DOCSLIB.ORG

Altered AKAP12 Expression in Portal Fibroblasts and Liver Sinusoids

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Altered AKAP12 Expression in Portal Fibroblasts and Liver Sinusoids Lee et al. Experimental & Molecular Medicine (2018) 50:48 DOI 10.1038/s12276-018-0074-5 Experimental & Molecular Medicine ARTICLE Open Access Altered AKAP12 expression in portal fibroblasts and liver sinusoids mediates transition from hepatic fibrogenesis to fibrosis resolution Hye Shin Lee1, Jinhyeok Choi1,TaekwonSon1,Hee-JunWee1,Sung-JinBae1,JiHaeSeo2,JiHyunPark1, Soo Hyung Ryu3, Danbi Lee4,MyoungKukJang5,EunsilYu6, Young-Hwa Chung4 and Kyu-Won Kim1,7 Abstract Liver fibrosis can be reversed by removing its causative injuries; however, the molecular mechanisms mediating the resolution of liver fibrogenesis are poorly understood. We investigate the role of a scaffold protein, A-Kinase Anchoring Protein 12 (AKAP12), during liver fibrosis onset, and resolution. Biliary fibrogenesis and fibrosis resolution was induced in wild-type (WT) or AKAP12-deficient C57BL/6 mice through different feeding regimens with 0.1% 3,5- diethoxycarbonyl-1,4-dihydrocollidine (DDC)-containing chow. AKAP12 expression in portal fibroblasts (PFs) and liver sinusoidal endothelial cells (LSECs) gradually decreased as fibrosis progressed but was restored after cessation of the fibrotic challenge. Histological analysis of human liver specimens with varying degrees of fibrosis of different etiologies revealed that AKAP12 expression diminishes in hepatic fibrosis from its early stages onward. AKAP12 KO mice displayed reduced fibrosis resolution in a DDC-induced biliary fibrosis model, which was accompanied by impaired 1234567890():,; 1234567890():,; normalization of myofibroblasts and capillarized sinusoids. RNA sequencing of the liver transcriptome revealed that genes related to ECM accumulation and vascular remodeling were mostly elevated in AKAP12 KO samples. Gene ontology (GO) and bioinformatic pathway analyses identified that the differentially expressed genes were significantly enriched in GO categories and pathways, such as the adenosine 3′,5′-cyclic monophosphate (cAMP) pathway. Knockdown of the AKAP12 gene in cultured primary PFs revealed that AKAP12 inhibited PF activation in association with the adenosine 3′,5′-cyclic monophosphate (cAMP) pathway. Moreover, AKAP12 knockdown in LSECs led to enhanced angiogenesis, endothelin-1 expression and alterations in laminin composition. Collectively, this study demonstrates that AKAP12-mediated regulation of PFs and LSECs has a central role in resolving hepatic fibrosis. Introduction liver fibrosis—liver malfunction with severe complications Liver fibrosis is the final outcome of chronic hepatic arises due to the distortion of liver architecture caused by damage caused by multiple etiologies, such as virus aberrant extracellular matrix (ECM) deposition. However, infections, alcohol over-consumption, and autoimmune an important characteristic of liver fibrosis that can pro- or metabolic diseases1,2. In cirrhosis—the end stage of vide new therapeutic strategies is its reversibility, even at an advanced stage, upon removal of the causative injury3,4. Correspondence: K-W. Kim ([email protected]) 1College of Pharmacy and Research, Institute of Pharmaceutical Sciences Seoul Hepatic non-parenchymal cells are involved not only in National University Seoul 08826, Korea fibrogenesis but also in fibrosis resolution. Hepatic stellate 2 Department of Biochemistry, School of Medicine, Keimyung University, Daegu cells (HSCs) and portal fibroblasts (PFs) are mesenchymal 42601, Korea Full list of author information is available at the end of the article cells capable of transforming into myofibroblasts that © The Author(s) 2018 Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, and provide a link to the Creative Commons license. You do not have permission under this license to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.Toviewacopyofthislicense,http:// creativecommons.org/licenses/by-nc-nd/4.0/. Official journal of the Korean Society for Biochemistry and Molecular Biology Lee et al. Experimental & Molecular Medicine (2018) 50:48 Page 2 of 13 aberrantly produce ECM proteins under fibrogenic con- (DDC)-supplemented diet; 0.1% DDC (Sigma) was mixed ditions2,5. These cells are removed by apoptosis6 or with normal mouse chow and fed to weight-matched 8- to senescence7 during fibrosis resolution; however, some 10-week-old male mice. The mice were kept on the DDC remain in a quiescent state8. The molecular mechanisms diet for 3 weeks, following which they were returned to a underlying the transition from fibrogenesis to fibrosis normal diet for the next 2 weeks. At the end of the resolution are not fully understood; however, shifting the experimental period, the mice were killed via deep anes- balance between pro-fibrotic pathways, such as TGF-β1 thesia and killed by cardiac perfusion. and PDGF signaling9,10, and anti-fibrotic ones, such as peroxisome proliferator-activated receptor gamma Human tissue specimens – (PPARγ) and cAMP pathways11 13, may mediate this Tissues from normal and fibrotic human livers were transition. obtained through biopsy specimens from patients who Under fibrotic conditions, liver sinusoids undergo vas- visited the Asan Medical Center, University of Ulsan, cular remodeling, which includes angiogenesis and College of Medicine, Seoul, Korea, for diagnosis. Informed capillarization characterized by the loss of fenestrae and consent was obtained from all patients. The patients’ the formation of basement membrane14. As differentiated clinical characteristics are summarized in supplementary liver sinusoidal endothelial cells (LSECs) function to Table 1. Fibrosis grades were determined by gross and maintain the quiescent status of HSCs, loss of LSEC dif- microscopic examination of the liver tissues. The study ferentiation under fibrosis contributes to HSC activa- was approved by the Institutional Review Board of the tion15,16. Forced re-differentiation of LSECs by a soluble Asan Medical Center, Seoul, Korea. guanylate cyclase activator promotes fibrosis regression in rodent models17, suggesting that the normalization of Histological analysis and immunohistochemistry LSECs to their differentiated state is a prerequisite for Immunofluorescence staining was performed on paraf- proper liver fibrosis resolution. fin sections or frozen sections. The paraffin sections were AKAP12 is a scaffold protein known to integrate de-paraffinized and stained with Picro-Sirius Red (Abcam, effector proteins such as protein kinase A, protein kinase Cambridge, MA, USA) according to the manufacturer’s C, and protein phosphatase 2B for the β-adrenergic instructions to visualize the deposition of ECM proteins. receptor pathway, through which it has a role in reg- To stain the paraffin sections, antigen retrieval was con- ulating cAMP compartmentalization and the re- ducted for 30 min at 95 °C in Tris or citrate buffer, sensitization of β-adrenergic receptors18,19. As AKAP12 depending on antibody compatibility. After blocking with is widely expressed by several cell types, it is reported to 5% normal donkey serum (Sigma-Aldrich) in PBS solu- have diverse physiological functions, such as inhibition of tion, the sections were incubated overnight at 4 °C with angiogenesis20, promotion of meningeal reconstruc- primary antibodies for AKAP12 (I. Gelman, Roswell Park tion21,22, and tumor suppression23. In connection to Cancer Institute), aSMA (Dako), laminin (Sigma), SE-1 chronic liver diseases, AKAP12 is reported to be down- (R&D Systems), CD31 (BD Biosciences), Thy-1 (BD regulated by an epigenetic mechanism in human hepa- Biosciences), collagen I (Southern Biotech), collagen III tocellular carcinoma24. However, little is known regarding (Southern Biotech), Desmin (R&D Systems), VEGFR2 its expression and function in normal and fibrotic livers. (Cell Signaling), F4/80 (Abcam), SE-1 (R&D Systems), and In this study, we aim to investigate the molecular collagen IV (Southern Biotech). After extensive washing mechanisms by which non-parenchymal cells—in parti- in PBS containing 0.1% Tween-20 solution, the sections cular, PFs and LSECs—modulate hepatic fibrosis resolu- were treated with Alexa 488- or 546-conjugated second- tion. By examining the expression profiles of AKAP12 in ary antibodies (1:750, Invitrogen, Carlsbad, CA, USA) for normal and fibrotic livers, we investigate the role of this 1 h at room temperature followed by counter staining protein in hepatic fibrogenesis and fibrosis resolution. with Hoechst (Sigma). Fluorescent images were taken under a confocal microscope (Carl Zeiss AG, Oberko- Materials and methods chen, Germany), and immuno-positive areas were quan- Animals and fibrosis induction tified by ImageJ software. Unless specified otherwise, 5–10 All mouse experiments were reviewed and approved by images from a single animal were quantified, and the the Committee for Care and Use of Laboratory Animals at mean value was considered to be a representative value Seoul National University according to the Guide
Load more

