DETERMINING THE IN VIVO ROLE OF NCK IN ENDOTHELIAL CELLS DURING
CARDIOVASCULAR DEVELOPMENT
A Thesis
Presented to
The Faculty of Graduate Studies
of
The University of Guelph
by
RICHARD ANDREW HARRIS
In partial fulfillment of requirements
for the degree of
Master of Science
October, 2009
©Richard Harris, 2009 Library and Archives Bibliothfeque et 1*1 Canada Archives Canada Published Heritage Direction du Branch Patrimoine de I'gdition
395 Wellington Street 395, rue Wellington Ottawa ON K1A 0N4 Ottawa ON K1A0N4 Canada Canada
Your file Votre reference ISBN: 978-0-494-60393-2 Our file Notre reference ISBN: 978-0-494-60393-2
NOTICE: AVIS:
The author has granted a non- L'auteur a accorde une licence non exclusive exclusive license allowing Library and permettant a la Bibliotheque et Archives Archives Canada to reproduce, Canada de reproduce, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par Nnternet, preter, telecommunication or on the Internet, distribuer et vendre des theses partout dans le loan, distribute and sell theses monde, a des fins commerciales ou autres, sur worldwide, for commercial or non- support microforme, papier, electronique et/ou commercial purposes, in microform, autres formats. paper, electronic and/or any other formats.
The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in this et des droits moraux qui protege cette these. Ni thesis. Neither the thesis nor la these ni des extraits substantiels de celle-ci substantial extracts from it may be ne doivent etre imprimes ou autrement printed or otherwise reproduced reproduits sans son autorisation. without the author's permission.
In compliance with the Canadian Conformement a la loi canadienne sur la Privacy Act some supporting forms protection de la vie privee, quelques may have been removed from this formulaires secondaires ont ete enleves de thesis. cette these.
While these forms may be included Bien que ces formulaires aient inclus dans in the document page count, their la pagination, il n'y aura aucun contenu removal does not represent any loss manquant. of content from the thesis. Canada ABSTRACT
DETERMINING THE IN VIVO ROLE OF NCK IN ENDOTHELIAL CELLS DURING
CARDIOVASCULAR DEVELOPMENT
Richard Andrew Harris Advisor:
University of Guelph, 2009 Dr. Nina Jones
Cardiovascular development is a complex process regulated by intercellular signaling mechanisms that coordinate cellular patterning during embryogenesis. The family of Nek adaptor proteins link incoming chemical stimuli at receptor tyrosine kinases on the cell surface to downstream effector molecules that regulate organization of the actin cytoskeleton network.
Considering that endothelial cell migration is essential for proper vascular development, and Nek has been shown to regulate this process, we hypothesize that Nek is required for cardiovascular development. Utilizing the Cre-LoxP genetic system, we have demonstrated that deleting Nck2 expression in embryonic endothelial cells of AfcAi-null mice results in lethality between embryonic day 10 and 11. These mice are characterized by specific defects to the vitelline vessel structure of the yolk sac, and the endocardial layering of the primitive heart tube. In order to complement the in vivo mutant phenotype, we have optimized a protocol for isolation of primary endothelial cell cultures from the lungs of Cre", Nckl"7", Nck2flx/flx adult mice, which will be used for further characterization. These results demonstrate the crucial role of Nek in endothelial cells during cardiovascular development, and may serve to further elucidate the signaling mechanisms that underlie this complex process. ACKNOWLEDGMENTS
When I first decided to pursue a Master of Science degree at the University of Guelph more than two years ago, I chose my advisor, Dr. Nina Jones, because she seemed smart and understanding, but she was also filled with a spirited and youthful enthusiasm. Looking back on it now, it was her passion for science that drove me to pursue my own goals with that same energy. Over the years, she has helped me to develop as a scientist, but also gave me the freedom to grow as an individual. I owe many successes to her leadership and understanding, and know that she will carry the same enthusiastic pursuit of research for many more years to come. I wish you a full career of reaching your goals, as you have helped me reach mine. I also want to thank
Drs. Andrew Bendall and Brenda Coomber for their continual advice and direction as members of my advisory committee.
To past and present members of the Jones lab: Steve, Laura, Megan, Melanie, Sylvie,
Kelly, Stephanie, Adam, and Colin, thank you for making the lab a fun and enjoyable place to work -1 couldn't have done it without you guys. I owe many thanks to Martha Manning, of the
Central Animal Facility, for taking good care of the mice. Dr. Michaela Strueder-Kypke, from the Advanced Analysis Center of the University of Guelph, was invaluable in her help with the confocal microscope. I want to thank Drs. Mira Puri and Aya Kitabayashi, from Mount Sinai
Hospital, for their help with the heart sections and letting me use their microscope. I also want to thank Dr. Geoffrey Wood for taking the time to help with the histology and a special thanks goes out to Dr. Reggie Lo for inviting me to play basketball as a break from lab work!
I wish to dedicate this work to my wife, Kristel, who continues to be an incredible source of inspiration and energy in my life. With her love and support, I feel that there is nothing I cannot achieve. As you are always there to catch me when I fall, I am no longer afraid to jump.
i DECLARATION OF WORK PERFORMED
I declare that all work described in this document was performed by myself, with the exception of all items indicated below. Martha Manning, of the Central Animal Facility, performed general maintenance of the mouse colony through feeding and bedding changes, as well as occasionally weaning and ear notching. Histological sectioning and staining was graciously performed by the Advanced Bio-imaging Centre at Mount Sinai Hospital, Toronto.
The customer support department at Invitrogen aided in developing the modified protocol for improved endothelial cell selection using Dynalbeads. Dr. Brenda Coomber graciously provided the bEND3 cell line. The Tie2-Cre and Nckl"'", Nck2flx/flx founder lines were generously provided by Dr. Rong Wang (University of California at San Francisco) and Dr. Tony Pawson
(University of Toronto), respectively.
ii TABLE OF CONTENTS
ABSTRACT
ACKNOWLEDGMENTS.. ±
DECLARATION OF WORK PERFORMED ii
TABLE OF CONTENTS iii - v
LIST OF TABLES vi
LIST OF FIGURES vii
LIST OF ABBREVIATIONS viii - ix
INTRODUCTION 1
Cardiovascular Development 2
Vasculogenesis in the early mammalian embryo 2
Angiogenesis contributes to maturation of the cardiovascular system 3
Heart development and blood circulation aids in vessel patterning 6
Placenta and extraembryonic membranes 9
Endothelial cell signaling 10
Receptor tyrosine kinase signaling regulates endothelial cell behavior 10
Vascular Endothelial Growth Factor 12
Tie/Tek 12
Platelet-Derived Growth Factor 13
Eph/Ephrin 14
Integrins 15
iii The Nek family of adaptor proteins 17
Introduction to Nek 17
Nek SH3 domains interact with actin-organizing effector molecules 20
RATIONALE AND HYPOTHESIS 23
MATERIALS AND METHODS 25
Objective 1: In vivo characterization of Nek in endothelial cells during development. 25
Animal care policy 25
Transgenic mice housing and care 25
Mouse genetics: Nckl"7", Nck2flx/flx, Tie2-Cre 26
Mouse ear-notch tissue sample preparation for PCR-based genotyping 27
DreamTaq PCR mixture and Thermocycler Conditions 27
Genotype primers 28
Pregnant mouse euthanasia and embryo collection 28
Whole-mount immunofluorescence for yolk sac 29
Histological sectioning and Hematoxylin and Eosin staining 30
Objective 2: In vitro characterization of Nek in cultured endothelial cells 30
Preparation of gelatin/fibronectin coated culture dishes 30
Collagenase treatment of dissected lung tissue 31
Positive sort for endothelial cells 32
Cell immunofluorescence staining 33
iv RESULTS 35
Breeding strategy for generation of Nck-null mouse model 35
Loss of endothelial-Nckresults in embryonic lethality betweenE10 and Ell 37
Thinning of the yolk sac vitelline vessel 42
Defects to the endocardial cushion, myocardial trabeculation and cardiac valves
of the heart 46
Primary endothelial cell culture 48
Revised protocol for endothelial cell selection 48
DISCUSSION 52
Loss of endothelial-Nck results in embryonic lethality between E10 and El 1 52
Thinning of the yolk sac vitelline vessel 53
Defects to the endocardial cushion, myocardial trabeculation and cardiac valves
of the heart 55
Cardiac output vs. vessel structure 56
Further characterization of the mutant embryo phenotype 58
Primary endothelial cell culture 61
SUMMARY AND CONCLUSIONS 63
REFERENCES 64
v LIST OF TABLES
Table Page
1. Primer sequences used for PCR-based genotyping of Cre, Nckl and Nck2 genes 28
2. Endothelial-Nck null pups succumb prenatally 37
3. Loss of endothelial-Nck results in embryonic lethality between E10 and Ell 38
4. Insights into endothelial molecular identity by mouse knockout studies 60
vi LIST OF FIGURES
Figure Page
1. Mechanisms of Vasculogenesis and Angiogenesis 5
2. Heart Development 7
3. Endothelial cell signaling pathways contributing vascular development 11
4. Binding partners for Nek 1/2 adaptor proteins 19
5. Breeding strategy for production of endothelial-Nek null mice from Tie2-Cre
and Nckl"7", Nck2flx/flx founder lines 36
6. Determining the lethal time-point of mutant embryos 40
7. Enlarged view of embryonic day 10.5 embryos 41
8. Loss of endothelial-Nck results in decreased vessel perfusion on yolk sac 43
9. Loss of endothelial-Nck results in loss of structural integrity of major vitelline
vessel of El 0.5 yolk sac 44
10. Recruitment of smooth muscle cells to the yolk sac vitelline vessel 45
11. Heart defects apparent in endocardial cushion and myocardial trabeculation of
mutant embryos 47
12. Isolation of primary endothelial cells from Cre", Nckl"/+, Nck2flx/flx mouse lung tissue . 49
13. Optimizing the efficiency of endothelial cell separation from primary lung cells 51
vii LIST OF ABBREVIATIONS
Abl Abelson murine leukemia viral oncogene homolog Ang Angiopoeitin Arp2/3 Actin-related protein2/3 BSC Biological safety cabinet Cbl Casitas B-lineage Lymphoma Cdc42 Cell division control 42 protein Cdk Cyclin dependent kinase DAPI 4',6-diamidino-2-phenylindole DLL4 Delta-like-4-ligand DMEM Dulbecco's modified eagle's medium Dok Downstream of tyrosine kinase protein E(8) Embryonic day (8) ECM Extracellular matrix EDTA Ethylenediamine-tetraacetic acid EMT Epithelial to mesenchymal transition Erk Extracellular signal-related kinase FAK Focal adhesion kinase Fix Flanked by Loxp Grb2/4 Growth factor receptor-bound protein 2/4 HB-EGF Heparin binding EGF-like growth factor H&E Hematoxylin and eosin HSP27 Heat shock protein 27 HUVEC Human umbilical vein endothelial cell ICAM-2 Intercellular adhesion molecule 2 ILK Integrin linked kinase protein IRES Internal ribosome entry site JNK c-Jun NH2-terminal kinase MAPK Mitogen activated protein kinase mDia2 Mammalian Diaphanous-related formin 2 MLEC Mouse lung endothelial cell
viii Nek Non-Catalytic region of tyrosine Kinase PAK p21-associated kinase PBS (MT) Phosphate buffered saline (Milk and Triton-XlOO) PCR Polymerase chain reaction PDGF/PDGFR Platelet derived growth factor/receptor PECAM Platelet endothelial cell adhesion molecule PI3K Phosphatidy linositol-3 -kinase PINCH Particularly interesting new Cys-His protein PIX Pak interacting exchange factor PLC Primary lung cells PTB Phosphotyrosine binding pYl 175 phospho-Tyrosine (residue 1175) RTK Receptor tyrosine kinase Ras-GAP Ras-GTPase activating protein RhoA Ras homolog-A SDS Sodium dodecyl sulfate SH2/3 Src homology 2/3 Shb Src homology 2 domain-containing protein B She Src homolog and collagen homolog protein SHP2 Protein tyrosine phosphatase SMA Smooth muscle actin Tie/Tek Tyrosine kinase with Ig-like loops and EGF-homology domains TUNEL Terminal deoxynucleotidyl transferase VE-Cadherin (Vascular endothelial) Cadherin VEGF/VEGFR Vascular endothelial growth factor/receptor (N)WASP (Neuronal) Wiskott-Aldrich Syndrome protein WAVE WASP-family verprolin-homologous protein
ix INTRODUCTION
The cardiovascular system is the earliest organ system to develop in vertebrate embryos, and functions to deliver nutrients and oxygen to newly forming and initially avascular tissues.
Embryonic growth and development depends on a functional circulatory system, not just for nutrient and waste regulation, but also for communication between distant organs and tissues.
Inter-cellular signaling mechanisms play a critical role in coordinating the complex progression of cellular patterning and behavior during cardiovascular development. The diverse classes of receptor tyrosine kinases (RTKs) are cell surface receptors that bind incoming soluble factors and respond by recruiting cytoplasmic proteins that transduce the signal into the cell. Of particular importance to development of the cardiovascular system are RTKs on the surface of endothelial and mural support cells, such as vascular endothelial growth factor receptors
(VEGFRs), platelet-derived growth factor receptors (PDGFRs), Tie/Tek receptors, the family of
Eph/Ephrin receptors, and the family of integrins, that regulate vessel formation, growth, and branching, as well as development of the embryonic heart. Animal loss-of-function studies of these vascular cell-specific receptors have revealed the vital importance of such receptors for proper development, as most knockout embryos succumb prenatally. As a result, the complex cascade of intracellular signaling events downstream of RTKs has yet to be fully investigated in the context of embryonic development. Recent advances in genetic technology have granted control over tissue-specific deletion of particular genes to reveal their inherent role in a given cell type during development. The endothelial cell-specific deletion of signaling molecules that function downstream of the above-noted RTKs will reveal their physiological role during development of the cardiovascular system.
1 CARDIOVASCULAR DEVELOPMENT
Vasculogenesis in the early mammalian embryo
Vasculogenesis is the process by which blood vessels are formed de novo and begins early in embryonic development, where vascular progenitor cells appear in the posterior primitive streak (Coultas et al., 2005). These blood precursor cells, known as hemangioblasts, express vascular endothelial growth factor receptor-2 (VEGFR-2 or Flkl) and are able to migrate to either the extraembryonic or intraembryonic mesoderm (Dumont et al., 1995). In the extra- embryonic mesoderm, hemangioblasts are guided by attractive and repulsive chemical gradients where they collect at specific sites of aggregation, known as primitive blood islands (Figure 1)
(Baron, 2001). Hemangioblasts then differentiate into either angioblasts, a migrating endothelial precursor cell on the periphery, or hematopoietic stem cells of the blood lumen (Risau and
Flamme, 1995). Endothelial cells and their precursors are marked with expression of platelet endothelial cell adhesion molecule (PECAM, or CD31) and vascular endothelial (VE)-Cadherin, which comprise cell-cell adhesion junctions between neighboring endothelial cells (Dejana,
2004). As endothelial cells continue to differentiate and migrate, primitive vessel tubes are formed from the elongation of localized blood islands with endothelial cells lining the inside of the vessel walls. At this time, multiple vessel tubes interconnect to form a structure known as the primary vascular plexus. Early expression of ephrinB2, and its receptor EphB4, define arterial and venous specification respectively, which establishes polarity and aids in coordinating vessel networks between adjacent endothelial cells (Wang et al., 1998). Major vascular structures of the intraembryonic mesoderm, such as the dorsal aorta and cardinal veins, develop directly from aggregating angioblasts without the concurrent association and differentiation of hematopoietic stem cells (Coultas et al., 2005). At this time, intraembryonic vessel networks
2 INTRODUCTION
The cardiovascular system is the earliest organ system to develop in vertebrate embryos,
and functions to deliver nutrients and oxygen to newly forming and initially avascular tissues.
Embryonic growth and development depends on a functional circulatory system, not just for
nutrient and waste regulation, but also for communication between distant organs and tissues.
Inter-cellular signaling mechanisms play a critical role in coordinating the complex progression
of cellular patterning and behavior during cardiovascular development. The diverse classes of
receptor tyrosine kinases (RTKs) are cell surface receptors that bind incoming soluble factors
and respond by recruiting cytoplasmic proteins that transduce the signal into the cell. Of particular importance to development of the cardiovascular system are RTKs on the surface of endothelial and mural support cells, such as vascular endothelial growth factor receptors
(VEGFRs), platelet-derived growth factor receptors (PDGFRs), Tie/Tek receptors, the family of
Eph/Ephrin receptors, and the family of integrins, that regulate vessel formation, growth, and branching, as well as development of the embryonic heart. Animal loss-of-function studies of these vascular cell-specific receptors have revealed the vital importance of such receptors for proper development, as most succumb prenatally. However, the complex cascade of intracellular signaling events downstream of RTKs has yet to be fully investigated in the context of embryonic development. Recent advances in genetic technology have granted control over tissue-specific deletion of particular genes to reveal their inherent role in a given cell type during development. The endothelial cell-specific deletion of signaling molecules that function downstream of the above-noted RTKs will reveal their physiological role during development of the cardiovascular system.
