). Madin-Darby canine kidney medium and may be buffered using standard methods, using, (MDCK) cells were maintained serum free in ULTRA for example reagents such as Sodium hydrogen phosphate, MDCK medium (Bio Whittaker, Walkersville, Md.). Sodium dihydrogen, phosphate, potassium hydrogen phos (0173 The influenza virus A/California/7/2009 (H1N1; phate and/or potassium dihydrogen phosphate or TRIS. Liq CDC #20097.12112) was kindly provided by the Centers for uid formulations may also include Suspensions and emul Disease Control and Prevention (CDC, Atlanta, USA). sions. The preparation of Suspensions include, for example, (0174. The vaccinia virus strain Lister/Elstree (VR-862) using a colloid mill, and emulsions include for example using was obtained from the American Type Culture Collection. a homogenizer. The basis of the Lister constructs was the subcloned virus 0166 In one embodiment, it is contemplated that the vac vpDW-862/Elstree. The MVA strain (MVA 1974/NIH clone cine carrier is a polymeric delayed release system. Synthetic 1) was kindly provided by B. Moss (National Institutes of polymers are useful in the formulation of a vaccine to effect Health). the controlled release of antigens using well-known tech 0.175 Cloning and sequencing of hemagglutinin and niques in the art. neuraminidase genes: The hemagglutinin (Genbank #FJ966082) and neuraminidase (Genbank #FJ966084) Kits sequences of A/California/4/2009 were synthesized (Gene 0167. The invention also contemplates kits for administer art, Regensburg, Germany). Both synthetic genes are driven ing the antigenic composition, recombinant virus or vaccine by the strong early/late vaccinia virus promoter mH5 and as described herein packaged in a manner which facilitates terminate with a vaccinia virus specific stop signal down their use to practice methods of the invention. In one embodi stream of the coding region that is absent internally. Both ment, such a kit includes a compound or composition expression cassettes were cloned into the MVA transfer plas described herein, packaged in a container Such as a sealed mid pHA-VA (2) resulting in pHA-mH5-H1-Ca and pHA bottle or vessel, with a label affixed to the container or mH5-N1-Ca, respectively. The insertion plasmids direct the included in the package that describes use of the compound or gene cassettes into the MVAHA-locus, close to deletion III of composition in practicing the method. Preferably, the com MVA (2). Both gene cassettes were inserted in parallel into pound or composition is packaged in a unit dosage form. The the vaccinia transfer plasmid pER-mH5-PL resulting inpER kit may further include a device suitable for administering the mH5-H1-Ca or pER-mH5-N1-Ca, respectively. The plasmid composition according to a specific route of administration or pER-mH5-PL was obtained by insertion of the vaccinia virus for practicing a screening assay. Preferably, the kit contains a promoter mH5, a vaccinia virus stop signal (TTTTTNT) and label that describes use of the composition. In some embodi a multiple cloning site (StuI, NcoI, PvulI. Spel, HindIII, SacI. ments, the kit comprises instructions for administering the Xmal, SalI. NotI) into plasmid pPR (5). For the MVA inser composition to a human Subject. tion plasmids, the gene cassettes were cloned into pHA-VA 0168 Additional aspects and details of the invention will (14) resulting in pHA-mH5-H1-Ca and pHA-mH5-N1-Ca, be apparent from the following examples, which are intended respectively. to be illustrative rather than limiting. (0176 Construction of recombinant vaccinia viruses: VV-L-H1-CA and VV-L-N1-CA. Twenty micrograms of EXAMPLES pER-mH5-H1-Ca or pER-mH5-N1-Ca plasmid DNA were transfected into vaccinia virus Lister infected Vero cells by Example 1 calcium phosphate precipitation and further processed as Construction and Characterization of Recombinant described previously (5). Plaque isolates were purified three Vaccinia Comprising Influenza HA and NA Genes times and expanded for large scale preparations in Vero cells. The vaccinia virus stocks were prepared in Vero cells by 0169. In order to generate a vaccine against the H1N1 viral infection with 0.1 MOI for 72 hours. Infected cells were proteins from a pandemic influenza A strain, H1 and N1 genes harvested and Sucrose cushion purified viral Stocks were pre were isolated and inserted into a vaccinia virus vector and the pared (Holzeret al., Virology 249(1): 160-6, 1998) MVA-H1 immunogenicity of the vaccine tested in vivo in mice, includ CA and MVA-N1-CA. Twenty micrograms of pHA-mH5 ing the ability of the vaccine to induce a humoral response in H1-Ca or pHA-mH5-N1-Ca plasmid DNA were transfected vivo. into MVA infected CEC by calcium phosphate precipitation (0170 Materials and Methods and further processed as described previously (14). The puri 0171 Animals: All animal experiments were reviewed by fied recombinant virus isolates were expanded for large scale the Institutional Animal Care and Use Committee (IACUC) preparations in CEC and purified by centrifugation through and approved by the Austrian regulatory authorities. Allani sucrose cushion (Joklik, W., Virology 18:9-18, 1962). mal experiments were conducted in accordance with Austrian (0177 Western blot analysis: Expression of the H1 or N1 laws on animal experimentation and guidelines set out by the proteins by recombinant vaccinia virus or MVA was detected Association for Assessment and Accreditation of Laboratory by Western blotting. Vero cells in case of the VV-L constructs, Animal Care International (AAALAC). Animals were or the avian cell line DF-1 (4) in case of MVA, were infected housed according to AAALAC guidelines, in housing facili at a multiplicity of infection of 0.1 for 48 h. MVA-H1-CA or ties accredited by the AAALAC. VVL-H1-CA infected cells were harvested by scraping or by (0172 Cells and viruses: The Vero (CCL-81) and DF-1 adding trypsin. MVA-N1-Ca or VVL-N1-Ca infected cells (CCL-12203) cell lines were obtained from the American were harvested by Scraping. Sonicated cell lysates were Type Culture Collection. They were cultivated in DMEM loaded onto 12% polyacrylamide gels (BioRad, Inc. Her (Biochrom AG) containing 5% fetal calf serum (FCS). cules, Calif.) and afterwards blotted on nitrocellulose mem Chicken embryo cells (CEC) were cultivated in M199 brane (Invitrogen, Inc, Carlsbad, Calif.). To detect H1 protein, (GIBCO, Inc./Invitrogen Inc., Carlsbad, Calif.) containing a sheep antiserum against the A/California/7/2009 hemagglu US 2011/O 159031 A1 Jun. 30, 2011

tinin (NIBSC 09/152) was used. Donkey-anti-sheep alkaline for infection. The detection limit of the assay, determined by phosphatase-conjugated IgG (Sigma Inc., St. Louis, Mo.) was spiking with 100, 10 and 1 TCIDso virus per flask, was used as a secondary antibody. To detect N1 protein, a poly approximately 1 TCIDso/ml. clonal rabbit anti avian influenza A neuraminidase (Abcam, 0182 Finding of lethal challenge dose of H1N1 wt in ab21304, Cambridge, Mass.) was used. Goat-anti-rabbit SCID mice: To define the lethal challenge dose 50 (LDs) of alkaline phosphatase-conjugated IgG (Sigma Inc.) was used wt H1N1 A/California/7/2009 in severe combined immuno as a secondary antibody. A whole virus vaccine H1N1 A/Cali deficient (SCID) mice, 4-5 week old female SCID mice fornia/7/2009 (8) served as positive control. (strain CB17/Icr-Prkdcscid/IcrCrl; Charles River, Sulzfeld, 0.178 Immunizations of Balb/c mice for analysis of cellu Germany) were used. They were challenged with 10-fold lar and humoral immunity: Groups of 6 female Balb/c mice serial dilutions of the wt A/California/7/2009(H1N1) strain. (8-10 weeks old) were immunized intramuscularly either The virus dose that kills 50% of the SCID mice (LDs) was once (day 0) or twice (days 0 and 21) with 10° or 107 pfu of calculated by the software program Graph-Pad PRISM 5 recombinant MVA-H1-Ca or VV-L-H1-Ca. Control groups (GraphPad Software Inc., La Jolla, Calif.). were immunized with 107 pfu wild-type MVA, 107 pfu wild 0183 H1N1 challenge and passive protection of SCID type VV-L, 3.75ug of whole virus vaccine H1N1 A/Califor mice: For generation of sera for passive transfer studies, CD1 nia/7/2009 or with PBS buffer. To analyze the vaccines effects mice (Charles River) were immunized twice (d0, d21) with on cellular immunity, blood samples were taken for IgG Sub 10 pfu recombinant MVA-H1-Ca, VV-L-H1-Ca, MVA wt or class and HI titer determinations on days 7 and 27 and spleens 3.75ug of whole virus vaccines H1N1 A/California/07/2009, were obtained for IFN-Y analyses at days 8 and 28 post respectively. Serum pools were prepared on day 42 and ana immunization after euthanizing the mice. To analyze induc lyzed via HI and ELISA. For passive protection experiments, tion of humoral immunity, blood samples were taken for IgG 4-5 week old SCID mice were vaccinated intraperitoneally subclass and HI titer determinations on days 20 and 41. Mice with 200 ul of the produced sera. One or two days afterwards, were challenged intranasally with 10 TCID50/ml of A/Cali mice were challenged by intranasal instillation with 10 fornia/7/2009 on day 42 and lungs were removed three days TCIDs per animal of the A/California/07/2009 (H1N1) wild later and frozen at sG0° C. type strain and monitored for clinical parameters and Survival 0179 Immunizations of Balb/c mice for analysis of cellu for 30 days. lar immunity: Groups of 5 female Balb/c mice (8-10 weeks 0.184 Hemagglutination Inhibition (HI) Assay: The HI old) were immunized intramuscularly on days 0 and 21 with titer of the Sera was determined using chicken erythrocytes as 10 pfu of recombinant MVA-H1-Ca or rVVL-H1-Ca, wild described (9). Briefly, sera were treated with receptor destroy type MVA or VV-L, 3.75 mg of whole virus vaccine H1N1 ing enzyme, inactivated at 56° C. and two-fold serially A/California/7/2009 (inactivated H1N1) or with PBS buffer. diluted. Sera were incubated with formalin inactivated Spleens were obtained for IFN-Y analyses at day 28 post A/California/07/2009 virus suspended to HA targettiters of 3 immunization. Furthermore, groups of 5 mice immunized followed by incubation with erythrocytes. Sera to be consid two times with 10 pfu of recombinant MVA-H1-Ca, ered below detection limit (HI titer of 10) were assigned a rVVLH1-Ca, or MVA wt were challenged intranasally with nominal HI titer of 5. 10 TCIDso per animal of A/California/7/2009 on day 42, and 0185. Preparation of single cell Neuraminidase Inhibition lungs and spleens were collected after euthanizing the mice 7 (NI) Assay: Anti-neuraminidase serum antibodies were mea days after the booster immunization (day 28), at the time of sured with a modified, miniaturized neuraminidase inhibition challenge (day 41) or three days thereafter (day 45) for deter assay (Sandbulte et al., Influenza and Other Respiratory mination of influenza-specific T-cell frequencies. Viruses 3:233-240, 2009). Briefly, serially diluted inactivated 0180 Preparation of the lung samples and titration: Mice H1N1 A/California/07/2009 wild-type virus preparation was were euthanized and lungs were removed on day 3 post chal mixed with an equal Volume of fetuin (25 mg/ml) and incu lenge with wild-type H1N1 virus. These tissue samples were bated for 18 h at 37° C. After addition of periodate and stored at <-60°C. until they were transferred into homogeni incubation for 20 min, arsenite was added and the solution zation tubes (PRECELLYSR Ceramic Kit 2.8 mm, PEQLAB mixed until the brown color disappeared. Thiobarbituric acid Biotechnologie GmbH, Germany) containing 1 ml cell was then added and samples boiled for 15 minutes. The pink medium Supplemented with antibiotics. The lungs were reaction product was extracted by butanol and its absorbance homogenized two times at 5000 rpm for twenty seconds with determined at 550 nm using a reaction blank as reference. The 5 seconds pause between the intervals with a tissue homog half-maximal neuraminidase activity (ECso) was determined enizer (PRECELLYS24(R), PEQLAB Biotechnologie using non-linear regression of the absorbance data (GraphPad GmbH). The infectious H1N1 virus titer inhomogenized lung PRISM, GraphPad Software Inc.). For the subsequent samples was determined by a TCID50 assay performed by neuraminidase inhibition studies, the concentration of the titration on Madin-Darby canine kidney (MDCK) cells by virus was adjusted to an equivalent of half-maximal serial ten-fold dilutions of samples as described (9). neuraminidase activity. Serially diluted sera were incubated 0181 Passage assay of low-titer lung samples in MDCK with the appropriately diluted virus preparation for 1 hour and cells: Lung samples with titers <3 log 10 TCIDs were veri the neuraminidase activity determined as described above. fied by this passage assay. Confluent MDCK cells (grown in The neuraminidase inhibition titer was defined as the recip 75 cm Roux flasks) were infected with 100 ul of mouse lung rocal serum dilution at which neuraminidase activity was sample. The adsorption medium was 10 ml ULTRA 50% inhibited suspensions from spleens or lungs of immu MDCKTM medium (BioWhittaker(R) and contained 1 g/ml nized and challenged mice: Single cell Suspensions of sple TPCK trypsin (Sigma Inc.). After one hour virus adsorption nocytes were obtained by grinding 5 spleens per group 40 ml ULTRA-MDCK-Medium supplemented with 1 lug/ml through a metal mesh into culture media (45% RPMI1640 TPCK trypsin was added and the infection was further incu (GIBCOR), 45% CLICKs Medium (Sigma), 10% FCS bated for 6 days. Afterwards the MDCK cells were analyzed (GIBCOR), Penicillin-Streptomycin (GIBCOR), 2 mM US 2011/O 159031 A1 Jun. 30, 2011

