DOCSLIB.ORG

Protein Disulfide Isomerase and Glutathione Are Alternative

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Protein Disulfide Isomerase and Glutathione Are Alternative Biochimica et Biophysica Acta 1830 (2013) 3846–3857 Contents lists available at SciVerse ScienceDirect Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbagen Protein disulfide isomerase and glutathione are alternative substrates in the one Cys catalytic cycle of glutathione peroxidase 7 Valentina Bosello-Travain a, Marcus Conrad b, Giorgio Cozza c, Alessandro Negro c, Silvia Quartesan a, Monica Rossetto a, Antonella Roveri a, Stefano Toppo a, Fulvio Ursini a, Mattia Zaccarin a, Matilde Maiorino a,⁎ a Department of Molecular Medicine, University of Padova, Viale G. Colombo, 3, I-35121-Padua, Italy b Institute of Developmental Genetics, Deutsches Zentrum für Neurodegenerative Erkrankungen and Helmholtz Zentrum München, Ingolstädter Landstrasse 1, D-85764 Munich-Neuherberg, Germany c Department of Biomedical Sciences, University of Padova, Viale G. Colombo, 3, I-35121-Padua, Italy article info abstract Article history: Background: Mammalian GPx7 is a monomeric glutathione peroxidase of the endoplasmic reticulum (ER), Received 15 November 2012 containing a Cys redox center (CysGPx). Although containing a peroxidatic Cys (CP) it lacks the resolving Received in revised form 11 February 2013 Cys (CR), that confers fast reactivity with thioredoxin (Trx) or related proteins to most other CysGPxs. Accepted 19 February 2013 Methods: Reducing substrate specificity and mechanism were addressed by steady-state kinetic analysis of wild Available online 27 February 2013 type or mutated mouse GPx7. The enzymes were heterologously expressed as a synuclein fusion to overcome limited expression. Phospholipid hydroperoxide was the oxidizing substrate. Enzyme–substrate and protein– Keywords: protein interaction were analyzed by molecular docking and surface plasmon resonance analysis. Kinetics 3 −1 −1 ′ Glutathione peroxidase Results: Oxidation of the CP is fast (k+1 >10 M s ), however the rate of reduction by GSH is slow (k +2 = −1 −1 Peroxide 12.6 M s ) even though molecular docking indicates a strong GSH–GPx7 interaction. Instead, the oxidized 3 −1 −1 Redox switch CP can be reduced at a fast rate by human protein disulfide isomerase (HsPDI) (k+1 >10 M s ), but not by Redoxin Trx. By surface plasmon resonance analysis, a KD =5.2μM was calculated for PDI–GPx7 complex. Participation of an alternative non-canonical CR in the peroxidatic reaction was ruled out. Specific activity measurements in the presence of physiological reducing substrate concentration, suggest substrate competition in vivo. Conclusions: GPx7 is an unusual CysGPx catalyzing the peroxidatic cycle by a one Cys mechanism in which GSH and PDI are alternative substrates. General significance: In the ER, the emerging physiological role of GPx7 is oxidation of PDI, modulated by the amount of GSH. © 2013 Elsevier B.V. All rights reserved. 1. Introduction Selenoperoxidases (SecGPxs) are typical of vertebrates. The catalytic moiety selenium is incorporated as selenocysteine, the ‘peroxidatic’ Non-heme peroxidases include two non-homolog families that have selenocysteine, UP- in the growing peptide chain [2].Themembersof in common the typical thioredoxin (Trx) fold and ping-pong catalytic this subfamily encompass both monomeric and tetrameric members, mechanism. Thus, glutathione peroxidases (GPxs), using either seleni- typically using glutathione (GSH) as the electron donor. Kinetics sug- um or sulfur as their redox center, and peroxiredoxins (Prdxs), which gested that the UP selenol, upon oxidation by a hydroperoxide (ROOH), only use sulfur in their redox centers [1], have major similarities. is oxidized to selenenic acid (Eq. (1)), in turn reacting with GSH and forming a mixed seleno-disulfide (Eq. (2)). The latter is reduced by a sec- ond GSH, releasing GSSG and regenerating the catalyst (Eq. (3)) [3,4]: Abbreviations: CysGPxs, subfamily of glutathione