1 CARDIOVASCULAR DEVELOPMENT
Vasculogenesis in the early mammalian embryo
Vasculogenesis is the process by which blood vessels are formed de novo and begins,
early in embryonic development, where vascular progenitor cells appear in the posterior
primitive streak (Coultas et al., 2005). These blood precursor cells, known as hemangioblasts,
express vascular endothelial growth factor receptor-2 (VEGFR-2 or Flkl) and are able to migrate
to either the extraembryonic or intraembryonic mesoderm (Dumont et al., 1995). In the extra-
embryonic mesoderm, hemangioblasts are guided by attractive and repulsive chemical gradients
where they collect at specific sites of aggregation, known as primitive blood islands (refer to
Figure 1) (Baron, 2001). Hemangioblasts then differentiate into either angioblasts, a migrating endothelial precursor cell, on the periphery or hematopoietic stem cells of the blood lumen
(Risau and Flamme, 1995). Endothelial cells and their precursors are marked with expression of platelet endothelial cell adhesion molecule (PECAM, or CD31) and vascular endothelial (VE)- cadherin, which comprise cell-cell adhesion junctions between neighboring endothelial cells
(Dejana, 2004). As endothelial cells continue to differentiate and migrate, primitive vessel tubes are formed from the elongation of localized blood islands with endothelial cells lining the inside of the vessel walls. At this time, multiple vessel tubes interconnect to form a structure known as the primary vascular plexus. Early expression of molecules ephrinB2, and its receptor EphB4, define arterial and venous specification respectively, which establish polarity and aid in coordinating vessel networks between adjacent endothelial cells (Wang et al., 1998). Major vascular structures of the intraembryonic mesoderm, such as the dorsal aorta and cardinal veins, develop directly from aggregating angioblasts without the concurrent association and differentiation of hematopoietic stem cells (Coultas et al., 2005). At this time, intraembryonic
2 vessel networks connect to extra-embryonic vascular structures to establish circulation and form
an immature cardiovascular system. Endothelial cells of mature blood vessels secrete platelet-
derived growth factor (PDGF) and express the Tie2 receptor to recruit circulating mural
progenitor cells, such as pericytes and vascular smooth muscle cells, which contribute to
vascular integrity and quiescence (Armulik et al., 2005). Both mural cell types share a
mesenchymal, fibroblast-like morphology, yet pericytes cover capillaries and immature blood
vessels, while vascular smooth muscle cells cover mature vessels and are separated from the
endothelium by a basement membrane (Adams and Alitalo, 2007). Finally, the generation of
lumen and establishment of blood flow in new vessels is thought to involve pinocytosis of the
vessel stalk, with large vacuole formation and fusion, which has been shown in growing
intersegmental vessels of the zebrafish (Kamei et al., 2006). The establishment of circulation is
essential to the patterning of vascular structures, as hemodynamic shear stress from the beating
heart aids in differentiating endothelial cells and contributes to vessel organization during
development of the cardiovascular system (Jones et al., 2006).
Angiogenesis contributes to maturation of the cardiovascular system
The immature cardiovascular system is further refined by angiogenesis, the sprouting of
new capillaries from pre-existing vessels, which is crucial for the vascularization of newly developing organs such as the brain, kidney, and central nervous system. Angiogenesis is a strictly controlled process involving numerous pro-angiogenic signals that promote endothelial cell sprouting, such as VEGF, and anti-angiogenic signals that promote quiescence. The process begins with a specific population of endothelial cells of the vessel wall known as tip cells that are selected for sprouting through VEGF signaling. Notch receptors and their Delta-like-4 ligand
(DLL4) appear to be directly connected to VEGF signaling, as DLL4 expression is induced in
3 response to VEGF, whereas Notch activation suppresses expression of VEGFR-2 (Lobov et al.,
2007). Furthermore, inactivation of Notch signaling promotes the number of tip cells generated
and stimulates non-specific angiogenesis in the mouse retina (Hellstrom et al., 2007). The DLL4-
Notch mechanism is thought to prevent excessive angiogenic sprouting, as selected endothelial
tip cells prevent VEGF-mediated signaling in neighboring cells. Tip cells then undergo
differentiation into an invasive cell type that degrades the surrounding extracellular matrix
(ECM) by secreting matrix-metalloproteinases (Heissig et al., 2003). Tip cells then migrate into
the surrounding extracellular space in response to exposed matrix-anchored VEGF-A isoform
chemotactic gradients (Gerhardt et al., 2003). Interestingly, transgenic mice engineered to solely
express a soluble VEGFA isoform that lacks a heparin-binding motif (VEGF 120 in mice),
resulted in a specific decrease in capillary branch formation suggesting that matrix-anchored
VEGF molecules play a key role in branching angiogenesis (Ruhrberg et al., 2002). Vascular
endothelial cells, especially new sprouts, require binding to an ECM matrix for migration as well
as proliferation and survival. Failure of endothelial cells to attach to an ECM can result in
inhibition of cell proliferation and induction of apoptosis (Ilan et al., 1998). Furthermore, the
ECM serves as a scaffold for sprouting endothelial cells to communicate by generating
mechanical and contractile forces independent of direct cell-cell contact (Vernon and Sage,
1995). Thus, basement membrane degradation is immediately followed by the biosynthesis of
ECM components, such as laminin and collagen, during sprouting angiogenesis (Davis and
Senger, 2005). As the vessel sprout continues to grow, another gradient of PDGF is generated by proliferating endothelial cells to recruit pericytes and stabilize the newly formed vessel.
4 Vasculogenesis Angiogenesis
O t t) VEGF ® ° O 0 't) Hemangioblasts Ai. O o o o o VEGF o ih o
o \j, Extracellular matrix o PDGF e o e o
o. o • o ® © v. i y d • • o Angl o
B o
A Endothelial cells o o Hematopoietic cells o A Smooth muscle U o 2)
Figure 1. Mechanisms of Vasculogenesis and Angiogenesis. In the early mammalian embryo, vasculogenesis (A-C) begins with a population of hemangioblasts that respond to chemical gradients of VEGF and collect at specific sites
of aggregation, known as blood islands. Hematopoietic stem cells comprise the blood lumen on the inside and endothelial progenitor cells line the walls of the immature vessel tube. Secretion of PDGF and expression of Tie2 receptors on endothelial cells aid in recruiting circulating smooth muscle cells to form a stabilized blood vessel.
Angiogenesis (D-F) begins with a specific set of endothelial cells known as tip cells that are selected to respond to chemical gradients of VEGF. Tip cells then differentiate into an invasive cell type that secrete matrix metalloproteases to degrade the extracellular matrix and migrate toward the source of the chemical gradient.
Subsequent proliferation of stalk endothelial cells and the formation of blood lumen push sprouting vessels into the extracellular space. Maturation of the new vessel is obtained through re-synthesis of the extracellular matrix and recruitment of smooth muscle cells.
5 The absence of oxygen, or hypoxia, also contributes to the onset and modeling of angiogenesis in the embryo and adult. Oxygen-sensing molecules in endothelial cells, such as Hypoxia-inducible factor, upregulate angiogenic growth factors and stimulate neo-vasculature growth in response to low oxygen concentrations which is thought to aid in meeting metabolic demands of developing tissues (Pugh and Ratcliffe, 2003).
Heart development and blood circulation aids in vessel patterning
The heart is the first functioning organ in vertebrate animals. In mice, the primitive heart tube is formed at embryonic day (E) 7.5 during gastrulation and blood circulation is established by E8 (Sissman, 1970). The heart develops from a population of cardiogenic cells from the embryonic mesoderm that migrate and coalesce to form the "cardiac crescent". In conjunction with the growth of the cranial neural tube, migrating endocardial cells form a lumen in the pericardial cavity and are surrounded by myocardial cells to form the centrally located and bilaterally symmetrical heart tube (refer to Figure 2) (Moorman et al., 2003). Cells from the anterior field then migrate to the cranial cardiac regions that will eventually become the outflow tract. With this migration, the heart tube loses symmetry and becomes morphologically defined in anterior and posterior regions, which will give rise to the ventricular and atrial compartments of the heart, respectively (Kelly and Buckingham, 2002). Specification of the early heart chambers is already evident at this stage due to the specific expression of cardiac markers in distinct domains along the anteroposterior axis (Fishman and Olson, 1997; Christoffels et al.,
2000, 2004). The next stage in heart development involves the conversion of anterior/posterior organization of the heart tube to a left/right organization in a process known as "looping", which realigns the ventricle and atrial compartments into a left/right position.
6 Heart Tube Looped Heart Mature Heart
Aorta.. J^"—y
Truncus arteriosus
Future Sinus AV valve Endocardial venosus cushion Future 1 OT valve Myocardial trabeculae Vitelline veins
• Aortic sac • Right atrium • Conotruncal • Left atrium • Right ventricle • Atrioventricular • Left ventricle valve
Figure 2. Heart development. In the early mammalian embryo, the heart forms as a symmetrical tube with the
Truncus arteriosus at the anterior pole and the Sinus venosus at the posterior pole. Blood supply to the growing yolk sac is provided by the Vitelline veins. The heart then undergoes a conversion of anterior/posterior organization to a left/right asymmetrical orientation to form the looped heart. At this stage in development, myocardial trabeculae are formed along the outer curvature of the ventricles and are responsible for generation of primitive circulation.
Maturation of the heart valves and chambers gives rise to the mature heart, which pumps deoxygenated blood out the right ventricle to the lungs, via the pulmonary artery, and oxygenated blood out the left ventricle to the body, via the aorta. Abbreviations: OT, outflow tract; V, ventricle; A, atrium; AV, atrioventricular. (Gilbert, 1949)
7 The primitive ventricle outer layer consists of an outer myocardial layer and an inner endocardial
layer, separated by an extracellular matrix of proteoglycans and glycosamino-glycans called the
cardiac jelly (Wagner and Siddiqui, 2007). Signaling from the overlying endocardium to the
ventricular myocardial cells initiates their proliferation and migration into the lumen to form
thickened protrusions, or trabeculae, of endocardially-covered myocardium, at the outer
curvature of the looped heart tube. Since the contractile myocardium has yet to form, the
myocardial trabeculations are responsible for the maintenance of blood circulation. Concurrently,
endocardial cells moving into the cardiac jelly from the atrioventricular canal and outflow tract
begin to bulge into the lumen and are called cardiac cushions. Endocardial cushion formation is
followed by heart valve development and septation, allowing maintenance of established
circulation by regulating blood flow between the two chambers and the rest of the embryonic
body. Genetic studies have revealed a number of signaling mechanisms between the endocardial and myocardial cell layers that are critical to proper development of heart tube components,
including VEGF-mediated signaling. VEGF signaling has been shown to mediate formation of the cardiac cushion and its eventual remodeling into valve leaflets (Zachary and Gliki, 2001).
The establishment of blood circulation is important for distributing nutrients and oxygen to developing tissues, as hypoxic conditions can damage tissues and impair proper development.
However, blood circulation also establishes hemodynamic force, which is important in aiding angiogenesis and contributes to the maturation of vascular networks. Cultured endothelial cells are able to respond to changes in hemodynamic stress by converting mechanical stress into intracellular signaling cascades that affect cellular behavior, such as proliferation, migration, permeability, and gene expression (Li et al., 2005). The hemodynamic force in the mouse yolk sac has been measured to fall within the parameters that induce responses in cultured endothelial
8 cells (Jones et al., 2004). Furthermore, it has been recently shown that hemodynamic stress is
necessary and sufficient to induce remodeling of the yolk sac vascular networks (Lucitti et al.,
2007). Taken altogether, circulation is important in distributing oxygen and nutrients to tissues,
as well as transforming largely unorganized vessel networks into polar vascular trees by
providing a hemodynamic force that induce morphological changes to endothelial cells.
Placenta and extraembryonic membranes
Due to the complex interaction between the embryo and its mother, the placenta and yolk
sac structures are critically important to proper embryonic development. The yolk sac is an
embryonic-derived tissue that encompasses the embryo in a vitelline fluid, and serves as a
mechanism of nutrient and waste regulation (Balkan et al., 1989). The endoderm of the yolk sac
is lined by an extraembryonic mesoderm that is vascularized strictly by vasculogenesis. During
development, the visceral yolk sac then inverts to completely surround the embryo, external to
the amnion, and then undergoes angiogenesis to spread vascular sprouts along the membrane
(Jollie, 1990). Meanwhile, the newly forming allantoic mesoderm comes into contact with the
chorion at the embryonic pole of the blastocyst, where the chorioallantoic placenta is formed and joins maternal and embryonic tissues to participate in nutrient and gas exchange through a
labyrinthe vasculature (Cross et al., 2003). The allantoic stalk later gives rise to the umbilical cord, which delivers oxygen and nutrient rich blood from the placenta to the developing embryo.
Defects to the developing yolk sac or embryonic-derived placental tissues may result in failure of the placenta to meet metabolic demands of the growing embryo, and is commonly referred to as placental insufficiency (Gagnon, 2003). In animal genetic studies, primary defects leading to placental insufficiency can cause secondary defects in the embryo proper, and must be examined.
9 ENDOTHELIAL CELL SIGNALING
Receptor tyrosine kinase signaling regulates endothelial cell behavior
Receptor tyrosine kinases (RTKs) are a class of single pass, type-1 receptors that have an
intrinsic capability to catalyze the transfer of a phosphoryl group to a tyrosine residue, using
ATP as the donor phosphate (Hubbard and Miller, 2007). Typically, RTKs are activated through
ligand-induced dimerization, which juxtaposes the cytosolic tyrosine kinase domains resulting in
autophosphorylation on specific tyrosine residues in the cytoplasmic tail region. This creates
docking sites for phosphotyrosine binding (PTB) and Src-homology 2 (SH2) domain-containing
proteins that mediate the recruitment of downstream machinery, and propagate the signal to
induce cellular behavior (Schlessinger, 2000). There are 58 RTKs and 32 non-receptor tyrosine
kinases in the human genome, of which most bind growth factors and thus have been implicated
in the onset of cancer via gain-of-function mutations or ligand/receptor overexpression (Hubbard
et al., 2007). RTKs expressed in vascular endothelial cells include the VEGF receptors, the
family of Tie/Tek receptors, the PDGF receptors, and the family of Eph receptors/Ephrin ligands,
as well as the family of integrin receptors that link endothelial cells to the ECM, and are essential
to endothelial cell proliferation, survival, and migration during cardiovascular development
(refer to Figure 3).
It should be noted that the signaling molecules discussed in this overview are by no means a complete compilation of all RTK signaling pathways in endothelial cells during cardiovascular development. In the interest of brevity, only signaling pathways relevant to this investigation are discussed.
10 Figure 3 Endothelial cell signaling pathways contributing to vascular development. Shown on the cell surface are receptor tyrosine kinases: VEGFR-2, Tie-2, PDGFRa/p, and Eph, as well as Integrins, which recruit intracellular signaling molecules in response to activation and ligand-induced tyrosine phosphorylation. Propagation of downstream signaling events contributes to endothelial cell survival, proliferation, extracellular matrix (ECM) control, and cell migration through actin cytoskeleton organization. Abbreviations provided in list of abbreviations.
11 Vascular Endothelial Growth Factor
The family of VEGF mitogens and their respective receptors (VEGFRs) are critical to
both the development of the vascular system and its successive remodeling through
angiogenesis, as well as the formation of the lymphatic system. Of particular importance to
vascular development is VEGFR-2, which binds to soluble ligands VEGF-A, -C, -D, and -E, and
contributes to vascular development by signaling to endothelial cell proliferation, permeability,
migration, and survival (Holmes et al., 2007). Endothelial cells over-expressing VEGFR-2
rapidly accumulate adaptor proteins such as She, Grb2, and Nek at the cell surface (Kroll and
Waltenberger, 1997). Nek recruitment can lead to actin polymerization through neuronal
Wiskott-Aldrich syndrome protein (N-WASP) and the Arp2/3 complex, or through heat shock protein 27 (HSP27) and Cofilin, downstream of Fyn, p21-associated kinase (Pak), and p38 activation (Holmqvist et al., 2003). Recruitment of the Shb adaptor protein to phospho-Tyrosine
(pY)l 175 of VEGFR-2, further recruits focal adhesion kinase (FAK) and PI3K, leading to focal adhesion turnover and cellular attachment to the ECM in parallel with integrin signaling
(Holmqvist et al., 2003). Expression of VEGFR-2 has been detected as early as E7.0 in mesodermal blood island precursors, and mice lacking VEGFR-2 or VEGF-A die at E8.5-9.5 due to defective development of blood islands and primitive vascular networks (Dumont et al., 1995;
Carmeliet et al., 1996; Shalaby et al., 1995). The loss of a single VEGF-A allele in mice results in vascular defects arid embryonic death at E8.5-E9.5, suggesting a critical role of VEGF gradients in regulating vasculogenesis (Ferrara et al., 1996).
Tie/Tek
The family of Tie tyrosine receptor kinases (Tie/Tie 1 and Tek/Tie-2) are endothelial cell- specific receptors, expressed as early as E7.5 in the mouse embryo, which bind the Angiopoietin
12 (Ang) family of ligands (Angl to Ang4) expressed by pericytes and smooth muscle cells (Jones
et al., 2001). Although a single angiopoietin has low mitogenic or proliferative activity on
endothelial cells, together Angl and Ang2 increase endothelial migration and sprouting in vivo
(Mochizuki et al., 2002; Witzenbichler et al., 1998). Activated Tie2 can recruit the tyrosine
phosphatase SHP2 and the adaptor protein Grb2, both of which can stimulate endothelial cell
survival and migration downstream of the ras-mitogen-activated protein kinase (MAPK)
pathway (Huang et al., 1995). Activated Tie2 also induces the recruitment of Dok-R, which
signals to actin remodeling and endothelial cell migration through Rac and Pak downstream of
Ras-GTPase activating protein (rasGAP), Nek and Crk (Jones and Dumont, 1998). Mice lacking
Angl show embryonic lethality, but the vascular defects are less pronounced than the Tie2
knockout, suggesting compensatory ligands and mechanisms exist for the Angl ligand in vivo
(Suri et al., 1996). The family of Tie receptors can also regulate later stages of vessel
development including the recruitment of pericytes and the stabilization of initial endothelial
sprouts, by the endothelial cell-dependent release of chemo-attractants, such as PDGF-|3 (von
Tell et al., 2006). Deletion of Tie2 in mice is embryonic lethal at mid gestation, with extensive
vascular defects including decreased sprouting, simplified vessel branching, cardiac defects such
as reduced myocardial trabeculation, and lack of pericyte recruitment (Dumont et al., 1995;
Patan, 1998; Puri et al., 1999).