L-glutamine (GIBCOR). Splenocytes were either used responses were statistically analyzed using the two-way immediately or were frozen in Cryostor CS-10 (VWR, ANOVA. Survival differences between animal groups were Bridgeport, N.J.). Single cell preparations were also obtained analyzed using the Kaplan Meyer log rank test of GraphPad from the lungs of immunized mice before and after challenge PRISM software. All differences were considered significant with H1N1 Swine flu virus. After euthanizing the mice, lungs at P values <0.05. were flushed by injecting 0.5-1 ml of PBS/Heparin (5 IE/ml) (0189 Results into the right ventricle of the heart. The lungs were then 0.190) 1. Construction and Characterization of the MVA removed and immediately placed into culture media, cut into Viruses small pieces and digested for 25 min at RT by adding 5 mM 0191 The HA and NA genes of the influenza strain MgCl2 (Merck, Whitehouse Station, N.J.), 150 Units/ml A/California/07/2009(H1N1) were placed downstream of a DNAse I (Roche, Pleasanton, Calif.) and 1 mg/ml collage strong vaccinia early/late promoter (22) and the resulting nase XI (Sigma Inc.) to the culture media. After digestion, the plasmids were used to construct the viruses MVA-H1-CA and remaining pieces were ground through a metal mesh into MVA-N1-CA by in vivo recombination techniques using culture media, and the resulting cell Suspension was filtered transient marker genes. Further, replicating control viruses through a 70 mm nylon mesh (Becton Dickinson). Residual based on the vaccinia Lister strain, rVVL-H1-CA and rVVL red blood cells were removed using RBC lysis buffer (Sigma N1-CA, respectively, were constructed (see Table 2 and Inc.) according to the manufacturer instructions, and the cells Methods). The H1 and N1 genes were synthetic genes opti were used immediately for FACS-based IFN-Y analyses. mized for expression in vaccinia virus, lacking internal tran 0186 T-cell IFN-Y analysis: Peak response frequencies of Scription stop signals. The virus constructs were character vaccine-specific IFN-Y producing T-cells in Balb/c mice were ized by PCR for the absence of wild-type virus and for the determined by flow cytometric intracellular cytokine staining presence of the HA and NA gene inserts. in spleens 7 days after the second immunization, or in lungs on the day before challenge (day 41) or 3 days after challenge TABLE 2 (day 45). Approximately 2x 106 cells were dispensed into 96-well round-bottom-plates (Costar, St. Louis, Mo.) and Viruses and vaccines constructs and controls used in the study. stimulated for approximately 14 h at 37° C. with vaccine Titer antigens (H1N1/California/07/2009, H1N1/Brisbane/59/ Vaccine inserted flugene plasmid (pfu/ml) 2007, H1N1/New Caledonia/20/99, H5N1/Vietnam/1203/ MVA-H1-CA Hemagglutinin pHA-mH5-H1-Ca 4.0 x 109 2004) at 3 mg/ml hemagglutinin, or with peptide pools of MVA-N1-CA Neuraminidase pHA-mH5-NA-Ca 1.6 x 10' 15-mers overlapping by 10 amino acids at 2 mg/ml per pep rVVL-H1-CA Hemagglutinin pER-mH5-H1-Ca 4.3 x 109 tide. Two pools of 111 and 92 peptides were used, spanning rVVL-N1-CA Neuraminidase pER-mH5-NA-Ca 7.4 x 109 the entire H1 or N1 proteins of A/California/07/2009, respec VV-WT (Lister) empty vector Il-8. 1.7 x 10 tively. Cells incubated with medium alone served as a nega MVA-wt empty vector Il-8. 5.0 x 10 tive control. After 2 hours 10 mg/ml brefeldin A (Sigma Inc.) Inact. whvv Ila. Il-8. Ila. was added to inhibit secretion of cytokines and further incu influenza genes in VV constructs are controlled by the vaccinia mH5 promoter;HA and NA genes derived from influenza CA07 strain; bated for 12h. Cells were resuspended in 50 mM PBS/EDTA, titers of sucrose-purified virus preparations (see Methods); and stained with LIVE/Dead Violet Kit (VIVID, Molecular MVA parental strain NIH-LVD clone 1. . . ; Probes(R), Carlsbad, Calif.) diluted 1:10000 in PBS for 15 min inactivated whole virus vaccine; at room temperature. Cells were washed and incubated with n, a, , not applicable, rat anti-mouse CD4-APC antibody (BD Biosciences, 0.4 0.192 Next, expression of the influenza genes in avian and mg/mL), and CD8-APC H7 antibody (BD Biosciences, 1.5 mouse cells was analyzed. To measure parameters such as mg/ml) for 10 min at room temperature. After washing and temporal order and the level of gene expression and process fixation with 1% paraformaldehyde (Merck), cells were per ing of the protective antigen influenza immune responses in meabilized in PBS supplemented with 0.08% saponin vaccinia-based live vaccines, western blot analyses with (Sigma), and incubated with ratanti-mouse IFN-Y FITC anti lysates of infected cells were performed. In infected target body, (BD Biosciences, 0.5 mg/mL) and ratantimouse CD3 cells of the respiratory tract, the influenza hemagglutinin PerCP (BD Biosciences, 1.5 mg/ml, San Jose, Calif.) for 30 precursor (HO) is cleaved by intracellular proteases into the minat room temperature. Finally, cells were washed and fixed heterodimeric receptor molecule (H1 and H2) resulting in full with 1% paraformaldehyde. At least 100,000 viable cells infectivity of influenza virus. In order to assess HA antigen were applied on a FACSCanto-2 (BD Biosciences), and data levels and processing, expression experiments in MVA-per analysis was performed using the FlowJo software (Tree Star, missive avian cells and in nonpermissive murine muscle cells Inc., Ashland, Oreg.). Percentages of IFN-Y producing T-cells were performed. Total cell lysates were analyzed by PAGE were calculated after gating on VIVID negative, CD3 posi and Western blotting using anti-hemagglutinin Sera. As tive, CD4 or CD8 positive lymphocytes. shown in FIG. 1A, the viruses with HA gene inserts induced 0187 Microneutralization assay: The microneutralization high level expression of HA in avian DF-1 cells. The large assay was done as described previously (Kistner et al., PLoS band at around 80 kDa represents the HO hemagglutinin One 5:e9349, 2010). Briefly, sera was diluted and mixed with precursor that was not cleaved in cells lacking the proper the A/California/7/09 virus strain at a concentration of 4.5 log proteases such as the chicken cells used to propagate MVA TCID50/ml. The mixture was incubated for six days on (lanes 4 and 6). To further characterize the HO precursor, the MDCK monolayer before cells were inspected for cytopathic cell lysates were treated with trypsin (see Methods). In both, effects. The neutralizing antibody titer was defined as the VVL-H1-CA and the MVA-H1-CA-infected cells, two described (Kistner et al., PLoS One 5:e9349, 2010). novel bands at approximately 64 and 26 kDa appeared rep 0188 Statistical analysis: For statistical comparison of resenting the HA1 and HA2 subunits (lanes 5 and 7). The lung titers the Tukey test was used. The data of T cell polypeptide pattern of the inactivated whole virus vaccine is US 2011/O 159031 A1 Jun. 30, 2011

shown in lane 2. The HA-specific bands in this control co indicated by absence of virus in the lungs, was used as the migrate with the ones expressed by the viral vectors. In the read-out for efficacy. In the protection experiment the hemag negative controls these bands are absent (lanes 3, 8, 9). A glutinin- and neuraminidase-expressing viral constructs were similar analysis was performed in mouse muscle cells, compared to a formalin-inactivated whole virus (whv) vac cine. The live vaccines were given by intramuscular injection infected with the HA containing vectors and controls. Again, of 1x10° and 1x107pfuper animal, the dose of the inactivated in murine cells only the HAO band could be seen, which was vaccine was 3.75ug (Table 3). The groups were boosted after then cleaved into the two subunits upon trypsin treatment. 21 days and challenge of all groups was carried out at day 42. Thus, the same expression pattern was obtained in cells per Negative controls included mice immunized with the empty missive for MVA and in nonpermissive murine cells that vectors (MVA-wt and VV-L) and with phosphate buffered presumably reflect the situation in mice vaccinated by the saline (PBS). The challenge virus was given intranasally at a intramuscular route. dose of 1x10TCID50 per animal. Three days after challenge 0193 In order to confirm the expression pattern of the the lungs were removed and titers were determined. The neuraminidase constructs, lysates of infected DF-1 cells, results of the lung titrations are shown in FIG. 2 and in Table together with controls were subjected to western blotting and 3. In the groups immunized with the hemagglutinin con probed with an antibody raised againstapeptidepresent in the structs, MVA-H1-CA or rVV-L-H1-CA, protection from neuraminidases of different subtypes including N1 and N5 pneumonia was nearly complete, approximately 92-100% (see Methods). The recombinant vectors induced a broad protection was achieved, depending on dose and construct novel band in the 75 kDa range, representing the highly (Table 3, groups 1-4). Hemagglutinin-inhibition (HI) titers of glycosylated neuraminidase of the CA/07 strain (FIG. 1B, the mouse sera were in the range 453-905. Neutralization lanes 4 and 5), that was also detectable in the inactivated titers were also high, i.e., in the range of 761-1076.

