DOCSLIB.ORG

Genome-Wide Effects of Postglacial Colonization in Arabidopsis Lyrata

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genome-Wide Effects of Postglacial Colonization in Arabidopsis Lyrata Heredity (2008) 100, 47–58 & 2008 Nature Publishing Group All rights reserved 0018-067X/08 $30.00 www.nature.com/hdy ORIGINAL ARTICLE Genome-wide effects of postglacial colonization in Arabidopsis lyrata M-H Muller1,2, J Leppa¨la¨1 and O Savolainen1 1Department of Biology, University of Oulu, Oulu, Finland and 2UMR DIA-PC 1097, INRA Montpellier, Domaine de Melgueil, Mauguio, France The perennial outcrossing Arabidopsis lyrata is becoming a taken into account in studies aiming at elucidating the genetic plant model species for molecular ecology and evolution. basis of local adaptation. As shown by sequence data, most However, its evolutionary history, and especially the impact of the loci used in this study do not evolve like typical of the climatic oscillations of the Pleistocene on its genetic microsatellite loci and show variable levels of homoplasy: this diversity and population structure, is not well known. We mode of evolution makes these markers less suitable to analyzed the broad-scale population structure of the species investigate the between-continent divergence and more based on microsatellite variation at 22 loci. A wide sample in generally the worldwide evolution of the species. Finally, a Europe revealed that glaciations and postglacial colonization strong negative correlation was detected between levels of have caused high divergence and high variation in variability within-population diversity and indices of differentiation such between populations. Colonization from Central Europe to as FST. We discuss the causes of this correlation as well as Iceland and Scandinavia was associated with a strong the potential bias it induces on the quantification and decrease of genetic diversity from South to North. On the interpretation of population structure. other hand, the Russian population included in our data set Heredity (2008) 100, 47–58; doi:10.1038/sj.hdy.6801057; may originate from a different refugium probably located published online 17 October 2007 more to the East. These genome-wide patterns must be Keywords: Arabidopsis lyrata; microsatellites; postglacial history; population structure; FST Introduction ssp. lyrata (North America), A. lyrata ssp. petraea (Europe and Siberia) and A. lyrata ssp. kamchatica (from Eastern Arabidopsis lyrata is a close relative of Arabidopsis thaliana, Asia to Northwest America). Within Europe, ssp. petraea the model organism for plant molecular biology, and itself has a patchy distribution extending from Central Europe is becoming a model for ecology and evolution (Clauss and to Norway (Jalas and Suominen, 1994; Jonsell et al., 1995). Koch, 2006). It benefits from a wealth of molecular tools It occurs under a variety of climatic and ecological and information accumulated for its congener, and the conditions, but is most often cold-tolerant and grows in genomic resources for A. lyrata are also rapidly improving low competition habitats (Jonsell et al., 1995; Clauss and (Kuittinen et al., 2002, 2004; http://www.jgi.doe.gov/ Mitchell-Olds, 2006). Studying the large-scale population sequencing/why/CSP2006/AlyrataCrubella.html). In con- structure and history of this species is needed as a trast to A. thaliana, it is a perennial, outcrossing species prerequisite for the study of potentially selected varia- and forms stable populations (Clauss and Koch, 2006). tion (Wright and Gaut, 2005). It is also interesting As such, it is a more tractable organism for population because A. lyrata constitutes a good example of the genetics and allows addressing evolutionary questions evolution of a species complex affected by the climatic and testing the validity of theoretical models (Riihima¨ki oscillations of the Pleistocene (Abbott and Brochmann, et al., 2005). For instance, A. lyrata, together with other 2003). species of the genus Arabidopsis, is intensively used for Indeed, the Pleistocene has