DOCSLIB.ORG

The Role of Oxidative Stress Following Antenatal Synthetic Glucocorticoid Therapy

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Role of Oxidative Stress Following Antenatal Synthetic Glucocorticoid Therapy The Role Of Oxidative Stress Following Antenatal Synthetic Glucocorticoid Therapy by Susmita Sarkar A thesis submitted in conformity with the requirements for the degree of Master of Science Department of Physiology University of Toronto © Copyright by Susmita Sarkar (2018) The Role Of Oxidative Stress Following Antenatal Synthetic Glucocorticoid Therapy Susmita Sarkar Master of Science Department of Physiology University of Toronto 2018 Abstract We investigated the role of oxidative stress following sGC treatment in a guinea pig model of gestation through measures including: expression of antioxidant enzyme genes, protein carbonylation, and the glutathione ratio in the hippocampus, placenta, and liver of female and male fetuses treated with two courses of betamethasone in utero. Results indicated no significant differences in hippocampal or placental gene expression. Peroxiredoxin-6 expression was significantly downregulated in the male liver following sGC, but there were no differences in the female liver. There were no differences in protein carbonylation or glutathione ratio in the fetal placenta or liver. To investigate long-term outcomes of sGC exposure in utero, we used gene set enrichment analysis of post-natal day 40 female hippocampi, and found significant downregulation of a gene set for oxidative phosphorylation. These finding suggest that while the fetus is acutely protected from oxidative stress following sGC, there might be long-term programming of mitochondrial functions. ii Acknowledgments These past two years have collectively been the most fulfilling experience of my education thus far. I would like to thank the following people for their significant role in shaping my time in graduate school. First and foremost, I would like to thank my research supervisor, Dr. Stephen Matthews for this opportunity. His support, guidance, and patience were all instrumental to my growth as a scientist. He welcomed my ideas, encouraged my independence, and challenged me to think critically. He taught me to never be afraid of the unknown, inspired me to not be discouraged by unexpected results, and educated me on proper scientific rhetoric. For all of this and more, I thank you. Secondly, I would like to thank the members of my research supervisory committee, Dr. Beverly Orser and Dr. Patrick McGowan for their expert feedback. They both were instrumental to the development and progression of my project. Additionally, I would like to thank the members of my defense committee, Dr. Martin Post, Dr. Robert Levitan, and Dr. Andrea Jurisicova for their thoughtful questions of my research. Third, I would like to thank Alice Kostaki, the lab manager for the Matthews Lab. Her vast knowledge and experience was an invaluable resource; I could always rely on Alice to help me brainstorm, troubleshoot, and answer questions that I had asked her ten times over. Her unique sense of humor and unmistakable laugh always lifted the mood and made for some unforgettable lunchtime conversations. And of course, thank you for all of the candy. Fourth, I would like to thank the members of the Matthews lab with whom I shared my time in the lab with. Alex Mouratidis introduced me to the lab and performed the animal work for this study; I cherish his mentorship, and more importantly, his friendship. I was fortunate enough to be desk mates with Liz Eng; I could always turn to her for her encouragement and advice, be that for science, fitness, or skincare. Andrada Naghi and I began our graduate studies together but I ended up learning so much from her; she taught me to care about what really matters, to appreciate the outdoors, and most importantly, how to be myself. I would also like to thank Tam Lye, Dr. Hiro Hamada, Dr. Guinever Imperio, Dr. Aya Sasaki, Abigail Lee, and Bona Kim for their feedback, support, and friendship during my time at the lab. Fifth, I would like to thank recent alumni of the Matthews lab: Dr. Vasilis Moisiadis, Dr. Andrea Costantinof, Mohsen Javam, and Maria Sqapi for their help and friendship. Sixth, I would like to thank the members of GASP council of 2016/2017 and 2017/2018. While there are too many of you to name, some of my most cherished memories of graduate school are from my time on GASP, and I know I have made friendships that will last for a lifetime. Seventh, I would like to thank Anna Roy and Anita Yen. Thank you for picking me back up when I was down; your friendship means the world to me. Eighth, I would like to thank the Department of Physiology, members of administration, and the Faculty of Medicine at UofT. My time in graduate school was facilitated by how well organized the department and program was. iii Finally, I would like to thank my parents, Chandan and Mithu Sarkar. As a child, you instilled in me the value of learning, and made such great sacrifices to provide me with opportunities to further my education. This past year was the most difficult year of my life and without your support, trust, and continuous encouragement, this accomplishment would not have been possible. When I could not walk, you carried me. When I could not eat, you fed me. And when I could not keep going, you made me. This thesis is dedicated to you and I hope to continue to make you proud. iv Table of Contents ACKNOWLEDGMENTS ............................................................................................................................................... III TABLE OF CONTENTS .................................................................................................................................................. V 1.0.0 INTRODUCTION 1.1 CLINICAL SIGNIFICANCE OF SGC TREATMENT IN FETUS ..................................................................... 