TABLE 3 Protection of mice from pneumonia and serology results after two vaccinations. protection HI- NI- ELISA dose nintotal Titer() NT(3) Titer() total Gr. Virus pfu/mouse (%) GMT2 GMT2 GMT2, IgG o63 1/12(3) 453 905 n.d. 1022 (92) O7 2f12 905 1076 n.d. 1310 (100) 06 2f12 453 761 n.d. 1039 (100) O7 2f12 640 1076 n.d. 1218 (100) 06 9/12 (75)

TABLE 5 Geometric mean neutralization (NT) and hemagglutination inhibitions (HI) tilters of mouse Sera after single dose immunizations with the live vectors. Day 7 Day 14 Day 21 Day 28 Day 35 Day 42 Day 70 Gr Vaccine Dose NT/HI NT/HI) NT/HI) NT/HI) NT/HI) NT/HI) NT/HI) 1 MVA-H1 10

2 MVA-H1 107

(0199 4. Passive Protection Studies in Severe Combined TABLE 4 Immune-Deficient (SCID) Mice 0200 Animal models should reflect the pathology Protection (lung titer) and serology results induced in humans. In the case of the new H1N1 influenza, of mice after single dose vaccinations. the model should protect from typical disease symptoms, dose protection HI-Titer ELISA Such as malaise, pneumonia, but also from death. Since Gr. Virus pful mouse nintotal (%) GMT. GMT immune competent Balb/c mice and even more Susceptible 1 wVIVA-H1-CA 106 10/12 (83) 120 218 CD1 mice recover from witH1N1 challenge, SCID mice were 2 wVIVA-N1-CA 106 8/12(67) 5

protection rate of animals treated with the VVL-H1-CA-de 0206 6. Neuraminidase-Specific T Cell Responses rived sera was 83%. The control animals, however, got sick 0207. Further, neuraminidase as target of T cells was ana and died in the third and fourth week after infection (FIG. lyzed. Mice were immunized as described above with 3B). In some of the animals protected by the MVA-H1-CA neuraminidase-containing constructs MVA-N1-CA and induced sera, no virus was found in lungs at the end of the VVL-N1-CA and with the controls. The results obtained are experiment at day 30. In others, despite lack of clinical Symp shown in FIG. 5. Using the homologous stimulant, H1N1/CA toms, virus was present in the lungs. Thus, passively trans antigen, induction of about 0.25% of CD4 T cells by the live ferred antibodies, induced by the MVA-H1-CA live vaccine vectors was achieved. With the Brisbane H1N1 and with the and the replicating controls, protect mice from lethal chal H5N1 antigens, good levels of cross reactivity were seen, lenge with the wild-type CA/07 virus confirming the impor while the North Carolina antigen was a poor stimulant (FIG. 5A). A peptide pool of 15 mers spanning the whole N1 tant role of anti-H1 antibodies in protection from H1N1 influ sequence induced amounts of CD4 T cells comparable to the enza. Full passive protection of SCID mice from lethal homologous proteinaceous antigen. Again the inactivated challenge by antisera generated in mice and guinea pigs with vaccine induced lower amounts of T cells. Interestingly, a the inactivated H1N1 whole virus vaccine used also in this very strong CD8 T cell response against N1 was also found in study was seen previously (8). mice vaccinated with the N1-containing live vaccines (FIG. 0202 5. Hemagglutinin-Specific and Cross-Reactive T 5B). Three to four percent of total CD8-T cells were N1-spe Cell Responses cific, when the N1/CA04 peptide pool was used for stimula 0203. In order to investigate T cell responses induced by tion, while the H1 peptide pool was negative. As seen before, the different vaccines, mice were immunized twice (days 0 induction of T cells by the inactivated vaccine was far lower. and 21) with the different vaccines. Splenocytes were pre 0208 7. Hemagglutinin-Specific T Cell Responses in the pared on day 28 and stimulated in-vitro with whole virus Lung Before and 3 Days After Intranasal Challenge with antigens or HA- or NA-specific peptide pools of overlapping H1N1 Swine Flu Virus 15-mers covering the entire HA or NA sequence of the CA/07 0209 To analyze whether the live vaccines, besides induc H1N1 strain. The whole virus antigens used for stimulation ing high levels of influenza-specific CD4 and CD8 T-cells in included the monovalent vaccine bulks (MVBs) of inacti the spleen shortly after booster immunization, also give rise to significant levels of HA-specific T-cells at the site of influenza vated influenza preparations of the H1N1 strains CA/07 infection, influenza-specific interferon Y-secreting T cells (H1N1/CA), A/Brisbane/59/2007 (H1N1/BR), A/North were also quantified in the lungs. Mice (5 per group) were Carolina (H1N1/NC) and the H5N1 strain A/Vietnam/1203/ immunized twice (at days 0 and 21) with the hemagglutinin 2004 (H5N1/VN). The number of INF-Y producing T cells constructs (MVA-H1-Ca and rVVL-H1-Ca), and with the was then determined by FACS-based intracellular cytokine MVA wt control (10 pfu per animal). Subsequent challenge assays. Differentiation between CD4 and CD8 T cells was with H1N1 wt virus was carried out at day 42. The pre- and achieved by staining of T cell specific markers (see methods). post challenge lung T cells were analyzed. For comparison 0204 The results obtained with hemagglutinin-containing reasons, T-cell responses were also measured at the same time constructs MVA-H1-CA and VVL-H1-CA and with the inac points in the spleens, a site not directly involved in viral tivated vaccine are shown in FIG. 4. Specific induction of infection. 0.5-0.8% of CD4 T cells was seen after homologous stimu 0210 Seven days after the second immunization, and one lation with H1N1/CA antigen of splenocytes of mice vacci day before and three days after the challenge (at days 28, 41 nated with the MVA and VVL-based vaccines. Significant and 44), lungs and spleens were isolated and cells processed levels of cross-induction were still achieved with the H1 for analysis. Mice were given an anesthesia, lungs were Brisbane and North Carolina antigens. The highest levels of flushed in-vivo with a heparin-containing medium to remove CD4 T cell stimulation were seen, however, with the HA-CA/ blood cells (that might have an impact on lung-specific T cell 07-specific peptide pools. With both the MVA and the VVL counts) and lungs and spleens were collected. Single cell based HA construct 1.3-1.4% of the CD4 T-cells produced Suspensions were prepared from 5 pooled lungs or spleens of IFN-y secretion in mice immunized with both the MVA and immunized mice. Pulmonary and spleen cells were stimu the VVL-based HA constructs. The levels achieved with the lated with the HA- and the control peptide pools (H1/CAPP inactivated virus were several-fold lower (FIG. 4A). and N1/CAPP, respectively) and subjected to FACS analysis. 0205 Next, CD8 T cells induced by the HA constructs High frequencies of influenza-specific CD4 and CD8 cells were analyzed. The H1/CA peptide pool stimulated surpris were induced by vaccination with the MVA-based HA vac ingly high amounts of CTLs, around 3-5% of total CD8 T cine, not only in the spleens but also in the lungs, although the cells were specific for H1, while the N1-specific peptide pool frequencies were slightly lower in the lungs (FIG. 6). Seven used as a negative control did not induce significant levels of days after the booster immunization, approximately 1% of the CD8 T cells (FIG. 4B). The MVA construct induced higher lung CD4 T cells (FIG. 6A) and 7% of the lung CD8 T-cells levels of CD8 T cells compared to the Lister construct. The (FIG. 6B) were HA specific. Two weeks later, levels of T-cells inactivated vaccine induced low but measurable amounts of had consistently dropped by 40-50% in both lungs and CTLs. The splenocytes of mice vaccinated with the empty spleens. Interestingly, however, three days after the chal vectors did not react with the HA-specific antigens and pep lenge, a five-fold increase in IFN-Y expressing HA-specific tides. An HA2-specific epitope conserved in the HAs of influ CD4 T cells was found only in the lungs. In contrast, deple enza subtypes 1, 5 and 9 (HA534-42) was also used in this tion of the spleens from influenza specific CD4 T-cells was study. Specific induction of CD8 T cells in the range of 2-3% observed at that time point, within three days after infection were seen with this peptide. Since the total peptide response CD4 frequencies have dropped by 60% (FIG. 6A). of the pool was about 3-fold higher, more HA peptides should 0211. A similar result was seen for the CD8 T cells. Before contribute to the strong CD8 T cell response. challenge, about 3% of the CD8 pulmonary T cells were US 2011/O 159031 A1 Jun. 30, 2011 20