been a period of intense the study of self-incompatibility evolution (Mable et al., and recurrent climatic changes that have affected the 2005; Schierup et al., 2006) or the genetic basis of distribution and genetic diversity of many species, adaptation at different geographic scales (for example, leading to the evolution of differentiated genetic entities Ka¨rkka¨inen et al., 2004; Riihima¨ki et al., 2005, Kivima¨ki and in some cases to speciation (Hewitt, 2004). Cold et al. 2007). periods displaced the distribution ranges southwards Despite this interest, the evolutionary history of the and European refugia have been described for a variety species is not well known. Follwing three subspecies are of organisms in Spain, Italy and the Balkans (Taberlet distinguished (Al-Shehbaz and O’Kane, 2002): A. lyrata et al., 1998). During interglacial times, species were able to expand northward; in Europe, different routes of colonization have contributed to the present-day dis- Correspondence: Dr M-H Muller, UMR DIA-PC 1097, INRA, Domaine tribution of many different species (Taberlet et al., 1998). de Melgueil, Mauguio F34130, France. E-mail: [email protected] In addition to these North–South movements, the Received 28 March 2007; revised 12 June 2007; accepted 3 August evolution of species having a ‘circumboreal’ distribution 2007; published online 17 October 2007 such as A. lyrata, has been affected by East–West Postglacial history of Arabidopsis lyrata M-H Muller et al 48 movements, from Europe to America, across the Atlantic, For all populations except Bohemia, we analyzed field- as well as through Russia and Asia (Abbott and collected seeds sampled from different families. Bohemia Brochmann, 2003). In plants, the vast majority of studies seeds were a population sample propagated in the of glacial and postglacial history have concerned tree laboratory, kindly provided by Mark McNair. Reykjavik species (for example, Heuertz et al., 2004), and a few seeds were kindly provided by MH Schierup and other circumboreal species (Alsos et al., 2005). Mayodan seeds by CH Langley. Previous studies on neutral variation, based on We used 22 microsatellite loci among which 21 were isozymes, microsatellites or nucleotide polymorphism, previously described (Table 1). The primers used for have revealed a strong differentiation between A.l. ssp. SOC1 were 50 TGTCAAATGTATTCGAGCAAGA and petraea and A.l. ssp. lyrata, and—generally but not 50 TGTAAGAGCAAGCACAAGAGGA. Some of these always—a lower level of diversity in ssp. lyrata, loci are mapped (Kuittinen et al., 2004; J Leppa¨la, potentially due to population bottlenecks (Van Treuren unpublished). Except for ELF3 and SOC1, all loci have et al., 1997; Savolainen et al., 2000; Ramos-Onsins et al., been derived from A. thaliana. 2004; Wright et al., 2006). Within Europe, genetic diversity appears to be strongly influenced by popula- Laboratory methods tion history and demography (Ka¨rkka¨inen et al., 2004; DNA was extracted from about 200 mg of plant leaves Ramos-Onsins et al., 2004). A recent study (Clauss and using the FastDNA kit and the FastPrep instrument Mitchell-Olds, 2006) analyzed the genetic diversity of (Qbiogene Inc, Carlsbad, CA, USA). The amplification ssp. petraea in Central Europe and suggested that the reaction consisted of 10 ng DNA, 0.25 mM each primer, species may have persisted in this region during the last one of which was fluorescently labelled with TET, HEX glacial maximum. The relationships of Northern Euro- or FAM, 1 Â reaction buffer (Promega, Madison, WI, pean, especially Scandinavian populations, with this USA), 2.5 mM MgCl , 100 mM dNTP, 0.15 U Taq DNA potential refugium, the importance of founder effects 2 polymerase (Promega), in a total volume of 15 ml. The during recolonization and the level of differentiation amplification method was as follows: 94 1C for 3 min, 35 within Europe compared to the between continent cycles of 94 1C for 20 s, 50 1C for 30 s, and 72 1C for 10s, differentiation (that is, differentiation with the subspe- followed by a final extension for 45 min at 