DOCSLIB.ORG

Somatic Hybrids Between Arabidopsis Thaliana and Cabbage (Brassica Oleracea L.) with All Chromosomes Derived from A

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Somatic Hybrids Between Arabidopsis Thaliana and Cabbage (Brassica Oleracea L.) with All Chromosomes Derived from A J. Japan. Soc. Hort. Sci. 77 (3): 277–282. 2008. Available online at www.jstage.jst.go.jp/browse/jjshs1 JSHS © 2008 Somatic Hybrids between Arabidopsis thaliana and Cabbage (Brassica oleracea L.) with all Chromosomes Derived from A. thaliana and Low Levels of Fertile Seed Hiroshi Yamagishi*, Shinya Nakagawa, Daisuke Kinoshita, Atsushi Ishibashi and Yoko Yamashita Department of Biotechnology, Kyoto Sangyo University, Kamigamo, Kyoto 603-8555, Japan We obtained somatic hybrids between Arabidopsis thaliana Columbia, and a cabbage variety, ‘Chusei Succession’ (Brassica oleracea L.), in addition to our previous success using the cabbage variety ‘Fujiwase’. All hybrids of the two combinations possessed the chloroplast genome of cabbage, while the mitochondrial genome was recombined. PCR primers specific to each of the five chromosomes of A. thaliana were designed and used to analyze the hybrids. It was found that the hybrids had all five chromosomes of A. thaliana. Somatic hybrids between Columbia and ‘Chusei Succession’ flowered and showed extremely low pollen fertility, producing no seeds by spontaneous self-fertilization, whereas seeds were obtained by crosses between somatic hybrids and three cultivars of B. oleracea. The seeds could be useful materials for the transfer of genes of A. thaliana to cabbage and to establish cabbage lines with novel mitochondrial genomes. Key Words: Arabidopsis thaliana, Brassica oleracea (cabbage), chromosomes, seed fertility, somatic hybrids. and Mathias, 1995; Siemens and Sacristán, 1995), most Introduction failed to obtain offspring. The single exception was the Arabidopsis thaliana has been utilized worldwide as hybrids between UV-irradiated A. thaliana and non- a model plant in plant genetics and molecular biology. treated Brassica napus produced by Forsberg et al. Especially after the accomplishment of genome (1998a, b). Because the hybrids produced seeds by back- sequencing projects (The Arabidopsis Genome Initiative, crossing with B. napus, progenies were selected for 2000), genome information of A. thaliana accelerated resistance to Leptoshaeria maculans to use for breeding comparative genomics for genetic mapping and the B. napus (Bohman et al., 2002). One reason for the identification of various useful genes in related species scarcity of research work on cell fusion using A. thaliana (Lan et al., 2000; Sillito et al., 2000), whereas attempts is that the protoplast culture and regeneration of plants to use the genes clarified in the A. thaliana genome for are much more difficult in A. thaliana than in other breeding crop plants are restricted in spite of the fact plants. Another reason is that A. thaliana belongs to a that A. thaliana is a member of family Brassicaceae to different tribe (Sisymbrieae) from Brassiceae, which which many useful crops belong. One main reason is contains many crops cultivated around the world, even that A. thaliana can not be cross-hybridized with any though they are in the same family. crops. The only method to obtain hybrids between However, an efficient protoplast culture system for A. thaliana and crop plants is cell fusion. A. thaliana was established (Yamagishi et al., 2002), by Gleba and Hoffmann (1980) had the first success in which more than a 50% shoot regeneration rate was producing Arabidobrassica, somatic hybrids between achieved. Using this system, we produced successfully A. thaliana and Brassica campestris, but the hybrids somatic hybrids with B. napus (Yamagishi et al., 2002), neither established as plants