Platelet-Derived Growth Factor
Platelet derived growth factors (PDGFs) are a family of soluble mitogens expressed in a variety of cell types, including endothelial cells, and regulate angiogenesis either directly or through recruitment of pericytes (Heldin and Westermark, 1999). Upon binding to their receptors
(PDGFRa or (3), on the surface of capillary endothelial cells, pericytes, and smooth muscle cells,
13 PDGF stimulates proliferation, chemotaxis, and formation of angiogenic sprouts in vitro (Beitz et
al., 1991; Battegay et al., 1994; Edelberg et al., 1998). Although PDGF has been shown to
promote angiogenesis, its primary role in vascular development is the recruitment of pericytes
and stabilization of neo-vascular sprouts (Risau et al., 1992). A large number of SH2 domain-
containing proteins can be recruited to activated PDGFRa/|3, including the p85 subunit of PI3K,
the Src family kinases, the GTPase-activating protein for Ras, as well as adaptor proteins Grb2,
She, Crk, and Nek (Heldin et al., 1999). Nek and p85 have been shown to compete for pY751 on
PDGFR, and a single Y751F point mutation was sufficient to prevent PDGF-mediated
phosphorylation of Nek (Nishimura et al., 1993). Nek recruited to activated PDGFRs can then
initiate signaling to the actin cytoskeleton through activation of Pak and Pix signaling. Mice
deficient in endothelial PDGF-(3 lacked the ability to recruit PDGFR-positive pericyte progenitor
cells, resulting in capillary micro-aneurysms and embryonic death in late gestation (Lindahl et
al., 1997).
Eph/Ephrin
With 13 known members, Eph is the largest sub-family of RTKs in the human genome, and serve several biological roles including axon guidance, tissue border formation, and cardiovascular development (Kullander and Klein, 2002). Upon binding to its cognate ligand,
Ephrin, the family of Eph receptors is unique in conferring 'bi-directional' signaling mechanisms between interconnecting cells. Activation of Eph receptors induces autophosphorylation of cytoplasmic tyrosine residues that subsequently stimulate downstream signaling cascades
(forward signaling), while a similar mechanism stimulates signaling cascades downstream of the membrane-bound Ephrin ligand on the neighboring cell (reverse signaling) (Davy and Soriano,
2005). This bi-directional signaling mechanism plays a critical role during cardiovascular
14 development as Ephrin-B2 and EphB4 seem to mediate communication between the arterial and
venous endothelium, respectively (Adams, 2003). In general, both forward signaling through the
Eph receptor and reverse signaling through the Ephrin ligand regulate cellular motility through
control of the actin cytoskeleton, in conjunction with integrins. In vitro sprouting assays indicate
the Ephrin-B2/EphB4 interaction can promote angiogenesis, which may participate in the
formation of capillary beds at the artery/vein interface (Wilkinson, 2001). In response to
interaction with the EphB2 receptor, Ephrin-B binds the adaptor protein Grb4 (Nck2) and induces focal adhesion disassembly downstream of FAK, Cbl, Abl, and Pakl (Cowan and
Henkemeyer, 2001). More recently, Nckl has been shown to strongly associate with activated
EphA3 on pY602 and this interaction regulates cell migration (Hu et al., 2009). EphA3 knockout mice have severe cardiac defects in the development of the atrial septa and atrioventricular cushions leading to death of approximately 75% of mutant mice at P0 (Stephen et al., 2007).
EphB2 knockout mice revealed defects in vasculogenesis of both arteries and veins in capillary networks of the head, yolk sac, and neural tube, and are embryonic lethal (Wang et al., 1998).
Integrin
Integrins are a family of a/|3 heterodimer transmembrane adhesion receptors expressed on the surface of endothelial cells that bind ECM proteins through focal adhesions. There are 16 a and 8 (3 subunits currently known that can combine to form at least 22 different receptors, each with distinct and often overlapping specificity for ECM proteins, including fibronectin, laminins, collagens, and vitronectins (Eliceiri, 2001). Upon binding to an extracellular ligand, FAK is recruited and autophosphorylated at Tyr397, which creates docking sites for SH2 domain- containing proteins, including Src-family kinases Src and Fyn, and adaptor proteins Nek, Grb2 and She (Schlaepfer et al., 1997; Wary et al., 1996). These recruited proteins then stimulate
15 transphosphorylation of focal adhesion components, which induces the clustering of integrins on the cell periphery and the propagation of signaling downstream to actin-organizing proteins vinculin, paxillin, and talin (Burridge and Fath, 1989). Although integrin signaling has been intimately associated with control of the cell cycle through the c-Jun NH2-terminal kinase (JNK) and MAPK cascades, its role in cell adhesion and migration has been linked to actin cytoskeleton signaling through Rho-family GTPases, Rho and Rac (Keely et al., 1997). Mice lacking integrin ct5|3i expression die early in embryonic development from mesodermal and vascular defects (Goh et al., 1997). Furthermore, endothelial FAK-knockout mice also die early in embryonic development from vascular defects characterized by hemorrhaging and lack of sprouting angiogenesis (Braren et al., 2006). Consistent with this finding, endothelial cells isolated from
FAK-null embryos exhibited an altered actin cytoskeleton, aberrant lamellipodia extensions, and no polarized cell movement, indicating a critical role for FAK and integrin-linked focal adhesion signaling in endothelial cell migration during embryogenesis (Braren et al., 2006).
Taken altogether, the diverse set of endothelial cell RTKs including VEGFR, Tie,
PDGFR, Eph, and the Integrin family of receptors, regulate cardiovascular development by transmitting incoming chemical signals at the cell surface into a number of cellular processes that include endothelial cell proliferation, survival and migration. Of particular importance to the development of the early cardiovascular system is the migration of endothelial cells and their precursors, and this complex process integrates several distinct intracellular signaling pathways that collectively regulate actin cytoskeleton dynamics to induce cellular behavior. The family of
Nek adaptor proteins is central to several of these pathways downstream of the above-mentioned endothelial cell receptors as it signals primarily to the actin cytoskeleton to regulate cellular migration.
16 THE NCK FAMILY OF ADAPTOR PROTEINS
Introduction to Nek
Nek is a family of widely expressed SH domain-containing adaptor proteins that link activated RTKs to downstream effector proteins that control the actin cy to skeleton. It was first characterized in a genetic study of Drosophila showing that Nck/Dock links growth cone receptors to the actin cytoskeleton during photoreceptor axon guidance and targeting (Garrity et al., 1996). Since then, studies in both mammals and invertebrates have shown the major cellular role of Nek is to link cell surface receptors to the actin cytoskeleton, which is required for various biological functions, such as axon pathfinding, endocytosis, chemotaxis, and cellular migration. However, the Nek gene was initially isolated from a human melanoma cDNA library, and overexpression of Nek in mammalian cultures induced cell transformation and tumor growth, thus the Nek protein is known as an oncogene (Buday, 1999); (Li et al., 1992). There are two known members of the Nek family in mice (mNckl and mNck2/Grb4) that share 68% amino acid sequence homology and appear functionally redundant (Li et al., 2001). Mice deficient for either Nckl or Nck2 are viable; however, inactivation of both Nek 1 and Nck2 results in embryonic lethality at E9.5 with defects to the mesoderm-derived notochord, lack of chorioallantoic fusion, deficient axial rotation, and impaired closure of the cephalic neural folds, suggesting that Nek proteins play a critical role during mammalian embryogenesis in the proper development of mesoderm-derived structures dependent on cell migration (Bladt et al., 2003).
Fibroblast cell lines derived from Nck-null embryos showed defects in cell motility and organization of lamellipodial actin networks. Although the compensatory phenotype in single knockout mice suggests redundant physiological functions between Nckl and Nck2 genes, Nckl was found to be expressed universally in the adult mouse while Nck2 was expressed at higher
17 levels in the thymus, spleen, and lungs, with lower levels in the heart, kidney and brain, and was
not detectable in the liver and skeletal muscles (Bladt et al., 2003). In addition, distinct binding
partners for Nckl and Nck2 are continuing to emerge in recent findings and may suggest unique
cellular functions (Buday et al., 2002). Nckl and Nck2 have one C-terminal SH2 domain that
binds phosphorylated tyrosine residues of consensus sequence pYDEP/D/V and three N-terminal
SH3 domains that bind proline-rich motifs in the consensus PXXP, where X is any amino acid
(refer to Figure 4) (Lehmann et al., 1990). The SH2 domain of Nckl/2 has been shown to
preferentially bind a number of different endothelial cell receptors including Eph/Ephrins,
PDGFR and VEGFR, as well as FAK, the rasGAP-associated phosphotyrosine protein Dok (1/2)
and the kidney slit diaphragm protein nephrin (Buday et al., 2002; Goicoechea et al., 2002;
Patrakka and Tryggvason, 2007). Nckl and Nck2 have mostly overlapping but some distinct
specificity for SH2 and SH3 binding partners. For example, Nck2 binds EphrinBl/2 exclusively, and in the case of PDGFRp, Nckl binds pY751, while Nck2 binds pY1009 (Cowan et al., 2001;
Su et al., 2004; Nishimura et al., 1993; Chen et al., 2000). Furthermore, Nck2 alone is responsible for signaling to paxillin and adhesion assembly during nerve growth factor-induced neurite outgrowth in cultured PC 12 cells (Guan et al., 2007). More recently, it has been shown that Nckl and Nck2 activate separate pathways downstream of activated PDGFR|3 involving cell division control protein 42 (Cdc42) and the Ras homolog-A (RhoA) respectively, yet both are required for cell motility (Guan et al., 2009). Once recruited to activated receptors, Nek undergoes intensive phosphorylation on tyrosine, threonine, and serine residues, which may serve as binding sites for additional downstream effector molecules (Li et al., 1992;
Meisenhelder and Hunter, 1992; Park and Rhee, 1992).
18 C' VEGFR-2 Nckl/2 PDGFRP SH2 Eph/Ephrin FAK Dok(l/2) N' SH3 SH3 SH3 Nephrin (pYDEP/D/V)
I I \ FAK Pakl PINCH (Nck2) Cbl Ras WASP
(Proline-rich regions)
L J If Actin Cytoskeleton (58%) Gene Expression (16%) DNA synthesis (10%) Protein Degradation (5%)
Figure 4. Binding partners for Nckl/2 adaptor proteins. Nckl/2 is comprised of one C-terminal Src Homology-2
(SH2) domain, which binds phosphorylated tyrosine residues of consensus sequence pYDEP/D/V on activated receptor tyrosine kinases VEGFR-2, and PDGFRP, Eph/Ephrin, as well as FAK, Dok (1/2) and Nephrin. Its three N- terminal SH3 domains bind proline-rich regions of downstream effector proteins that control the actin cytoskeleton, gene expression, DNA synthesis, and protein degradation pathways. In brackets are percentages of the functions of all known Nek binding partners (Li et al., 2001).
19 Nek SH3 domains interact with actin-organizing effector molecules
The mechanism by which endothelial cells migrate, or 'crawl', is a complex process of
intracellular signaling to the actin cytoskeleton downstream of activated receptors. In endothelial
cells, Nckl/2 is recruited to activated cell-surface receptors via its SH2 domain which allows
membrane localization of SH3 domain-associated regulators of the actin cytoskeleton, including
the Pak family of serine/threonine kinases, the WASP family proteins, and the LIM-only protein
PINCH (particularly interesting new Cys-His protein) (Rivero-Lezcano et al., 1995; Bagrodia et
al., 1995; Tu et al., 1998; Lamalice et al., 2004). Pak, WASP, and PINCH directly regulate
cellular actin dynamics and aid in the formation of cell migratory structures including filopodia, lamellipodia, and focal adhesions, during endothelial cell migration.
In the first stage of endothelial cell migration, a chemical gradient is sensed by the cell through the projection of'finger-like' membrane extensions, called filopodia, that are believed to mediate guidance cues of the cell toward the source of the signal (Mattila and Lappalainen,
2008). The Pak family proteins play an important role in the formation of filopodia during cell migration and stress response (Bagrodia and Cerione, 1999). Pakl is recruited to activated cell surface receptors, via the interaction between the second SH3 domain of Nek and the first proline-rich region at the N-terminus of Pakl (Bokoch et al., 1996). In conjunction with Pak interacting exchange factors (aPix and (3Pix), that bind to Pak on unique sites via an N-terminal
SH3 domain, Pak/PIX/Nck complexes associate with Rho family GTPases, Rac and Cdc42
(Yoshii et al., 1999). While Rac can stimulate small focal adhesions in lamellipodia, Cdc42 regulates the initiation and regulation of actin assembly cycles in formation of filopodia by binding the mammalian Diaphanous-related formin 2 (mDia2) to stimulate actin nucleation
(Machesky and Hall, 1997; Ladwein and Rottner, 2008). This formin specifically accumulates in
20 filopodia of growth cones, where it produces linear actin filaments (Mallavarapu and Mitchison,
1999).
In the second stage of endothelial cell migration, the leading edge of the cell is then
extended through the formation of lamellipodia toward the source of the chemical gradient. They
are comprised of a branched actin cytoskeleton network, typically oriented at 70° angles between
filaments, via incorporation of the Arp2/3 complex (Small et al., 2002). The WASP, N-WASP
and WASP-family verprolin-homologous (WAVE) proteins bind G-actin monomers, leading to
actin nucleation through activation of the Arp2/3 complex downstream of Cdc42 and Racl
(Takenawa and Suetsugu, 2007; Theriot and Mitchison, 1991). Phosphorylation and protein-
protein interactions are also important for activation of WASP-family proteins, as their proline-
rich regions can bind SH3 domains of adaptor proteins, such as Nek and Grb2, that mediate their
recruitment to signaling complexes at activated cell-surface receptors (Stradal and Scita, 2006).
Stimulation of VEGFR-2 results in the rapid accumulation of N-WASP to the cell surface by
binding to Nek via the third SH3 domain (Gong et al., 2004; Rivero-Lezcano et al., 1995).
Furthermore, Nek SH3 domains have been shown to dramatically stimulate the rate of actin
nucleation by N-WASP in the presence of Arp2/3 (Rohatgi et al., 1999). The importance of
WASP proteins in endothelial cells was demonstrated in mouse embryos lacking WAVE2, which
showed defects in branching of endothelial cells during angiogenesis resulting in severe hemorrhaging and lethality at E10 (Yamazaki et al., 2003).
Once the cell has advanced in position through formation of lamellipodia, it then anchors to the substratum through the formation of focal adhesions at the cell surface. Integrin-linked signaling plays a key role in focal adhesion assembly through the activation of FAKs and their recruitment of actin-associated cell machinery (Otey et al., 1990). Upon binding to an
21 extracellular ligand, FAK is recruited and autophosphorylated at Tyr397, which creates docking
sites for SH2 domain-containing proteins Src and Fyn, and adaptor proteins Nek, Grb2 and She
(Schlaepfer et al., 1997; Wary et al, 1996). Nck2 can also bind the fourth LIM domain of
PINCH via its third SH3 domain independent of the PxxP consensus motif (Tu et al., 1998).
PINCH is a widely expressed and evolutionary conserved focal adhesion protein comprised
solely of LIM protein-binding domains that can be recruited to activated (3-integrins in association with integrin-linked kinase (ILK) (Rearden, 1994). Recruitment of Nck2 to focal adhesions via PINCH or FAK can also mediate recruitment of downstream signaling molecules including Pak, which in turn allows binding of Cdc42 and Rac, stimulation of actin-associating molecules vinculin, paxillin, and talin, and contribution to the formation of focal adhesions at the cell periphery (Li et al., 2001).
Taken altogether, Nek proteins play a critical role in transmitting extracellular chemical stimuli into intracellular signaling responses in order to elicit changes in cellular migration. They are able to bind activated endothelial cell RTKs, including VEGFR, Tie/Tek, PDGFR,
Eph/Ephrin, and Integrins, and respond by recruiting downstream signaling proteins, including
Pak, WASP, and PINCH. These effector molecules transduce the signal to actin organizing molecules, including mDia2 and the Arp2/3 complex, downstream of Rho GTPases Rac and
Cdc42. Propagation of these signaling pathways leads to the formation of actin-associated cellular structures, including filopodia, lamellipodia, and focal adhesions, which facilitate endothelial cell migration during embryogenesis and contribute to the development of the cardiovascular system.
22 RATIONALE AND HYPOTHESIS
Development of the cardiovascular system is a complex process of cellular patterning and
is regulated by several RTKs that signal to endothelial cells. Nek is a cytosolic adaptor protein
that is recruited to several such endothelial cell receptors that regulate cellular behavior during
critical stages of vessel and heart development. Nek has also been implicated as a key regulator
of the actin cytoskeleton in vivo, which is primarily responsible for cellular structure, motility,
and chemotaxis. Deletion of both Nckl and Nck2 in mice revealed profound defects in
development of mesoderm-derived structures dependent on cell movement, resulting in impaired
gastrulation and embryonic lethality by E9.5 (Bladt et al., 2003). Moreover, mice lacking Nckl/2
expression specifically in kidney podocytes develop renal disease by effacement of foot
processes, which is a consequence of perturbations in the actin cytoskeleton (Jones et al., 2006).
These studies suggest Nek signaling to the actin cytoskeleton is critical to embryonic
development and kidney function; however, the direct role of Nek in coordinating endothelial
cell motility during cardiovascular development has yet to be investigated in vivo.