peroxidases containing a Cys redox center; 1CysGPx, a glutathione peroxidase containing the CP only; 2CysGPxs, glutathione ROOH þ HSe⋯ðÞSecGPx →ROH þ HOSe⋯ðÞSecGPx ð1Þ peroxidases containing both the CP and the CR;CP, peroxidatic Cys; CR, resolving Cys; GPx7, glutathione peroxidase 7; ER, endoplasmic reticulum; GSH, reduced glutathione; GSH þ HOSe⋯ðÞSecGPx →H O þ GS–Se⋯ðÞSecGPx ð2Þ GSSG, oxidized glutathione; GPxs, glutathione peroxidases; PDI, protein disulfide isomer- 2 ase; PCOOH, phosphatidylcholine hydroperoxide; Prdxs, peroxiredoxins; ROOH, hydro- peroxide; Sec, Selenocysteine; SecGPxs, subfamily of glutathione peroxidases containing GSH þ GS–Se⋯ðÞSecGPx →GSSG þ HSe⋯ðÞSecGPx : ð3Þ a Sec redox center; Syn, synuclein; Trx, thioredoxin; TrxR, thioredoxin reductase; UP, peroxidatic Selenocysteine In contrast, in invertebrates and the plant kingdom, the sub-family ⁎ Corresponding author at: Department of Molecular Medicine, Viale G. Colombo 3, I-35121 Padova, Italy. Tel.: +39 049 8276103; fax: +39 049 8073310. of sulfur-containing peroxidases (CysGPxs) encompasses almost ex- E-mail address: [email protected] (M. Maiorino). clusively monomeric proteins containing a peroxidatic Cys residue 0304-4165/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.bbagen.2013.02.017 V. Bosello-Travain et al. / Biochimica et Biophysica Acta 1830 (2013) 3846–3857 3847 (Cp) in place of the UP. Here the CP is accompanied by an intra-chain Cys residue located within the so-called ‘Cys block’ (Fig. 1), within the α4 helix of the thioredoxin fold. This second Cys participates in the re- action as the ‘resolving Cys’ (CR). Hence invertebrate and plant CysGPxs can be referred to as ‘2CysGPxs’. The CR endows reactivity with some redoxins, i.e. the Trx or Trx-related proteins, while muta- tion of the CR, abolishes the peroxidase activity [5]. The reaction mechanism of invertebrate and plant 2CysGPxs is sim- Briefly, in 2CysGPx and atypical Prdx, an intra-chain disulfide in- ilar to that of atypical Prdxs [1,6].TheCP, oxidized to the sulfenic acid derivative upon reaction with ROOH, reacts with the C ,toforman termediate is produced upon reaction with the hydroperoxide that R fi intra-chain disulfide (Eqs. (4) and (5)). This disulfide intermediate is re- is then ef ciently reduced by the CXXC motif of the redoxin. In the duced by a CXXC motif of the redoxin in two steps: the N-terminal Cys peroxidases relying on Sec catalysis, typically lacking the CR, the reac- tion with the hydroperoxide generates a selenenic acid intermediate, of the CXXC motif attaches the CR of the peroxidase forming a mixed di- sulfide (Eq. (6)), which is displaced by the C-terminal Cys of the CXXC which is reduced by GSH in two steps. This, seemingly, descends from motif of the redoxin (Eq. (7)) [5,7]: the peculiar reactivity of selenium. The recent discovery of rare Prdxs and GPxs, containing the CP but missing the CR residue, hence referred to as 1CysPrdx and 1CysGPxs, challenges this paradigm. þ ⋯ðÞ⋯ → þ ⋯ðÞ⋯ ð Þ ROOH HS CPCysGPxCR SH ROH HOS CPCysGPxCR SH 4 In mammalian cells, two monomeric 1CysGPxs (GPx7 and GPx8) have been described in endoplasmic reticulum (ER) [8,9]. Phylogeny suggests that they represent a branch in the evolution of the monomeric SecGPx4. Given that the common ancestor of GPxs is a Cys-containing enzyme, the evolution of GPx7 and GPx8 from SecGPx4 indicates a re- cent, intriguing reversion to usage of Cys in the catalytic center [10]. Fig. 1. Alignment of different GPx7 homologues with other GPxs. Human GPx1 and 4 have been taken as examples for SecGPxs, Drosophila melanogaster GPx and yeast GPx3 for 2CysGPxs. The peroxidatic residue of GPxs (either Cys or Sec) is indicated by an arrow. The ‘Cys block’ within the α4 helix of the dimer interface, where the CR is usually located in the 2CysGPxs, is indicated. Note that the CR is present in the DmGPx and the yeast GPx3 sequences only. The putative signal peptide, the conserved PCNQF motif, and the ER retention sequence of GPx7 are boxed. Accession numbers are the following: NP_056511.2, for human GPx7 (HsGPx7); NP_077160.1, for Mus musculus GPx7 (MmGPx7); NP_001088904.1, for Xenopus laevis GPx7 (X. laevis GPx7); AAF47761.1, for the GPx of Drosophila melanogaster (DmGPx); P40581.1, for yeast GPx3; NP_000572.2, for human GPx1 (HsGPx1). Sequence identity score between HsGPx7 and MmGPx7 is 90%. 