nor produced progenies. Raphanus sativus (Yamagishi and Glimelius, 2003), and Though a few groups reported asymmetric somatic Brassica oleracea (Yamagishi and Nakagawa, 2004). hybrids thereafter (Bauer-Weston et al., 1993; O’Neill Among them, hybrids with R. sativus and B. oleracea were the first reports of these combinations. Furthermore, Received; December 21, 2007. Accepted; February 12, 2008. although UV treatment was used with B. napus to obtain * Corresponding author (E-mail: [email protected]). asymmetric hybrids in the cell fusion with B. napus 277 278 H. Yamagishi, S. Nakagawa, D. Kinoshita, A. Ishibashi and Y. Yamashita (Yamagishi et al., 2002) for the purpose of overcoming cell fusion treatment were as described in the previous the phylogenetic remoteness, somatic hybrids were paper (Yamagishi and Nakagawa, 2004). The fused produced without such treatment in the two latter protoplasts were cultured under the same media and combinations (Yamagishi and Glimelius, 2003; culture conditions as mentioned in Yamagishi and Yamagishi and Nakagawa, 2004). Nakagawa (2004). In the previous paper we reported somatic hybrids between A. thaliana Columbia and cabbage variety Investigations of the genome structure of somatic hybrids B. oleracea ‘Fujiwase’ (Yamagishi and Nakagawa, Because various kinds of PCR primers to detect the 2004). Although the hybrids are growing in a glasshouse, chloroplast and mitochondrial genomes were designed they have not flowered yet, and progenies have not been and utilized previously (Yamagishi and Glimelius, 2003; obtained. Thus, in order to increase hybrid materials, Yamagishi and Nakagawa, 2004), we applied them also somatic hybrids using another cultivar of cabbage to the somatic hybrids obtained here. For the chloroplast ‘Chusei Succession’ were produced. The hybrids are genome, two intergenic regions of trnF and ndhJ, and expected to be useful as breeding materials for cabbage trnH and psbA were studied, while PCR patterns were by introducing genes from A. thaliana. DNA markers investigated in atp1 and coxI regions for the mitochon- for each of the five chromosomes of A. thaliana were drial genome. On the other hand, for the nucleus genome, designed and their presence in the hybrids was only polymorphisms in the Tpi gene were examined investigated by PCR. Furthermore, because the hybrids previously by PCR (Yamagishi and Nakagawa, 2004), of Columbia and ‘Chusei Succession’ flowered, flower and it was not clarified whether the hybrids had all five morphology and pollen fertility were observed. The chromosomes of A. thaliana. Thus, DNA markers hybrids were crossed with B. oleracea as pollen parents, specific to each of the five A. thaliana chromosomes and seed fertility was examined. were designed. The chromosomes, gene names deposited in the databases (EMBL etc.), and the sequences of the Materials and Methods primers for PCRs are shown in Table 1. Using these Plant materials for cell fusion and the regeneration of primers, the PCR patterns of hybrids were compared somatic hybrids with those of the parents. The ecotype Columbia of A. thaliana and the cabbage variety ‘Chusei Succession’ (Nihon Nosan, Japan) were Cross hybridization of somatic hybrids with B. oleracea used for cell fusion. Both parental species were cultured The somatic hybrids of Columbia and ‘Fujiwase’ aseptically and protoplasts were isolated from hypocotyls continued vegetative growth and did not flower. On the and leaves of 2-week-old seedlings of A. thaliana, other hand, somatic hybrids of Columbia and ‘Chusei whereas true leaves were used for protoplast isolation Succession’ were propagated by meristem culture, and in the cabbage. The enzymes, isolation procedure, and the hybrid plants grew to the flowering stage, thus, the Table 1. PCR primers and their sequences used to detect the