72 1C. cies ssp. lyrata) remain to be studied. Electrophoresis was performed on an ABI Prism 377 With their high level of diversity, ease of use and sequencer. The GENESCAN 3.1 and GENOTYPER 2.0 codominant nature, microsatellite markers have already (Applied Biosystems, Foster City, CA, USA) were used to proven useful in small-scale analyses of A. lyrata (Clauss analyze the DNA fragments and to score the genotypes. et al., 2002; Clauss and Mitchell-Olds, 2006). In the We reported all observed size classes. The final extension present study, we surveyed microsatellite variation at 22 time was long to ensure that one T was added to all loci in a sample including seven European populations fragments by the Taq polymerase. of ssp. petraea and one American population of ssp. As most of the microsatellite loci had been derived lyrata. We asked the following main questions: how has from A. thaliana, their molecular structure and thus their postglacial colonization impacted the patterns of within mode of evolution in A. lyrata could differ from that of population diversity, and divergence of populations? typical microsatellites. For 18 loci, we thus sequenced Have the populations reached a genetic equilibrium after one allele from each of the populations Karhuma¨ki, the colonization? What are the implications of the Plech, Spiterstulen and Mayodan. For homozygote demographic history for studies of molecular ecology genotypes, we directly sequenced the polymerase chain and functional genomics? reaction product. For heterozygotes, we cloned the We show that populations of A. lyrata exhibit highly polymerase chain reaction products into TOPO TA PCR variable levels of diversity and are strongly differentiated, 2.1 cloning vector (Invitrogen, Carlsbad, CA, USA) and especially within Europe, as a consequence of the different sequenced one single clone per individual. The sequen- routes of postglacial colonization. Further, we illustrate cing reactions were run in the ABI PRISM 377 sequencer how the variable within-population diversity can impact and the contigs were read and aligned using the Staden- the methods of analyzing population differentiation.
Load more

Recommended publications
  • Comparative Gene Mapping in Arabidopsis Lyrata Chromosomes 1 and 2 and the Corresponding A
    Genet. Res., Camb. (2006), 87, pp. 75–85. f 2006 Cambridge University Press 75 doi:10.1017/S0016672306008020 Printed in the United Kingdom Comparative gene mapping in Arabidopsis lyrata chromosomes 1 and 2 and the corresponding A. thaliana chromosome 1: recombination rates, rearrangements and centromere location BENGT HANSSON1 #, AKIRA KAWABE1,SONJAPREUSS1, HELMI KUITTINEN2 AND DEBORAH CHARLESWORTH1* 1Institute of Evolutionary Biology, School of Biological Sciences, University of Edinburgh, West Mains Road, Edinburgh EH9 3JT, UK 2 Department of Biology, PL 3000, FIN-90014 University of Oulu, Finland (Received 7 November 2005 and in revised form 23 December 2006) Summary To add detail to the genetic map of Arabidopsis lyrata, and compare it with that of A. thaliana, we have developed many additional markers in the A. lyrata linkage groups, LG1 and LG2, corresponding to A. thaliana chromosome 1. We used a newly developed method for marker development for single nucleotide polymorphisms present in gene sequences, plus length differences, to map genes in an A. lyrata family, including variants in several genes close to the A. thaliana centromere 1, providing the first data on the location of an A. lyrata centromere; we discuss the implications for the evolution of chromosome 1 of A. thaliana. With our larger marker density, large rearrangements between the two Arabidopsis species are excluded, except for a large inversion on LG2. This was previously known in Capsella; its presence in A. lyrata suggests that, like most other rearrangements, it probably arose in the A. thaliana lineage. Knowing that marker orders are similar, we can now compare homologous, non-rearranged map distances to test the prediction of more frequent crossing-over in the more inbreeding species.