3848 V. Bosello-Travain et al. / Biochimica et Biophysica Acta 1830 (2013) 3846–3857 According to the above paradigm both, GPx7 and GPx8 are was induced by adding 1 mM isopropyl-b-D-thiogalactopyranoside expected to not accept electrons from a redoxin. Yet, it has been re- (IPTG) and cells were harvested after 3 h by centrifugation at 5000 ×g cently suggested that they react faster with protein disulfide isomer- for 30 min. The pellet was stored at −80 °C for no longer than one ase (PDI) and other PDI family members, than GSH [9]. In that study week or immediately lysed. For lysis, bacterial pellets obtained from however, the assay with PDI was carried out in the presence of GSH, 1 l of culture were suspended by 30 ml of cold lysis buffer (0.1 M thus preventing the precise assessment of the actual capability of Tris–HCl, pH 7.4, 5% Nonidet, 0.15 M KCl, 0.1% Triton X-100, 3 mM the peroxidase to use PDI directly as a reducing substrate. Moreover, GSH containing protease inhibitors (–0.1 mg/ml PMSF, 0.7 mg/ml an unrealistically low second order rate constant, deduced from the pepsatin, 0.5 mg/ml leupeptin – for 15 min at 4 °C, under slow agita- specific activity, was reported. In this study, we specifically address tion. After centrifugation at 29,000 ×g for 30 min at 4 °C, the superna- the analysis of the kinetics of the catalytic cycle of GPx7, aiming to tant was immediately used as enzyme source for activity/kinetic get information on the rate constant of the oxidative and reductive analysis. Protein was quantified by the Bradford assay [12]. steps of the cycle that are relevant for gaining an insight into the Quantitation of (Syn)GPx7 or (Syn)GPx7C85A within the 29,000 ×g physiological function of the enzyme.
Load more

Recommended publications
  • (ER) Membrane Contact Sites (MCS) Uses Toxic Waste to Deliver Messages Edgar Djaha Yoboue1, Roberto Sitia1 and Thomas Simmen2
    Yoboue et al. Cell Death and Disease (2018) 9:331 DOI 10.1038/s41419-017-0033-4 Cell Death & Disease REVIEW ARTICLE Open Access Redox crosstalk at endoplasmic reticulum (ER) membrane contact sites (MCS) uses toxic waste to deliver messages Edgar Djaha Yoboue1, Roberto Sitia1 and Thomas Simmen2 Abstract Many cellular redox reactions housed within mitochondria, peroxisomes and the endoplasmic reticulum (ER) generate hydrogen peroxide (H2O2) and other reactive oxygen species (ROS). The contribution of each organelle to the total cellular ROS production is considerable, but varies between cell types and also over time. Redox-regulatory enzymes are thought to assemble at a “redox triangle” formed by mitochondria, peroxisomes and the ER, assembling “redoxosomes” that sense ROS accumulations and redox imbalances. The redoxosome enzymes use ROS, potentially toxic by-products made by some redoxosome members themselves, to transmit inter-compartmental signals via chemical modifications of downstream proteins and lipids. Interestingly, important components of the redoxosome are ER chaperones and oxidoreductases, identifying ER oxidative protein folding as a key ROS producer and controller of the tri-organellar membrane contact sites (MCS) formed at the redox triangle. At these MCS, ROS accumulations could directly facilitate inter-organellar signal transmission, using ROS transporters. In addition, ROS influence the flux 2+ 2+ of Ca ions, since many Ca handling proteins, including inositol 1,4,5 trisphosphate receptors (IP3Rs), SERCA pumps or regulators of the mitochondrial Ca2+ uniporter (MCU) are redox-sensitive. Fine-tuning of these redox and ion signaling pathways might be difficult in older organisms, suggesting a dysfunctional redox triangle may accompany 1234567890 1234567890 the aging process.