1 1.1.1 MATERNAL CORTISOL PHYSIOLOGY ............................................................................................................ 1 1.1.2 SYNTHETIC GLUCOCORTICOIDS (SGC) : MECHANISMS, USES, AND EFFICACY ................................................ 4 1.2.0 OXIDATIVE DAMAGE – CELLULAR PERSPECTIVE ................................................................................. 6 1.2.1 ROS – PHYSIOLOGICAL ROLE ..................................................................................................................... 6 1.2.2 ANTIOXIDANT ENZYMES ............................................................................................................................ 7 1.2.3 OXIDATIVE DAMAGE (MARKERS) ............................................................................................................... 8 1.2.4 OXIDATIVE STRESS PROGRESSION............................................................................................................... 9 1.3.0 CLINICAL SIGNIFICANCE OF OXIDATIVE DAMAGE IN UTERO .......................................................10 1.3.1 NORMAL PREGNANCY - BASELINE ROS .................................................................................................... 10 1.3.2 ROS LEADING TO PREGNANCY COMPLICATIONS......................................................................................... 11 1.3.3 LONG-TERM OUTCOMES LATER IN THE LIFE OF THE CHILD .......................................................................... 13 1.4.0 ESTABLISHING MECHANISM BETWEEN GC AND OXIDATIVE STRESS – IN VITRO .................16 1.5.0 EFFECTS OF GC ON OXIDATIVE STRESS, IN VIVO .................................................................................18 1.6.0 EFFECTS OF PRENATAL GC ON OXIDATIVE STRESS IN FETUS/ LATER OUTCOMES IN LIFE ..............................................................................................................................................................................................20 FIGURE 1.1 CELLULAR OXIDATIVE STRESS .....................................................................................................23 2.0.0 OBJECTIVES, RATIONALE, AND HYPOTHESIS 2.1 OBJECTIVE: ..............................................................................................................................................................24 2.2 RATIONALE: .............................................................................................................................................................24 2.2.1 BRAIN – HIPPOCAMPUS ............................................................................................................................ 24 2.2.2 PLACENTA ............................................................................................................................................... 25 2.2.3 FETAL LIVER ............................................................................................................................................ 26 2.3 HYPOTHESIS .............................................................................................................................................................27 3.0.0 METHODS 3.1 ANIMAL PROTOCOL ..............................................................................................................................................28 3.2 QUANTITATIVE REAL-TIME PCR (QRT-PCR) ..............................................................................................29 3.2.1 PRIMER DESIGN, STANDARDS, EFFICIENCY ................................................................................................. 29 3.2.2 TISSUE PREPARATION, RNA EXTRACTION AND CDNA CONVERSION ........................................................... 30 3.2.3 PCR, HOUSEKEEPING GENES,
Load more

Recommended publications
  • (ER) Membrane Contact Sites (MCS) Uses Toxic Waste to Deliver Messages Edgar Djaha Yoboue1, Roberto Sitia1 and Thomas Simmen2
    Yoboue et al. Cell Death and Disease (2018) 9:331 DOI 10.1038/s41419-017-0033-4 Cell Death & Disease REVIEW ARTICLE Open Access Redox crosstalk at endoplasmic reticulum (ER) membrane contact sites (MCS) uses toxic waste to deliver messages Edgar Djaha Yoboue1, Roberto Sitia1 and Thomas Simmen2 Abstract Many cellular redox reactions housed within mitochondria, peroxisomes and the endoplasmic reticulum (ER) generate hydrogen peroxide (H2O2) and other reactive oxygen species (ROS). The contribution of each organelle to the total cellular ROS production is considerable, but varies between cell types and also over time. Redox-regulatory enzymes are thought to assemble at a “redox triangle” formed by mitochondria, peroxisomes and the ER, assembling “redoxosomes” that sense ROS accumulations and redox imbalances. The redoxosome enzymes use ROS, potentially toxic by-products made by some redoxosome members themselves, to transmit inter-compartmental signals via chemical modifications of downstream proteins and lipids. Interestingly, important components of the redoxosome are ER chaperones and oxidoreductases, identifying ER oxidative protein folding as a key ROS producer and controller of the tri-organellar membrane contact sites (MCS) formed at the redox triangle. At these MCS, ROS accumulations could directly facilitate inter-organellar signal transmission, using ROS transporters. In addition, ROS influence the flux 2+ 2+ of Ca ions, since many Ca handling proteins, including inositol 1,4,5 trisphosphate receptors (IP3Rs), SERCA pumps or regulators of the mitochondrial Ca2+ uniporter (MCU) are redox-sensitive. Fine-tuning of these redox and ion signaling pathways might be difficult in older organisms, suggesting a dysfunctional redox triangle may accompany 1234567890 1234567890 the aging process.