    [Show full text]
  • State of New York City's Plants 2018
    STATE OF NEW YORK CITY’S PLANTS 2018 Daniel Atha & Brian Boom © 2018 The New York Botanical Garden All rights reserved ISBN 978-0-89327-955-4 Center for Conservation Strategy The New York Botanical Garden 2900 Southern Boulevard Bronx, NY 10458 All photos NYBG staff Citation: Atha, D. and B. Boom. 2018. State of New York City’s Plants 2018. Center for Conservation Strategy. The New York Botanical Garden, Bronx, NY. 132 pp. STATE OF NEW YORK CITY’S PLANTS 2018 4 EXECUTIVE SUMMARY 6 INTRODUCTION 10 DOCUMENTING THE CITY’S PLANTS 10 The Flora of New York City 11 Rare Species 14 Focus on Specific Area 16 Botanical Spectacle: Summer Snow 18 CITIZEN SCIENCE 20 THREATS TO THE CITY’S PLANTS 24 NEW YORK STATE PROHIBITED AND REGULATED INVASIVE SPECIES FOUND IN NEW YORK CITY 26 LOOKING AHEAD 27 CONTRIBUTORS AND ACKNOWLEGMENTS 30 LITERATURE CITED 31 APPENDIX Checklist of the Spontaneous Vascular Plants of New York City 32 Ferns and Fern Allies 35 Gymnosperms 36 Nymphaeales and Magnoliids 37 Monocots 67 Dicots 3 EXECUTIVE SUMMARY This report, State of New York City’s Plants 2018, is the first rankings of rare, threatened, endangered, and extinct species of what is envisioned by the Center for Conservation Strategy known from New York City, and based on this compilation of The New York Botanical Garden as annual updates thirteen percent of the City’s flora is imperiled or extinct in New summarizing the status of the spontaneous plant species of the York City. five boroughs of New York City. This year’s report deals with the City’s vascular plants (ferns and fern allies, gymnosperms, We have begun the process of assessing conservation status and flowering plants), but in the future it is planned to phase in at the local level for all species.
    [Show full text]
  • Arabidopsis Thaliana
    Downloaded from genome.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press RESEARCH A Physical Map of Chromosome 2 of Arabidopsis thaliana Eve Ann Zachgo, 2,4 Ming Li Wang, 1'2'4 Julia Dewdney, 1'2 David Bouchez, 3 Christine Carnilleri, 3 Stephen Belmonte, 2 Lu Huang, 2 Maureen Dolan, 2 and Howard M. Goodman 1'2'5 1Department of Genetics, Harvard Medical School and 2Department of Molecular Biology, Massachusetts General Hospital, Boston, Massachusetts 02114; 3Laboratoire de Biologie Cellulaire, Institut National de la Recherche Agronomique (INRA), 78026 Versailles CEDEX, France A yeast artificial chromosome (YAC] physical map of chromosome 2 of Arabidopsis thaliana has been constructed by hybridization of 69 DNA markers and 61 YAC end probes to gridded arrays of YAC clones. Thirty-four YACs in four contigs define the chromosome. Complete closure of the map was not attained because some regions of the chromosome were repetitive or were not represented in the YAC library. Based on the sizes of the YACs and their coverage of the chromosome, the length of chromosome 2 is estimated to be at least 18 Mb. These data provide the means for immediately identifying the YACs containing a genetic locus mapped on Arabidopsis chromosome 2. The small flowering plant Arabidopsis thaliana is ters (Maluszynska and Heslop-Harrison 1991; A1- an excellent model system for metabolic, genetic, bini 1994; Copenhaver et al. 1995). We present and developmental studies in plants. Its haploid here a YAC contig physical map of chromosome nuclear genome is small (-100 Mb), consisting of 2 of A.