    [Show full text]
  • SUPPLEMENTARY DATA Supplementary Figure 1. The
    SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary
    [Show full text]
  • GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis Giovanni C
    REVIEW GPX4 www.proteomics-journal.com GPX4 at the Crossroads of Lipid Homeostasis and Ferroptosis Giovanni C. Forcina and Scott J. Dixon* formation of toxic radicals (e.g., R-O•).[5] Oxygen is necessary for aerobic metabolism but can cause the harmful The eight mammalian GPX proteins fall oxidation of lipids and other macromolecules. Oxidation of cholesterol and into three clades based on amino acid phospholipids containing polyunsaturated fatty acyl chains can lead to lipid sequence similarity: GPX1 and GPX2; peroxidation, membrane damage, and cell death. Lipid hydroperoxides are key GPX3, GPX5, and GPX6; and GPX4, GPX7, and GPX8.[6] GPX1–4 and 6 (in intermediates in the process of lipid peroxidation. The lipid hydroperoxidase humans) are selenoproteins that contain glutathione peroxidase 4 (GPX4) converts lipid hydroperoxides to lipid an essential selenocysteine in the enzyme + alcohols, and this process prevents the iron (Fe2 )-dependent formation of active site, while GPX5, 6 (in mouse and toxic lipid reactive oxygen species (ROS). Inhibition of GPX4 function leads to rats), 7, and 8 use an active site cysteine lipid peroxidation and can result in the induction of ferroptosis, an instead. Unlike other family members, GPX4 (PHGPx) can act as a phospholipid iron-dependent, non-apoptotic form of cell death. This review describes the hydroperoxidase to reduce lipid perox- formation of reactive lipid species, the function of GPX4 in preventing ides to lipid alcohols.[7,8] Thus,GPX4ac- oxidative lipid damage, and the link between GPX4 dysfunction, lipid tivity is essential to maintain lipid home- oxidation, and the induction of ferroptosis. ostasis in the cell, prevent the accumula- tion of toxic lipid ROS and thereby block the onset of an oxidative, iron-dependent, non-apoptotic mode of cell death termed 1.
    [Show full text]
  • Catalysis of Peroxide Reduction by Fast Reacting Protein Thiols Focus Review †,‡ †,‡ ‡,§ ‡,§ ∥ Ari Zeida, Madia Trujillo, Gerardo Ferrer-Sueta, Ana Denicola, Darío A
    Review Cite This: Chem. Rev. 2019, 119, 10829−10855 pubs.acs.org/CR Catalysis of Peroxide Reduction by Fast Reacting Protein Thiols Focus Review †,‡ †,‡ ‡,§ ‡,§ ∥ Ari Zeida, Madia Trujillo, Gerardo Ferrer-Sueta, Ana Denicola, Darío A. Estrin, and Rafael Radi*,†,‡ † ‡ § Departamento de Bioquímica, Centro de Investigaciones Biomedicaś (CEINBIO), Facultad de Medicina, and Laboratorio de Fisicoquímica Biologica,́ Facultad de Ciencias, Universidad de la Republica,́ 11800 Montevideo, Uruguay ∥ Departamento de Química Inorganica,́ Analítica y Química-Física and INQUIMAE-CONICET, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, 2160 Buenos Aires, Argentina ABSTRACT: Life on Earth evolved in the presence of hydrogen peroxide, and other peroxides also emerged before and with the rise of aerobic metabolism. They were considered only as toxic byproducts for many years. Nowadays, peroxides are also regarded as metabolic products that play essential physiological cellular roles. Organisms have developed efficient mechanisms to metabolize peroxides, mostly based on two kinds of redox chemistry, catalases/peroxidases that depend on the heme prosthetic group to afford peroxide reduction and thiol-based peroxidases that support their redox activities on specialized fast reacting cysteine/selenocysteine (Cys/Sec) residues. Among the last group, glutathione peroxidases (GPxs) and peroxiredoxins (Prxs) are the most widespread and abundant families, and they are the leitmotif of this review. After presenting the properties and roles of different peroxides in biology, we discuss the chemical mechanisms of peroxide reduction by low molecular weight thiols, Prxs, GPxs, and other thiol-based peroxidases. Special attention is paid to the catalytic properties of Prxs and also to the importance and comparative outlook of the properties of Sec and its role in GPxs.