    [Show full text]
  • SUPPLEMENTARY DATA Supplementary Figure 1. The
    SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary
    [Show full text]
  • GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis Giovanni C
    REVIEW GPX4 www.proteomics-journal.com GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis Giovanni C. Forcina and Scott J. Dixon* formation of toxic radicals (e.g., R-O•).[5] Oxygen is necessary for aerobic metabolism but can cause the harmful The eight mammalian GPX proteins fall oxidation of lipids and other macromolecules. Oxidation of cholesterol and into three clades based on amino acid phospholipids containing polyunsaturated fatty acyl chains can lead to lipid sequence similarity: GPX1 and GPX2; peroxidation, membrane damage, and cell death. Lipid hydroperoxides are key GPX3, GPX5, and GPX6; and GPX4, GPX7, and GPX8.[6] GPX1–4 and 6 (in intermediates in the process of lipid peroxidation. The lipid hydroperoxidase humans) are selenoproteins that contain glutathione peroxidase 4 (GPX4) converts lipid hydroperoxides to lipid an essential selenocysteine in the enzyme + alcohols, and this process prevents the iron (Fe2 )-dependent formation of active site, while GPX5, 6 (in mouse and toxic lipid reactive oxygen species (ROS). Inhibition of GPX4 function leads to rats), 7, and 8 use an active site cysteine lipid peroxidation and can result in the induction of ferroptosis, an instead. Unlike other family members, GPX4 (PHGPx) can act as a phospholipid iron-dependent, non-apoptotic form of cell death. This review describes the hydroperoxidase to reduce lipid perox- formation of reactive lipid species, the function of GPX4 in preventing ides to lipid alcohols.[7,8] Thus,GPX4ac- oxidative lipid damage, and the link between GPX4 dysfunction, lipid tivity is essential to maintain lipid home- oxidation, and the induction of ferroptosis. ostasis in the cell, prevent the accumula- tion of toxic lipid ROS and thereby block the onset of an oxidative, iron-dependent, non-apoptotic mode of cell death termed 1.