five chromosomes of A. thaliana. Chromosome Gene name Primer Sequence (5'→3') IF10A5.13F1 GGAGGAGAAATCCAAGTCAAG R2 CTGTGTTCCTGCAAGCTTGT IF17F8.14F2 GCTCAGCAACCATATCATGC R1 CAAGCCTACTCTCTGAGATCC II F16P2 F1 TGGATTCTCTCGTTGAATCCG R2 GTCGAGCAATGCATTTTCCCT II T20F21 F1 GGAACAAAGCAGAGTTCAACG R2 CCATTGAGTTATATGCCCCG III F15B8.130 F2 ACATACAACACCTGATGGACGT R1 CTGTTCCATTAGATCGTCGAG III MXC7.10 F1 CCAACTACTGTCACGAAGAAG R2 AAGCTCATAACTGACACCTC IV F18A5.110 F1 TGAAAGGGCTTCCTGGTATG R2 GTACCATCATCTGTCTGGAAC IV T12G13 F1 GGATATGCAGGCATGTACATC R2 GCTATGAGAAGACGGCAATG V MZN1.16 F1 AAGCGATGGCTGCTTATAAGG R2 TCACTTACACTATCGCTGACTC VMQD19.17F1 GATAGCTCTGAGACTCACTTAG R2 TGGTAAAACCCACACCATGA J. Japan. Soc. Hort. Sci. 77 (3): 277–282. 2008. 279 flower morphology and pollen fertility of the latter regeneration and hybrid plant establishment was hybrids were observed. Pollen fertility was determined improved. by counting the pollen stained with acetocarmine using a microscope. For each plant, more than 500 pollen Presence of the five chromosomes of A. thaliana in grains were observed; thereafter, the hybrid plants were somatic hybrids crossed with three cultivars of B. oleracea, ‘Fujiwase’ As mentioned previously, we developed PCR markers (Cabbage; B. oleracea var. capitata), ‘Kairan’ for various sites in the chloroplast and mitochondrial (B. oleracea var. alboglabra), and ‘Purple Bird’ genomes (Yamagishi and Nakagawa, 2004), and these (Kohlrabi; B. oleracea var. gongylodes). In the crosses, markers were tested in somatic hybrids, which showed B. oleracea plants were used as the pollen parents. The the identical characteristics to those of hybrids between number of seeds were counted after maturation. Columbia and ‘Fujiwase’. Namely, the two somatic hybrid plants of Columbia and ‘Chusei Succession’ Results possessed only the chloroplast genome derived from the Regeneration of somatic hybrids between Columbia and cabbage parent, while they had hybrid traits in the ‘Chusei Succession’ mitochondrial genome. The PCR patterns of the hybrids After fusion treatment of the protoplasts isolated from and their parents are shown in Table 3 and Figure 1. Columbia and ‘Chusei Succession’,
Load more

Recommended publications
  • Arabidopsis Thaliana
    Downloaded from genome.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press RESEARCH A Physical Map of Chromosome 2 of Arabidopsis thaliana Eve Ann Zachgo, 2,4 Ming Li Wang, 1'2'4 Julia Dewdney, 1'2 David Bouchez, 3 Christine Carnilleri, 3 Stephen Belmonte, 2 Lu Huang, 2 Maureen Dolan, 2 and Howard M. Goodman 1'2'5 1Department of Genetics, Harvard Medical School and 2Department of Molecular Biology, Massachusetts General Hospital, Boston, Massachusetts 02114; 3Laboratoire de Biologie Cellulaire, Institut National de la Recherche Agronomique (INRA), 78026 Versailles CEDEX, France A yeast artificial chromosome (YAC] physical map of chromosome 2 of Arabidopsis thaliana has been constructed by hybridization of 69 DNA markers and 61 YAC end probes to gridded arrays of YAC clones. Thirty-four YACs in four contigs define the chromosome. Complete closure of the map was not attained because some regions of the chromosome were repetitive or were not represented in the YAC library. Based on the sizes of the YACs and their coverage of the chromosome, the length of chromosome 2 is estimated to be at least 18 Mb. These data provide the means for immediately identifying the YACs containing a genetic locus mapped on Arabidopsis chromosome 2. The small flowering plant Arabidopsis thaliana is ters (Maluszynska and Heslop-Harrison 1991; A1- an excellent model system for metabolic, genetic, bini 1994; Copenhaver et al. 1995). We present and developmental studies in plants. Its haploid here a YAC contig physical map of chromosome nuclear genome is small (-100 Mb), consisting of 2 of A.