    [Show full text]
  • Characterization of Cytosolic Glutathione Peroxidase And
    Aquatic Toxicology 130–131 (2013) 97–111 Contents lists available at SciVerse ScienceDirect Aquatic Toxicology jou rnal homepage: www.elsevier.com/locate/aquatox Characterization of cytosolic glutathione peroxidase and phospholipid-hydroperoxide glutathione peroxidase genes in rainbow trout (Oncorhynchus mykiss) and their modulation by in vitro selenium exposure a a b a d c a,∗ D. Pacitti , T. Wang , M.M. Page , S.A.M. Martin , J. Sweetman , J. Feldmann , C.J. Secombes a Scottish Fish Immunology Research Centre, Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen AB24 2TZ, United Kingdom b Integrative and Environmental Physiology, Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen AB24 2TZ, United Kingdom c Trace Element Speciation Laboratory, Department of Chemistry, University of Aberdeen, Aberdeen AB24 3UE, United Kingdom d Alltech Biosciences Centre, Sarney, Summerhill Rd, Dunboyne, Country Meath, Ireland a r t i c l e i n f o a b s t r a c t Article history: Selenium (Se) is an oligonutrient with both essential biological functions and recognized harmful effects. Received 4 July 2012 As the selenocysteine (SeCys) amino acid, selenium is integrated in several Se-containing proteins Received in revised form (selenoproteins), many of which are fundamental for cell homeostasis. Nevertheless, selenium may exert 19 December 2012 toxic effects at levels marginally above those required, mainly through the generation of reactive oxygen Accepted 20 December 2012 species (ROS). The selenium chemical speciation can strongly affect the bioavailability of this metal and its impact on metabolism, dictating the levels that can be beneficial or detrimental towards an organism.
    [Show full text]
  • Molecular Characterization, Protein–Protein Interaction Network, and Evolution of Four Glutathione Peroxidases from Tetrahymena Thermophila
    antioxidants Article Molecular Characterization, Protein–Protein Interaction Network, and Evolution of Four Glutathione Peroxidases from Tetrahymena thermophila Diana Ferro 1,2, Rigers Bakiu 3 , Sandra Pucciarelli 4, Cristina Miceli 4 , Adriana Vallesi 4 , Paola Irato 5 and Gianfranco Santovito 5,* 1 BIO5 Institute, University of Arizona, Tucson, AZ 85719, USA; [email protected] 2 Department of Pediatrics, Children’s Mercy Hospital and Clinics, Kansas City, MO 64108, USA 3 Department of Aquaculture and Fisheries, Agricultural University of Tirana, 1000 Tiranë, Albania; [email protected] 4 School of Biosciences and Veterinary Medicine, University of Camerino, 62032 Camerino, Italy; [email protected] (S.P.); [email protected] (C.M.); [email protected] (A.V.) 5 Department of Biology, University of Padova, 35131 Padova, Italy; [email protected] * Correspondence: [email protected] Received: 6 September 2020; Accepted: 1 October 2020; Published: 2 October 2020 Abstract: Glutathione peroxidases (GPxs) form a broad family of antioxidant proteins essential for maintaining redox homeostasis in eukaryotic cells. In this study, we used an integrative approach that combines bioinformatics, molecular biology, and biochemistry to investigate the role of GPxs in reactive oxygen species detoxification in the unicellular eukaryotic model organism Tetrahymena thermophila. Both phylogenetic and mechanistic empirical model analyses provided indications about the evolutionary relationships among the GPXs of Tetrahymena and the orthologous enzymes of phylogenetically related species. In-silico gene characterization and text mining were used to predict the functional relationships between GPxs and other physiologically-relevant processes. The GPx genes contain conserved transcriptional regulatory elements in the promoter region, which suggest that transcription is under tight control of specialized signaling pathways.