Given that the actin cytoskeleton is essential for endothelial cell migration during
embryonic cardiovascular development, we hypothesize that Nek signaling in endothelial cells
is required for proper embryonic cardiovascular development. Consequently, the conditional deletion of Nckl/2 in embryonic endothelial cells of mice may arrest signaling to the actin cytoskeleton and subsequently prevent endothelial cell migration, leading to defects in cardiovascular development and resulting in an embryonic lethal phenotype.
23 Objective 1: Develop a mouse breeding line to conditionally ablate Nck2 expression in embryonic endothelial cells of Nckl-null mice and characterize its effect. By observing the physiology of various vascular networks of endothelial cell specific Nck-null mice, we will establish the in vivo role of Nek in endothelial cell behavior during cardiovascular development.
Objective 2: Evaluate the effect of deleting Nek expression in vitro on cellular migration and chemotaxis in primary cultured endothelial cells. This analysis will allow us to support the in vivo observations by examining the cellular physiology of Nck-null endothelial cells and monitoring actin cytoskeleton organization and dynamics.
24 MATERIALS AND METHODS
Objective 1: In vivo characterization of Nek in endothelial cells during development
Animal care policy
All work with transgenic laboratory mice was pre-defined under Animal Utilization
Protocol #07R009, which has been reviewed and sanctioned by the Animal Care Committee of
the Senate Research Board, at the University of Guelph.
Transgenic mice housing and care
Transgenic mice were housed in the Central Animal Facility at the University of Guelph,
under supervision of registered laboratory animal technician, Martha Manning. At all times, only
pre-approved and trained individuals were given access to the facility and allowed to work with
the mice. Appropriate procedures were maintained to keep a minimum standard of sanitation for
the colony including: the use of sterile, protective clothing when working with mice, disinfection
of outside footwear upon entering and exiting the facility, and the control of airflow inside the facility and animal rooms. Mice were fed a Harlan Teklad 2014 Global 14% protein rodent diet at all times except females before and during pregnancy, which were fed a Harlan Teklad 2018
Global 18% protein diet. The photoperiod was regulated at 12 hours of light from 7am to 7pm, and 12 hours of dark from 7pm to 7am. The cages were changed once a week with fresh bedding and environmental enrichment (nestlets, paper towels, mouse houses, egg cartons, and popsicle sticks). For setting up timed matings, one male mouse was set up with two female mice in the afternoon, and left to mate overnight. The morning of day 0 is considered embryonic day 0.5.
Females were checked for vaginal plugs, then weighed using a scale, and separated to a new cage if evidence of sexual activity was observed. The occurrence of pregnancy was determined by weight gain of over 2 grams after a period of 7 days.
25 Mouse genetics: Nckl''', Nckfx/flx, Tie2-Cre
The Tie2-Cre and Nckl"7', Nek2flx/flx founder lines were generously provided by Dr. Rong
Wang (University of California at San Francisco) and Dr. Tony Pawson (University of Toronto),
respectively. As previously reported in Bladt et al., 2003, the murine Nckl gene was inactivated
by inserting an IRES-|3-galactosidase cassette into the first coding exon, 29 nucleotides
downstream of the start codon. An embryonic stem cell line that had undergone homologous
recombination was used to generate chimeric mice (129/Sv background), which were then
crossed with ICR mice to obtain Nckl"7" homozygous mice. To generate Nck2flx/flx mice, the first
coding exon of Nck2 was flanked by LoxP sites to allow recombination by cyclization recombination (Cre) (see below), and founder mice were established as described above. The Cre recombinase is a Type 1 Topoisomerase isolated from Bacteriophage PI that mediates the recombination of a DNA sequence flanked by two LoxP sites (for locus of X-over PI), which are homologous 34bp sites on the Bacteriophage PI, specifically recognized by Cre (Kos, 2004).
Depending on the orientation of the two LoxP sites, Cre recombination results in either the deletion of the intervening sequence and one LoxP site, or its inversion between the two LoxP sites, for a parallel and an anti-parallel orientation, respectively (Kos, 2004). When coupled to a tissue-specific promoter, Cre expression results in recombination of the LoxP-flanked, or
"floxed" (fix) gene, in the specific set of cells dictated by the promoter sequence. The Tie2 promoter coupled with the essential enhancer element from intron 1 was first used by Schlaeger et al., 1997, to drive the expression of the (3-galactosidase gene in vascular endothelial cells of transgenic mice beginning at E7.5. Since then, it has been linked with the gene encoding Cre recombinase to drive Cre expression in the embryonic endothelial cells of FAKflx/flx mice (Wang et al., 2001; Braren et al., 2006). In an independent study, Tie2-Cre mice were bred with CAG-
26 CAT-Z mice to produce a double-transgenic line in which LacZ is expressed solely after Cre- mediated excision of the floxed choline acetyltransferase (CAT) cassette. These mice displayed specific expression of LacZ in the endocardium and endothelium, as well as the mesenchymal cells in the atrioventricular canal of the primitive heart and a small number of circulating endothelial cells, although no expression of LacZ was seen in hematopoietic cells in the blood islands of the yolk sac or in the vitelline artery from E8.5-E11.5 (Kisanuki et al., 2001).
Interestingly, a research group recently found Tie2-independent Cre-mediated gene deletion of a floxed allele when Tie2-Cre was passed though the female germline (de Lange et al., 2008). For this reason, our Tie2-Cre transgene was always passed through male mice during breeding. This strain was re-derived at the Toronto Centre for Phenogenomics onto an ICR background.
Mouse ear-notch tissue sample preparation for PCR-based genotyping
Mouse ear-notching was performed at 3 weeks of age, during weaning. Ear tissue was placed in sterile Eppendorf tubes and brought back to the laboratory for DNA preparation. The tissue was digested in 50[iL of Proteinase K solution (200nm NaCl, lOOmM Tris (pH8.5), 5mM
EDTA, 0.2% SDS, and 200ug/mL Proteinase K (Sigma-Aldrich)) overnight at 55°C. The solution was then vortexed and spun in a 5415C centrifuge (Eppendorf) at 16,000 x g for 10 minutes at room temperature. lOuL of supernatant was removed and diluted in a fresh Eppendorf tube containing 90jiL of sterile, Millipore water. The diluted solution was boiled for 10 minutes, then spun down briefly and used as the template DNA solution in subsequent PCR reactions.
Prepared DNA samples and digested tissue solutions were stored at -20°C.
DreamTaq PCR mixture and Thermocycler Conditions
For a total volume of 25|uL per sample reaction using the DreamTaq Green DNA polymerase (Fermentas), the following components were added: 17|xL of sterile, Millipore water,
27 2.5jxL of 10X DreamTaq Reaction Buffer (Fermentas), lfxL of 10uM dNTP mixture
(Fermentas), lptL of lOmM forward primer solution, l^L of lOmM reverse primer solution,
0.5[xL of DreamTaq DNA polymerase enzyme, and 2jxL of prepared DNA sample. Tubes were
placed in a MyCycler™ Thermocycler (BioRad) with the following conditions: 1 cycle of 94°C
for 5 minutes for initial denaturation, 35 cycles of 94°C for 30 seconds for denaturation, then
55 C for 30 seconds for primer annealing, and 72°C for 45 seconds for elongation, followed by 1
cycle of 72 C for 5 minutes for final elongation, and a hold at IO C.
Genotype Primers
All primers used were ordered from Sigma-Aldrich Genosys. The primer powder was
dissolved in lmL of sterile Millipore water, then diluted to lOmM in sterile Eppendorf tubes and
stored at -20°C until needed.
Table 1. Primer sequences used for PCR-based genotyping of Cre, Nckl and Nck2 genes
Gene Forward Sequence Reverse Sequence Product Size (bp)
Tie2-Cre gttataagcaatccccagaaatg ggcagtaaaaactatccagcaa 200 Nckl -wt gcatgtagacaattacacttcagcacc attcatggaatttacacttcagcacc 210 Nckl-LacZ ctgattgaagcagaagcctgcgatg tattggcttcatccaccacatacagg 280 Nck2-wt gaggaatgctgccaacaggacagg cacatacagatacacacacgctgaag 170 Nck2-flx ggataccacattggcattagtag gtgctcatttgacaagtgacac 510
Pregnant mouse euthanasia and embryo collection
Pregnant mice were kept in home cages and transported to the laboratory under a cage cover. Euthanasia was performed via cervical dislocation in a darkened room on a clean lab
28 bench. The mouse was then transferred to a Leica MZ12 dissection scope, where it was sprayed
with 70% ethanol. Using a pair of fine forceps and scissors, an anterior to posterior incision was
made down the midline of the mouse and the skin was peeled back to expose the abdominal
viscera. The cavity was then sprayed with 70% ethanol. Using a fresh pair of forceps and
scissors, the parietal peritoneum was cut to expose the uterus, which was removed by cutting at
the ovaries and the vagina. The uterus was placed in a 10cm dish with 1 OmL of cold phosphate- buffered saline (PBS) under the dissection scope. Beginning on the end and working toward the middle, embryos were sequentially removed from the uterus, using fine forceps, by tearing away the uterine muscle to reveal the placenta and visceral yolk sac. During dissection, notes were taken on the presence of a heartbeat, and the level of vasculature for yolk sac and embryo proper.
Pictures were taken, using a Q-imaging camera, of the yolk sac and embryo on its dorsal and ventral side. The yolk sac was removed and used for PCR-based genotyping, according to the same protocol used for adult ear-notch tissues. Individual embryos and corresponding placentas and/or yolk sacs were placed in a labeled 24-well dish and fixed in 4% paraformaldehyde in PBS overnight at 4°C on a Nutator. They were then washed three times for 5 minutes in lmL of PBT
(PBS + 0.1% Tween-20) and dehydrated in washes of 25%, 50%, and 75% methanol in PBT at 5 minutes each at room temperature, followed by two washes of 100% methanol for 5 minutes.
Embryos and yolk sacs were then stored at 4°C in a cold room.
Whole-mount immunofluorescence for yolk sac
In a 6-well dish, yolk sacs were bleached in 2mL of bleaching solution (methanol, dimethyl sulfoxide (Sigma-Aldrich), and 30% hydrogen peroxide (Sigma-Aldrich) at 4:1:1, respectively) for 90 minutes at room temperature with rocking. Yolk sacs were then re-hydrated with washes of 75%, 50%, and 25% methanol in PBT at 5 minutes each at room temperature,
29 followed by two washes of PBT for 30 minutes. Yolk sacs were blocked in 2mL of blocking
solution (2% skim milk in PBS, 2% Triton-XlOO (Sigma-Aldrich), 0.2% Bovine-Serum Albumin
(Sigma-Aldrich), and 1% heat-inactivated Goat Serum (Fisher)) for 60 minutes at room
temperature, then placed in the primary antibody solution (1:200 Rat anti-Mouse PEC AM (BD
Pharmingen), or 1:200 Mouse anti-Mouse Smooth Muscle Actin (Sigma)), in blocking solution
and incubated overnight at 4 C on a nutator. The next day, yolk sacs were washed twice in
PBSMT (2% skim milk and 2% Triton-XlOO in PBS) for 15 minutes at 4°C and three times in
PBSMT for 20 minutes at room temperature. Yolk sacs were then placed in secondary antibody
solution (1:400 Goat anti-Rat AlexaFluor 488 (Invitrogen) in PBSMT) for 2 hours at room
temperature on a nutator, followed by three washes of PBT for 10 minutes at room temperature.
Immunofluorescent images were taken using an upright Leica DM 6000B microscope connected
to a Leica TCS SP5 system and Leica LAS AF imaging software, as well as allied software
provided by Becker and Hickl, according to manufacturers protocol.
Histological sectioning and Hematoxylin and Eosin staining
Histological sectioning and staining was graciously performed by the Advanced
Bioimaging Centre at Mount Sinai Hospital, Toronto. Images were taken using a Leica DM LB2
Microscope and Leica Application Suite Software following histological preparation.
Objective 2: In vitro characterization of Nek in cultured endothelial cells
Preparation of fibronectin/gelatin-coated dishes
Dish-coating media was prepared fresh by combining 0.1 mg of fibronectin from bovine plasma (Sigma-Aldrich) and lOmL of 0.1% gelatin (Sigma-Aldrich) (400mg in 400mL of milipore water and heat-inactivated by autoclaving at 65 C for 30 minutes) in a lOmL falcon
30 tube. The solution was aliquoted to a clean 10cm dish (Corning) in a Microzone Bio-Safety
Cabinet and incubated for 2 hours at 37°C and 5% atmospheric CO2 in an incubator (Thermo-
Fisher).
Collagenase treatment of dissected lung tissue
Transgenic mice with genotype Cre", Nckl"7", Nck2flx/flx were transferred to the laboratory
from the Central Animal Facility, under cage cover, and killed by cervical dislocation. The body
was sprayed with 70% ethanol and transferred to a sterile Biological Safety Cabinet (BSC).
Dissection was performed on a sterile, wax dissecting block and all instruments were cleaned
using 70%> ethanol before use. Using a pair of forceps and scissors, an incision was made anterior
to posterior down the midline of the mouse and the skin was peeled back to reveal the abdominal
viscera. Using a pair of fresh forceps and surgical scissors, the chest cavity was cut open and the
rib cage pinned down using dissection pins. The thoracic cavity was exposed by cutting the
diaphragm to reveal the heart and lungs. The lungs were removed and placed in a sterile 50mL
tube containing fresh HyClone®, Ham's F-12 media (Thermo-Fisher), supplemented with 0.1%
penicillin and streptomycin, and put on ice until all tissues were removed from each mouse used.
The lungs were cleaned by preparing three 10cm dishes containing Hams F-12 media, lOmL of
70% ethanol, and lOmL of mouse lung endothelial cell (MLEC) media, respectively.
MLEC media was prepared by mixing 250mL of HyClone®, high-glucose Dulbecco's
Modified Eagle's Medium (DMEM) (Thermo-Fisher) and 250mL of Ham's F-12 in a single
500mL Pyrex® bottle. 50mg of heparin (Sigma-Aldrich) was dissolved in 5mL of Ham's F-12
immediately before adding to the DMEM/Hams F-12 mixture. 5mL of 100X penicillin and
streptomycin (Fisher) and lOmL of 200mM glutamine (Sigma-Aldrich) was added and the mixture was filtered using a 0.2jxm disposable filter (Sarstedt). 25mg of endothelial growth
31 supplement (Sigma-Aldrich) and lOOmL of heat-inactivated fetal calf serum (Fisher) were added
after filtering and the media was stored at 4°C.
The lungs were transferred to the 10cm dish containing Hams F-12 and stripped of any
fat, blood clots, or connective tissue using a pair of sterile forceps. The lungs were then washed
briefly in 70% ethanol and transferred to MLEC media for a longer wash. The lungs were placed
on an inverted lid of a sterile 10cm dish and minced into a pate-like consistency using sterile,
sharp scissors. Using a sterile metal spatula, the minced lungs were transferred to a sterile 50mL
tube containing lOmL of filter-sterilized, 0.1% Type 1 collagenase solution (Invitrogen) and
incubated at 37 C in a water bath for 60 minutes with occasional swirling. The solution was then
passed through a 70^im cell strainer (Fisher) into a 50mL tube containing 20mL of MLEC media
and centrifuged for 5 minutes at 3000 x g in a 5415C centrifuge (Eppendorf). The supernatant
was then removed, leaving approximately 5mL of liquid and resuspended by gentle pipetting,
and plated onto a gelatin/fibronectin coated 75cm2 plate containing 1 OmL of MLEC media. Cells
were incubated at 37°C in 5% CO2 for 48 hours.
Positive sort for endothelial cells
Once cells had reached confluency, endothelial cells were sorted using mouse PECAM-
conjugated magnetic Dynalbeads. For each confluent dish, 50[iL of Sheep anti-Rat Dynalbeads
(Invitrogen) were diluted in 200jiL of PBS, with 2\ig of Rat anti-mouse PECAM antibody (BD
Pharmingen) in a sterile Eppendorf tube and incubated at 4°C for 30 minutes on a nutator. The
tube was placed on a DynaMag™-2 magnet (Invitrogen) for 5 minutes to wash the beads with
2mL of MLEC media. The PECAM/Dynalbead solution was resuspended in 3mL of MLEC media and stored at 4 C until needed. The media of the 10cm dish was replaced with the
PECAM/Dynalbead solution and incubated for 60 minutes at 4 C, on a nutator. The solution was
32 then removed and adhered cells were washed gently three times with PBS. Cells were
trypsinized with ImL of 0.25% trypsin (Sigma-Aldrich) for 2 minutes at 37°C in 5% C02 in an
incubator. Cells were resuspended in 9.5mL of MLEC and mixed by pipetting gently, then
aliquoted to a sterile 15mL falcon tube. The tube was placed into a DynaMag™-15 magnet
(Invitrogen) and beads were allowed to attach for 5 minutes. The media was pipetted off and
discarded, then cells resuspended in lOmL of MLEC media and placed back into a 15mL magnetic holder to attach for another 5 minutes. The media was pipetted off and discarded, then the cells were resuspended in 5mL of MLEC media and transferred to a single well of a pre- coated 6-well dish (Falcon) with coverslips. The dish was placed back in incubator and cells were allowed to grow at 37°C in 5% C02.