HA-specific, and a two-fold increase was detected after chal phoid organs. However, upon pulmonary infection with influ lenge with H1N1 wt virus at day 45, whereas the CD8 T-cell enza virus, IFN-y secreting CD8 T-cells are detected only frequency in the spleens decreased by 50%. The NA peptide after 5 days in the lungs (Lawrence et al., J. Immunol. 174: pool (N1/CA PP), used as a control in this experiment, 5332-5340, 2005) whereas, after immunization with MVA induced only background levels of T cells, demonstrating that H1, they are present already in high frequencies before infec little or no T-cells induced by the infection with the swine tion, and, upon infection, enter the lungs much more rapidly virus were present in the lungs three days after challenge. by relocation from other sites such as the spleen. These influ Therefore, the observed increase of influenza specific T-cells enza-specific effector T-cells present at the site of infection in the lungs upon challenge presumably reflects influx of the have the potential to contribute to protection in various ways, HA-specific effector T-cells from other sites into the lung. for instance, by inhibition of viral replication, by secretion of 0212 Consistent results were obtained in mice immu cytokines, by direct killing of virus-infected host cells, or by nized with rVV-H1-Ca live vaccine. Also in this group, a support of influenza specific B-cells. Interestingly, in Balb/c pronounced rise in influenza-specific CD4- (FIG. 6C) and mice, the primary pulmonary CD8 T cell response against CD8 T-cells (FIG. 6D) was observed after challenge with influenza A/Japan/305/57(H2N2) appeared directed against Swine influenza virus. As expected, immunization with the three epitopes in the HA and one in the NP (Lawrence et al., MVA wt control did not induce any influenza-specific T-cells J. Immunol. 174:5332-5340, 2005), suggesting that CD8 T in the lungs before and after challenge. This clearly demon cell responses are strongly dependent on the infecting virus strates that functionally competent effector T cells were strain and the host genetic background. Moreover, lung-resi induced by the vaccine which were capable of homing into dent proliferation contributes significantly to the magnitude virus-infected tissue Such as the lungs. of the antigen-specific CD8 T cell response following influ 0213 Discussion enza virus infection (McGill et al., J. Immunol. 183:4177 0214. In the above study, experimental vaccinia-based 4181, 2009). pandemic H1N1 influenza live vaccines were compared to an 0218. A further advantage of using a poxviral (e.g. MVA) inactivated whole virus vaccine. When given in two doses, the vector as pandemic influenza vaccine is its genetic stability hemagglutinin containing vaccines were fully protective in including the expressed foreign genes. Passage of influenza active immunizations and protected animals had high HI anti primary isolates in eggs usually results in adaptive mutations body titers. The neuraminidase containing MVA viruses were in the HA gene. When non egg-adapted human influenza partially protective. virus, i.e., either the natural virus present in a clinical speci 0215. After single dose vaccinations only the HA-contain men or an isolate propagated exclusively in tissue culture ing live vaccines induced protection from virus in the lungs, cells, is first passaged in the allantoic cavity of embryonated presumably due to the much higher T cell responses induced hens' eggs, variants which have amino acid substitutions by these vaccines. Earlier work indicates that CD8 T cells around the receptor binding site are selected (19). Therefore, contribute to viral clearance of influenza in the lungs of mice eggadaption can result in altered antigenicity resulting in less and thus contribute to protective immunity (23) and more protection (21). Similarly, influenza virus grown in cell lines recent work in chickens suggests, that pulmonary cellular selects for specific variants present in the seed viruses, that immunity is very important in protecting naive natural hosts may not be the preferred ones present in the human isolate. against lethal H5N1 influenza viruses (16). T-cell responses Therefore, to preserve the original genotype of viruses used to natural influenza infections are mainly directed against as reference strains, a complex procedure is recommended, common epitopes on the nucleoprotein, PB2 and M1 but also involving cloning in chicken eggs of the candidate virus at a against the highly variable haemagglutinin and the very early passage, selection and analysis with appropriate neuraminidase (21). antibodies and selection of the isolate whose hemagglutinin 0216. The MVA-based live vaccines induced surprisingly molecule most closely resembles the clinical isolate (3). All high amounts of CD8 T cells, both the HA and the NA these complications are overcome ifa stable DNA virus, such constructs gave rise to 4-5% of total antigen-specific CD8 T as MVA, is used as a vector for the influenza genes. This cells in splenocytes 7 days after the second immunization, vector is independent of influenza virus-specific selection which may explain the good performance after single dose mechanisms and thus, the originally inserted sequences do vaccinations. Further, the HA antigen-specific INF-y produc not change resulting in preservation of originally inserted the ing CD4 T cells were higher in the live vaccines. Considerable HA or NA genes. levels of CD4 T cells cross-reacting with related H1 strains 0219 MVA-based pandemic vaccines may also have were found while cross-reaction with the H5 subtype was not advantages as compared to cold-adapted live influenza vac seen. CD4 T cells induced by the recombinant N1 vectors also cines. In a recent evaluation of live attenuated cold-adapted cross-reacted with the neuraminidase for seasonal H1N1 H5N1 influenza virus vaccines in healthy adults, HI and neu strains, and also against the N1 of the avian VN1203 H5N1 tralizing antibody responses were found to be minimal (6). strain. Several reasons were identified for this failure, the attenuating 0217. Furthermore, high levels of HA-specific CD4 and mutations specified by the A/Ann Arbor/6/60 (H2N2) cold CD8 T-cells were detected in the lungs of mice immunized adapted virus loci had the greatest influence, followed by the with the MVA-HA vaccine construct at the time of challenge deletion of the H5 HA multi-basic cleavage site (MBS), and with wild type H1N1/CA virus, with a further accumulation the constellation effects of the internal backbone genes acting of effector T-cells observed in the lungs three days after the in concert with the H5N1 glycoproteins (17). In poxviral challenge. Accumulation of specific effector T-cells in the vectors, such influenza virus-specific reasons do not play a lungs of infected mice has been shown to depend on differ role. Injection of defined amounts of a stable vector results in ential expression of homing receptors such as CD44 or reliable delivery and the use of strong vaccinia promoters and CD62L (Cerwenka et al., J. Immunol 163:5535-43, 1999), optimized foreign genes result in high-level expression and which target the cells from the lymphoid tissue to non-lym good induction of B and T cell responses. In addition, MVA US 2011/O 159031 A1 Jun. 30, 2011 tolerates pre-existing anti-vaccinia immunity and can be used cleavage. Thus, introduction of a polybasic cleavage site into as an immunizing agent under conditions of pre-existing a HA, that normally does not contain Such a site, results in immunity to the vector and thereby may allow repeated use fully functional receptors having their natural conformation (13). when expressed in non-airway tissues. 0220 Moreover, after passive transfer of sera from MVA 0224. In order to express the completely functional HA, H1 immunized mice, full protection of SCID was achieved the cleavage site of the HA is modified (see FIGS. 7-9). The while the control mice, challenged with a dose of 1x10 modified HA contains a more efficient cleavage site recog TCID50 of wt CA/07 virus died within three weeks from nized by furin-like ubiquitous proteases. After intramuscular pneumonia and titers of 5-6 log 10 TCID50 were found in the injection of the live vaccine, the HAO induced by the vaccine lungs. Interestingly, despite lack of clinical symptoms in the is completely cleaved and presents the novel conformational protected SCID mice, in the majority of lungs virus was found epitopes that widen the antibody response. Surprisingly, at the end of the 4 week monitoring period. This indicates that using MVA as a vector, a higher expression level is achieved a single prophylactic dose of antiserum given prior to chal with the modified HA, and in turn, a better overall immune lenge was not sufficient for virus clearance. However, as response. In vaccinia-based live vaccines, presence or shown previously, infection of SCID mice with A/PR8/34 absence of the polybasic cleavage site in the influenza HA (H1N1) influenza virus followed by passive transfer two molecule does not affect infectivity or safety of the live vac doses of an anti-hemagglutinin antibody cocktail at days 2 C1G. and 6 led to clearance and full recovery from infection (15). 0225. This type of modification can be done with all HA Thus, protection, including clearance of virus, may be Subtypes that normally do not possess polybasic cleavage achieved by a higher dose and by repeated dosing of the sites. Influenza HAs of subtypes H5 and H7 are known to antiserum. Further, in the case of H1N1 CA/07 virus, full naturally possess such sites and they are not necessarily asso protection of SCID mice was obtained after passive transfer ciated with increased virulence (30). All other HAs usually do of sera generated with the inactivated whole virus vaccine in not possess Such cleavage sites (but may acquire them natu mice and guinea pigs (8). rally). 0221) The mouse data described above suggests that 0226 Materials and Methods modified vaccinia Ankara-based recombinant viruses, 0227 Cells and Viruses: Cell lines. The DF-1 (CCL besides extraordinary safety, have some further advantages as 12203) cell line is obtained from the American Type Culture pandemic influenza vaccines, including excellent induction Collection. The cell line is cultivated in DMEM (Biochrom of antibodies and T cells, genetic stability of the hemagglu AG, Berlin, Germany) containing 5% fetal calf serum (FCS). tinin due to independence from influenza-specific genetic Chicken embryo cells (CEC) are cultivated in M199 alterations and efficacy after single dose vaccination. The (GIBCOR, Inc.) containing 5% fetal calf serum (FCS). present study shows that MVA is a good alternative as pan Madin-Darby canine kidney (MDCK) cells are maintained demic influenza vaccine against the novel H1N1 subtype, in serum free in ULTRA-MDCK medium (Bio WhittakerR). accordance with previous studies demonstrating that corre 0228 Influenza strains. The influenza virus A/California/ sponding MVA recombinants also protect against avian 07/2009 (H1N1; CDC #20097.12112) was kindly provided by H5N1 strains (Kreitz et al., J Infect. Dis. 195:1598-1606, the Centers for Disease Control and Prevention (CDC, 2007; Kreitz et al., J Infect Dis 199:405-13, 2009). The Atlanta, USA). The influenza virus A/Singapore/1/1957 H1N1 pandemic strain currently causes mild disease presum (H2N2) is obtained from the Centers for Disease Control and ably due to partial immunity mainly in the adult population. Prevention (CDC, Atlanta, USA) or from another collection If, similar to the 1918 pandemic, more virulent mutants would of microorganisms. occur in Subsequent waves of infection, more broadly protec 0229 Cloning of the wild-type and modified hemaggluti tive vaccines are desirable. nin genes. The hemagglutinin sequences of A/California/04/ 0222 Recombinant vaccinia viruses, antigenic composi 2009 (Genbank accession #FJ966082) and of A/Singapore/ tions or vaccines of the present invention are administered to 1/1957 (Genbank accession #CY034044) are chemically human Subjects using techniques known in the art. synthesized (Geneart, Regensburg, Germany). The synthetic gene includes the strong early/late vaccinia virus promoter Example 2 mH5 upstream of the coding region and a vaccinia virus specific stop-signal downstream of the coding region. The Introduction of a Modified HA1/HA2 Cleavage Site gene may be codon-optimized for high expression. For the Into the Hemagglutinin Gene and Characterization of MVA insertion, the HA gene cassette is cloned into plasmid the Virus (H1 Swine Flu and H2 of Singapore Strain) pHA-VA (24) resulting in pHA-mH5-H1-Ca. The insertion 0223 For full receptor function of the influenza virus plasmid directs the gene cassette into the MVA HA-locus. hemagglutinin (HA), cleavage of the HA precursor into the 0230. The modified cleavage sites are introduced by PCR subunits HA1 and HA2 is required. This usually occurs in the mutation using the wild-type sequence as a template. For this airway epithelia of the respiratory tract. The HA receptor purpose PCR (KOD Hot Start PCR Kit, Novagen, EMD acquires its final conformation and the influenza virus gains Chemicals Inc., Gibbstown, N.J.) is performed to mutate the its infectivity. Vaccinia-based live vaccines are usually original cleavage site using the oligo pairs o.HA-Ca5 administered by the Subcutaneous or intramuscular routes. In (GGCACCTATA AATTGGGCTC AAGG) (SEQ ID NO: 2) the cell types present in this environment (Subcutaneous tis plus o.HA-Ca8 (CTTTTTTCTT CTTCTCTCT CTAGAT Sue, muscle) cleavage of the HAO precursor usually does not TGAA TAGACGGGA) (SEQ ID NO: 3) and o.HA-Caé occur. On the other hand, the H5 hemagglutinins of the avian (AATTTCACTAAAGCTGCGGCCG) (SEQID NO: 4) plus H5N viruses (for example the A/Vietnam/1203/2004 strain) o.HA-Ca7 (GAGAGAAGAA GAAAAAAG AGAGGC contain a polybasic cleavage site that is readily cleaved in cell CTATTTGGGG) (SEQID NO: 5) in case of the HA gene of types that do not contain the proteases normally required for A/California/07/09. In case of A/Singapore/1/1957 the oligo US 2011/O 159031 A1 Jun. 30, 2011 22 pairs o.HA-Si5 (GAAGGCCGTCAAGGCCGCATGG) 0235 Materials and Methods: Cloning of the plasmids (SEQ ID NO: 6) plus o.HA-Si8 (TCTCTTTTTT CTTCT containing the double gene cassette. First, a plasmid was TCTCTCTCTTGATTCAATCTGGGGAACATT) (SEQID cloned, which contains the NA gene of the A/California/04/ NO: 7) and o.HA-Si6 (GCAGTGAAAG GAAGGCCCAT 09 strain downstream of the synthetic early/late promoter GAGG) (SEQ ID NO: 8) plus o.HA-Si7 (GAGAGAAGAA selP. For this purpose, the N1 gene (excised from pHA-mH5 GAAAAAAGAG. AGGATTGTTT GGGGCAATAG C) NA-Ca.; see example 1) was inserted into the plasmid plM (SEQ ID NO: 9) are used. After purification (Sigma D4R (Ricci, University of Vienna) using the restriction GENELUTETM, Sigma, Inc.) the two PCR fragments are used enzymes Eco 105I and NotI. The resulting plasmid was to amplify the complete CDS of the modified HA (mHA) with termed plM-N1 ca. The plasmid directs the gene cassette into the oligos o.HA-Ca5 and o.HA.Cao or o.HA-Si5 and o.HA the D4/D5 intergenic region of MVA. The HA gene cassette Si6. The mHA gene cassette of A/California/07/09 is intro containing the hemagglutinin sequences of A/California/04/ duced into the plasmid pHA-mH5-H1-Caby substituting the 2009 (see Example 1) was chemically synthesized and cloned wild-type HA gene cassette using the restriction sites NheI in plM-N1causing the restriction sites XhoI and NheI. The and NotI resulting in pHA-mH5-mHA-Ca and pHA-mH5 resulting plasmid containing the wild-type HA and NA mHA-Si, respectively. All plasmids are verified by sequenc sequence of A/California/04/09 was termed plM-H1-N1ca. ing. Alternatively, the full sequence of the modified HA-gene 0236 Results cassettes are synthesized and then cloned into the appropriate 0237 Construction and characterization of the double transfer plasmids. recombinant MVA virus MVA-H1-N1-Ca: The NA gene of 0231 Construction and characterization of recombinant A/California/07/09 (H1N1) was placed downstream the syn MVA viruses. MVA-mHA-Ca and MVA-mHA-Si. Twenty thetic early/late promoter selP while the HA gene was under micrograms of pHA-mH5-mHA-Ca or pHA-mH5-mHA-Si control of the strong early/late promoter mH5. The resulting plasmid DNA are transfected into MVA-infected chicken plasmid containing the genes in tandem order was used to cells by calcium phosphate precipitation and further pro construct the virus MVA-H1-N1ca by in-vivo recombination cessed as described previously (14). The purified recombi techniques as described in Example 1. The titer of the final nant virus isolates are expanded for large scale preparations in virus preparation was 3.2x10 pfu/ml. The virus construct chicken cells and characterized by PCR or by Southern blot was characterized by PCR for absence of wild-type virus and ting according to standard procedures. for presence of the HA and NA gene inserts. 0232 Expression of the H1, H2 and mHA proteins by 0238. Subsequently, the correct expression of the influ recombinant MVA is detected by Western blotting. DF-1 cells enza HA and NA genes was analyzed. Total cell lysates were are infected at a multiplicity of infection of 0.1 for 48 h. analyzed by SDS-PAGE and Western blotting using anti Infected cells are harvested by scraping or by adding trypsin. hemagglutinin A/California/7/09 (H1N1) polyclonal serum Sonicated cell lysates are loaded onto 12% polyacrylamide or anti-neuraminidase antibodies. As controls, cell lysates gels (BioRad, Inc) and afterwards blotted on nitrocellulose infected with MVA-H1-Ca or MVA-N1ca (see Example 1) membrane (Invitrogen, Inc). To detect the H1 protein, a sheep were used. Both recombinant viruses express the wild-type antiserum against the A/California/7/2009 hemagglutinin HA and NA protein of A/California/07/2009 (H1N1), respec (NIBSC 09/152) is used. Donkey-anti-sheep alkaline phos tively. Furthermore, an inactivated whole virus vaccine of phatase-conjugated IgG (Sigma Inc.) is used as a secondary H1N1 (Kistner et al., PLoS One 5:e9349, 2010), and an antibody. uninfected cell lysates were used. The Western Blot probed with the HA anti-serum demonstrated that the double recom Example 3 binant MVA-H1-N1ca expresses the HA protein (FIG. 12A). The large bands at 80 kDa represent the uncleaved HAO, Construction and Use of a MVA Virus Expressing which is the exclusive form of HA after infection of avian the Swine Influenza HA and NA Genes (H1N1) DF-1 cells with MVAS coding the wild-type HA protein. The 0233. Since both HA and NA contribute to protection, a lower bands around 55 and 26 kDa represent the HA1 and MVA live vaccine (termed MVA-H1-N1-Ca) containing HA2 subunits and are seen in the inactivated H1N1 control. both antigens is useful to achieve greater immunogenicity. To 0239. To reveal the expression of the neuraminidase, the generate this virus, a double gene cassette is constructed that Western Blot was probed with an antibody raised against a contains the HA gene cassette (consisting of a first vaccinia peptide present in the neuraminidase of different subtypes virus promoter and the HA coding sequence) and the NA gene including the N1. The double construct induced a band cassette (consisting of a second vaccinia virus promoter and around 75 kDa similar to the MVA-N1-Ca (Example 1) and the NA coding sequence). Vaccinia promoters are preferably the inactivated H1N1 vaccine (FIG. 12B). The specific band strong early/late promoters such as the modified H5 promoter is absent in the wild-type MVA control, and uninfected cell (22) or a synthetic early/late promoter (25) or the P7.5 early lysates. late promoter (26). 0240 Protection studies in immune competent mice: Pro 0234. A plasmid containing the double gene cassette is tection studies were carried out in BALB/c mice similar as used to construct the virus MVA-H1-N1-Ca by in-vivo described in Example 1. Mice were immunized once with recombination techniques including selection and/or rescue three different doses (10", 10, 10 pfu per animal) of MVA techniques (27, 5, 14). Western blotting is used to verify H1-N1 ca. At day 42 they were challenged intranasally with expression of the HA and NA proteins in infected cells as in 10 TCIDso of wild-type virus per animal. Three days later the previous example. The resulting virus MVA-H1-N1-Ca lungs were removed and lung titers were determined by induces strong neutralizing and neuraminidase inhibiting TCIDs titration. Protection results are compiled in Table 6 (NI) antibodies. In addition, strong CD8 T cell responses are and displayed in FIG. 13. Mice vaccinated with the controls induced against the NA and HA antigens. The structure of the (wild-type MVA (MVA wt) or PBS) were not protected show recombinant virus is shown in FIG. 10 and FIG. 11. ing average log 10 TCIDs titers of 5.3 or 4.7. Mice vacci US 2011/O 159031 A1 Jun. 30, 2011