    [Show full text]
  • Involvement of Glutathione Peroxidases in the Occurrence And
    Zhang et al. J Transl Med (2020) 18:247 https://doi.org/10.1186/s12967-020-02420-x Journal of Translational Medicine REVIEW Open Access Involvement of glutathione peroxidases in the occurrence and development of breast cancers Man‑Li Zhang1†, Hua‑Tao Wu2†, Wen‑Jia Chen1,3, Ya Xu1, Qian‑Qian Ye1,3, Jia‑Xin Shen4 and Jing Liu1,3* Abstract Glutathione peroxidases (GPxs) belong to a family of enzymes that is important in organisms; these enzymes pro‑ mote hydrogen peroxide metabolism and protect cell membrane structure and function from oxidative damage. Based on the establishment and development of the theory of the pathological roles of free radicals, the role of GPxs has gradually attracted researchers’ attention, and the involvement of GPxs in the occurrence and development of malignant tumors has been shown. On the other hand, the incidence of breast cancer in increasing, and breast cancer has become the leading cause of cancer‑related death in females worldwide; breast cancer is thought to be related to the increased production of reactive oxygen species, indicating the involvement of GPxs in these processes. Therefore, this article focused on the molecular mechanism and function of GPxs in the occurrence and development of breast cancer to understand their role in breast cancer and to provide a new theoretical basis for the treatment of breast cancer. Keywords: Glutathione peroxidase, Breast cancer, Reactive oxygen species, Occurrence Background [4]. However, the mechanisms of the occurrence, devel- Breast cancer has become the most common cancer and opment, and metastasis of breast cancer are very com- the leading cause of cancer-related deaths in females plicated and overlap, suggesting the necessity of diferent worldwide, according to a status report on the global therapies to treat diferent subtypes of breast cancer.
    [Show full text]
  • Transcript and Protein Analysis Reveals Better Survival Skills of Monocyte-Derived Dendritic Cells Compared to Monocytes During Oxidative Stress
    Transcript and Protein Analysis Reveals Better Survival Skills of Monocyte-Derived Dendritic Cells Compared to Monocytes during Oxidative Stress Ilse Van Brussel1*, Dorien M. Schrijvers2, Wim Martinet2, Isabel Pintelon3, Maartje Deschacht4, Kathy Schnorbusch3, Louis Maes4, Johan M. Bosmans1,5, Christiaan J. Vrints1,5, Dirk Adriaensen3, Paul Cos4, Hidde Bult6 1 Laboratory of Cellular and Molecular Cardiology, University of Antwerp, Wilrijk, Antwerp, Belgium, 2 Laboratory of Physiopharmacology, University of Antwerp, Wilrijk, Antwerp, Belgium, 3 Laboratory of Cell Biology and Histology, University of Antwerp, Antwerp, Antwerp, Belgium, 4 Laboratory of Microbiology, Parasitology and Hygiene (LMPH), University of Antwerp, Wilrijk, Antwerp, Belgium, 5 Department of Cardiology, University Hospital of Antwerp, Edegem, Antwerp, Belgium, 6 Laboratory of Pharmacology, University of Antwerp, Wilrijk, Antwerp, Belgium Abstract Background: Dendritic cells (DCs), professional antigen-presenting cells with the unique ability to initiate primary T-cell responses, are present in atherosclerotic lesions where they are exposed to oxidative stress that generates cytotoxic reactive oxygen species (ROS). A large body of evidence indicates that cell death is a major modulating factor of atherogenesis. We examined antioxidant defence systems of human monocyte-derived (mo)DCs and monocytes in response to oxidative stress. Methods: Oxidative stress was induced by addition of tertiary-butylhydroperoxide (tert-BHP, 30 min). Cellular responses were evaluated using flow cytometry and confocal live cell imaging (both using 5-(and-6)-chloromethyl-2,7- dichlorodihydrofluorescein diacetate, CM-H2DCFDA). Viability was assessed by the neutral red assay. Total RNA was extracted for a PCR profiler array. Five genes were selected for confirmation by Taqman gene expression assays, and by immunoblotting or immunohistochemistry for protein levels.