Cell immunofluorescence staining
In a 6-well dish where cells were seeded on coverslips, the media was aspirated and the cells washed twice with ImL of PBS. The cells were fixed in ImL of 4% paraformaldehyde
(Sigma-Aldrich), pH7.0, for 10 minutes at room temperature. The cells were washed three times with ImL of PBS, then permeabilized with ImL of 0.2% Triton-XlOO (Sigma-Aldrich) in PBS for 5 minutes at room temperature. After permeabilization, the cells were washed again in ImL of PBS three times at room temperature, then blocked in 5% BSA, supplemented with 1% heat- inactivated Goat serum (Fisher), for 1 hour at room temperature with rocking. After washing again with ImL of PBS three times, the coverslips were removed and transferred to a foil- covered staining box, lined with Parafilm, with wet paper towel on the bottom. The coverslips were incubated in lOOuL of primary antibody solution (1:100 Rat anti-Mouse PECAM (BD
Pharmingen), or 1:100 Rat anti-Mouse I-CAM2 (BD Pharmingen), in blocking solution) for 1 hour at room temperature. The coverslips were then returned to the 6-well dish and washed again
33 in lmL of PBS three times. The cells were then incubated in the secondary antibody solution
(1:200 Goat anti-Rat AlexaFluor 488 (Invitrogen)) in the foil-covered staining box for 1 hour at
room temperature. The coverslips were again returned to the 6-well dish and washed three times with lmL of PBS, then stained with Texas-Red Phalloidin (Invitrogen) (3|iL in 150mL of PBS) for 30 minutes at room temperature. After washing three times with lmL of PBS, the cells were stained with 1:2000 Hoechst in PBS for 1 minute, then washed again with lmL of PBS three times. Then, one at a time, each coverslip was dipped in a beaker of water to rinse and laid face- down on a glass slide containing GelTol mounting medium (Thermo-Fisher). Slides were allowed to harden overnight and stored at 4°C. Images were taken using a Leica DM IRE2
Epifluorescence microscope connected to a Leica CTR MIC system and OpenLab™ software.
34 RESULTS
Breeding strategy for generation of endothelial cell-specific Nck-null mouse model
In order to generate mice lacking expression of Nek in embryonic endothelial cells, mice
expressing Cre recombinase under the control of the endothelial cell-specific Tie2 promoter
(Braren et al., 2006) were crossed to Nckl"'", Nck2flx/flx mice which are doubly homozygous for
the Nckl null allele and a ZoxP-flanked Nck2 allele (Jones et al., 2006). By breeding the Nckl"'",
Nck2flx/flx and Tie2-Cre founder lines together, we generated F1 mice either positive or negative
for the Tie2-Cre transgene and heterozygous for both Nckl"/wt and Nck2flx/wt alleles. Following
PCR genotyping of F1 pups, Tie2-Cre positive male pups were then back-crossed to Nckl"7",
Nck2flx/flx female mice to generate F2 pups with 8 different genotypes. Pups were either Tie2-Cre
positive or negative, Nckl"/wt or Nckl"7', and either Nck2flx/wt or Nck2flx/flx in a 1/8 frequency.
From 3 different matings and the production of 31 pups at F2, we did not observe a single viable
pup with the mutant genotype of Cre+, Nckl"7", Nck2flx/flx. In order to increase the frequency of the mutant genotype in mice, we backcrossed Cre+, Nckl"/+, Nck2flx/flx male mice to Cre", Nckl"7",
Nck2fIx/flx female mice to generate F3 pups with 4 different genotypes, including the mutant genotype (Refer to Figure 5).
35 Cre*, Nckl*'*, Cre, Nckl-*, Nck2'MI><
FO X 1
Cre , Nckl**, Nck2™"lj< Cre*, Nckl**, Nck2™"«x Cre-, Nckl-*, Nck2«*""<
F1 X i
Cre, Nckl**, NckZ""1- Cre, Nckl-*, Nck2««i>' Cre, Nckl*', Nck2,'xfflx Cre, Nckl-*, Nck2"^
P2 Cre+, Nck1« , Nck2«»m* Cre*, Nckl*, Nck2™«l*
Cre , Nckl-*, Nck2"x*x
i
Cre, Nckl**, Nck2""«x Cre , Nckl-*, Nck2"x«ix Cre*, Nckl*', Nck2«x«* Cre*, Nckl*, Nck2"x**
F3
Figure 5: Breeding strategy for production of endothelial-Nck null mice from Tie2-Cre and Nckl "7", Nck2fI*/fl* founder lines. Shown in green box are male breeding mice with Cre+, Nckl+/", Nck2nx/flx genotype used for F3 generation. Shown in white are Nck-null mutant mice observed in a 1/8 frequency at F2 and a 1/4 frequency at F3.
36 Table 2. Endothelial-Nck null pups succumb prenatally. The number of expected and observed mice within the F3
generation from Cre+, Nckl+/\ Nck2flx/flxand Cre", Nckl"'", Nck2Mx parents, following 9 litters born and genotyped
(assuming 10 pups per litter and the production of 90 offspring total).
Genotype Expected Pups Observed Pups Cre Nckl Nck2 Assuming 10 per litter
+ /- fix/fix 22/90(25%) 27/67(41%) -/- fix/fix 22/90(25%) 19/67(28%) + +/- fix/fix 22/90(25%) 21/67(31%) ~~+ fix/fix 22/90 (25%) 0/67 (0%)
* Shown in red are mutant genotype numbers.
Loss of endothelial-Nck results in embryonic lethality between E10 and Ell
From 9 matings and the production of 67 pups at F3, we found 27 viable pups with the
genotype Cre", Nckl+/", Nck2flx/flx, 19 viable pups with the genotype Cre", Nckl7", Nck2flx/flx, 21 viable pups with the genotype Cre+, Nckl+/", Nck2flx/flx, and no viable pups with the mutant
genotype (Refer to Table 2). Assuming the production of 10 pups per litter, we expected the production of approximately 22 mutant pups according to a 1/4 ratio, as predicted. The absence
of viable mutant mice suggested they were succumbing prenatally, during embryonic
development. As such, timed matings were established in order to determine the lethal time-point
of mutant embryos. Beginning at El 1.5 and working backwards to E9.5, embryos were dissected from pregnant female mice and examined for the presence of a heartbeat, which indicated viability at that time point in development.
37 Table 3. Loss of endothelial-Nck results in embryonic lethality between E10 and El 1. From E9.5 to El 1.5, the number of each genotype observed over the total number of embryos collected, with the number of viable mutant embryos over total number of embryos, and number of litters examined.
Genotype Embryonic Day (E)
Cre Nckl Nck2 9.5 10.5 11.5
+ /- fix/fix 10/37 (27%) 12/67 (18%) 10/39 (26%)
+ +/- fix/fix 10/37 (27%) 17/67 (25%) 9/39 (23%) fix/fix 5/37 (14%) 18/67 (27%) 8/39 (20%)
+ -/- fix/fix 12/37 (32%) 20/67 (30%) 12/39(31%)
Viable Mutant Embryos 11/12(92%) 13/20 (65%) 0/12 (0%) Number of Litters 3 6 4
* Shown in red are mutant genotype statistics.
38 From the dissection of 4 pregnant female mice at El 1.5, 12 embryos were found with the
mutant genotype from a total of 39 embryos (Refer to Table 3). Of those 12 mutant embryos,
none had a visible heartbeat. Mutant embryos were smaller than their littermates, and showed
significant necrosis and tissue deterioration throughout the body (Refer to Figure 6). In contrast,
the littermate embryos of all genotypes were well developed with a clearly defined vessel
network full of circulating blood, and are herein referred to as control embryos. At E10.5, 6
pregnant female mice were dissected to reveal 20 embryos with the mutant genotype from a total
of 67 embryos. Of those 20 mutant embryos, 13 showed a visible heartbeat. At this time point,
most mutant embryos were of smaller size compared to their control littermates, although
developmental defects were apparent in the yolk sac, head, heart, and spine regions. In contrast
to littermate embryos, the yolk sac vascular perfusion was reduced in all mutant embryos. Most
showed a reduction in head size and organization, suggestive of growth retardation in the
developing nervous system (Refer to Figure 7). Tissue damage and deterioration was evident in
common cranial structures, including the developing brain, eyes, and neural tube. In many
mutant embryos, the heart was enlarged and extended from the body with a slower, more
exaggerated heart beat. Blood was observed in major arteries and the beating heart, although
displaying a decreased perfusion from that of their control littermates. All mutant embryos
showed a reduction in spine curvature and in many cases resulted in complete inversion of the
spinal cord, similar to incomplete gastrulation. From the dissection of 3 pregnant female mice at
E9.5, 12 embryos were found with the mutant genotype from a total of 37 embryos. Of those 12 mutant embryos, 11 had visible heart beats. Mutant embryos were similar in size to their littermates, with no visible developmental abnormalities. Together these results suggest that loss of Nek expression in endothelial cells leads to embryonic lethality between ~E10 and El 1.0.
39 CTL MUT
E11.5
E10.5
E9.5
Figure 6. Determining the lethal time-point of mutant embryos. Control (CTL) and mutant (MUT) embryos dissected in PBS at embryonic day (E)l 1.5, E10.5, and E9.5 and photographed under the dissection scope using a imaging camera. Scale bar 0.5mm.
40 CTL MUT
1 mm
Figure 7. Enlarged view of embryonic day 10.5 embryos. Control (left) and mutant (right) embryos, dissected in
PBS and photographed under the dissection scope with reflected (top) and transmission (bottom) light using a Q- imaging camera. Arrow indicates heart. Scale bar 1mm.
41 Thinning of the yolk sac vitelline vessel
Readily apparent from freshly dissected embryos was the extent of vascular perfusion of
the yolk sac. At El0.5, the control yolk sac had a well-developed vascular tree with a thick
vitelline vessel (Refer to Figure 8). By contrast, the mutant yolk sac appeared to have less vessel perfusion with no clear vitelline vessel. To better visualize the yolk sac vasculature, we utilized
antibodies to PECAM to specifically label endothelial cells within the vessel networks.
Following anti-PECAM immunostaining coupled with AlexaFluor488 fluorescence detection, the major vitelline vessel of the mutant yolk sac appeared thinner in diameter, when compared to the vessel diameter of the control littermate (Refer to Figure 9). In areas of microvasculature networks, control yolk sac vessels appeared thick and highly branched. By contrast, the microvessels of the mutant yolk sac were thinner, although they appeared to have a similar level of vessel branching as the control yolk sac.
In order to further investigate the loss of structural integrity of the mutant yolk sac vitelline vessel, double-immunofluorescence staining with PECAM and Smooth Muscle Actin
(SMA) was performed. At El0.5, smooth muscle cells were apparent on the major vitelline vessel of both the control and mutant yolk sac, suggesting signaling mechanisms for smooth muscle cell recruitment were still functional for the mutant embryo (Refer to Figure 10).
However, when compared to the consistent patterning of smooth muscle cells in control littermates, a 'scattered' staining pattern was observed in the mutant yolk sac vitelline vessel.
These results suggest a disordered layering of smooth muscle cells on the vitelline vessel of the mutant yolk sac, and could be the result of defective signaling mechanisms between the endothelium and smooth muscle layer.
42 MUT
Figure 8. Loss of endothelial-Nck results in decreased vessel perfusion on yolk sac. Control (above) and mutant
(below) yolk sacs, still attached to placenta, dissected into fresh PBS and photographed under dissection scope.
Arrow indicates vitelline vessel of yolk sac. Scale bar: 1mm.
43 Figure 9. Loss of endothelial-Nck results in loss of structural integrity of major vitelline vessel of E10.5 yolk sac.
Control (A) and mutant (B) yolk sac vitelline vessels, and control (C) and mutant (D) yolk sac microvasculature stained with AlexaFluor488-PECAM and imaged using a Multi-photon confocal laser scanning microscope. Arrow indicates vitelline vessel. Scale bar: 100|i.m.
44 PECAM Smooth Muscle Actin Merge
Figure 10. Recruitment of smooth muscle cells to the yolk sac vitelline vessel. Control (CTL) and mutant (MUT)
El0.5 yolk sac vitelline vessels stained with AlexaFluor488-PECAM, AlexaFluor594-Smooth Muscle Actin (SMA), and merged planes, imaged using a Multi-photon confocal laser scanning microscope. Scale bar: 100|J.m.
45 Defects to the endocardial cushion, myocardial trabeculation and cardiac valves of the heart
Histological analysis was performed to examine the enlarged heart observed in El0.5
mutant embryos at dissection. Hematoxylin and Eosin stained sagittal sections were prepared for
El0.5 mutant and control embryos. Control heart sections revealed a continuous endocardial lining of both the ventricle and atrial chambers at the plane of both the future atrioventricular
(AV) and outflow tract (OT) valves (Refer to Figure 11). Consistent with a continuous endocardial lining, the control heart was observed to have well defined layers of myocardial trabeculation in the ventricle (V) chamber (marked with an arrow). The control heart sections also revealed a thick layer of cardiac jelly between the myocardium and endocardial lining, giving rise to well-defined endocardial cushions and ultimately chamber valve leaflets (marked with an asterisk). By contrast, mutant heart sections displayed a discontinuous endocardial lining in the ventricle chamber with segmented myocardial cells at the plane of the AV and OT valves
(marked with an arrow). Consistent with this finding, thinning and severe perturbations to myocardial trabeculation were found in the ventricle chamber. The mutant heart sections also revealed a thinned and disrupted layer of cardiac jelly, with a reduction in size and organization of the OT valve endocardial cushions (marked with an asterisk). Taken altogether, these observations show profound defects to the endocardial and myocardial layering of the mutant heart, suggesting the signaling mechanisms derived from reciprocal interactions between these two cell layers has been compromised.
46 Atrioventricular Valve Outflow Tract Valve
Figure 11. Heart defects apparent in endocardial cushion and myocardial trabeculation of mutant embryos.
Hematoxylin and Eosin stained sagittal sections of control (CTL) and mutant (MUT) E10.5 hearts photographed under dissection scope at the plane of the atrioventricular valve and outflow tract valve. Arrows show discontinuous endocardium and perturbations to myocardial trabeculation in the mutant embryo. Asterisk show thinning of the endocardial cushion of the outflow tract valve in the mutant embryo. Abbreviations: A, atrium; V, ventricle; OT, outflow tract. Scale bar: 100|im.
47 Primary endothelial cell culture
To complement our in vivo investigation into the role of Nek in endothelial cells during
cardiovascular development, we attempted to establish a culture of primary endothelial cells. In
this approach, the expression of Nek could be eliminated by ectopic expression of Cre from an
adenovirus in order to observe its cellular effect to the actin cytoskeleton and migration. Primary
cells were isolated from the lungs of adult Cre", Nckl"'", Nck2flx/flx mice and grown in modified media until dense enough to perform cell selection using Dynalbeads conjugated to mouse
PECAM antibodies. A magnet was used to isolate Dynalbead/PECAM-attached cells into a fresh dish and cultured until further characterization. Using immunofluorescence staining with
PECAM and ICAM-2 (Intercellular adhesion molecule-2) antibodies as endothelial cell markers, with Texas-Red/Phalloidin as a counterstain for F-actin, and a stable mouse brain endothelial cell line (bEND3) as control, the isolated cells were subjected to qualitative analysis of positively stained (endothelial) cells. Sorted primary lung cells (PLCs) were observed to have an extremely small population of PECAM-positive cells, and no cells positively stained with ICAM-2, when compared to the 2°-Antibody (Ab) only control (Refer to Figure 12). In addition, a large degree of contamination by non-endothelial cells was also observed in the primary cell population, indicating non-specific binding by Dynalbeads and/or PECAM. By contrast, the stable bEND3 cell line stained positive for the PECAM and ICAM-2 endothelial cell markers, when compared to the no 1°-Ab control.
Revised protocol for endothelial cell selection
These results suggested the preliminary protocol for endothelial cell isolation using
PECAM-conjugated Dynalbeads was not efficient enough to produce a sufficient population of endothelial cells for analysis. The protocol was then modified, in order to increase efficiency of
48 PECAM ICAM-2 No l°Ab control
PLC
bEND3
Figure 12. Isolation of primary endothelial cells from Cre", Nckl"'", Nck2nx/flx mouse lung tissue. Endothelial cells were positively selected from a population of primary lung cells (PLC) by PECAM-conjugated Dynalbeads and plated for qualitative analysis using AlexaFluor488-conjugated PECAM and AlexaFluor488-conjugated ICAM-2 immunofluorescence (Green), with Texas-Red/Phalloidin counterstain (Red), and DAPI nuclear stain (blue), using the stable bEND3 cell line as a positive control. Scale bar: 10(im.
49 PECAM-Dynalbead binding to primary endothelial cells, and minimize non-specific binding to
non-endothelial cells. This was achieved by mixing the Dynalbeads with PECAM antibodies
prior to incubation on the primary cells, instead of adding the two reagents directly to the cells in
a step-wise fashion. In order to determine the efficiency of the new protocol, the newly-selected
PLCs were then subject to the same qualitative analysis using immunofluorescence staining with
PECAM and Texas-Red/Phalloidin, in comparison to Dynalbead-selected bEND3 cells as a
positive control, Dynalbead-selected COS7 (immortalized CV-1 cell line derived from the
kidney cells of African green monkey) as a negative control, and unsorted PLC cells (Refer to
Figure 13). The PECAM-Dynalbead cell selection for the stable bEND3 cell line yielded a full
population of viable endothelial cells, when compared to selecting the cells using Dynalbeads
only. The PECAM-Dynalbead cell selection for the COS7 cell line yielded a very small
population of cells that did not stain positive for endothelial identity. The PECAM-Dynalbead
cell selection for the isolated PLC cell line yielded a small population of viable cells that stained
positive for endothelial cell identity. These cells were observed to have an extensive actin
cytoskeleton network and grew in strong contact with other cells with endothelial morphology in
small island clusters. There were no contaminating cell types isolated with the primary
endothelial cells, indicating a more specific cell selection. The plate of unsorted PLC culture
stained with PECAM revealed that approximately 50% of primary cells had endothelial identity.