nated with 10 pful of MVA-H1-N1-Ca were fully protected. NPca plasmid DNA were transfected into MVA-H1-N1ca Partial protection was achieved with 10 or 10 pfuMVA-H1 infected chicken cells by calcium phosphate precipitation and N1-Ca. The experiment shows that a single dose of virus as plaques were isolated and purified according to standard pro low as 10" or 10 pfu per mouse results in partial protection cedures. The plaque-purified recombinant virus isolates were against lung viremia and a single dose of 10 results in full expanded for large scale preparations in CEC and purified by protection. Compared to the previously obtained results (see centrifugation through a Sucrose cushion. Example 1), the double insert virus shows a more robust 0244 Western Blot analysis. To detect the expression of protection. NP, confluent DF-1 were infected with 0.1 MOI of MVA-H1 N1-NPca for 48 h. Infected cells were harvested by scraping, TABLE 6 mixed with 2x Laemmli buffer (Fermentas, Glen Burnie, Md.), and sonicated. The cell lysates, together with controls, Protection of mice from lung viremia after were loaded onto 12% polyacrylamide gels (BioRad, Inc.) single dose vaccinations with MVA-Hl-N1ca. and afterwards blotted on nitrocellulose membrane (Invitro Average gen, Inc.). To detect the NP protein, a 1:100 dilution of a Vaccine lung titer polyclonal mouse influenza serum was used. A 1:2000 diluted dose HI (logio Protection goat-anti-mouse alkaline phosphatase-conjugated IgG Gr. Vaccine pfu/mouse titer TCID50) nint (%) (Sigma) was used as secondary antibody. Expression of the 1 MVA-H1-N1ca 104 2O

Ankara can be used as an immunizing agent under condi immunity with influenza virus-specific cytotoxic T lym tions of preexisting immunity to the vector. J. Virol. phocytes recognizing a common virion antigen. Scand. J. 74:7651-7655. Immunol. 8:413-420. 0268. 14. Scheiflinger, F., F. Dorner, and F. G. Falkner. 0278 24. Antoine, G., F. Scheiflinger, F. Dorner, and F. G. 1998. Transient marker stabilisation: a general procedure Falkner. 1998. The complete genomic sequence of the to construct marker-free recombinant vaccinia virus. Arch. modified vaccinia Ankara Strain: comparison with other Virol. 143:467-74. orthopoxviruses. Virology 244:365-396. 0269. 15. Scherle, P. A., G. Palladino, and W. Gerhard. 0279 25. Chakrabarti, S., J. R. Sisler, and B. Moss. 1997. 1992. Mice can recover from pulmonary influenza virus Compact, synthetic, vaccinia virus early/late promoter for infection in the absence of class I-restricted cytotoxic T protein expression. Biotechniques 23:1094-7. cells. J. Immunol. 148:212-217. (0280 26. Coupar, B. E., M. E. Andrew, G. W. Both, and D. 0270. 16. Seo, S. H., M. Peiris, and R. G. Webster. 2002. B. Boyle. 1986. Temporal regulation of influenza hemag Protective cross-reactive cellular immunity to lethal glutinin expression in vaccinia virus recombinants and A/Goose/Guangdong/1/96-like H5N1 influenza virus is effects on the immune response. EurJImmunol 16:1479 correlated with the proportion of pulmonary CD8 (+) T 87. cells expressing gamma interferon. J. Virol. 76:4886-4890. (0281. 27. Falkner, F. G., and B. Moss. 1988. Escherichia (0271 17. Suguitan, A. L., Jr., M. P. Marino, P. D. Desai, L. coli gpt gene provides dominant selection for vaccinia M. Chen, Y. Matsuoka, R. O. Donis, H. Jin, D. E. Swayne, virus open reading frame expression vectors. J Virol G. Kemble, and K. Subbarao. 2009. The influence of the 62:1849-54. multi-basic cleavage site of the H5 hemagglutinin on the 0282. 28. Holzer, G. W., and F. G. Falkner. 1997. Con attenuation, immunogenicity and efficacy of a live attenu struction of a vaccinia virus deficient in the essential DNA ated influenza A H5N1 cold-adapted vaccine virus. Virol repair enzyme uracil DNA glycosylase by a complement ogy 395:280-288. (0272. 18. Talon, J., M. Salvatore, R. E. O'Neill, Y. Nakaya, ing cell line. J. Virol. 71:4997-5002 H. Zheng, T. Muster, A. Garcia-Sastre, and P. Palese. 2000. (0283 29. Mayrhofer, J., S. Coulibaly, A. Hessel, G. W. Influenza A and B viruses expressing altered NS1 proteins: Holzer, M. Schwendinger, P. Bruhl, M. Gerencer, B. A. A vaccine approach. Proc Natl AcadSci USA97:4309-14. Crowe, S. Shuo, W. Hong, Y. J. Tan, B. Dietrich, N. 0273. 19. Williams, S. P., and J. S. Robertson. 1993. Sabarth, H. Savidis-Dacho, O. Kistner, P.N. Barrett, and F. Analysis of the restriction to the growth of nonegg-adapted G. Falkner. 2009. Nonreplicating vaccinia virus vectors human influenza virus in eggs. Virology 196:660-665. expressing the H5 influenza virus hemagglutinin produced 0274 20. Wood, J. M., and J. S. Robertson. 2004. From in modified Vero cells induce robust protection. J Virol lethal virus to life-saving vaccine: developing inactivated 83:51.92-2O3. vaccines for pandemic influenza. Nat. Rev. Microbiol. 0284 30. Stech, O. J. Veits, S. Weber, D. Deckers, D. 2:842-847. Schroer, T. W. Vahlenkamp, A. Breithaupt, J. Teifke, T. C. (0275 21. Wright, P. F., G. Neumann, and Y. Kawaoka Mettenleiter, and J. Stech. 2009. Acquisition of a polybasic (ed.). 2007. Orthomyxoviruses. Fields Virology, 5th Edi hemagglutinin cleavage site by a low-pathogenic avian tion, vol. 2. Lippincott Williams & Wilkins. influenza virus is not sufficient for immediate transforma (0276 22. Wyatt, L. S., S. T. Shors, B. R. Murphy, and B. tion into a highly pathogenic strain. J Virol 83:5864-8. Moss. 1996. Development of a replication-deficient (0285) 31. Sutter, G., and B. Moss. 1992. Nonreplicating recombinant vaccinia virus vaccine effective against vaccinia Vector efficiently expresses recombinant genes. parainfluenza virus 3 infectioninananimal model. Vaccine Proc Natl Acad Sci USA 89:10847-51. 14:1451-1458. 0286 32. Yen, H. L., and R. G. Webster. 2009. Pandemic (0277. 23. Yap, K. L., and G. L. Ada. 1978. The recovery of influenza as a current threat. Curr Top Microbiol Immunol mice from influenza A virus infection: adoptive transfer of 333:3-24.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS : 19

<21 Os SEQ ID NO 1 &211s LENGTH: 8 212s. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic peptide

<4 OOs SEQUENCE: 1 Arg Glu Arg Arg Arg Llys Lys Arg 1. 5

<21 Os SEQ ID NO 2 &211s LENGTH: 24 US 2011/O 159031 A1 Jun. 30, 2011 26

- Continued

&212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic primer

<4 OOs, SEQUENCE: 2 ggcaccitata aattgggctic aagg 24

<210s, SEQ ID NO 3 &211s LENGTH: 38 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic primer <4 OOs, SEQUENCE: 3 cittittitt citt citt citctic to tagattgaat agacggga 38

<210s, SEQ ID NO 4 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic primer <4 OOs, SEQUENCE: 4 aattt Cacta aagctg.cggc cg 22

<210s, SEQ ID NO 5 &211s LENGTH: 34 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic primer <4 OOs, SEQUENCE: 5 gagagaagaa gaaaaaagag aggcc tattt gggg 34

<210s, SEQ ID NO 6 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic primer <4 OOs, SEQUENCE: 6 gaaggc.cgt.c aaggcc.gcat gg 22

<210s, SEQ ID NO 7 &211s LENGTH: 45 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic primer

<4 OO > SEQUENCE: 7 tctic titttitt citt cittct ct ct cittgattic aatctgggga acatt 45

<210s, SEQ ID NO 8 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic primer US 2011/O 159031 A1 Jun. 30, 2011 27

- Continued

<4 OOs, SEQUENCE: 8 gCagtgaaag galagg CCC at gagg 24

<210s, SEQ ID NO 9 &211s LENGTH: 41 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Synthetic primer

<4 OOs, SEQUENCE: 9 gagagaagaa gaaaaaagag aggattgttt ggggcaatag C 41

<210s, SEQ ID NO &211s LENGTH: 39 &212s. TYPE: DNA &213s ORGANISM: influenza virus

<4 OOs, SEQUENCE: attcaatcta gagagagaag aagaaaaaag agaggccta 39

<210s, SEQ ID NO &211s LENGTH: 13 212. TYPE: PRT &213s ORGANISM: influenza virus

<4 OOs, SEQUENCE: Ile Glin Ser Arg Glu Arg Arg Arg Llys Lys Arg Gly Lieu. 1. 5

<210s, SEQ ID NO &211s LENGTH: 39 &212s. TYPE: DNA &213s ORGANISM: influenza virus

<4 OOs, SEQUENCE: attgaatcaa gagagagaag aagaaaaaag agaggattg 39

<210s, SEQ ID NO &211s LENGTH: 13 212. TYPE: PRT &213s ORGANISM: influenza virus

<4 OOs, SEQUENCE: 3 Ile Glu Ser Arg Glu Arg Arg Arg Llys Lys Arg Gly Lieu 1. 5 1O