    [Show full text]
  • Concerted Genomic and Epigenomic Changes Accompany Stabilization of Arabidopsis Allopolyploids
    ARTICLES https://doi.org/10.1038/s41559-021-01523-y Concerted genomic and epigenomic changes accompany stabilization of Arabidopsis allopolyploids Xinyu Jiang 1, Qingxin Song 1,2, Wenxue Ye 1 and Z. Jeffrey Chen 2 ✉ During evolution successful allopolyploids must overcome ‘genome shock’ between hybridizing species but the underlying pro- cess remains elusive. Here, we report concerted genomic and epigenomic changes in resynthesized and natural Arabidopsis suecica (TTAA) allotetraploids derived from Arabidopsis thaliana (TT) and Arabidopsis arenosa (AA). A. suecica shows con- served gene synteny and content with more gene family gain and loss in the A and T subgenomes than respective progenitors, although A. arenosa-derived subgenome has more structural variation and transposon distributions than A. thaliana-derived subgenome. These balanced genomic variations are accompanied by pervasive convergent and concerted changes in DNA methylation and gene expression among allotetraploids. The A subgenome is hypomethylated rapidly from F1 to resynthesized allotetraploids and convergently to the T-subgenome level in natural A. suecica, despite many other methylated loci being inher- ited from F1 to all allotetraploids. These changes in DNA methylation, including small RNAs, in allotetraploids may affect gene expression and phenotypic variation, including flowering, silencing of self-incompatibility and upregulation of meiosis- and mitosis-related genes. In conclusion, concerted genomic and epigenomic changes may improve stability and adaptation during polyploid evolution. olyploidy or whole-genome duplication (WGD) is a perva- species, including Aly24, Aha25 and Aka26, having been sequenced, sive feature of genome evolution in animals and flowering A. arenosa and A. suecica genomes are unavailable, except for a draft Pplants1–6.
    [Show full text]
  • Phylogenetic Position and Generic Limits of Arabidopsis (Brassicaceae)
    PHYLOGENETIC POSITION Steve L. O'Kane, Jr.2 and Ihsan A. 3 AND GENERIC LIMITS OF Al-Shehbaz ARABIDOPSIS (BRASSICACEAE) BASED ON SEQUENCES OF NUCLEAR RIBOSOMAL DNA1 ABSTRACT The primary goals of this study were to assess the generic limits and monophyly of Arabidopsis and to investigate its relationships to related taxa in the family Brassicaceae. Sequences of the internal transcribed spacer region (ITS-1 and ITS-2) of nuclear ribosomal DNA, including 5.8S rDNA, were used in maximum parsimony analyses to construct phylogenetic trees. An attempt was made to include all species currently or recently included in Arabidopsis, as well as species suggested to be close relatives. Our ®ndings show that Arabidopsis, as traditionally recognized, is polyphyletic. The genus, as recircumscribed based on our results, (1) now includes species previously placed in Cardaminopsis and Hylandra as well as three species of Arabis and (2) excludes species now placed in Crucihimalaya, Beringia, Olimar- abidopsis, Pseudoarabidopsis, and Ianhedgea. Key words: Arabidopsis, Arabis, Beringia, Brassicaceae, Crucihimalaya, ITS phylogeny, Olimarabidopsis, Pseudoar- abidopsis. Arabidopsis thaliana (L.) Heynh. was ®rst rec- netic studies and has played a major role in un- ommended as a model plant for experimental ge- derstanding the various biological processes in netics over a half century ago (Laibach, 1943). In higher plants (see references in Somerville & Mey- recent years, many biologists worldwide have fo- erowitz, 2002). The intraspeci®c phylogeny of A. cused their research on this plant. As indicated by thaliana has been examined by Vander Zwan et al. Patrusky (1991), the widespread acceptance of A. (2000). Despite the acceptance of A.
    [Show full text]
  • Arabidopsis and Relatives As Models for the Study of Genetic And
    Downloaded from http://rstb.royalsocietypublishing.org/ on March 29, 2015 Phil. Trans. R. Soc. B (2010) 365, 1815–1823 doi:10.1098/rstb.2009.0304 Review Arabidopsis and relatives as models for the study of genetic and genomic incompatibilities Kirsten Bomblies† and Detlef Weigel* Department of Molecular Biology, Max Planck Institute for Developmental Biology, 72076 Tu¨bingen, Germany The past few years have seen considerable advances in speciation research, but whether drift or adaptation is more likely to lead to genetic incompatibilities remains unknown. Some of the answers will probably come from not only studying incompatibilities between well-established species, but also from investigating incipient speciation events, to learn more about speciation as an evolutionary process. The genus Arabidopsis, which includes the widely used Arabidopsis thaliana, provides a useful set of model species for studying many aspects of population divergence. The genus contains both self-incompatible and incompatible species, providing a platform for studying the impact of mating system changes on genetic differentiation. Another important path to plant speciation is via formation of polyploids, and this can be investigated in the young allotetraploid species A. arenosa. Finally, there are many cases of intraspecific incompatibilities in A. thaliana, and recent progress has been made in discovering the genes underlying both F1 and F2 breakdown. In the near future, all these studies will be greatly empowered by complete genome sequences not only for all members of this relatively small genus, but also for many different individuals within each species. Keywords: speciation; Arabidopsis; hybrid incompatibility; self-incompatibility; polyploid speciation 1. INTRODUCTION thaliana, provide a useful set of model plants for study- It is widely accepted that a common path to speciation ing several aspects of speciation processes.