These results demonstrate that the protocol for isolation of primary cells from the lungs
of Cre", Nckl"7", Nck2flx/flx mice yielded a mixed population of endothelial and contaminating cells from which a small population of viable endothelial cells was successfully isolated. This protocol can now be scaled up to generate larger populations of cells that can be treated with Cre adenovirus to remove Nek expression, and used for further characterization of Nek function.
50 PECAM/ Dynalbeads Dynalbeads only
bEND3
COS7
PLC
Unsorted PLC
PECAM No l°Ab control
Figure 13. Optimizing the efficiency of endothelial cell separation from primary lung cells. Cultures of bEND3 cells, COS7 cells, and PLCs were selected for endothelial cell identity by PECAM-conjugated Dynalbeads and plated for qualitative analysis using AlexaFluor488-conjugated PECAM immunofluorescence (Green), with Texas-
Red/Phalloidin counterstain (Red), and DAPI nuclear stain (blue), using 'Dynalbeads only' as a negative control.
Shown below blue line are the unsorted primary lung cells stained using AlexaFluor488-conjugated PECAM and 2° antibody only. Scale bar: 10|im.
51 DISCUSSION
Loss of endothelial-Nck results in embryonic lethality between E10 and Ell
From 9 litters and the production of 67 pups at F3, we did not observe a single viable
mouse with the mutant genotype. This suggested that the loss of endothelial-Nck results in
embryonic lethality with a 100% penetrance. Of the four pregnant female mice sacrificed and 12
mutant embryos dissected at El 1.5, all had succumbed prenatally. The measure of necrosis and tissue damage at El 1.5 suggested an earlier lethal time point. Mutant embryos dissected at El0.5 - displayed a varied degree of developmental defects in the head, heart, and spine, as well as loss of vessel perfusion in the yolk sac. Approximately 65% of mutant embryos dissected at El0.5 had a beating heart, yet this was slower and more erratic when compared to control littermates.
Interestingly, some mutant embryos were first thought to be deceased due to substantial growth retardation and tissue damage, yet were observed to have a faint heart beat upon closer inspection. Mutant embryos dissected at E9.5 were of similar size to their littermates, and did not display any developmental defects. Taken altogether, these observations suggested that the lack of viable mutant mice produced at F3 was due to mutant mice succumbing prenatally between
E10 and Ell. Considering that the Tie2 promoter is normally active in the extraembryonic mesoderm of the yolk sac at E7.5, the placenta at E12.5, and the embryonic mesoderm at E8.5, we anticipated that Cre recombinase expression would result in the subsequent deletion of Nck2 in the embryo proper by E9.5 (Dumont et al., 1995). The embryonic lethality of mutant embryos between E10 and Ell correlates with Tie2 promoter expression at E8.5, and suggests the half- life of Nek is less than 24 hours. Consistent with this finding, the induced deletion of Nek in the podocytes of transgenic mice resulted in extensive renal disease approximately one week later, suggesting a relatively rapid turnover of Nek proteins (Jones et al., 2009).
52 The reproducibility of the mutant phenotype and observed 100% penetrance at Ell
suggest that we are achieving complete and specific Cre recombinase efficiency in our system.
The previously characterized Tie2-Cre mouse strain was shown to efficiently express Cre
recombinase in mesodermal blood islands by E7.5 and in the dorsal aorta by E8.5, resulting in
the excision of endothelial FAK with >95% efficiency by El 0.5 (Braren et al., 2006). To confirm
the efficiency of Cre recombinase expression in our mouse line, the Tie2-Cre strain could be
crossed to a Rosa26R reporter line, in which (3-galactosidase is activated only after Cre excision.
After harvesting embryos at E8.5 and E9.5, X-Gal staining would confirm that Cre is expressed
solely in endothelial cells at the appropriate time in embryonic development. The efficiency of
Nck2 excision could also be estimated by performing a western blot assay of total embryonic lysate at E9.5, El0.5, and El 1.5 for the presence of Cre and Nck2 protein in comparison to control littermates. A similar experiment was performed for the endothelial-FAK knockout study, where the authors showed a reduction in endothelial-FAK by assaying total embryonic protein at E9.5 (Braren et al., 2006). Due to time constraints and reagent availability, this experiment could not be completed, but we are nonetheless confident that we have successfully deleted Nck2 expression in the endothelial cells of Nckl-null mice.
Thinning of the yolk sac vitelline vessel
At the lethal time point, between E10 and El 1, the heart is still a single curved tube that pumps blood through the primitive cardiovascular system. Major vessels of the intraembryonic and extraembryonic networks have connected, establishing a functional circulatory system. The previous processes of vasculogenesis have produced functional blood vessels, which are further refined by sprouting angiogenesis in areas of high growth and metabolic demand, such as the developing yolk sac, brain, and neural tube. When examining the mutant El0.5 yolk sac, the
53 primary defect observed was underdevelopment of the vitelline vessel. The yolk sac vitelline
vasculature showed a simplified organization with reduced vessel diameter, which was likely not
able to support blood flow, when compared to the control littermate. Considering Nek adaptor
proteins signal primarily to the actin cytoskeleton and contribute to the regulation of cell
structure dynamics, it is not unreasonable to speculate that the loss of endothelial-Nck resulted in
the loss of vessel remodeling, as seen in the vitelline vessel. Remnants of microvasculature
networks were observed as moderately branched and resembling the patterning seen in the
control yolk sac, suggesting a certain degree of vessel growth and angiogenesis had previously
occurred. The vessel patterning in the yolk sac microvasculature could be the result of early
angiogenic remodeling that preceded Nck2 deletion, or may suggest that early angiogenesis is
able to proceed without Nek proteins. Examination of the yolk sac at an earlier time point, such
as E9.5, may further our understanding of the observed phenotype.
Certain factors may contribute to the remodeling and stability of vessels, including the
recruitment of smooth muscle cells to the immature vessel for structural support, and positive
hemodynamic pressure from blood circulation. Double immunofluorescence staining with
PECAM and SMA revealed the presence of smooth muscle cells on both the control and the mutant yolk sac vitelline vessel at El0.5. However, the staining on the mutant vitelline vessel appeared as a scattered pattern, which may indicate a degree of smooth muscle disorganization or a defect in attachment of smooth muscle cells to the vascular endothelium. One characteristic feature of Tie2"/_ and Ang 1''' mice is a defective smooth muscle cell layering around affected vessels (Dumont et al., 1994; Suri et al., 1996). Recent evidence also suggests that endothelial cells regulate smooth muscle cell layering, via Tie2 signaling, in a paracrine mechanism that may involve heparin binding EGF-like growth factor (HB-EGF), PDGF and TGF pathways
54 (Iivanainen et al., 2003; Nishishita and Lin, 2004). Smooth muscle cell attachment may also
involve the proper formation of a vascular basement membrane, which is critical to interactions
between endothelial cells and smooth muscle cells (Torsney et al., 2003). The scattered smooth
muscle observation could also be a secondary effect to fundamental changes to the endothelium
following Nck2 deletion, including a loss of structural integrity, a defective balance of cellular
proliferation and differentiation, or the presence of cell death. In order to further investigate these
observations, double immunofluorescence staining with PECAM and SMA could be performed
on yolk sacs of an earlier time point, including E9.5, to determine the presence and organization
of smooth muscle on the mutant vitelline vessel. Taken together, these results indicate that Nek
is not required for the recruitment of circulating smooth muscle cells to the yolk sac vitelline
vessel, yet may serve a role in signaling mechanisms that mediate their attachment to the
endothelium.
Defects to the endocardial cushion, myocardial trabeculation and cardiac valves of the heart
Histological sectioning revealed notable defects to the continuous endocardial lining,
myocardial trabeculation, and primitive cardiac valves of the mutant E10.5 heart. Proper
development of the endocardial cushions depends on the migration of endocardial cells into the cardiac jelly, which is mediated by VEGF and TGF signaling (Dor et al., 2001). This migration is preceded by endocardial cells undergoing an epithelial-to-mesenchymal transformation
(EMT). Considering that Nek has been shown to bind VEGFR-2 and Tie2 and signal downstream to mediate cell migration, the loss of endothelial-Nck may be responsible for the improper formation of the endocardial cushions, by preventing migration after endocardial EMT during heart tube development. Impaired formation of the endocardial cushions would then lead to altered development of the atrioventricular and outflow tract valves. Mutant hearts also
55 showed poor myocardial trabeculation with a reduced thickness of the myocardial layer. These
results suggest the loss of Nek proteins in the endocardium has brought upon a loss of reciprocal
signaling between the endocardial and myocardial cell layers to cause a reduction in myocardial
trabeculae. Indeed, this may explain why some mutant embryos were observed to have a beating
heart long after significant tissue damage to the body, as myocardial trabeculae are still present
to regulate blood circulation, yet improper formation of the endocardial cushions and cardiac
valves could lead to unregulated blood flow between chambers and loss of cardiac output.
Interestingly, germ-line deletion of the EphA3 receptor resulted in specific defects to the
atrioventricular endocardial cushion and resulted in the death of approximately 70% of EphAS"'"
mice at P0 (Stephen et al., 2007). Furthermore, endocardial cushion explants from EphA3~'~ mice
gave rise to fewer migrating mesenchymal cells, suggesting Eph signaling plays a role in cell
migration for development of the endocardial cushions. In addition, the Tie2 knockout study revealed a degenerating endocardium with defects to myocardial trabeculation resulting in lethality at E10.5 (Dumont et al., 1994). These phenotypes suggest that endothelial-Nck may be involved in Eph and Tie2 signaling during heart development, and the loss of Nek proteins in the endocardium impaired these pathways, resulting in similar heart defects during development.
Cardiac output vs. vessel structure
Primary defects observed in both the vitelline vessel structure and endocardial layers of the heart tube may suggest a reciprocal relationship. The loss of vessel structure in major networks of the embryonic and extraembryonic body, from defects to smooth muscle layering or endothelial cell structure, could contribute to an increase in hemodynamic pressure on the heart, causing ventricular hypertrophy, and affect development to endocardial layers. A recent study, involving a murine model for transverse aortic constriction, showed the selective up-regulation
56 of genes in the ventricular myocardium in response to acute pressure overload, including
transcription factors c-myc, and c-jun, as well as growth factors VEGF and FGF-2 (Spruill et al.,
2008). External sources, including vessel thinning and acute pressure overload, influencing
cardiac gene expression could profoundly affect the proper development of endocardial layers of
the heart by changing cellular behavior during formation of the cardiac cushion. Conversely,
defects to endocardial layers of the heart could lead to a decrease in cardiac output, causing a
loss of hemodynamic force and affecting the structural integrity of vessels during remodeling.
Another recent study, involving an Mlc2a-null mouse embryo model for impaired heart
contractility, demonstrated a specific loss of vessel remodeling in the yolk sac, due to a loss of
hemodynamic stress (Lucitti et al., 2007). This study suggested that hemodynamic force,
generated by the beating heart, plays a prominent role in the patterning of the yolk sac
vasculature. A significant decrease in hemodynamic force from defects to myocardial
trabeculation of the heart could lead to impaired vascular remodeling and cause a loss of vessel
structure. Furthermore, impaired heart output may lead to a deficiency in nutrient and oxygen
circulation, causing defects to the vessel structure from endothelial cell starvation. The observed
phenotype could also be a combination of defects to both the vessel structure and endocardial
layers of the heart tube, as each contributes to the onset and magnitude of the other. In order to further investigate the causal relationship between the two observed defects, individual mutant embryos could be examined for both defects at earlier time points, including E9.5, to determine the earliest onset of the phenotype. For example, if the loss of vitelline vessel structure was observed in the E9.5 mutant embryo, yet histological analysis revealed no defects to the endocardial layers of the heart, the loss of endothelial-Nck would have caused a primary defect to the vessel structure, which may have contributed to defects observed in the heart.
57 Alternatively, if heart defects were observed in the mutant embryo, but the vitelline vessel was
healthy and comparable to a control littermate, the loss of endothelial-Nck would have caused a
primary defect to the heart, which may have contributed to defects in the vessel structure.
Further characterization of the mutant embryo phenotype
Future experiments for investigating the endothelial-Nck null embryos are aimed at
identifying specific defects that contribute to the observed phenotype. These include examining
the hindbrain for specific defects to sprouting angiogenesis, examining the neural tube for
defects to vessel organization and tissue damage, and examining the placenta for defects leading to placental insufficiency. In order to further investigate the role of Nek in sprouting angiogenesis, we will perform PECAM immunofluorescence on paraffin-embedded thick sectioned (lOOi^m) mutant embryos and examine the extent of vessel branching in the developing neuroepithelium of the hindbrain. This technique has been used by Braren et al., 2006, to show that deletion of endothelial-FAK resulted in specific defects to sprouting angiogenesis in the neuroepithelium. We will investigate the capillary network along the neural tube using whole- mount PECAM immunofluorescence staining and TUNEL (Terminal deoxynucleotidyl transferase) assay. The neural tube is specifically vascularized by sprouting angiogenesis from the perineural vascular plexus and regulated by VEGF signaling (Hogan et al., 2004). By examining the neural tube for defects to angiogenesis that may lead to hypoxia and apoptosis in the neural tube, we will determine the source of tissue damage resulting in growth retardation along the spine region of the mutant embryos. Finally, histological analysis of the placenta will reveal the presence of any defects leading to placental insufficiency. The loss of endothelial-Nck may have caused defects to the embryonic-derived vessels of the labyrinthe vasculature of the placenta, leading to insufficient nutrient regulation and growth arrest. However, Tie2 expression
58 in the murine placenta begins at E12.5, much later than onset of the observed mutant phenotype,
which suggests no specific defect should have developed prior to embryonic lethality (Dumont et
al., 1995). Histological analysis will reveal the presence of any placental defect and confirm that
the defects observed in the mutant phenotype are a direct result of the loss of endothelial-Nck,
and not that of a contributing effect from placental insufficiency. These future experiments will
serve to better characterize the observed mutant phenotype and aid in determining the specific
roles of endothelial-Nck during cardiovascular development.
To gain further insight into the endothelial molecular signaling pathways that are affected
by removing Nek expression in our mouse model, we decided to cross-reference our embryonic
phenotype to characteristics from knockout studies of related signaling molecules. These
observations are summarized in Table 4, which shows the phenotype and time of death for mouse knockout models of endothelial cell receptors and signaling molecules. Among the signaling molecules investigated, the phenotype of our endothelial cell-specific Nek deletion most closely matches mice lacking the Angl, Tie2, EphrinB2, and Eph2/3 genes, with specific defects to vessel remodeling and organization and improper formation of heart trabeculation, resulting in embryonic lethality at El0.5 (refer to Table 4). This implies that Nek signaling in endothelial cells during cardiovascular development potentially involves Tie2 and ephrin pathways, and will be considered first for future biochemical investigation.
59 Table 4. Insights into endothelial molecular signaling pathways by mouse knockout studies. List of observed
phenotypes and times of death for mouse knockout studies of genes in molecule families: VEGF, Tie, Ephrin,
PDGF, and Integrins. References: (Ferrara et al., 1996), (Fong et al., 1995), (Shalaby et al., 1995), (Dumont et al.,
1998), (Suri et al„ 1996), (Puri et al., 1995), (Dumont et al., 1994), (Wang et al., 1998), (Orioli et al., 1996), (Leveen
et al., 1994), (Bostrom et al., 1996), (Soriano, 1994), (Fassler and Meyer, 1995), (Bader et al, 1998), (Scharffetter-
Kochaneket al., 1998).
Molecule Phenotype Time of death Family Gene knockout
VEGF-A Absent dorsal aorta, defects to endothelial cell E8.5 - E9.5 development
VEGFR-1 Failure to form endothelial cells E8.5 - E9.5 VEGF VEGFR-2 Excess of endothelial cells form abnormal vessel E8.5 - E9.5 structures entering vessel lumens VEGFR-3 Defective vessel remodeling and organization E10.5-E12 Angl Defective vessel remodeling and organization, improper E10.5 formation of heart trabeculation
Ang2 Poor vessel integrity, edema and hemorrhage E12.5-P1 Tie Tiel Poor vessel integrity, edema, and hemorrhage E13.5-P1 Tie2 Defective vessel remodeling and organization, improper E10.5 formation of heart trabeculation
Ephrin-B2 Defective vessel remodeling and organization, improper E10.5 ' formation of heart trabeculation Ephrin EphB2/B3 Defective vessel remodeling and organization, improper El0.5 (30%) formation of heart trabeculation
PDGF-p Deformed heart, hemorrhaging, dilated blood vessels, PI (75%) abnormal glomeruli in kidney El8 (25%) PDGF PDGF-a El 0(50%) Lung emphysema, hypertrophic heart ventricle P42 (50%) PDGF-Rp Extensive edema, abnormal glomeruli in kidney PI PI Early developmental defects E5.5 Integrins av Cleft palate, CNS or gastrointestinal hemorrhage E9.5 - PI
f52 Impaired leukocyte recruitment, skin infections Prenatal (10-40%)
60 Primary endothelial cell culture
In addition to the characterization of endothelial-Nck null mice, the corresponding study
of Nck-deficient endothelial cells in culture would serve to support the observed phenotype and
complement the in vivo data. With the use of cell cultures, several parameters of cellular
dysfunction, including endothelial cell migration, adhesion, and biochemical signaling pathways,
can be studied in a controlled environment. We are incorporating several distinct studies of
various endothelial cell lineages and methods to remove Nek expression in vitro, including the
generation of stable shRNA-knockdown murine brain endothelial (bEND3) cells, and the
transient knockdown of Nek by siRNA in human umbilical vein endothelial cells (HUVECs).