    [Show full text]
  • Phylogenetic Position and Generic Limits of Arabidopsis (Brassicaceae)
    PHYLOGENETIC POSITION Steve L. O'Kane, Jr.2 and Ihsan A. 3 AND GENERIC LIMITS OF Al-Shehbaz ARABIDOPSIS (BRASSICACEAE) BASED ON SEQUENCES OF NUCLEAR RIBOSOMAL DNA1 ABSTRACT The primary goals of this study were to assess the generic limits and monophyly of Arabidopsis and to investigate its relationships to related taxa in the family Brassicaceae. Sequences of the internal transcribed spacer region (ITS-1 and ITS-2) of nuclear ribosomal DNA, including 5.8S rDNA, were used in maximum parsimony analyses to construct phylogenetic trees. An attempt was made to include all species currently or recently included in Arabidopsis, as well as species suggested to be close relatives. Our ®ndings show that Arabidopsis, as traditionally recognized, is polyphyletic. The genus, as recircumscribed based on our results, (1) now includes species previously placed in Cardaminopsis and Hylandra as well as three species of Arabis and (2) excludes species now placed in Crucihimalaya, Beringia, Olimar- abidopsis, Pseudoarabidopsis, and Ianhedgea. Key words: Arabidopsis, Arabis, Beringia, Brassicaceae, Crucihimalaya, ITS phylogeny, Olimarabidopsis, Pseudoar- abidopsis. Arabidopsis thaliana (L.) Heynh. was ®rst rec- netic studies and has played a major role in un- ommended as a model plant for experimental ge- derstanding the various biological processes in netics over a half century ago (Laibach, 1943). In higher plants (see references in Somerville & Mey- recent years, many biologists worldwide have fo- erowitz, 2002). The intraspeci®c phylogeny of A. cused their research on this plant. As indicated by thaliana has been examined by Vander Zwan et al. Patrusky (1991), the widespread acceptance of A. (2000). Despite the acceptance of A.
    [Show full text]
  • Biogeography and Diversification of Brassicales
    Molecular Phylogenetics and Evolution 99 (2016) 204–224 Contents lists available at ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev Biogeography and diversification of Brassicales: A 103 million year tale ⇑ Warren M. Cardinal-McTeague a,1, Kenneth J. Sytsma b, Jocelyn C. Hall a, a Department of Biological Sciences, University of Alberta, Edmonton, Alberta T6G 2E9, Canada b Department of Botany, University of Wisconsin, Madison, WI 53706, USA article info abstract Article history: Brassicales is a diverse order perhaps most famous because it houses Brassicaceae and, its premier mem- Received 22 July 2015 ber, Arabidopsis thaliana. This widely distributed and species-rich lineage has been overlooked as a Revised 24 February 2016 promising system to investigate patterns of disjunct distributions and diversification rates. We analyzed Accepted 25 February 2016 plastid and mitochondrial sequence data from five gene regions (>8000 bp) across 151 taxa to: (1) Available online 15 March 2016 produce a chronogram for major lineages in Brassicales, including Brassicaceae and Arabidopsis, based on greater taxon sampling across the order and previously overlooked fossil evidence, (2) examine Keywords: biogeographical ancestral range estimations and disjunct distributions in BioGeoBEARS, and (3) determine Arabidopsis thaliana where shifts in species diversification occur using BAMM. The evolution and radiation of the Brassicales BAMM BEAST began 103 Mya and was linked to a series of inter-continental vicariant, long-distance dispersal, and land BioGeoBEARS bridge migration events. North America appears to be a significant area for early stem lineages in the Brassicaceae order. Shifts to Australia then African are evident at nodes near the core Brassicales, which diverged Cleomaceae 68.5 Mya (HPD = 75.6–62.0).