    [Show full text]
  • Biogeography and Diversification of Brassicales
    Molecular Phylogenetics and Evolution 99 (2016) 204–224 Contents lists available at ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev Biogeography and diversification of Brassicales: A 103 million year tale ⇑ Warren M. Cardinal-McTeague a,1, Kenneth J. Sytsma b, Jocelyn C. Hall a, a Department of Biological Sciences, University of Alberta, Edmonton, Alberta T6G 2E9, Canada b Department of Botany, University of Wisconsin, Madison, WI 53706, USA article info abstract Article history: Brassicales is a diverse order perhaps most famous because it houses Brassicaceae and, its premier mem- Received 22 July 2015 ber, Arabidopsis thaliana. This widely distributed and species-rich lineage has been overlooked as a Revised 24 February 2016 promising system to investigate patterns of disjunct distributions and diversification rates. We analyzed Accepted 25 February 2016 plastid and mitochondrial sequence data from five gene regions (>8000 bp) across 151 taxa to: (1) Available online 15 March 2016 produce a chronogram for major lineages in Brassicales, including Brassicaceae and Arabidopsis, based on greater taxon sampling across the order and previously overlooked fossil evidence, (2) examine Keywords: biogeographical ancestral range estimations and disjunct distributions in BioGeoBEARS, and (3) determine Arabidopsis thaliana where shifts in species diversification occur using BAMM. The evolution and radiation of the Brassicales BAMM BEAST began 103 Mya and was linked to a series of inter-continental vicariant, long-distance dispersal, and land BioGeoBEARS bridge migration events. North America appears to be a significant area for early stem lineages in the Brassicaceae order. Shifts to Australia then African are evident at nodes near the core Brassicales, which diverged Cleomaceae 68.5 Mya (HPD = 75.6–62.0).
    [Show full text]
  • Coordination of Biradial-To-Radial Symmetry and Tissue Polarity by HD
    ARTICLE https://doi.org/10.1038/s41467-021-24550-6 OPEN Coordination of biradial-to-radial symmetry and tissue polarity by HD-ZIP II proteins ✉ Monica Carabelli1,4, Luana Turchi1, Giorgio Morelli 2, Lars Østergaard 3,5 , Ida Ruberti1,5,6 & ✉ Laila Moubayidin 3,4 Symmetry establishment is a critical process in the development of multicellular organs and requires careful coordination of polarity axes while cells actively divide within tissues. For- 1234567890():,; mation of the apical style in the Arabidopsis gynoecium involves a bilateral-to-radial sym- metry transition, a stepwise process underpinned by the dynamic distribution of the plant morphogen auxin. Here we show that SPATULA (SPT) and the HECATE (HEC) bHLH pro- teins mediate the final step in the style radialisation process and synergistically control the expression of adaxial-identity genes, HOMEOBOX ARABIDOPSIS THALIANA 3 (HAT3) and ARABIDOPSIS THALIANA HOMEOBOX 4 (ATHB4). HAT3/ATHB4 module drives radialisation of the apical style by promoting basal-to-apical auxin flow and via a negative feedback mechanism that finetune auxin distribution through repression of SPT expression and cyto- kinin sensitivity. Thus, this work reveals the molecular basis of axes-coordination and hor- monal cross-talk during the sequential steps of symmetry transition in the Arabidopsis style. 1 Institute of Molecular Biology and Pathology, National Research Council, Rome, Italy. 2 Research Centre for Genomics and Bioinformatics, Council for Agricultural Research and Economics (CREA), Rome, Italy. 3 Department of Crop Genetics, John Innes Centre, Norwich, UK. 4These authors contributed ✉ equally: Monica Carabelli, Laila Moubayidin. 5These authors jointly supervised this work: Lars Østergaard, Ida Ruberti.