<210s, SEQ ID NO 14 &211s LENGTH: 57 3 212. TYPE: PRT &213s ORGANISM: Influenza virus

<4 OOs, SEQUENCE: 14 Met Lys Ala Ile Lieu Wal Wall Lieu. Leu Tyr Thr Phe Ala Thr Ala Asn 1. 5 1O 15 Ala Asp Thir Lieu. Cys Ile Gly Tyr His Ala Asn. Asn. Ser Thr Asp Thr 2O 25 3O

Val Asp Thr Val Lieu. Glu Lys Asn Wall Thir Wall Thir His Ser Wall Asn 35 4 O 45 US 2011/O 159031 A1 Jun. 30, 2011 28

- Continued Lieu. Lieu. Glu Asp Llys His Asn Gly Lys Lieu. Cys Llys Lieu. Arg Gly Val SO 55 6 O Ala Pro Lieu. His Lieu. Gly Lys Cys Asn. Ile Ala Gly Trp Ile Lieu. Gly 65 70 7s 8O Asn Pro Glu. Cys Glu Ser Leu Ser Thr Ala Ser Ser Trp Ser Tyr Ile 85 90 95 Val Glu Thr Pro Ser Ser Asp Asn Gly Thr Cys Tyr Pro Gly Asp Phe 1OO 105 11 O Ile Asp Tyr Glu Glu Lieu. Arg Glu Glin Lieu. Ser Ser Val Ser Ser Phe 115 12 O 125 Glu Arg Phe Glu Ile Phe Pro Llys Thr Ser Ser Trp Pro Asn His Asp 13 O 135 14 O Ser Asn Lys Gly Val Thr Ala Ala Cys Pro His Ala Gly Ala Lys Ser 145 150 155 160 Phe Tyr Lys Asn Lieu. Ile Trp Lieu Val Lys Lys Gly Asn. Ser Tyr Pro 1.65 17O 17s Llys Lieu. Ser Lys Ser Tyr Ile Asin Asp Llys Gly Lys Glu Val Lieu Val 18O 185 19 O Lieu. Trp Gly Ile His His Pro Ser Thr Ser Ala Asp Gln Glin Ser Lieu. 195 2OO 2O5 Tyr Glin Asn Ala Asp Thr Tyr Val Phe Val Gly Ser Ser Arg Tyr Ser 21 O 215 22O Llys Llys Phe Llys Pro Glu Ile Ala Ile Arg Pro Llys Val Arg Asp Glin 225 23 O 235 24 O Glu Gly Arg Met Asn Tyr Tyr Trp Thr Lieu Val Glu Pro Gly Asp Llys 245 250 255 Ile Thr Phe Glu Ala Thr Gly Asn Lieu Val Val Pro Arg Tyr Ala Phe 26 O 265 27 O Ala Met Glu Arg Asn Ala Gly Ser Gly Ile Ile Ile Ser Asp Thr Pro 27s 28O 285 Val His Asp Cys Asn Thr Thr Cys Glin Thr Pro Lys Gly Ala Ile Asn 29 O 295 3 OO Thir Ser Leu Pro Phe Glin Asn Ile His Pro Ile Thr Ile Gly Lys Cys 3. OS 310 315 32O Pro Llys Tyr Val Llys Ser Thr Lys Lieu. Arg Lieu Ala Thr Gly Lieu. Arg 3.25 330 335 Asn. Ile Pro Ser Ile Glin Ser Arg Glu Arg Arg Arg Llys Lys Arg Gly 34 O 345 35. O Lieu. Phe Gly Ala Ile Ala Gly Phe Ile Glu Gly Gly Trp Thr Gly Met 355 360 365 Val Asp Gly Trp Tyr Gly Tyr His His Glin Asn Glu Gln Gly Ser Gly 37 O 375 38O Tyr Ala Ala Asp Lieu Lys Ser Thr Glin Asn Ala Ile Asp Glu Ile Thr 385 390 395 4 OO Asn Llys Val Asn Ser Val Ile Glu Lys Met Asn Thr Glin Phe Thr Ala 4 OS 41O 415 Val Gly Lys Glu Phe Asn His Lieu. Glu Lys Arg Ile Glu Asn Lieu. Asn 42O 425 43 O Llys Llys Val Asp Asp Gly Phe Lieu. Asp Ile Trp Thr Tyr Asn Ala Glu 435 44 O 445 Lieu. Lieu Val Lieu. Lieu. Glu Asn. Glu Arg Thr Lieu. Asp Tyr His Asp Ser US 2011/O 159031 A1 Jun. 30, 2011 29

- Continued

450 45.5 460 Asn. Wall Lys Asn Lieu. Tyr Glu Lys Val Arg Ser Glin Lieu Lys Asn. Asn 465 470 47s 48O Ala Lys Glu Ile Gly Asn Gly Cys Phe Glu Phe Tyr His Lys Cys Asp 485 490 495 Asn Thr Cys Met Glu Ser Val Lys Asn Gly Thr Tyr Asp Tyr Pro Llys SOO 505 51O Tyr Ser Glu Glu Ala Lys Lieu. Asn Arg Glu Glu Ile Asp Gly Val Lys 515 52O 525 Lieu. Glu Ser Thr Arg Ile Tyr Glin Ile Leu Ala Ile Tyr Ser Thr Val 53 O 535 54 O Ala Ser Ser Lieu Val Lieu Val Val Ser Lieu. Gly Ala Ile Ser Phe Trp 5.45 550 555 560 Met Cys Ser Asn Gly Ser Lieu. Glin Cys Arg Ile Cys Ile 565 st O

<210s, SEQ ID NO 15 &211s LENGTH: 569 212. TYPE: PRT <213> ORGANISM: Influenza virus

<4 OOs, SEQUENCE: 15 Met Ala Ile Ile Tyr Lieu. Ile Lieu. Lieu. Phe Thr Ala Val Arg Gly Asp 1. 5 1O 15 Glin Ile Cys Ile Gly Tyr His Ala Asn. Asn. Ser Thr Glu Lys Val Asp 2O 25 3O Thir Ile Lieu. Glu Arg Asn Val Thr Val Thir His Ala Lys Asp Ile Lieu. 35 4 O 45 Glu Lys Thr His Asn Gly Llys Lieu. Cys Llys Lieu. Asn Gly Ile Pro Pro SO 55 6 O Lieu. Glu Lieu. Gly Asp Cys Ser Ile Ala Gly Trp Lieu. Lieu. Gly Asn Pro 65 70 7s 8O Glu Cys Asp Arg Lieu Lleu Ser Val Pro Glu Trp Ser Tyr Ile Met Glu 85 90 95 Lys Glu Asn Pro Arg Asp Gly Lieu. Cys Tyr Pro Gly Ser Phe Asn Asp 1OO 105 11 O Tyr Glu Glu Lieu Lys His Lieu. Lieu. Ser Ser Val Llys His Phe Glu Lys 115 12 O 125 Val Lys Ile Leu Pro Lys Asp Arg Trp Thr Gln His Thr Thr Thr Gly 13 O 135 14 O Gly Ser Arg Ala Cys Ala Val Ser Gly Asn. Pro Ser Phe Phe Arg Asn 145 150 155 160 Met Val Trp Lieu. Thir Lys Lys Gly Ser Asn Tyr Pro Val Ala Lys Gly 1.65 17O 17s Ser Tyr Asn Asn Thr Ser Gly Glu Gln Met Lieu. Ile Ile Trp Gly Val 18O 185 19 O His His Pro Asn Asp Glu Thr Glu Glin Arg Thr Lieu. Tyr Glin Asn Val 195 2OO 2O5 Gly Thr Tyr Val Ser Val Gly Thr Ser Thr Lieu. Asn Lys Arg Ser Thr 21 O 215 22O Pro Asp Ile Ala Thr Arg Pro Llys Val Asn Gly Lieu. Gly Ser Arg Met 225 23 O 235 24 O US 2011/O 159031 A1 Jun. 30, 2011 30

- Continued Glu Phe Ser Trp Thr Lieu Lleu. Asp Met Trp Asp Thr Ile Asin Phe Glu 245 250 255 Ser Thr Gly Asn Lieu. Ile Ala Pro Glu Tyr Gly Phe Lys Ile Ser Lys 26 O 265 27 O Arg Gly Ser Ser Gly Ile Met Lys Thr Glu Gly Thr Lieu. Glu Asn Cys 27s 28O 285 Glu Thir Lys Cys Glin Thr Pro Leu Gly Ala Ile Asn Thr Thr Lieu Pro 29 O 295 3 OO Phe His Asn Val His Pro Leu. Thir Ile Gly Glu. Cys Pro Llys Tyr Val 3. OS 310 315 32O Llys Ser Glu Lys Lieu Val Lieu Ala Thr Gly Lieu. Arg Asn Val Pro Glin 3.25 330 335 Ile Glin Ser Arg Glu Arg Arg Arg Llys Lys Arg Gly Lieu. Phe Gly Ala 34 O 345 35. O Ile Ala Gly Phe Ile Glu Gly Gly Trp Glin Gly Met Val Asp Gly Trp 355 360 365 Tyr Gly Tyr His His Ser Asn Asp Glin Gly Ser Gly Tyr Ala Ala Asp 37 O 375 38O Lys Glu Ser Thr Glin Lys Ala Phe Asp Gly Ile Thr Asn Llys Val Asn 385 390 395 4 OO Ser Val Ile Glu Lys Met Asn Thr Glin Phe Glu Ala Val Gly Lys Glu 4 OS 41O 415 Phe Ser Asn Lieu. Glu Arg Arg Lieu. Glu Asn Lieu. Asn Llys Llys Met Glu 42O 425 43 O Asp Gly Phe Lieu. Asp Val Trp Thr Tyr Asn Ala Glu Lieu. Lieu Val Lieu 435 44 O 445 Met Glu Asn. Glu Arg Thr Lieu. Asp Phe His Asp Ser Asn. Wall Lys Asn 450 45.5 460 Lieu. Tyr Asp Llys Val Arg Met Glin Lieu. Arg Asp Asn. Wall Lys Glu Lieu. 465 470 47s 48O Gly Asin Gly Cys Phe Glu Phe Tyr His Lys Cys Asp Asp Glu. Cys Met 485 490 495 Asn Ser Val Lys Asn Gly Thr Tyr Asp Tyr Pro Llys Tyr Glu Glu Glu SOO 505 51O Ser Lys Lieu. Asn Arg Asn. Glu Ile Lys Gly Val Llys Lieu. Ser Ser Met 515 52O 525 Gly Val Tyr Glin Ile Lieu Ala Ile Tyr Ala Thr Val Ala Gly Ser Lieu. 53 O 535 54 O Ser Leu Ala Ile Met Met Ala Gly Ile Ser Phe Trp Met Cys Ser Asn 5.45 550 555 560 Gly Ser Lieu. Glin Cys Arg Ile Cys Ile 565

<210s, SEQ ID NO 16 &211s LENGTH: 566 212. TYPE: PRT <213> ORGANISM: Influenza virus

<4 OOs, SEQUENCE: 16 Met Lys Ala Ile Lieu Val Val Lieu. Lieu. Tyr Thr Phe Ala Thr Ala Asn 1. 5 1O 15 Ala Asp Thir Lieu. Cys Ile Gly Tyr His Ala Asn. Asn. Ser Thr Asp Thr 2O 25 3O US 2011/O 159031 A1 Jun. 30, 2011 31