    [Show full text]
  • Coordination of Biradial-To-Radial Symmetry and Tissue Polarity by HD
    ARTICLE https://doi.org/10.1038/s41467-021-24550-6 OPEN Coordination of biradial-to-radial symmetry and tissue polarity by HD-ZIP II proteins ✉ Monica Carabelli1,4, Luana Turchi1, Giorgio Morelli 2, Lars Østergaard 3,5 , Ida Ruberti1,5,6 & ✉ Laila Moubayidin 3,4 Symmetry establishment is a critical process in the development of multicellular organs and requires careful coordination of polarity axes while cells actively divide within tissues. For- 1234567890():,; mation of the apical style in the Arabidopsis gynoecium involves a bilateral-to-radial sym- metry transition, a stepwise process underpinned by the dynamic distribution of the plant morphogen auxin. Here we show that SPATULA (SPT) and the HECATE (HEC) bHLH pro- teins mediate the final step in the style radialisation process and synergistically control the expression of adaxial-identity genes, HOMEOBOX ARABIDOPSIS THALIANA 3 (HAT3) and ARABIDOPSIS THALIANA HOMEOBOX 4 (ATHB4). HAT3/ATHB4 module drives radialisation of the apical style by promoting basal-to-apical auxin flow and via a negative feedback mechanism that finetune auxin distribution through repression of SPT expression and cyto- kinin sensitivity. Thus, this work reveals the molecular basis of axes-coordination and hor- monal cross-talk during the sequential steps of symmetry transition in the Arabidopsis style. 1 Institute of Molecular Biology and Pathology, National Research Council, Rome, Italy. 2 Research Centre for Genomics and Bioinformatics, Council for Agricultural Research and Economics (CREA), Rome, Italy. 3 Department of Crop Genetics, John Innes Centre, Norwich, UK. 4These authors contributed ✉ equally: Monica Carabelli, Laila Moubayidin. 5These authors jointly supervised this work: Lars Østergaard, Ida Ruberti.
    [Show full text]
  • CRISPR/Cas9-Mediated Knockout of HOS1 Reveals Its Role in the Regulation of Secondary Metabolism in Arabidopsis Thaliana
    plants Article CRISPR/Cas9-Mediated Knockout of HOS1 Reveals Its Role in the Regulation of Secondary Metabolism in Arabidopsis thaliana Yury Shkryl * , Yulia Yugay, Tatiana Avramenko, Valeria Grigorchuk, Tatiana Gorpenchenko, Olga Grischenko and Victor Bulgakov Federal Scientific Center of the East Asia Terrestrial Biodiversity, Far Eastern Branch, the Russian Academy of Sciences, 690022 Vladivostok, Russia; [email protected] (Y.Y.); [email protected] (T.A.); [email protected] (V.G.); [email protected] (T.G.); [email protected] (O.G.); [email protected] (V.B.) * Correspondence: [email protected] Abstract: In Arabidopsis, the RING finger-containing E3 ubiquitin ligase HIGH EXPRESSION OF OSMOTICALLY RESPONSIVE GENES 1 (HOS1) functions as a main regulator of the cold signaling. In this study, CRISPR/Cas9-mediated targeted mutagenesis of the HOS1 gene in the first exon was performed. DNA sequencing showed that frameshift indels introduced by genome editing of HOS1 resulted in the appearance of premature stop codons, disrupting the open reading frame. Obtained hos1Cas9 mutant plants were compared with the SALK T-DNA insertion mutant, line hos1-3, in terms of their tolerance to abiotic stresses, accumulation of secondary metabolites and expression levels of genes participating in these processes. Upon exposure to cold stress, enhanced tolerance and expression of cold-responsive genes were observed in both hos1-3 and hos1Cas9 plants. The hos1 mutation caused changes in the synthesis of phytoalexins in transformed cells. The content of glucosinolates (GSLs) was down-regulated by 1.5-times, while flavonol glycosides were up-regulated by 1.2 to 4.2 times in transgenic plants.