However, we decided to first pursue the isolation of primary endothelial cells from the adult
lungs of Cre", Nckl"7", Nck2flx/flx transgenic mice, followed by the controlled excision of Nck2 through infection with Cre-expressing adenovirus. Since the endothelial cells in question are directly isolated from the founder transgenic mouse line used to generate Nck-null mice, the in vitro study of Nck-null endothelial cells would best complement the experimental phenotype observed in these mice.
Immunomagnetic separation is a technique used by many groups for isolation of specific viable microorganisms, antigens, or nucleic acids, and has advanced research fields including diagnostic microbiology and clinical transplantation (Olsvik et al., 1994; Collins, 1994). PECAM
(CD31)-conjugated Dynalbeads have been successfully implemented in the isolation and characterization of primary endothelial cells in studies of endothelial-specific FAK and ILK deletion (Braren et al., 2006; Friedrich et al., 2004). Using a preliminary protocol, primary cells were successfully isolated and grown in modified media until endothelial cell selection by magnetic Dynalbeads conjugated to PECAM antibodies. Selected cells were then fluorescently
61 labeled with AlexaFluor488-PECAM and AlexaFluor488-ICAM2 to examine the presence of
endothelial-positive cells. When compared to the stable bEND3 cell line, the primary cells
showed only a small population of endothelial-positive cells with a large degree of non-
endothelial contaminating cells. As such, the protocol for endothelial cell selection was revised
to increase efficiency of positive-cell recovery and decrease the amount of non-endothelial
contaminating cells. Using a modified protocol, we successfully isolated a small population of
endothelial-positive cells from the PLCs and no contaminating cells were observed, suggesting the selection efficiency had been increased and the non-specific binding decreased from the preceding protocol. However, the small number of endothelial cells isolated from the primary lung culture indicates that this approach may not be suitable for experiments requiring a large sample size, including cell migration and biochemistry assays. It will therefore be necessary to up-scale the isolation of primary endothelial cells using a revised protocol, or utilize one of the other knockdown-based approaches that we are developing for such studies.
Nonetheless, the endothelial cells isolated from the primary lung culture can be used for
Cre-mediated Nck2 deletion by adenovirus infection. Cre-expressing adenoviruses have been used extensively to mediate recombination of floxed DNA sequences both in vitro and in vivo
(Shui and Tan, 2004; Kaartinen and Nagy, 2001). In a study involving adenovirus-mediated Cre excision in primary mouse hepatocytes, a >95% infection rate was observed even at a low multiplicity of infection, resulting in a >95% recombination after 24 hours with no effect on cell viability (Prost et al., 2001). The Cre-mediated excision of Nck2 from adenovirus infection in primary cultured endothelial cells from Cre", Nckl+/", Nck2flx/flx mice will allow us to examine the effect of Nek deletion on the actin cytoskeleton network and these studies will undoubtedly complement the experimental phenotype observed in these mice.
62 SUMMARY AND CONCLUSIONS
We have investigated the role of Nek in regulating endothelial cells during cardiovascular
development. The loss of Nck2 in the embryonic endothelial cells of Nckl-null mice results in
embryonic lethality between E10 and Ell. At this time point, mutant embryos appeared smaller
and less developed than their littermate counterparts with growth retardation in the head and
spine regions. Primary defects were observed as loss of yolk sac vitelline vessel structure with
disorganized smooth muscle layering, a discontinuous endocardial lining resulting in defects to myocardial trabeculation and loss of endocardial cushion formation. These observations suggest that the loss of endothelial-Nck results in defects that cause embryonic lethality, which supports our hypothesis that Nek signaling in endothelial cells is required for proper embryonic cardiovascular development. Future experiments stand to clarify specific questions concerning the observed phenotype, including the role of endothelial-Nck in sprouting angiogenesis of the neural tube and neuroepithelium, as well as defects to the labyrinthe vasculature of the placenta leading to placental insufficiency. In addition to investigating the deletion of endothelial Nek in vivo, the specific molecular mechanisms underlying the observed phenotype remain to be elucidated on a cellular level. Primary endothelial cell cultures were isolated from Cre", Nckl"7",
Nck2flx/fIx mice and successfully selected using Dynalbeads conjugated to PECAM antibodies using a modified protocol. Following Cre-mediated excision of Nck2 by adenovirus infection, we can observe its effect on the actin cytoskeleton and relate the loss of Nek in cultured endothelial cells to the observed phenotype of endothelial-Nck null mice. In conclusion, these observations demonstrate the crucial role of Nek adaptor proteins in endothelial cells during cardiovascular development, and may serve to further elucidate the signaling mechanisms that underlie this complex process.
63 REFERENCES
Adams, R. H. (2003). Molecular control of arterial-venous blood vessel identity. J. Anat 202, 105-112.
Adams, R. H., and Alitalo, K. (2007). Molecular regulation of angiogenesis and lymphangiogenesis. Nat Rev Mol Cell Biol 8, 464-478.
Armulik, A., Abramsson, A., and Betsholtz, C. (2005). Endothelial/Pericyte Interactions. Circ Res 97, 512-523.
Bader, B. L., Rayburn, H., Crowley, D., and Hynes, R. O. (1998). Extensive Vasculogenesis, Angiogenesis, and Organogenesis Precede Lethality in Mice Lacking All [alpha] v Integrins. Cell 95, 507-519.
Bagrodia, S., Taylor, S. J., Creasy, C. L., Chernoff, J., and Cerione, R. A. (1995). Identification of a mouse p21Cdc42/Rac activated kinase. J. Biol. Chem 270, 22731-22737.
Bagrodia, S., and Cerione, R. A. (1999). PAK to the future. Trends in Cell Biology 9, 350-355.
Balkan, W., Phillips, L. S., Goldstein, S., and Sadler, T. W. (1989). Role of the mouse visceral yolk sac in nutrition: inhibition by a somatomedin inhibitor. J. Exp. Zool 249, 36-40.
Baron, M. H. (2001). Molecular regulation of embryonic hematopoiesis and vascular development: a novel pathway. J. Hematother. Stem Cell Res 10, 587-594.
Battegay, E., Rupp, J., Iruela-Arispe, L., Sage, E., and Pech, M. (1994). PDGF-BB modulates endothelial proliferation and angiogenesis in vitro via PDGF beta-receptors. J. Cell Biol. 725,917-928.
Beitz, J. G., Kim, I. S., Calabresi, P., and Frackelton, A. R. (1991). Human microvascular endothelial cells express receptors for platelet-derived growth factor. Proceedings of the National Academy of Sciences of the United States of America 88, 2021-2025.
Bladt, F., Aippersbach, E., Gelkop, S., Strasser, G. A., Nash, P., Tafuri, A., Gertler, F. B., and Pawson, T. (2003). The Murine Nek SH2/SH3 Adaptors Are Important for the Development of Mesoderm-Derived Embryonic Structures and for Regulating the Cellular Actin Network. Mol. Cell. Biol. 23, 4586-4597.
Bokoch, G. M., Wang, Y., Bohl, B. P., Sells, M. A., Quilliam, L. A., and Knaus, U. G. (1996). Interaction of the Nek Adapter Protein with p21-activated Kinase (PAK1). J. Biol. Chem. 271, 25746-25749.
Bostrom, H., Willetts, K., Pekny, M., Leveen, P., Lindahl, P., Hedstrand, H., Pekna, M., Hellstrom, M., Gebre-Medhin, S., Schalling, M., et al. (1996). PDGF-A signaling is a
64 critical event in lung alveolar myofibroblast development and alveogenesis. Cell 85, 863- 873.
Braren, R., Hu, H., Kim, Y. H., Beggs, H. E., Reichardt, L. F., and Wang, R. (2006). Endothelial FAK is essential for vascular network stability, cell survival, and lamellipodial formation. J. Cell Biol. 172, 151-162.
Buday, L. (1999). Membrane-targeting of signalling molecules by SH2/SH3 domain-containing adaptor proteins. Biochimica et Biophysica Acta (BBA) - Reviews on Biomembranes 1422, 187-204.
Buday, L., Wunderlich, L., and Tamas, P. (2002). The Nek family of adapter proteins: Regulators of actin cytoskeleton. Cellular Signalling 14, 723-731.
Burridge, K., and Fath, K. (1989). Focal contacts: transmembrane links between the extracellular matrix and the cytoskeleton. Bioessays 10, 104-8.
Carmeliet, P., Ferreira, V., Breier, G., Pollefeyt, S., Kieckens, L., Gertsenstein, M., Fahrig, M., Vandenhoeck, A., Harpal, K., Eberhardt, C., et al. (1996). Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele. Nature 380, 435-9.
Chen, M„ She, H., Kim, A., Woodley, D. T., and Li, W. (2000). Nckbeta Adapter Regulates Actin Polymerization in NIH 3T3 Fibroblasts in Response to Platelet-Derived Growth Factor bb. Mol. Cell. Biol. 20, 7867-7880.
Christoffels, V. M., Habets, P. E., Franco, D., Campione, M., de Jong, F., Lamers, W. H., Bao, Z. Z., Palmer, S., Biben, C., Harvey, R. P., et al. (2000). Chamber formation and morphogenesis in the developing mammalian heart. Dev. Biol 223, 266-278.
Christoffels, V. M., Burch, J. B. E., and Moorman, A. F. M. (2004). Architectural plan for the heart: early patterning and delineation of the chambers and the nodes. Trends Cardiovasc. Med 14, 301-307.
Collins, R. H. (1994). CD34+ selected cells in clinical transplantation. Stem Cells 12, 577-585.
Coultas, L., Chawengsaksophak, K., and Rossant, J. (2005). Endothelial cells and VEGF in vascular development. Nature 438, 937-945.
Cowan, C. A., and Henkemeyer, M. (2001). The SH2/SH3 adaptor Grb4 transduces B-ephrin reverse signals. Nature 413, 174-179.
Cross, J. C., Simmons, D. G., and Watson, E. D. (2003). Chorioallantoic morphogenesis and formation of the placental villous tree. Ann. N. Y. Acad. Sci 995, 84-93.
65 Davis, G. E., and Senger, D. R. (2005). Endothelial Extracellular Matrix: Biosynthesis, Remodeling, and Functions During Vascular Morphogenesis and Neovessel Stabilization. Circ Res 97, 1093-1107.
Davy, A., and Soriano, P. (2005). Ephrin signaling in vivo: Look both ways. Developmental Dynamics 232, 1-10.
Dejana, E. (2004). Endothelial cell-cell junctions: happy together. Nat Rev Mol Cell Biol 5, 261- 270.
Dor, Y., Camenisch, T., Itin, A., Fishman, G., McDonald, J., Carmeliet, P., and Keshet, E. (2001). A novel role for VEGF in endocardial cushion formation and its potential contribution to congenital heart defects. Development 128, 1531-1538.
Dumont, D. J., Gradwohl, G., Fong, G. H., Puri, M. C., Gertsenstein, M., Auerbach, A., and Breitman, M. L. (1994). Dominant-negative and targeted null mutations in the endothelial receptor tyrosine kinase, tek, reveal a critical role in vasculogenesis of the embryo. Genes Dev 8,1897-1909.
Dumont, D. J., Jussila, L., Taipale, J., Lymboussaki, A., Mustonen, T., Pajusola, K., Breitman, M., and Alitalo, K. (1998). Cardiovascular failure in mouse embryos deficient in VEGF receptor-3. Science 282, 946-949.
Dumont, D. J., Fong, G., Puri, M. C., Gradwohl, G., Alitalo, K., and Breitman, M. L. (1995). Vascularization of the mouse embryo: A study of flk-l, tek, tie, and vascular endothelial growth factor expression during development. Developmental Dynamics 203, 80-92.
Edelberg, J. M., Aird, W. C., Wu, W., Rayburn, H., Mamuya, W. S„ Mercola, M., and Rosenberg, R. D. (1998). PDGF mediates cardiac microvascular communication. J. Clin. Invest 102, 837-843.
Eliceiri, B. P. (2001). Integrin and Growth Factor Receptor Crosstalk. Circ Res 89, 1104-1110.
Fassler, R., and Meyer, M. (1995). Consequences of lack of beta 1 integrin gene expression in mice. Genes Dev 9, 1896-1908.
Ferrara, N., Carver-Moore, K., Chen, H., Dowd, M., Lu, L., O'Shea, K. S., Powell-Braxton, L., Hillan, K. J., and Moore, M. W. (1996). Heterozygous embryonic lethality induced by targeted inactivation of the VEGF gene. Nature 380, 439-42.
Fishman, M. C., and Olson, E. N. (1997). Parsing the heart: genetic modules for organ assembly. Cell 91, 153-156.
Fong, G. H., Rossant, J., Gertsenstein, M., and Breitman, M. L. (1995). Role of the Fit-1 receptor tyrosine kinase in regulating the assembly of vascular endothelium. Nature 376, 66-70.
66 Friedrich, E. B., Liu, E., Sinha, S., Cook, S., Milstone, D. S., MacRae, C. A., Mariotti, M., Kuhlencordt, P. J., Force, T., Rosenzweig, A., et al. (2004). Integrin-linked kinase regulates endothelial cell survival and vascular development. Mol. Cell. Biol 24, 8134- 8144.
Gagnon, R. (2003). Placental insufficiency and its consequences. Eur. J. Obstet. Gynecol. Reprod. Biol 110 Suppl 1, S99-107.
Garrity, P. A., Rao, Y., Salecker, I., McGlade, J., Pawson, T., and Zipursky, S. L. (1996). Drosophila Photoreceptor Axon Guidance and Targeting Requires the Dreadlocks SH2/SH3 Adapter Protein. Cell 85, 639-650.
Gerhardt, H., Golding, M., Fruttiger, M., Ruhrberg, C., Lundkvist, A., Abramsson, A., Jeltsch, M., Mitchell, C., Alitalo, K., Shima, D., et al. (2003). VEGF guides angiogenic sprouting utilizing endothelial tip cell filopodia. J. Cell Biol. 161, 1163-1177.
Gilbert, S. F. (2006) Developmental Biology. Eighth Ed. Sunderland, MA, USA: Sinauer Associates Inc. p478.
Goh, K., Yang, J., and Hynes, R. (1997). Mesodermal defects and cranial neural crest apoptosis in alpha5 integrin-null embryos. Development 124, 4309-4319.
Goicoechea, S. M., Tu, Y., Hua, Y., Chen, K., Shen, T., Guan, J., and Wu, C. (2002). Nck-2 interacts with focal adhesion kinase and modulates cell motility. Int. J. Biochem. Cell Biol 34, 791-805.
Gong, C., Stoletov, K. V., and Terman, B. I. (2004). VEGF treatment induces signaling pathways that regulate both actin polymerization and depolymerization. Angiogenesis 7, 313-322.
Guan, S., Chen, M., Woodley, D., and Li, W. (2007). Nck{beta} Adapter Controls Neuritogenesis by Maintaining the Cellular Paxillin Level. Mol. Cell. Biol. 27, 6001- 6011.
Guan, S., Fan, J., Han, A., Chen, M., Woodley, D. T., and Li, W. (2009). Non-compensating roles between Nckalpha and Nckbeta in PDGF-BB signaling to promote human dermal fibroblast migration. J. Invest. Dermatol 129, 1909-1920.
1. Heissig, B. et al. Angiogenesis: vascular remodeling of the extracellular matrix involves metalloproteinases. Curr Opin Hematol 10, 136-41(2003).
Heldin, C., and Westermark, B. (1999). Mechanism of Action and In Vivo Role of Platelet- Derived Growth Factor. Physiol. Rev. 7P, 1283-1316.
67 Hellstrom, M., Phng, L., Hofmann, J. J., Wallgard, E., Coultas, L., Lindblom, P., Alva, J., Nilsson, A., Karlsson, L., Gaiano, N., et al. (2007). D114 signalling through Notehl regulates formation of tip cells during angiogenesis. Nature 445, 776-780.
Hogan, K. A., Ambler, C. A., Chapman, D. L., and Bautch, V. L. (2004). The neural tube patterns vessels developmentally using the VEGF signaling pathway. Development 131, 1503-1513.
Holmes, K., Roberts, O. L., Thomas, A. M., and Cross, M. J. (2007). Vascular endothelial growth factor receptor-2: Structure, function, intracellular signalling and therapeutic inhibition. Cellular Signalling 19, 2003-2012.
Holmqvist, K., Cross, M., Riley, D., and Welsh, M. (2003). The Shb adaptor protein causes Src- dependent cell spreading and activation of focal adhesion kinase in murine brain endothelial cells. Cellular Signalling 15, 171-179.
Hu, T., Shi, G., Larose, L., Rivera, G. M., Mayer, B. J., and Zhou, R. (2009). Regulation of process retraction and cell migration by EphA3 is mediated by the adaptor protein Nckl. Biochemistry 48, 6369-6378.
Huang, L., Turck, C. W., Rao, P., and Peters, K. G. (1995). GRB2 and SH-PTP2: potentially important endothelial signaling molecules downstream of the TEK/TIE2 receptor tyrosine kinase. Oncogene 11, 2097-2103.
Hubbard, S. R., and Miller, W. T. (2007). Receptor tyrosine kinases: mechanisms of activation and signaling. Current Opinion in Cell Biology 19, 117-123.
Iivanainen, E., Nelimarkka, L., Elenius, V., Heikkinen, S., Junttila, T. T., Sihombing, L., Sundvall, M., Maatta, J. A., Laine, V. J. O., Yla-Herttuala, S., et al. (2003). Angiopoietin- regulated recruitment of vascular smooth muscle cells by endothelial-derived heparin binding EGF-like growth factor. FASEB J 17, 1609-1621.
Ilan, N., Mahooti, S., and Madri, J. A. (1998). Distinct signal transduction pathways are utilized during the tube formation and survival phases of in vitro angiogenesis. J Cell Sc i 111 (Pt 24), 3621-31.