    [Show full text]
  • Catalysis of Peroxide Reduction by Fast Reacting Protein Thiols Focus Review †,‡ †,‡ ‡,§ ‡,§ ∥ Ari Zeida, Madia Trujillo, Gerardo Ferrer-Sueta, Ana Denicola, Darío A
    Review Cite This: Chem. Rev. 2019, 119, 10829−10855 pubs.acs.org/CR Catalysis of Peroxide Reduction by Fast Reacting Protein Thiols Focus Review †,‡ †,‡ ‡,§ ‡,§ ∥ Ari Zeida, Madia Trujillo, Gerardo Ferrer-Sueta, Ana Denicola, Darío A. Estrin, and Rafael Radi*,†,‡ † ‡ § Departamento de Bioquímica, Centro de Investigaciones Biomedicaś (CEINBIO), Facultad de Medicina, and Laboratorio de Fisicoquímica Biologica,́ Facultad de Ciencias, Universidad de la Republica,́ 11800 Montevideo, Uruguay ∥ Departamento de Química Inorganica,́ Analítica y Química-Física and INQUIMAE-CONICET, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, 2160 Buenos Aires, Argentina ABSTRACT: Life on Earth evolved in the presence of hydrogen peroxide, and other peroxides also emerged before and with the rise of aerobic metabolism. They were considered only as toxic byproducts for many years. Nowadays, peroxides are also regarded as metabolic products that play essential physiological cellular roles. Organisms have developed efficient mechanisms to metabolize peroxides, mostly based on two kinds of redox chemistry, catalases/peroxidases that depend on the heme prosthetic group to afford peroxide reduction and thiol-based peroxidases that support their redox activities on specialized fast reacting cysteine/selenocysteine (Cys/Sec) residues. Among the last group, glutathione peroxidases (GPxs) and peroxiredoxins (Prxs) are the most widespread and abundant families, and they are the leitmotif of this review. After presenting the properties and roles of different peroxides in biology, we discuss the chemical mechanisms of peroxide reduction by low molecular weight thiols, Prxs, GPxs, and other thiol-based peroxidases. Special attention is paid to the catalytic properties of Prxs and also to the importance and comparative outlook of the properties of Sec and its role in GPxs.
    [Show full text]
  • Characterization of Cytosolic Glutathione Peroxidase And
    Aquatic Toxicology 130–131 (2013) 97–111 Contents lists available at SciVerse ScienceDirect Aquatic Toxicology jou rnal homepage: www.elsevier.com/locate/aquatox Characterization of cytosolic glutathione peroxidase and phospholipid-hydroperoxide glutathione peroxidase genes in rainbow trout (Oncorhynchus mykiss) and their modulation by in vitro selenium exposure a a b a d c a,∗ D. Pacitti , T. Wang , M.M. Page , S.A.M. Martin , J. Sweetman , J. Feldmann , C.J. Secombes a Scottish Fish Immunology Research Centre, Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen AB24 2TZ, United Kingdom b Integrative and Environmental Physiology, Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen AB24 2TZ, United Kingdom c Trace Element Speciation Laboratory, Department of Chemistry, University of Aberdeen, Aberdeen AB24 3UE, United Kingdom d Alltech Biosciences Centre, Sarney, Summerhill Rd, Dunboyne, Country Meath, Ireland a r t i c l e i n f o a b s t r a c t Article history: Selenium (Se) is an oligonutrient with both essential biological functions and recognized harmful effects. Received 4 July 2012 As the selenocysteine (SeCys) amino acid, selenium is integrated in several Se-containing proteins Received in revised form (selenoproteins), many of which are fundamental for cell homeostasis. Nevertheless, selenium may exert 19 December 2012 toxic effects at levels marginally above those required, mainly through the generation of reactive oxygen Accepted 20 December 2012 species (ROS). The selenium chemical speciation can strongly affect the bioavailability of this metal and its impact on metabolism, dictating the levels that can be beneficial or detrimental towards an organism.
    [Show full text]
  • Molecular Characterization, Protein–Protein Interaction Network, and Evolution of Four Glutathione Peroxidases from Tetrahymena Thermophila
    antioxidants Article Molecular Characterization, Protein–Protein Interaction Network, and Evolution of Four Glutathione Peroxidases from Tetrahymena thermophila Diana Ferro 1,2, Rigers Bakiu 3 , Sandra Pucciarelli 4, Cristina Miceli 4 , Adriana Vallesi 4 , Paola Irato 5 and Gianfranco Santovito 5,* 1 BIO5 Institute, University of Arizona, Tucson, AZ 85719, USA; [email protected] 2 Department of Pediatrics, Children’s Mercy Hospital and Clinics, Kansas City, MO 64108, USA 3 Department of Aquaculture and Fisheries, Agricultural University of Tirana, 1000 Tiranë, Albania; [email protected] 4 School of Biosciences and Veterinary Medicine, University of Camerino, 62032 Camerino, Italy; [email protected] (S.P.); [email protected] (C.M.); [email protected] (A.V.) 5 Department of Biology, University of Padova, 35131 Padova, Italy; [email protected] * Correspondence: [email protected] Received: 6 September 2020; Accepted: 1 October 2020; Published: 2 October 2020 Abstract: Glutathione peroxidases (GPxs) form a broad family of antioxidant proteins essential for maintaining redox homeostasis in eukaryotic cells. In this study, we used an integrative approach that combines bioinformatics, molecular biology, and biochemistry to investigate the role of GPxs in reactive oxygen species detoxification in the unicellular eukaryotic model organism Tetrahymena thermophila. Both phylogenetic and mechanistic empirical model analyses provided indications about the evolutionary relationships among the GPXs of Tetrahymena and the orthologous enzymes of phylogenetically related species. In-silico gene characterization and text mining were used to predict the functional relationships between GPxs and other physiologically-relevant processes. The GPx genes contain conserved transcriptional regulatory elements in the promoter region, which suggest that transcription is under tight control of specialized signaling pathways.