    [Show full text]
  • Looking Back at the Early Times of Redox Biology Author: Leopold Flohé
    Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 26 October 2020 doi:10.20944/preprints202010.0511.v1 1 Title: Looking back at the early times of redox biology Author: Leopold Flohé Affiliations: Dipartimento di Medicina Molecolare, Università degli Studi di Padova, v.le G. Colombo 3, 35121 Padova (Italy) and Departamento de Bioquímica, Universidad de la República, Avda. General Flores 2125, 11800 Montevideo (Uruguay) E-mail: [email protected] Abstract: The beginnings of redox biology are recalled with special emphasis on formation, metabolism and function of reactive oxygen and nitrogen species in mammalian systems. The review covers the early history of heme peroxidases and the metabolism of hydrogen peroxide, the discovery of selenium as integral part of glutathione peroxidases, which expanded the scope of the field to other hydroperoxides including lipid hydroperoxide, the discovery of superoxide dismutases and superoxide radicals in biological systems and their role in host defense, tissue damage, metabolic regulation and signaling, the identification of the endothelial-derived relaxing factor as the nitrogen monoxide radical and its physiological and pathological implications. The article highlights the perception of hydrogen peroxide and other hydroperoxides as signaling molecules, which marks the beginning of the flourishing fields of redox regulation and redox signaling. Final comments describe the development of the redox language. In the 18th and 19th century, it was highly individualized and hard to translate into modern terminology. In the 20th century, the redox language co-developed with the chemical terminology and became clearer. More recently, the introduction and inflationary use of poorly defined terms has unfortunately impaired the understanding of redox events in biological systems.
    [Show full text]
  • Antioxidant Enzymes Haplotypes and Polymorphisms Associated with Obesity in Mexican Children
    antioxidants Article Antioxidant Enzymes Haplotypes and Polymorphisms Associated with Obesity in Mexican Children Paula Costa-Urrutia 1 , Aline Mariana Flores-Buendía 1,2, Iván Ascencio-Montiel 3, Jacqueline Solares-Tlapechco 1, Omar Noel Medina-Campos 2 , José Pedraza-Chaverri 2 , Julio Granados 4, Angélica Saraí Jiménez-Osorio 1,* and Martha Eunice Rodríguez-Arellano 1,* 1 Laboratorio de Medicina Genómica, Hospital Regional Lic. Adolfo López Mateos, ISSSTE, Ciudad de Mexico 01030, Mexico; [email protected] (P.C.-U.); alinefl[email protected] (A.M.F.-B.); [email protected] (J.S.-T.) 2 Departamento de Biología, Facultad de Química, Universidad Nacional Autónoma de Mexico, Ciudad de Mexico 04510, Mexico; [email protected] (O.N.M.-C.); [email protected] (J.P.-C.) 3 Coordinación de Vigilancia de Epidemiología, Instituto Mexicano de Seguro Social, 120 Mier y Pesado Street, del Valle Benito Juárez, Ciudad de Mexico 03100, Mexico; [email protected] 4 División de Inmunogenética, Departamento de Trasplantes, Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán, Ciudad de Mexico 14080, Mexico; [email protected] * Correspondence: [email protected] (A.S.J.-O.); [email protected] (M.E.R.-A.) Received: 8 June 2020; Accepted: 14 July 2020; Published: 1 August 2020 Abstract: Obesity is a major health problem worldwide and constitutes a sanitary emergency in Mexico, especially childhood obesity. Several studies have proved the relationship between obesity and oxidative stress and the influence of genetic predisposition. This work was aimed to analyze the association of antioxidant enzyme polymorphisms with overweight and obesity in Mexican children and adolescents.