Jollie, W. P. (1990). Development, morphology, and function of the yolk-sac placenta of laboratory rodents. Teratology 41, 361-381.
Jones, E. A. V., Baron, M. H., Fraser, S. E., and Dickinson, M. E. (2004). Measuring hemodynamic changes during mammalian development. Am. J. Physiol. Heart Circ. Physiol 287, HI561 -1569.
Jones, E. A. V., le Noble, F., and Eichmann, A. (2006). What Determines Blood Vessel Structure? Genetic Prespecification vs. Hemodynamics. Physiology 21, 388-395.
68 Jones, N., and Dumont, D. J. (1998). The Tek/Tie2 receptor signals through a novel Dok-related docking protein, Dok-R. Oncogene 77, 1097-1108.
Jones, N., Iljin, K., Dumont, D. J., and Alitalo, K. (2001). Tie receptors: new modulators of angiogenic and lymphangiogenic responses. Nat. Rev. Mol. Cell Biol 2, 257-267.
Jones, N., Blasutig, I. M., Eremina, V., Ruston, J. M., Bladt, F., Li, H., Huang, H., Larose, L., Li, S. S., Takano, T., et al. (2006). Nek adaptor proteins link nephrin to the actin cytoskeleton of kidney podocytes. Nature 440, 818-823.
Jones, N., New, L. A., Fortino, M. A., Eremina, V., Ruston, J., Blasutig, I. M., Aoudjit, L., Zou, Y., Liu, X., Yu, G., et al. (2009). Nek proteins maintain the adult glomerular filtration barrier. J. Am. Soc. Nephrol 20, 1533-1543.
Kaartinen, V., and Nagy, A. (2001). Removal of the floxed neo gene from a conditional knockout allele by the adenoviral Cre recombinase in vivo. Genesis 31, 126-129.
Kamei, M., Brian Saunders, W., Bayless, K. J., Dye, L., Davis, G. E., and Weinstein, B. M. (2006). Endothelial tubes assemble from intracellular vacuoles in vivo. Nature 442, 453- 456.
Keely, P. J., Westwick, J. K., Whitehead, I. P., Der, C. J., and Parise, L. V. (1997). Cdc42 and Racl induce integrin-mediated cell motility and invasiveness through PI(3)K. Nature 390, 632-6.
Kelly, R. G., and Buckingham, M. E. (2002). The'anterior heart-forming field: voyage to the arterial pole of the heart. Trends in Genetics 18, 210-216.
Kisanuki, Y. Y., Hammer, R. E., Miyazaki, J., Williams, S. C., Richardson, J. A., and Yanagisawa, M. (2001). Tie2-Cre transgenic mice: a new model for endothelial cell- lineage analysis in vivo. Dev. Biol 230, 230-242.
Kos, C. H. (2004). Cre/loxP system for generating tissue-specific knockout mouse models. Nutr Rev 62, 243-6.
Kroll, J., and Waltenberger, J. (1997). The Vascular Endothelial Growth Factor Receptor KDR Activates Multiple Signal Transduction Pathways in Porcine Aortic Endothelial Cells. J. Biol. Chem. 272, 32521-32527.
Kullander, K., and Klein, R. (2002). Mechanisms and functions of eph and ephrin signalling. Nat Rev Mol Cell Biol 3, 475-486.
Ladwein, M., and Rottner, K. (2008). On the Rho'd: The regulation of membrane protrusions by Rho-GTPases. FEBS Letters 582, 2066-2074.
69 Lamalice, L., Houle, F., Jourdan, G., and Huot, J. (2004). Phosphorylation of tyrosine 1214 on VEGFR2 is required for VEGF-induced activation of Cdc42 upstream of SAPK2//p38. Oncogene 23, 434-445. de Lange, W. J., Halabi, C. M., Beyer, A. M., and Sigmund, C. D. (2008). Germ line activation of the Tie2 and SMMHC promoters causes noncell-specific deletion of floxed alleles. Physiol. Genomics 35, 1-4.
Lehmann, J. M., Riethmuller, G., and Johnson, J. P. (1990). Nek, a melanoma cDNA encoding a cytoplasmic protein consisting of the sre homology units SH2 and SH3. Nucleic Acids Res. 18, 1048.
Leveen, P., Pekny, M., Gebre-Medhin, S., Swolin, B., Larsson, E., and Betsholtz, C. (1994). Mice deficient for PDGF B show renal, cardiovascular, and hematological abnormalities. Genes Dev 8, 1875-1887.
Li, W., Fan, J., and Woodley, D. T. (2001). Nck/Dock: an adapter between cell surface receptors and the actin cytoskeleton. Oncogene 20, 6403-6417.
Li, W., Hu, P., Skolnik, E. Y., Ullrich, A., and Schlessinger, J. (1992). The SH2 and SH3 domain-containing Nek protein is oncogenic and a common target for phosphorylation by different surface receptors. Mol. Cell. Biol. 12, 5824-5833.
Li, Y. J., Haga, J. H., and Chien, S. (2005). Molecular basis of the effects of shear stress on vascular endothelial cells. Journal of Biomechanics 38, 1949-1971.
Lindahl, P., Johansson, B. R., Leveen, P., and Betsholtz, C. (1997). Pericyte Loss and Microaneurysm Formation in PDGF-B-Deficient Mice. Science 277, 242-245. i Lobov, I. B., Renard, R. A., Papadopoulos, N., Gale, N. W., Thurston, G., Yancopoulos, G. D., and Wiegand, S. J. (2007). Delta-like ligand 4 (D114) is induced by VEGF as a negative regulator of angiogenic sprouting. Proc Natl Acad Sci USA. 104, 3219-3224.
Lucitti, J. L., Jones, E. A. V., Huang, C., Chen, J., Fraser, S. E., and Dickinson, M. E. (2007). Vascular remodeling of the mouse yolk sac requires hemodynamic force. Development 134, 3317-3326.
Machesky, L. M., and Hall, A. (1997). Role of Actin Polymerization and Adhesion to Extracellular Matrix in Rac- and Rho-induced Cytoskeletal Reorganization. J. Cell Biol. 138, 913-926.
Mallavarapu, A., and Mitchison, T. (1999). Regulated Actin Cytoskeleton Assembly at Filopodium Tips Controls Their Extension and Retraction. J. Cell Biol. 146, 1097-1106.
70 Mallavarapu, A., and Mitchison, T. (1999). Regulated Actin Cytoskeleton Assembly at Filopodium Tips Controls Their Extension and Retraction. J. Cell Biol. 146, 1097-1106.
Mattila, P. K., and Lappalainen, P. (2008). Filopodia: molecular architecture and cellular functions. Nat Rev Mol Cell Biol 9, 446-454.
Meisenhelder, J., and Hunter, T. (1992). The SH2/SH3 domain-containing protein Nek is recognized by certain anti-phospholipase C-gamma 1 monoclonal antibodies, and its phosphorylation on tyrosine is stimulated by platelet-derived growth factor and epidermal growth factor treatment. Mol. Cell. Biol 12, 5843-5856.
Mochizuki, Y., Nakamura, T., Kanetake, H., and Kanda, S. (2002). Angiopoietin 2 stimulates migration and tube-like structure formation of murine brain capillary endothelial cells through c-Fes and c-Fyn. J. Cell. Sci 115, 175-183.
Moorman, A., Webb, S., Brown, N. A., Lamers, W., and Anderson, R. H. (2003). DEVELOPMENT OF THE HEART: (1) FORMATION OF THE CARDIAC CHAMBERS AND ARTERIAL TRUNKS. Heart. 89, 806-814.
Nishimura, R., Li, W., Kashishian, A., Mondino, A., Zhou, M., Cooper, J., and Schlessinger, J. (1993). Two signaling molecules share a phosphotyrosine-containing binding site in the platelet-derived growth factor receptor. Mol. Cell. Biol. 13, 6889-6896.
Nishishita, T., and Lin, P. C. (2004). Angiopoietin 1, PDGF-B, and TGF-beta gene regulation in endothelial cell and smooth muscle cell interaction. Journal of Cellular Biochemistry 91, 584-593.
Olsvik, O., Popovic, T., Skjerve, E., Cudjoe, K. S., Homes, E., Ugelstad, J., and Uhlen, M. (1994). Magnetic separation techniques in diagnostic microbiology. Clin. Microbiol. Rev 7, 43-54.
Orioli, D., Henkemeyer, M., Lemke, G., Klein, R., and Pawson, T. (1996). Sek4 and Nuk receptors cooperate in guidance of commissural axons and in palate formation. EMBO J 15, 6035-6049.
Otey, C., Pavalko, F., and Burridge, K. (1990). An interaction between alpha-actinin and the beta 1 integrin subunit in vitro. J. Cell Biol. Ill, 721-729.
Park, D., and Rhee, S. G. (1992). Phosphorylation of Nek in response to a variety of receptors, phorbol myristate acetate, and cyclic AMP. Mol. Cell. Biol. 12, 5816-5823.
Patan, S. (1998). TIE1 and TIE2 Receptor Tyrosine Kinases Inversely Regulate Embryonic Angiogenesis by the Mechanism of Intussusceptive Microvascular Growth. Microvascular Research 56, 1-21.
71 Patrakka, J., and Tryggvason, K. (2007). Nephrin-a unique structural and signaling protein of the kidney filter. Trends Mol Med 13, 396-403.
Prost, S., Sheahan, S., Rannie, D., and Harrison, D. J. (2001). Adenovirus-mediated Cre deletion of floxed sequences in primary mouse cells is an efficient alternative for studies of gene deletion. Nucleic Acids Res 29, E80.
Pugh, C. W., and Ratcliffe, P. J. (2003). Regulation of angiogenesis by hypoxia: role of the HIF system. Nat Med 9, 677-684.
Puri, M. C., Partanen, J., Rossant, J., and Bernstein, A. (1999). Interaction of the TEK and TIE receptor tyrosine kinases during cardiovascular development. Development 126, 4569- 80.
Puri, M. C., Rossant, J., Alitalo, K., Bernstein, A., and Partanen, J. (1995). The receptor tyrosine kinase TIE is required for integrity and survival of vascular endothelial cells. EMBO J 14, 5884-5891.
Rearden, A. (1994). A new LIM protein containing an autoepitope homologous to "senescent cell antigen". Biochem. Biophys. Res. Commun 201, 1124-1131.
Risau, W., Drexler, H., Mironov, V., Smits, A., Siegbahn, A., Funa, K., and Heldin, C. H. (1992). Platelet-derived growth factor is angiogenic in vivo. Growth Factors 7, 261-266.
Risau, W., and Flamme, I. (1995). Vasculogenesis. Annu. Rev. Cell Dev. Biol 11, 73-91.
Rivero-Lezcano, O. M., Marcilla, A., Sameshima, J. H., and Robbins, K. C. (1995). Wiskott- Aldrich syndrome protein physically associates with Nek through Src homology 3 domains. Mol. Cell. Biol 15, 5725-5731.
Rohatgi, R., Ma, L., Miki, H., Lopez, M., Kirchhausen, T., Takenawa, T., and Kirschner, M. W. (1999). The interaction between N-WASP and the Arp2/3 complex links Cdc42- dependent signals to actin assembly. Cell 97, 221-31.
Ruhrberg, C., Gerhardt, H., Golding, M., Watson, R., Ioannidou, S., Fujisawa, H., Betsholtz, C., and Shima, D. T. (2002). Spatially restricted patterning cues provided by heparin-binding VEGF-A control blood vessel branching morphogenesis. Genes Dev 16, 2684-2698.
Scharffetter-Kochanek, K., Lu, H., Norman, K., van Nood, N., Munoz, F., Grabbe, S., McArthur, M., Lorenzo, I., Kaplan, S., Ley, K., et al. (1998). Spontaneous Skin Ulceration and Defective T Cell Function in CD 18 Null Mice. J. Exp. Med. 188, 119-131.
Schlaepfer, D., Broome, M., and Hunter, T. (1997). Fibronectin-stimulated signaling from a focal adhesion kinase-c-Src complex: involvement of the Grb2, pl30cas, and Nek adaptor proteins. Mol. Cell. Biol. 17, 1702-1713.
72 Schlessinger, J. (2000). Cell Signaling by Receptor Tyrosine Kinases. Cell 103, 211-225.
Shalaby, F., Rossant, J., Yamaguchi, T. P., Gertsenstein, M., Wu, X. F., Breitman, M. L., and Schuh, A. C. (1995). Failure of blood-island formation and vasculogenesis in Flk-1- deficient mice. Nature 376, 62-6.
Shui, J., and Tan, T. (2004). Germline transmission and efficient DNA recombination in mouse embryonic stem cells mediated by adenoviral-Cre transduction. Genesis 39, 217-223.
Sissman, N. J. (1970). Developmental landmarks in cardiac morphogenesis: comparative chronology. Am. J. Cardiol 25, 141-148.
Small, J. V., Stradal, T., Vignal, E., and Rottner, K. (2002). The lamellipodium: where motility begins. Trends in Cell Biology 12, 112-120.
Soriano, P. (1994). Abnormal kidney development and hematological disorders in PDGF beta- receptor mutant mice. Genes Dev 8, 1888-1896.
Spruill, L. S., Baicu, C. F., Zile, M. R, and McDermott, P. J. (2008). Selective translation of mRNAs in the left ventricular myocardium of the mouse in response to acute pressure overload. Journal of Molecular and Cellular Cardiology 44, 69-75.
Stephen, L. J., Fawkes, A. L., Verhoeve, A., Lemke, G., and Brown, A. (2007). A critical role for the EphA3 receptor tyrosine kinase in heart development. Dev. Biol 302, 66-79.
Stradal, T. E., and Scita, G. (2006). Protein complexes regulating Arp2/3-mediated actin assembly. Current Opinion in Cell Biology 18, 4-10.
Su, Z., Xu, P., and Ni, F. (2004). Single phosphorylation of Tyr304 in the cytoplasmic tail of ephrin B2 confers high-affinity and bifunctional binding to both the SH2 domain of Grb4 and the PDZ domain of the PDZ-RGS3 protein. Eur. J. Biochem 271, 1725-1736.
Suri, C., Jones, P. F., Patan, S., Bartunkova, S., Maisonpierre, P. C., Davis, S., Sato, T. N., and Yancopoulos, G. D. (1996). Requisite Role of Angiopoietin-1, a Ligand for the TIE2 Receptor, during Embryonic Angiogenesis. Cell 87, 1171-1180.
Takenawa, T., and Suetsugu, S. (2007). The WASP-WAVE protein network: connecting the membrane to the cytoskeleton. Nat Rev Mol Cell Biol 8, 37-48. von Tell, D., Armulik, A., and Betsholtz, C. (2006). Pericytes and vascular stability. Exp. Cell Res 312, 623-629.
Theriot, J. A., and Mitchison, T. J. (1991). Actin microfilament dynamics in locomoting cells. Nature 352, 126-31.
73 Torsney, E., Charlton, R., Diamond, A. G., Burn, J., Soames, J. V., and Arthur, H. M. (2003). Mouse Model for Hereditary Hemorrhagic Telangiectasia Has a Generalized Vascular Abnormality. Circulation 107, 1653-1657.
Tu, Y., Li, F., and Wu, C. (1998). Nck-2, a novel Src homology2/3-containing adaptor protein that interacts with the LIM-only protein PINCH and components of growth factor receptor kinase-signaling pathways. Mol. Biol. Cell 9, 3367-3382.
Vernon, R., and Sage, E. (1995). Between molecules and morphology. Extracellular matrix and creation of vascular form. Am J Pathol 147, 873-883.
Wagner, M., and Siddiqui, M. A. Q. (2007). Signal Transduction in Early Heart Development (II): Ventricular Chamber Specification, Trabeculation, and Heart Valve Formation. Experimental Biology and Medicine 232, 866-880.
Wang, H. U., Chen, Z., and Anderson, D. J. (1998). Molecular Distinction and Angiogenic Interaction between Embryonic Arteries and Veins Revealed by ephrin-B2 and Its Receptor Eph-B4. Cell 93, 741 -753.
Wang, R., Ferrell, L. D., Faouzi, S., Maher, J. J., and Bishop, J. M. (2001). Activation of the Met Receptor by Cell Attachment Induces and Sustains Hepatocellular Carcinomas in Transgenic Mice. J. Cell Biol. 153, 1023-1034.
Wary, K. K„ Mainiero, F., Isakoff, S. J., Marcantonio, E. E., and Giancotti, F. G. (1996). The adaptor protein She couples a class of integrins to the control of cell cycle progression. Cell 87, 733-43.
Wilkinson, D. G. (2001). Multiple roles of EPH receptors and ephrins in neural development. Nat. Rev. Neurosci 2, 155-164.
Witzenbichler, B., Maisonpierre, P. C., Jones, P., Yancopoulos, G. D., and Isner, J. M. (1998). Chemotactic properties of angiopoietin-1 and -2, ligands for the endothelial-specific receptor tyrosine kinase Tie2. J. Biol. Chem 273, 18514-18521.
Yamazaki, D., Suetsugu, S., Miki, H., Kataoka, Y., Nishikawa, S., Fujiwara, T., Yoshida, N., and Takenawa, T. (2003). WAVE2 is required for directed cell migration and cardiovascular development. Nature 424, 452-456.
Yoshii, S„ Tanaka, M., Otsuki, Y., Wang, D. Y., Guo, R. J., Zhu, Y., Takeda, R., Hanai, H., Kaneko, E., and Sugimura, H. (1999). alphaPIX nucleotide exchange factor is activated by interaction with phosphatidylinositol 3-kinase. Oncogene 18, 5680-5690.
Zachary, I., and Gliki, G. (2001). Signaling transduction mechanisms mediating biological actions of the vascular endothelial growth factor family. Cardiovasc. Res 49, 568-581.
74