    [Show full text]
  • Floristic Quality Assessment Report
    FLORISTIC QUALITY ASSESSMENT IN INDIANA: THE CONCEPT, USE, AND DEVELOPMENT OF COEFFICIENTS OF CONSERVATISM Tulip poplar (Liriodendron tulipifera) the State tree of Indiana June 2004 Final Report for ARN A305-4-53 EPA Wetland Program Development Grant CD975586-01 Prepared by: Paul E. Rothrock, Ph.D. Taylor University Upland, IN 46989-1001 Introduction Since the early nineteenth century the Indiana landscape has undergone a massive transformation (Jackson 1997). In the pre-settlement period, Indiana was an almost unbroken blanket of forests, prairies, and wetlands. Much of the land was cleared, plowed, or drained for lumber, the raising of crops, and a range of urban and industrial activities. Indiana’s native biota is now restricted to relatively small and often isolated tracts across the State. This fragmentation and reduction of the State’s biological diversity has challenged Hoosiers to look carefully at how to monitor further changes within our remnant natural communities and how to effectively conserve and even restore many of these valuable places within our State. To meet this monitoring, conservation, and restoration challenge, one needs to develop a variety of appropriate analytical tools. Ideally these techniques should be simple to learn and apply, give consistent results between different observers, and be repeatable. Floristic Assessment, which includes metrics such as the Floristic Quality Index (FQI) and Mean C values, has gained wide acceptance among environmental scientists and decision-makers, land stewards, and restoration ecologists in Indiana’s neighboring states and regions: Illinois (Taft et al. 1997), Michigan (Herman et al. 1996), Missouri (Ladd 1996), and Wisconsin (Bernthal 2003) as well as northern Ohio (Andreas 1993) and southern Ontario (Oldham et al.
    [Show full text]
  • Homology-Based Interactions Between Small Rnas and Their Targets Control Dominance Hierarchy of Male Determinant Alleles of Self-Incompatibility in Arabidopsis Lyrata
    International Journal of Molecular Sciences Article Homology-Based Interactions between Small RNAs and Their Targets Control Dominance Hierarchy of Male Determinant Alleles of Self-Incompatibility in Arabidopsis lyrata Shinsuke Yasuda 1,†,‡, Risa Kobayashi 1,‡, Toshiro Ito 1 , Yuko Wada 1,* and Seiji Takayama 2,* 1 Division of Biological Sciences, Nara Institute of Science and Technology, Nara 630-0192, Japan; [email protected] (S.Y.); [email protected] (R.K.); [email protected] (T.I.) 2 Department of Applied Biological Chemistry, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Tokyo 113-8657, Japan * Correspondence: [email protected] (Y.W.); [email protected] (S.T.) † Present address: Plant Breeding and Experiment Station, Takii and Company, Limited, Konan, Shiga 520-3231, Japan. ‡ These authors contributed equally to this work. Abstract: Self-incompatibility (SI) is conserved among members of the Brassicaceae plant family. This trait is controlled epigenetically by the dominance hierarchy of the male determinant alleles. We previously demonstrated that a single small RNA (sRNA) gene is sufficient to control the linear dominance hierarchy in Brassica rapa and proposed a model in which a homology-based interaction between sRNAs and target sites controls the complicated dominance hierarchy of male SI deter- Citation: Yasuda, S.; Kobayashi, R.; minants. In Arabidopsis halleri, male dominance hierarchy is reported to have arisen from multiple Ito, T.; Wada, Y.; Takayama, S. networks of sRNA target gains and losses. Despite these findings, it remains unknown whether Homology-Based Interactions the molecular mechanism underlying the dominance hierarchy is conserved among Brassicaceae.