    [Show full text]
  • Emerging Roles for Non-Selenium Containing ER-Resident Glutathione
    Biol. Chem. 2021; 402(3): 271–287 Review Katalin Buday and Marcus Conrad* Emerging roles for non-selenium containing ER-resident glutathione peroxidases in cell signaling and disease https://doi.org/10.1515/hsz-2020-0286 Introduction Received August 17, 2020; accepted October 8, 2020; published online October 22, 2020 Maintenance of redox homeostasis is essential for preventing the oxidative damage of biological molecules such as proteins, Abstract: Maintenance of cellular redox control is pivotal lipids and DNA (Poli et al. 2004). The insufficient elimination of for normal cellular functions and cell fate decisions reactive oxygen species (ROS) may trigger cell death and as including cell death. Among the key cellular redox systems such might be a detrimental factor to human health and life- in mammals, the glutathione peroxidase (GPX) family of span (Navarro-Yepes et al. 2014; Valko et al. 2007). Up until proteins is the largest conferring multifaceted functions now, a number of diseases have been directly linked with and affecting virtually all cellular processes. The endo- dysregulated redox homeostasis, including cancer, neurolog- plasmic reticulum (ER)-resident GPXs, designated as GPX7 ical disorders, cardiovascular diseases, obesity and metabolic and GPX8, are the most recently added members of this diseases, as well as aging (Sayre et al. 2001; Valko et al. 2006, family of enzymes. Recent studies have provided exciting 2007). To counterbalance the level of ROS, mammals have insights how both enzymes support critical processes of the evolved a complex ROS scavenging system consisting of ER including oxidative protein folding, maintenance of ER diverseenzymes,suchascatalase(CAT),superoxidedismut- redox control by eliminating H2O2, and preventing palmitic ase (SOD), thioredoxin reductases (TXNRD) and glutathione acid-induced lipotoxicity.
    [Show full text]
  • GPX7 Antibody (Clone 2704) Mouse Monoclonal Antibody Catalog # ALS11859
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 GPX7 Antibody (clone 2704) Mouse Monoclonal Antibody Catalog # ALS11859 Specification GPX7 Antibody (clone 2704) - Product Information Application IHC Primary Accession Q96SL4 Reactivity Human Host Mouse Clonality Monoclonal Calculated MW 21kDa KDa GPX7 Antibody (clone 2704) - Additional Information Gene ID 2882 Anti-GPX7 antibody IHC of human liver. Other Names Glutathione peroxidase 7, GPx-7, GSHPx-7, GPX7 Antibody (clone 2704) - Background 1.11.1.9, CL683, GPX7, GPX6 It protects esophageal epithelia from Target/Specificity hydrogen peroxide- induced oxidative stress. It Human GPX7 suppresses acidic bile acid-induced reactive oxigen species (ROS) and protects against Reconstitution & Storage Long term: -70°C; Short term: -70°C oxidative DNA damage and double-strand breaks. Precautions GPX7 Antibody (clone 2704) is for research GPX7 Antibody (clone 2704) - References use only and not for use in diagnostic or therapeutic procedures. Gu S.,et al.Submitted (NOV-2000) to the EMBL/GenBank/DDBJ databases. Clark H.F.,et al.Genome Res. GPX7 Antibody (clone 2704) - Protein Information 13:2265-2270(2003). Ota T.,et al.Nat. Genet. 36:40-45(2004). Gregory S.G.,et al.Nature 441:315-321(2006). Name GPX7 Barrow I.K.-P.,et al.Submitted (AUG-1998) to the EMBL/GenBank/DDBJ databases. Synonyms GPX6 Function It protects esophageal epithelia from hydrogen peroxide- induced oxidative stress. It suppresses acidic bile acid-induced reactive oxigen species (ROS) and protects against oxidative DNA damage and double-strand breaks. Cellular Location Secreted. Page 1/2 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 Tissue Location Expressed in esophageal epithelial cells; expression is up-regulated after exposure to acidic bile acids GPX7 Antibody (clone 2704) - Protocols Provided below are standard protocols that you may find useful for product applications.
    [Show full text]