- Continued

Val Asp Thr Val Lieu. Glu Lys Asn Val Thr Val Thr His Ser Val Asn 35 4 O 45 Lieu. Lieu. Glu Asp Llys His Asn Gly Lys Lieu. Cys Llys Lieu. Arg Gly Val SO 55 6 O Ala Pro Lieu. His Lieu. Gly Lys Cys Asn. Ile Ala Gly Trp Ile Lieu. Gly 65 70 7s 8O Asn Pro Glu. Cys Glu Ser Leu Ser Thr Ala Ser Ser Trp Ser Tyr Ile 85 90 95 Val Glu Thr Pro Ser Ser Asp Asn Gly Thr Cys Tyr Pro Gly Asp Phe 1OO 105 11 O Ile Asp Tyr Glu Glu Lieu. Arg Glu Glin Lieu. Ser Ser Val Ser Ser Phe 115 12 O 125 Glu Arg Phe Glu Ile Phe Pro Llys Thr Ser Ser Trp Pro Asn His Asp 13 O 135 14 O Ser Asn Lys Gly Val Thr Ala Ala Cys Pro His Ala Gly Ala Lys Ser 145 150 155 160 Phe Tyr Lys Asn Lieu. Ile Trp Lieu Val Lys Lys Gly Asn. Ser Tyr Pro 1.65 17O 17s Llys Lieu. Ser Lys Ser Tyr Ile Asin Asp Llys Gly Lys Glu Val Lieu Val 18O 185 19 O Lieu. Trp Gly Ile His His Pro Ser Thr Ser Ala Asp Gln Glin Ser Lieu. 195 2OO 2O5 Tyr Glin Asn Ala Asp Thr Tyr Val Phe Val Gly Ser Ser Arg Tyr Ser 21 O 215 22O Llys Llys Phe Llys Pro Glu Ile Ala Ile Arg Pro Llys Val Arg Asp Glin 225 23 O 235 24 O Glu Gly Arg Met Asn Tyr Tyr Trp Thr Lieu Val Glu Pro Gly Asp Llys 245 250 255 Ile Thr Phe Glu Ala Thr Gly Asn Lieu Val Val Pro Arg Tyr Ala Phe 26 O 265 27 O Ala Met Glu Arg Asn Ala Gly Ser Gly Ile Ile Ile Ser Asp Thr Pro 27s 28O 285 Val His Asp Cys Asn Thr Thr Cys Glin Thr Pro Lys Gly Ala Ile Asn 29 O 295 3 OO Thir Ser Leu Pro Phe Glin Asn Ile His Pro Ile Thr Ile Gly Lys Cys 3. OS 310 315 32O Pro Llys Tyr Val Llys Ser Thr Lys Lieu. Arg Lieu Ala Thr Gly Lieu. Arg 3.25 330 335 Asn. Ile Pro Ser Ile Glin Ser Arg Gly Lieu. Phe Gly Ala Ile Ala Gly 34 O 345 35. O Phe Ile Glu Gly Gly Trp Thr Gly Met Val Asp Gly Trp Tyr Gly Tyr 355 360 365 His His Glin Asn. Glu Glin Gly Ser Gly Tyr Ala Ala Asp Lieu Lys Ser 37 O 375 38O Thr Glin Asn Ala Ile Asp Glu Ile Thr Asn Llys Val Asn. Ser Val Ile 385 390 395 4 OO Glu Lys Met Asn Thr Glin Phe Thr Ala Val Gly Lys Glu Phe Asn His 4 OS 41O 415 Lieu. Glu Lys Arg Ile Glu Asn Lieu. Asn Llys Llys Val Asp Asp Gly Phe 42O 425 43 O US 2011/O 159031 A1 Jun. 30, 2011 32

- Continued Lieu. Asp Ile Trp Thr Tyr Asn Ala Glu Lieu. Lieu Val Lieu. Lieu. Glu Asn 435 44 O 445 Glu Arg Thr Lieu. Asp Tyr His Asp Ser Asn. Wall Lys Asn Lieu. Tyr Glu 450 45.5 460 Llys Val Arg Ser Glin Lieu Lys Asn. Asn Ala Lys Glu Ile Gly Asn Gly 465 470 47s 48O Cys Phe Glu Phe Tyr His Lys Cys Asp Asn Thr Cys Met Glu Ser Val 485 490 495 Lys Asn Gly. Thir Tyr Asp Tyr Pro Llys Tyr Ser Glu Glu Ala Lys Lieu. SOO 505 51O Asn Arg Glu Glu Ile Asp Gly Val Lys Lieu. Glu Ser Thr Arg Ile Tyr 515 52O 525 Glin Ile Lieu Ala Ile Tyr Ser Thr Val Ala Ser Ser Lieu Val Lieu Val 53 O 535 54 O Val Ser Leu Gly Ala Ile Ser Phe Trp Met Cys Ser Asn Gly Ser Leu 5.45 550 555 560 Glin Cys Arg Ile Cys Ile 565

<210s, SEQ ID NO 17 &211s LENGTH: 469 212. TYPE: PRT <213> ORGANISM: Influenza virus

<4 OOs, SEQUENCE: 17 Met Asin Pro Asn Gln Lys Ile Ile Thr Ile Gly Ser Val Cys Met Thr 1. 5 1O 15 Ile Gly Met Ala Asn Lieu. Ile Lieu. Glin Ile Gly Asn. Ile Ile Ser Ile 2O 25 3O Trp Ile Ser His Ser Ile Gln Leu Gly Asin Glin Asn Glin Ile Glu Thr 35 4 O 45 Cys Asn Glin Ser Val Ile Thr Tyr Glu Asn Asn. Thir Trp Val Asn Glin SO 55 6 O Thr Tyr Val Asn Ile Ser Asn Thr Asn Phe Ala Ala Gly Glin Ser Val 65 70 7s 8O Val Ser Val Lys Lieu Ala Gly Asn. Ser Ser Lieu. Cys Pro Val Ser Gly 85 90 95 Trp Ala Ile Tyr Ser Lys Asp Asn. Ser Val Arg Ile Gly Ser Lys Gly 1OO 105 11 O Asp Val Phe Val Ile Arg Glu Pro Phe Ile Ser Cys Ser Pro Leu Glu 115 12 O 125 Cys Arg Thr Phe Phe Lieu. Thr Glin Gly Ala Lieu. Lieu. Asn Asp Llys His 13 O 135 14 O Ser Asn Gly Thr Ile Lys Asp Arg Ser Pro Tyr Arg Thr Lieu Met Ser 145 150 155 160 Cys Pro Ile Gly Glu Val Pro Ser Pro Tyr Asn Ser Arg Phe Glu Ser 1.65 17O 17s Val Ala Trp Ser Ala Ser Ala Cys His Asp Gly Ile Asn Trp Lieu. Thr 18O 185 19 O Ile Gly Ile Ser Gly Pro Asp Asin Gly Ala Val Ala Val Lieu Lys Tyr 195 2OO 2O5 Asn Gly Ile Ile Thr Asp Thir Ile Llys Ser Trp Arg Asn. Asn. Ile Lieu 21 O 215 22O US 2011/O 159031 A1 Jun. 30, 2011 33

- Continued

Arg Thr Glin Glu Ser Glu. Cys Ala Cys Val Asn Gly Ser Cys Phe Thr 225 23 O 235 24 O Val Met Thr Asp Gly Pro Ser Asn Gly Glin Ala Ser Tyr Lys Ile Phe 245 250 255 Arg Ile Glu Lys Gly Lys Ile Val Lys Ser Val Glu Met Asn Ala Pro 26 O 265 27 O Asn Tyr His Tyr Glu Glu. Cys Ser Cys Tyr Pro Asp Ser Ser Glu Ile 27s 28O 285 Thir Cys Val Cys Arg Asp Asn Trp His Gly Ser Asn Arg Pro Trp Val 29 O 295 3 OO Ser Phe Asin Glin Asn Lieu. Glu Tyr Glin Ile Gly Tyr Ile Cys Ser Gly 3. OS 310 315 32O Ile Phe Gly Asp Asn. Pro Arg Pro Asn Asp Llys Thr Gly Ser Cys Gly 3.25 330 335 Pro Val Ser Ser Asn Gly Ala Asn Gly Val Lys Gly Phe Ser Phe Lys 34 O 345 35. O Tyr Gly Asn Gly Val Trp Ile Gly Arg Thr Lys Ser Ile Ser Ser Arg 355 360 365 Asn Gly Phe Glu Met Ile Trp Asp Pro Asn Gly Trp Thr Gly Thr Asp 37 O 375 38O Asn Asn. Phe Ser Ile Lys Glin Asp Ile Val Gly Ile Asn. Glu Trp Ser 385 390 395 4 OO Gly Tyr Ser Gly Ser Phe Val Gln His Pro Glu Lieu. Thr Gly Lieu. Asp 4 OS 41O 415 Cys Ile Arg Pro Cys Phe Trp Val Glu Lieu. Ile Arg Gly Arg Pro Llys 42O 425 43 O Glu Asn. Thir Ile Trp Thr Ser Gly Ser Ser Ile Ser Phe Cys Gly Val 435 44 O 445 Asn Ser Asp Thr Val Gly Trp Ser Trp Pro Asp Gly Ala Glu Lieu Pro 450 45.5 460 Phe Thir Ile Asp Llys 465

<210s, SEQ ID NO 18 &211s LENGTH: 498 212. TYPE: PRT <213> ORGANISM: Influenza virus

<4 OOs, SEQUENCE: 18 Met Ala Ser Glin Gly Thr Lys Arg Ser Tyr Glu Gln Met Glu. Thr Gly 1. 5 1O 15 Gly Glu Arg Glin Asp Ala Thr Glu Ile Arg Ala Ser Val Gly Arg Met 2O 25 3O Ile Gly Gly Ile Gly Arg Phe Tyr Ile Gln Met Cys Thr Glu Lieu Lys 35 4 O 45 Lieu. Ser Asp Tyr Asp Gly Arg Lieu. Ile Glin Asn. Ser Ile Thir Ile Glu SO 55 6 O Arg Met Val Lieu. Ser Ala Phe Asp Glu Arg Arg Asn Llys Tyr Lieu. Glu 65 70 7s 8O Glu. His Pro Ser Ala Gly Lys Asp Pro Llys Llys Thr Gly Gly Pro Ile 85 90 95 Tyr Arg Arg Val Asp Gly Llys Trp Met Arg Glu Lieu. Ile Lieu. Tyr Asp US 2011/O 159031 A1 Jun. 30, 2011 34

- Continued

1OO 105 11 O Lys Glu Glu Ile Arg Arg Val Trp Arg Glin Ala Asn. Asn Gly Glu Asp 115 12 O 125 Ala Thr Ala Gly Lieu. Thr His Ile Met Ile Trp His Ser Asn Lieu. Asn 13 O 135 14 O Asp Ala Thir Tyr Glin Arg Thr Arg Ala Lieu Val Arg Thr Gly Met Asp 145 150 155 160 Pro Arg Met Cys Ser Leu Met Glin Gly Ser Thr Lieu Pro Arg Arg Ser 1.65 17O 17s Gly Ala Ala Gly Ala Ala Wall Lys Gly Val Gly. Thir Ile Ala Met Glu 18O 185 19 O Lieu. Ile Arg Met Ile Lys Arg Gly Ile Asn Asp Arg Asn. Phe Trp Arg 195 2OO 2O5 Gly Glu Asn Gly Arg Arg Thr Arg Val Ala Tyr Glu Arg Met Cys Asn 21 O 215 22O Ile Lieu Lys Gly Llys Phe Glin Thir Ala Ala Glin Arg Ala Met Met Asp 225 23 O 235 24 O Glin Val Arg Glu Ser Arg Asn. Pro Gly Asn Ala Glu Ile Glu Asp Lieu. 245 250 255 Ile Phe Lieu Ala Arg Ser Ala Lieu. Ile Lieu. Arg Gly Ser Val Ala His 26 O 265 27 O Llys Ser Cys Lieu. Pro Ala CyS Val Tyr Gly Lieu. Ala Val Ala Ser Gly 27s 28O 285 His Asp Phe Glu Arg Glu Gly Tyr Ser Leu Val Gly Ile Asp Pro Phe 29 O 295 3 OO Llys Lieu. Lieu. Glin Asn. Ser Glin Val Val Ser Lieu Met Arg Pro Asn. Glu 3. OS 310 315 32O Asn Pro Ala His Llys Ser Glin Lieu Val Trp Met Ala Cys His Ser Ala 3.25 330 335 Ala Phe Glu Asp Lieu. Arg Val Ser Ser Phe Ile Arg Gly Lys Llys Val 34 O 345 35. O Ile Pro Arg Gly Llys Lieu. Ser Thr Arg Gly Val Glin Ile Ala Ser Asn 355 360 365 Glu Asn Val Glu Thir Met Asp Ser Asn. Thir Lieu. Glu Lieu. Arg Ser Arg 37 O 375 38O Tyr Trp Ala Ile Arg Thr Arg Ser Gly Gly Asn. Thir Asn Glin Glin Lys 385 390 395 4 OO Ala Ser Ala Gly Glin Ile Ser Val Glin Pro Thr Phe Ser Val Glin Arg 4 OS 41O 415 Asn Lieu Pro Phe Glu Arg Ala Thr Val Met Ala Ala Phe Ser Gly Asn 42O 425 43 O Asn Glu Gly Arg Thr Ser Asp Met Arg Thr Glu Val Ile Arg Met Met 435 44 O 445 Glu Ser Ala Lys Pro Glu Asp Lieu. Ser Phe Glin Gly Arg Gly Val Phe 450 45.5 460 Glu Lieu. Ser Asp Glu Lys Ala Thr Asn Pro Ile Val Pro Ser Phe Asp 465 470 47s 48O Met Ser Asn Glu Gly Ser Tyr Phe Phe Gly Asp Asn Ala Glu Glu Tyr 485 490 495