    [Show full text]
  • Involvement of Glutathione Peroxidases in the Occurrence And
    Zhang et al. J Transl Med (2020) 18:247 https://doi.org/10.1186/s12967-020-02420-x Journal of Translational Medicine REVIEW Open Access Involvement of glutathione peroxidases in the occurrence and development of breast cancers Man‑Li Zhang1†, Hua‑Tao Wu2†, Wen‑Jia Chen1,3, Ya Xu1, Qian‑Qian Ye1,3, Jia‑Xin Shen4 and Jing Liu1,3* Abstract Glutathione peroxidases (GPxs) belong to a family of enzymes that is important in organisms; these enzymes pro‑ mote hydrogen peroxide metabolism and protect cell membrane structure and function from oxidative damage. Based on the establishment and development of the theory of the pathological roles of free radicals, the role of GPxs has gradually attracted researchers’ attention, and the involvement of GPxs in the occurrence and development of malignant tumors has been shown. On the other hand, the incidence of breast cancer in increasing, and breast cancer has become the leading cause of cancer‑related death in females worldwide; breast cancer is thought to be related to the increased production of reactive oxygen species, indicating the involvement of GPxs in these processes. Therefore, this article focused on the molecular mechanism and function of GPxs in the occurrence and development of breast cancer to understand their role in breast cancer and to provide a new theoretical basis for the treatment of breast cancer. Keywords: Glutathione peroxidase, Breast cancer, Reactive oxygen species, Occurrence Background [4]. However, the mechanisms of the occurrence, devel- Breast cancer has become the most common cancer and opment, and metastasis of breast cancer are very com- the leading cause of cancer-related deaths in females plicated and overlap, suggesting the necessity of diferent worldwide, according to a status report on the global therapies to treat diferent subtypes of breast cancer.
    [Show full text]
  • Transcript and Protein Analysis Reveals Better Survival Skills of Monocyte-Derived Dendritic Cells Compared to Monocytes During Oxidative Stress
    Transcript and Protein Analysis Reveals Better Survival Skills of Monocyte-Derived Dendritic Cells Compared to Monocytes during Oxidative Stress Ilse Van Brussel1*, Dorien M. Schrijvers2, Wim Martinet2, Isabel Pintelon3, Maartje Deschacht4, Kathy Schnorbusch3, Louis Maes4, Johan M. Bosmans1,5, Christiaan J. Vrints1,5, Dirk Adriaensen3, Paul Cos4, Hidde Bult6 1 Laboratory of Cellular and Molecular Cardiology, University of Antwerp, Wilrijk, Antwerp, Belgium, 2 Laboratory of Physiopharmacology, University of Antwerp, Wilrijk, Antwerp, Belgium, 3 Laboratory of Cell Biology and Histology, University of Antwerp, Antwerp, Antwerp, Belgium, 4 Laboratory of Microbiology, Parasitology and Hygiene (LMPH), University of Antwerp, Wilrijk, Antwerp, Belgium, 5 Department of Cardiology, University Hospital of Antwerp, Edegem, Antwerp, Belgium, 6 Laboratory of Pharmacology, University of Antwerp, Wilrijk, Antwerp, Belgium Abstract Background: Dendritic cells (DCs), professional antigen-presenting cells with the unique ability to initiate primary T-cell responses, are present in atherosclerotic lesions where they are exposed to oxidative stress that generates cytotoxic reactive oxygen species (ROS). A large body of evidence indicates that cell death is a major modulating factor of atherogenesis. We examined antioxidant defence systems of human monocyte-derived (mo)DCs and monocytes in response to oxidative stress. Methods: Oxidative stress was induced by addition of tertiary-butylhydroperoxide (tert-BHP, 30 min). Cellular responses were evaluated using flow cytometry and confocal live cell imaging (both using 5-(and-6)-chloromethyl-2,7- dichlorodihydrofluorescein diacetate, CM-H2DCFDA). Viability was assessed by the neutral red assay. Total RNA was extracted for a PCR profiler array. Five genes were selected for confirmation by Taqman gene expression assays, and by immunoblotting or immunohistochemistry for protein levels.