    [Show full text]
  • Expression Profiling and Local Adaptation of Boechera Holboellii
    CORE Metadata, citation and similar papers at core.ac.uk Provided by DigitalCommons@CalPoly µBlackwellExpression Publishing Ltd profiling and local adaptation of Boechera holboellii populations for water use efficiency across a naturally occurring water stress gradient CHARLES A. KNIGHT HEIKO VOGEL JUERGEN KROYMANN ALICE SHUMATE HANNEKE WITSENBOER and THOMAS MITCHELL-OLDS Abstract We studied the physiological basis of local adaptation to drought in Boechera holboellii, a perennial relative of Arabidopsis thaliana, and used cDNA–AFLPs to identify candidate genes showing differential expression in these populations. We compared two populations of B. holboellii from contrasting water environments in a reciprocal transplant experiment, as well as in a laboratory dry-down experiment. We continuously measured the water con­ tent of soils using time domain reflectometery (TDR). We compared populations for their water use efficiency (WUE), root/shoot ratios (R:S) and leaf mass per unit area (LMA) in the field and in the laboratory, and identified candidate genes that (i) responded plastically to water stress and (ii) were differentially expressed between the two populations. Genotypes from the drier site had higher WUE, which was attributable to a large reduction in transpi­ rational water loss. The xeric-adapted population also had increased investment in root bio­ mass and greater leaf mass per unit area. Reciprocal transplants in the field had significantly greater survival in their native habitat. In total, 450 cDNA-AFLP fragments showed significant changes between drought and control treatments. Furthermore, some genes showed genotype (population)-specific patterns of up- or down-regulation in response to drought. Three hundred cDNA-AFLP bands were sequenced leading to the identification of cDNAs coding for proteins involved in signal transduction, transcriptional regulation, redox regulation, oxidative stress and pathways involved in stress adaptation.
    [Show full text]
  • Divergence of Annual and Perennial Species in the Brassicaceae and the Contribution of Cis-Acting Variation at FLC Orthologues
    Molecular Ecology (2017) 26, 3437–3457 doi: 10.1111/mec.14084 Divergence of annual and perennial species in the Brassicaceae and the contribution of cis-acting variation at FLC orthologues C. KIEFER,* E. SEVERING,* R. KARL,† S. BERGONZI,‡ M. KOCH,† A. TRESCH*§ and G. COUPLAND* *Max Planck Institute for Plant Breeding Research, Plant Developmental Biology, Carl-von-Linne Weg 10, 50829 Cologne, Germany, †Department of Biodiversity and Plant Systematics, Centre for Organismal Studies, INF 345, 69120 Heidelberg, Germany, ‡Wageningen UR Plant Breeding, Wageningen University and Research Centre, Droevendaalsesteeg 1, 6708 PB, Wageningen, The Netherlands, §Cologne Biocenter, University of Cologne, Zulpicher€ Str. 47b, 50674 Cologne, Germany Abstract Variation in life history contributes to reproductive success in different environments. Divergence of annual and perennial angiosperm species is an extreme example that has occurred frequently. Perennials survive for several years and restrict the duration of reproduction by cycling between vegetative growth and flowering, whereas annuals live for 1 year and flower once. We used the tribe Arabideae (Brassicaceae) to study the divergence of seasonal flowering behaviour among annual and perennial species. In perennial Brassicaceae, orthologues of FLOWERING LOCUS C (FLC), a floral inhibi- tor in Arabidopsis thaliana, are repressed by winter cold and reactivated in spring con- ferring seasonal flowering patterns, whereas in annuals, they are stably repressed by cold. We isolated FLC orthologues from three annual and two perennial Arabis species and found that the duplicated structure of the A. alpina locus is not required for perenniality. The expression patterns of the genes differed between annuals and perennials, as observed among Arabidopsis species, suggesting a broad relevance of these patterns within the Brassicaceae.
    [Show full text]
  • DEVELOPMENT of SYMMETRY in PLANTS A. Hudson
    Annu. Rev. Plant Physiol. Plant Mol. Biol. 2000. 51:349–70 Copyright °c 2000 by Annual Reviews. All rights reserved DEVELOPMENT OF SYMMETRY IN PLANTS A. Hudson Institute of Cell and Molecular Biology, University of Edinburgh, King’s Buildings, Mayfield Road, Edinburgh EH9 3JH United Kingdom; e-mail: [email protected] Key Words asymmetry, axes, embryogenesis, lateral organs, flowers I Abstract Plant development involves specification and elaboration of axes of asymmetry. The apical-basal and inside-outside axes arise in embryogenesis, and are probably oriented maternally. They are maintained during growth post-germination and interact to establish novel axes of asymmetry in flowers and lateral organs (such as leaves). Whereas the genetic control of axis elaboration is now partially understood in embryos, floral meristems, and organs, the underlying mechanisms of axis specifica- tion remain largely obscure. Less functionally significant aspects of plant asymmetry (e.g. the handedness of spiral phyllotaxy) may originate in random events and therefore have no genetic control. CONTENTS WHAT IS SYMMETRY? ........................................... 349 ASYMMETRY IN EMBRYOGENESIS ................................ 350 Apical-Basal (A-B) Asymmetry .................................... 350 Inside-Outside Asymmetry of the Embryo ............................. 354 Bilateral Symmetry of the Embryo ................................... 356 ELABORATION OF ASYMMETRY AFTER EMBRYOGENESIS ............. 359 Phyllotaxy and Translational Symmetry in the Shoot .....................