    [Show full text]
  • CRISPR/Cas9-Mediated Knockout of HOS1 Reveals Its Role in the Regulation of Secondary Metabolism in Arabidopsis Thaliana
    plants Article CRISPR/Cas9-Mediated Knockout of HOS1 Reveals Its Role in the Regulation of Secondary Metabolism in Arabidopsis thaliana Yury Shkryl * , Yulia Yugay, Tatiana Avramenko, Valeria Grigorchuk, Tatiana Gorpenchenko, Olga Grischenko and Victor Bulgakov Federal Scientific Center of the East Asia Terrestrial Biodiversity, Far Eastern Branch, the Russian Academy of Sciences, 690022 Vladivostok, Russia; [email protected] (Y.Y.); [email protected] (T.A.); [email protected] (V.G.); [email protected] (T.G.); [email protected] (O.G.); [email protected] (V.B.) * Correspondence: [email protected] Abstract: In Arabidopsis, the RING finger-containing E3 ubiquitin ligase HIGH EXPRESSION OF OSMOTICALLY RESPONSIVE GENES 1 (HOS1) functions as a main regulator of the cold signaling. In this study, CRISPR/Cas9-mediated targeted mutagenesis of the HOS1 gene in the first exon was performed. DNA sequencing showed that frameshift indels introduced by genome editing of HOS1 resulted in the appearance of premature stop codons, disrupting the open reading frame. Obtained hos1Cas9 mutant plants were compared with the SALK T-DNA insertion mutant, line hos1-3, in terms of their tolerance to abiotic stresses, accumulation of secondary metabolites and expression levels of genes participating in these processes. Upon exposure to cold stress, enhanced tolerance and expression of cold-responsive genes were observed in both hos1-3 and hos1Cas9 plants. The hos1 mutation caused changes in the synthesis of phytoalexins in transformed cells. The content of glucosinolates (GSLs) was down-regulated by 1.5-times, while flavonol glycosides were up-regulated by 1.2 to 4.2 times in transgenic plants.
    [Show full text]
  • Expression Profiling and Local Adaptation of Boechera Holboellii
    CORE Metadata, citation and similar papers at core.ac.uk Provided by DigitalCommons@CalPoly µBlackwellExpression Publishing Ltd profiling and local adaptation of Boechera holboellii populations for water use efficiency across a naturally occurring water stress gradient CHARLES A. KNIGHT HEIKO VOGEL JUERGEN KROYMANN ALICE SHUMATE HANNEKE WITSENBOER and THOMAS MITCHELL-OLDS Abstract We studied the physiological basis of local adaptation to drought in Boechera holboellii, a perennial relative of Arabidopsis thaliana, and used cDNA–AFLPs to identify candidate genes showing differential expression in these populations. We compared two populations of B. holboellii from contrasting water environments in a reciprocal transplant experiment, as well as in a laboratory dry-down experiment. We continuously measured the water con­ tent of soils using time domain reflectometery (TDR). We compared populations for their water use efficiency (WUE), root/shoot ratios (R:S) and leaf mass per unit area (LMA) in the field and in the laboratory, and identified candidate genes that (i) responded plastically to water stress and (ii) were differentially expressed between the two populations. Genotypes from the drier site had higher WUE, which was attributable to a large reduction in transpi­ rational water loss. The xeric-adapted population also had increased investment in root bio­ mass and greater leaf mass per unit area. Reciprocal transplants in the field had significantly greater survival in their native habitat. In total, 450 cDNA-AFLP fragments showed significant changes between drought and control treatments. Furthermore, some genes showed genotype (population)-specific patterns of up- or down-regulation in response to drought. Three hundred cDNA-AFLP bands were sequenced leading to the identification of cDNAs coding for proteins involved in signal transduction, transcriptional regulation, redox regulation, oxidative stress and pathways involved in stress adaptation.
    [Show full text]