Asp Ser US 2011/O 159031 A1 Jun. 30, 2011 35

- Continued

<210s, SEQ ID NO 19 &211s LENGTH: 562 212. TYPE: PRT <213> ORGANISM: Influenza virus

<4 OOs, SEQUENCE: 19 Met Ala Ile Ile Tyr Lieu. Ile Lieu. Lieu. Phe Thr Ala Val Arg Gly Asp 1. 5 1O 15 Glin Ile Cys Ile Gly Tyr His Ala Asn. Asn. Ser Thr Glu Lys Val Asp 2O 25 3O Thir Ile Lieu. Glu Arg Asn Val Thr Val Thir His Ala Lys Asp Ile Lieu. 35 4 O 45 Glu Lys Thr His Asn Gly Llys Lieu. Cys Llys Lieu. Asn Gly Ile Pro Pro SO 55 6 O Lieu. Glu Lieu. Gly Asp Cys Ser Ile Ala Gly Trp Lieu. Lieu. Gly Asn Pro 65 70 7s 8O Glu Cys Asp Arg Lieu Lleu Ser Val Pro Glu Trp Ser Tyr Ile Met Glu 85 90 95 Lys Glu Asn Pro Arg Asp Gly Lieu. Cys Tyr Pro Gly Ser Phe Asn Asp 1OO 105 11 O Tyr Glu Glu Lieu Lys His Lieu. Lieu. Ser Ser Val Llys His Phe Glu Lys 115 12 O 125 Val Lys Ile Leu Pro Lys Asp Arg Trp Thr Gln His Thr Thr Thr Gly 13 O 135 14 O Gly Ser Arg Ala Cys Ala Val Ser Gly Asn. Pro Ser Phe Phe Arg Asn 145 150 155 160 Met Val Trp Lieu. Thir Lys Lys Gly Ser Asn Tyr Pro Val Ala Lys Gly 1.65 17O 17s Ser Tyr Asn Asn Thr Ser Gly Glu Gln Met Lieu. Ile Ile Trp Gly Val 18O 185 19 O His His Pro Asn Asp Glu Thr Glu Glin Arg Thr Lieu. Tyr Glin Asn Val 195 2OO 2O5 Gly Thr Tyr Val Ser Val Gly Thr Ser Thr Lieu. Asn Lys Arg Ser Thr 21 O 215 22O Pro Asp Ile Ala Thr Arg Pro Llys Val Asn Gly Lieu. Gly Ser Arg Met 225 23 O 235 24 O Glu Phe Ser Trp Thr Lieu Lleu. Asp Met Trp Asp Thr Ile Asin Phe Glu 245 250 255 Ser Thr Gly Asn Lieu. Ile Ala Pro Glu Tyr Gly Phe Lys Ile Ser Lys 26 O 265 27 O Arg Gly Ser Ser Gly Ile Met Lys Thr Glu Gly Thr Lieu. Glu Asn Cys 27s 28O 285 Glu Thir Lys Cys Glin Thr Pro Leu Gly Ala Ile Asn Thr Thr Lieu Pro 29 O 295 3 OO Phe His Asn Val His Pro Leu. Thir Ile Gly Glu. Cys Pro Llys Tyr Val 3. OS 310 315 32O Llys Ser Glu Lys Lieu Val Lieu Ala Thr Gly Lieu. Arg Asn Val Pro Glin 3.25 330 335 Ile Glu Ser Arg Gly Lieu. Phe Gly Ala Ile Ala Gly Phe Ile Glu Gly 34 O 345 35. O Gly Trp Glin Gly Met Val Asp Gly Trp Tyr Gly Tyr His His Ser Asn 355 360 365 US 2011/O 159031 A1 Jun. 30, 2011 36

- Continued

Asp Glin Gly Ser Gly Tyr Ala Ala Asp Glu Ser Thr Glin Lys Ala 37 O 375

Phe Asp Gly Ile Thr Asn Wall Asn. Ser Wall Ile Glu Lys Met Asn 385 390 395 4 OO

Thir Glin Phe Glu Ala Wall Lys Glu Phe Ser ASn Lell Glu Arg Arg 4 OS 415

Lell Glu Asn Luell Asn Lys Met Glu Asp Gly Phe Lieu. Asp Val Trp 425 43 O

Thir Tyr Asn Ala Glu Lieu. Luell Wall Luell Met Glu Asn Glu Arg Thir Lieu. 435 44 O 445

Asp Phe His Asp Ser Asn Wall Lys Asn Lieu. Asp Wall Arg Met 450 45.5 460

Glin Lieu. Arg Asp Asn Wall Glu Lieu. Gly ASn Gly Phe Glu Phe 465 470

His Asp Asp Glu Cys Met Asn. Ser Wall Asn Gly Thr 485 490 495

Asp Pro Tyr Glu Glu Glu Ser Lieu. Asn Arg Asn. Glu SOO 505

Ile Lys Gly Wall Luell Ser Ser Met Gly Wall Glin Ile Lieu Ala 515 52O 525

Ile Tyr Ala Thr Wall Ala Gly Ser Luell Ser Luell Ala Ile Met Met Ala 53 O 535 54 O

Gly Ile Ser Phe Trp Met Ser Asn Gly Ser Luell Glin Cys Arg Ile 5.45 550 555 560

Ile

1. An antigenic composition comprising a vaccinia virus 9. The antigenic composition of claim 1, wherein the vector vector comprising a polynucleotide encoding a hemaggluti optionally comprises a polynucleotide encoding an influenza nin protein (HA) from influenza A and a polynucleotide A nucleoprotein (NP) protein. encoding a neuraminidase protein (NA) from an influenza A virus, wherein the HA is of subtype selected from the group 10. The antigenic composition of claim 9, wherein the HA, consisting of H1, H2,H3, H4, H5, H6, H7, H8, H9, H10, H11, NA and NP are derived from the same strain. H12, H13, H14, H15, and H16, and wherein the NA is of a 11. The antigenic composition of claim 1, wherein the subtype selected from the group consisting of N1, N2, N3, vaccinia virus is selected from the group consisting of modi N4, N5, N6, N7, N8 and N9. fied vaccinia Ankara (MVA), vaccinia virus Lister (VVL) and 2. The antigenic composition of claim 1, wherein the poly defective vaccinia Lister. nucleotide encoding the HA and the polynucleotide encoding 12. The antigenic composition of claim 1, said antigenic the NA are derived from the same virus strain. composition characterized by the ability to propagate in Ver 3. The antigenic composition of claim 1, wherein the poly nucleotide encoding the HA and the polynucleotide encoding tebrate cell culture. the NA are derived from different virus strains. 13. The antigenic composition of claim 12, wherein the 4. The antigenic composition of claim 1, wherein the HA is vertebrate cell is selected from the group consisting of MRC derived from subtype H1 and the NA derived from subtype 5, Vero, CV-1, MDCK, MDBK, HEK, H9, CEM, PerC6, N1. BHK-21, BSC and LLC-MK2, DF-1, QT-35, or primary 5. The antigenic composition of claim 4, wherein the HA chicken cells. and NA are derived from influenza A strain virus A/Califor 14. The antigenic composition of claim 13, wherein the nia/07/2009. vertebrate cell is a Vero cell. 6. The antigenic composition of claim 5, wherein the HA 15. The antigenic composition of claim 1, further compris protein encoded by the polynucleotide is set out in FIG. 8 ing a pharmaceutically acceptable carrier. (SEQ ID NO: 14) or FIG. 14A (SEQID NO: 16). 7. The antigenic composition of claim 5, wherein the NA 16. The antigenic composition of claim 1, wherein the HA protein encoded by the polynucleotide is set out in FIG. 14B comprises a polybasic cleavage site. (SEQ ID NO:17). 17. The antigenic composition of claim 16, wherein the 8. The antigenic composition of claim 1, wherein the HA is polybasic cleavage site has the amino acid sequence of subtype H2. RERRRKKR (SEQID NO: 1). US 2011/O 159031 A1 Jun. 30, 2011 37

18. A recombinant vaccinia virus comprising a polynucle 37-46. (canceled) otide encoding a hemagglutinin protein (HA) from influenza 47. The vaccine of any one of claim 35 or 36, wherein the A and a polynucleotide encoding a neuraminidase protein polynucleotide encoding the HA, the polynucleotide encod (NA) from an influenza A virus, wherein the HA is of subtype ing the NA and the polynucleotide encoding the NP are each selected from the group consisting of H1, H2, H3, H4, H5, operably linked to a promoter. H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, and H16, and wherein the NA is of a subtype selected from the group 48-53. (canceled) consisting of N1, N2, N3, N4, N5, N6, N7, N8 and N9. 54. A method for eliciting an immune response against at 19-27. (canceled) least one influenza virus strain in a Subject, comprising 28. The recombinant vaccinia virus of claim 18, wherein administering an antigenic composition of claim 1, a recom the vaccinia virus is selected from the group consisting of binant vaccinia virus of claim 18 or a vaccine of claim 35 or modified vaccinia Ankara (MVA), vaccinia virus Lister claim 36 in an amount effective to elicit the immune response (VVL) and defective vaccinia Lister. against at least one influenza virus strain. 29. The recombinant vaccinia virus of claim 18, said 55. A method for preventing infection of a subject by an recombinant vaccinia virus characterized by the ability to propagate in Vertebrate cell culture. influenza virus comprising, administering to the Subject an 30-34. (canceled) effective amount of an antigenic composition of claim 1, a 35. A vaccine comprising: a vaccinia virus vector compris recombinant vaccinia virus of claim 18 or a vaccine of claim ing a polynucleotide encoding a hemagglutinin protein (HA) 35 or claim 36 in an amount effective to prevent infection of from influenza A and a polynucleotide encoding a neuramini the subject by the influenza virus. dase protein (NA) from an influenza A virus, wherein the HA 56-57. (canceled) is from a subtype selected from the group consisting of H1, 58. A method of making a vaccine comprising a vaccinia H2,H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, virus vector and polynucleotide encoding a hemagglutinin H15, and H16, and wherein the NA is from a subtype selected protein (HA) from influenza A and a polynucleotide encoding from the group consisting of N1, N2, N3, N4, N5, N6, N7, N8 a neuraminidase protein (NA) from an influenza A virus, and N9, and wherein the HA is of subtype selected from the group con wherein the polynucleotide encoding the HA and the poly sisting of H1, H2,H3, H4, H5, H6, H7, H8, H9, H10, H11, nucleotide encoding the NA are operatively linked to H12, H13, H14, H15, and H16, and wherein the NA is of a allow packaging of the polynucleotides into a virion. subtype selected from the group consisting of N1, N2, N3, 36. A vaccine comprising, i) a first vaccinia virus vector N4, N5, N6, N7, N8 and N9, and optionally comprising a comprising a polynucleotide encoding a hemagglutinin pro polynucleotide encoding an influenza A nucleoprotein (NP) tein (HA) from influenza A, and ii) a second vaccinia Vector protein, the method comprising transfecting the HA, NA, and comprising a polynucleotide encoding a neuraminidase pro optionally NP polynucleotides into the virus in vertebrate tein (NA) from an influenza A virus, cells under conditions suitable for growth of the virus. wherein the polynucleotide encoding the HA and the poly 59-69. (canceled) nucleotide encoding the NA are operatively linked to allow packaging of the polynucleotides into a virion.