    [Show full text]
  • ANATOMICAL CHARACTERISTICS and ECOLOGICAL TRENDS in the XYLEM and PHLOEM of BRASSICACEAE and RESEDACAE Fritz Hans Schweingruber
    IAWA Journal, Vol. 27 (4), 2006: 419–442 ANATOMICAL CHARACTERISTICS AND ECOLOGICAL TRENDS IN THE XYLEM AND PHLOEM OF BRASSICACEAE AND RESEDACAE Fritz Hans Schweingruber Swiss Federal Research Institute for Forest, Snow and Landscape, CH-8903 Birmensdorf, Switzerland (= corresponding address) SUMMARY The xylem and phloem of Brassicaceae (116 and 82 species respectively) and the xylem of Resedaceae (8 species) from arid, subtropical and tem- perate regions in Western Europe and North America is described and ana- lysed, compared with taxonomic classifications, and assigned to their ecological range. The xylem of different life forms (herbaceous plants, dwarf shrubs and shrubs) of both families consists of libriform fibres and short, narrow vessels that are 20–50 μm in diameter and have alter- nate vestured pits and simple perforations. The axial parenchyma is para- tracheal and, in most species, the ray cells are exclusively upright or square. Very few Brassicaceae species have helical thickening on the vessel walls, and crystals in fibres. The xylem anatomy of Resedaceae is in general very similar to that of the Brassicaceae. Vestured pits occur only in one species of Resedaceae. Brassicaceae show clear ecological trends: annual rings are usually dis- tinct, except in arid and subtropical lowland zones; semi-ring-porosity decreases from the alpine zone to the hill zone at lower altitude. Plants with numerous narrow vessels are mainly found in the alpine zone. Xylem without rays is mainly present in plants growing in the Alps, both at low and high altitudes. The reaction wood of the Brassicaceae consists primarily of thick-walled fibres, whereas that of the Resedaceae contains gelatinous fibres.
    [Show full text]
  • Arabidopsis Thaliana and Its Wild Relatives: a Model System for Ecology and Evolution
    Review TRENDS in Ecology & Evolution Vol.16 No.12 December 2001 693 Arabidopsis thaliana and its wild relatives: a model system for ecology and evolution Thomas Mitchell-Olds The postgenomics era will bring many changes to ecology and evolution. diploids with eight chromosome pairs. Evolutionary Information about genomic sequence and function provides a new foundation and ecological studies have focused on A. lyrata ssp. for organismal biology. The crucifer Arabidopsis thaliana and its wild relatives lyrata in North America, A. lyrata ssp. petraea and will play an important role in this synthesis of genomics and ecology. We A. halleri in Europe, and A. halleri ssp. gemmifera discuss the need for model systems in ecology, the biology and relationships in Japan. (Earlier literature refers to these taxa as of crucifers, and the molecular resources available for these experiments. The Arabis lyrata, Cardaminopsis petraea, C. halleri scientific potential of this model system is illustrated by several recent studies and Arabis gemmifera, respectively.) Species are in plant–insect interactions, developmental plasticity, comparative genomics interfertile within this group of closely related N = 8 and molecular evolution. taxa. Chromosome number is reduced to N = 5 in A. thaliana, so diploid mapping crosses with wild There is a rich history of field studies on many species relatives are impossible5. However, Arabidopsis in diverse environments in plant ecology and suecica is believed to be an allotetraploid derived from evolution. Molecular methods are sufficiently A. thaliana and A. arenosa. advanced that we can now study the function and Previous taxonomic treatments of Arabis do not evolution of genes that are important in ecology; for constitute a natural classification, because various example, those that control responses to temperature, distantly related species have been included in this drought, pathogens, insects and other environmental grouping2–4, and future taxonomic work is needed in challenges.