    [Show full text]
  • Looking Back at the Early Times of Redox Biology Author: Leopold Flohé
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 26 October 2020 doi:10.20944/preprints202010.0511.v1 1 Title: Looking back at the early times of redox biology Author: Leopold Flohé Affiliations: Dipartimento di Medicina Molecolare, Università degli Studi di Padova, v.le G. Colombo 3, 35121 Padova (Italy) and Departamento de Bioquímica, Universidad de la República, Avda. General Flores 2125, 11800 Montevideo (Uruguay) E-mail: [email protected] Abstract: The beginnings of redox biology are recalled with special emphasis on formation, metabolism and function of reactive oxygen and nitrogen species in mammalian systems. The review covers the early history of heme peroxidases and the metabolism of hydrogen peroxide, the discovery of selenium as integral part of glutathione peroxidases, which expanded the scope of the field to other hydroperoxides including lipid hydroperoxide, the discovery of superoxide dismutases and superoxide radicals in biological systems and their role in host defense, tissue damage, metabolic regulation and signaling, the identification of the endothelial-derived relaxing factor as the nitrogen monoxide radical and its physiological and pathological implications. The article highlights the perception of hydrogen peroxide and other hydroperoxides as signaling molecules, which marks the beginning of the flourishing fields of redox regulation and redox signaling. Final comments describe the development of the redox language. In the 18th and 19th century, it was highly individualized and hard to translate into modern terminology. In the 20th century, the redox language co-developed with the chemical terminology and became clearer. More recently, the introduction and inflationary use of poorly defined terms has unfortunately impaired the understanding of redox events in biological systems.
    [Show full text]
  • Antioxidant Enzymes Haplotypes and Polymorphisms Associated with Obesity in Mexican Children
    antioxidants Article Antioxidant Enzymes Haplotypes and Polymorphisms Associated with Obesity in Mexican Children Paula Costa-Urrutia 1 , Aline Mariana Flores-Buendía 1,2, Iván Ascencio-Montiel 3, Jacqueline Solares-Tlapechco 1, Omar Noel Medina-Campos 2 , José Pedraza-Chaverri 2 , Julio Granados 4, Angélica Saraí Jiménez-Osorio 1,* and Martha Eunice Rodríguez-Arellano 1,* 1 Laboratorio de Medicina Genómica, Hospital Regional Lic. Adolfo López Mateos, ISSSTE, Ciudad de Mexico 01030, Mexico; [email protected] (P.C.-U.); alinefl[email protected] (A.M.F.-B.); [email protected] (J.S.-T.) 2 Departamento de Biología, Facultad de Química, Universidad Nacional Autónoma de Mexico, Ciudad de Mexico 04510, Mexico; [email protected] (O.N.M.-C.); [email protected] (J.P.-C.) 3 Coordinación de Vigilancia de Epidemiología, Instituto Mexicano de Seguro Social, 120 Mier y Pesado Street, del Valle Benito Juárez, Ciudad de Mexico 03100, Mexico; [email protected] 4 División de Inmunogenética, Departamento de Trasplantes, Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán, Ciudad de Mexico 14080, Mexico; [email protected] * Correspondence: [email protected] (A.S.J.-O.); [email protected] (M.E.R.-A.) Received: 8 June 2020; Accepted: 14 July 2020; Published: 1 August 2020 Abstract: Obesity is a major health problem worldwide and constitutes a sanitary emergency in Mexico, especially childhood obesity. Several studies have proved the relationship between obesity and oxidative stress and the influence of genetic predisposition. This work was aimed to analyze the association of antioxidant enzyme polymorphisms with overweight and obesity in Mexican children and adolescents.
    [Show full text]
  • Emerging Roles for Non-Selenium Containing ER-Resident Glutathione
    Biol. Chem. 2021; 402(3): 271–287 Review Katalin Buday and Marcus Conrad* Emerging roles for non-selenium containing ER-resident glutathione peroxidases in cell signaling and disease https://doi.org/10.1515/hsz-2020-0286 Introduction Received August 17, 2020; accepted October 8, 2020; published online October 22, 2020 Maintenance of redox homeostasis is essential for preventing the oxidative damage of biological molecules such as proteins, Abstract: Maintenance of cellular redox control is pivotal lipids and DNA (Poli et al. 2004). The insufficient elimination of for normal cellular functions and cell fate decisions reactive oxygen species (ROS) may trigger cell death and as including cell death. Among the key cellular redox systems such might be a detrimental factor to human health and life- in mammals, the glutathione peroxidase (GPX) family of span (Navarro-Yepes et al. 2014; Valko et al. 2007). Up until proteins is the largest conferring multifaceted functions now, a number of diseases have been directly linked with and affecting virtually all cellular processes. The endo- dysregulated redox homeostasis, including cancer, neurolog- plasmic reticulum (ER)-resident GPXs, designated as GPX7 ical disorders, cardiovascular diseases, obesity and metabolic and GPX8, are the most recently added members of this diseases, as well as aging (Sayre et al. 2001; Valko et al. 2006, family of enzymes. Recent studies have provided exciting 2007). To counterbalance the level of ROS, mammals have insights how both enzymes support critical processes of the evolved a complex ROS scavenging system consisting of ER including oxidative protein folding, maintenance of ER diverseenzymes,suchascatalase(CAT),superoxidedismut- redox control by eliminating H2O2, and preventing palmitic ase (SOD), thioredoxin reductases (TXNRD) and glutathione acid-induced lipotoxicity.
    [Show full text]
  • GPX7 Antibody (Clone 2704) Mouse Monoclonal Antibody Catalog # ALS11859
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 GPX7 Antibody (clone 2704) Mouse Monoclonal Antibody Catalog # ALS11859 Specification GPX7 Antibody (clone 2704) - Product Information Application IHC Primary Accession Q96SL4 Reactivity Human Host Mouse Clonality Monoclonal Calculated MW 21kDa KDa GPX7 Antibody (clone 2704) - Additional Information Gene ID 2882 Anti-GPX7 antibody IHC of human liver. Other Names Glutathione peroxidase 7, GPx-7, GSHPx-7, GPX7 Antibody (clone 2704) - Background 1.11.1.9, CL683, GPX7, GPX6 It protects esophageal epithelia from Target/Specificity hydrogen peroxide- induced oxidative stress. It Human GPX7 suppresses acidic bile acid-induced reactive oxigen species (ROS) and protects against Reconstitution & Storage Long term: -70°C; Short term: -70°C oxidative DNA damage and double-strand breaks. Precautions GPX7 Antibody (clone 2704) is for research GPX7 Antibody (clone 2704) - References use only and not for use in diagnostic or therapeutic procedures. Gu S.,et al.Submitted (NOV-2000) to the EMBL/GenBank/DDBJ databases. Clark H.F.,et al.Genome Res. GPX7 Antibody (clone 2704) - Protein Information 13:2265-2270(2003). Ota T.,et al.Nat. Genet. 36:40-45(2004). Gregory S.G.,et al.Nature 441:315-321(2006). Name GPX7 Barrow I.K.-P.,et al.Submitted (AUG-1998) to the EMBL/GenBank/DDBJ databases. Synonyms GPX6 Function It protects esophageal epithelia from hydrogen peroxide- induced oxidative stress. It suppresses acidic bile acid-induced reactive oxigen species (ROS) and protects against oxidative DNA damage and double-strand breaks. Cellular Location Secreted. Page 1/2 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 Tissue Location Expressed in esophageal epithelial cells; expression is up-regulated after exposure to acidic bile acids GPX7 Antibody (clone 2704) - Protocols Provided below are standard protocols that you may find useful for product applications.
    [Show full text]