    [Show full text]
  • Growth Stage–Based Phenotypic Analysis of Arabidopsis: a Model for High Throughput Functional Genomics in Plants
    The Plant Cell, Vol. 13, 1499–1510, July 2001, www.plantcell.org © 2001 American Society of Plant Biologists GENOMICS ARTICLE Growth Stage–Based Phenotypic Analysis of Arabidopsis: A Model for High Throughput Functional Genomics in Plants Douglas C. Boyes, Adel M. Zayed, Robert Ascenzi, Amy J. McCaskill, Neil E. Hoffman, Keith R. Davis,1 and Jörn Görlach Department of Plant Research, Paradigm Genetics, Inc., Research Triangle Park, North Carolina 27709 With the completion of the Arabidopsis genome sequencing project, the next major challenge is the large-scale deter- mination of gene function. As a model organism for agricultural biotechnology, Arabidopsis presents the opportunity to provide key insights into the way that gene function can affect commercial crop production. In an attempt to aid in the rapid discovery of gene function, we have established a high throughput phenotypic analysis process based on a series of defined growth stages that serve both as developmental landmarks and as triggers for the collection of morphologi- cal data. The data collection process has been divided into two complementary platforms to ensure the capture of de- tailed data describing Arabidopsis growth and development over the entire life of the plant. The first platform characterizes early seedling growth on vertical plates for a period of 2 weeks. The second platform consists of an ex- -months. When combined with parallel pro 2ف tensive set of measurements from plants grown on soil for a period of cesses for metabolic and gene expression profiling, these platforms constitute a core technology in the high throughput determination of gene function. We present here analyses of the development of wild-type Columbia (Col-0) plants and selected mutants to illustrate a framework methodology that can be used to identify and interpret pheno- typic differences in plants resulting from genetic variation and/or environmental stress.
    [Show full text]
  • Recent Speciation of Capsella Rubella from Capsella Grandiflora, Associated with Loss of Self-Incompatibility and an Extreme Bottleneck
    Recent speciation of Capsella rubella from Capsella grandiflora, associated with loss of self-incompatibility and an extreme bottleneck Ya-Long Guoa,1, Jesper S. Bechsgaardb,1, Tanja Slottec, Barbara Neufferd, Martin Lascouxc, Detlef Weigela,2, and Mikkel H. Schierupb,2 aDepartment of Molecular Biology, Max Planck Institute for Developmental Biology, 72076 Tu¨bingen, Germany; bEcology and Genetics, Institute of Biological Sciences, University of Aarhus, 8000 Aarhus C, Denmark; cProgram in Evolutionary Functional Genomics, Uppsala University, 75326 Uppsala, Sweden; and dDepartment of Systematic Botany, University of Osnabru¨ck, 49076 Osnabru¨ck, Germany Edited by Spencer C. H. Barrett, University of Toronto, Toronto, Canada, and accepted by the Editorial Board January 26, 2009 (received for review August 13, 2008) Flowering plants often prevent selfing through mechanisms of thaliana, the work horse for much of plant molecular genetics, self-incompatibility (S.I.). The loss of S.I. has occurred many times has become self-compatible relatively recently, apparently by the independently, because it provides short-term advantages in sit- gradual fixation of multiple, independent mutations that weak- uations where pollinators or mates are rare. The genus Capsella, ened or disabled the S.I. system throughout its geographical which is closely related to Arabidopsis, contains a pair of closely range (15, 16). related diploid species, the self-incompatible Capsella grandiflora We set out to investigate the breakdown of S.I. in Capsella and the self-compatible Capsella rubella. To elucidate the transi- rubella to test the generality of the pattern described for A. tion to selfing and its relationship to speciation of C. rubella,we thaliana.
    [Show full text]