Recommended publications
  • Analysis of the Indacaterol-Regulated Transcriptome in Human Airway
    Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2018/04/13/jpet.118.249292.DC1 1521-0103/366/1/220–236$35.00 https://doi.org/10.1124/jpet.118.249292 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 366:220–236, July 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Analysis of the Indacaterol-Regulated Transcriptome in Human Airway Epithelial Cells Implicates Gene Expression Changes in the s Adverse and Therapeutic Effects of b2-Adrenoceptor Agonists Dong Yan, Omar Hamed, Taruna Joshi,1 Mahmoud M. Mostafa, Kyla C. Jamieson, Radhika Joshi, Robert Newton, and Mark A. Giembycz Departments of Physiology and Pharmacology (D.Y., O.H., T.J., K.C.J., R.J., M.A.G.) and Cell Biology and Anatomy (M.M.M., R.N.), Snyder Institute for Chronic Diseases, Cumming School of Medicine, University of Calgary, Calgary, Alberta, Canada Received March 22, 2018; accepted April 11, 2018 Downloaded from ABSTRACT The contribution of gene expression changes to the adverse and activity, and positive regulation of neutrophil chemotaxis. The therapeutic effects of b2-adrenoceptor agonists in asthma was general enriched GO term extracellular space was also associ- investigated using human airway epithelial cells as a therapeu- ated with indacaterol-induced genes, and many of those, in- tically relevant target. Operational model-fitting established that cluding CRISPLD2, DMBT1, GAS1, and SOCS3, have putative jpet.aspetjournals.org the long-acting b2-adrenoceptor agonists (LABA) indacaterol, anti-inflammatory, antibacterial, and/or antiviral activity. Numer- salmeterol, formoterol, and picumeterol were full agonists on ous indacaterol-regulated genes were also induced or repressed BEAS-2B cells transfected with a cAMP-response element in BEAS-2B cells and human primary bronchial epithelial cells by reporter but differed in efficacy (indacaterol $ formoterol .
    [Show full text]
  • AKAP12 Regulates Human Blood–Retinal Barrier Formation by Downregulation of Hypoxia-Inducible Factor-1Α
    4472 • The Journal of Neuroscience, April 18, 2007 • 27(16):4472–4481 Cellular/Molecular AKAP12 Regulates Human Blood–Retinal Barrier Formation by Downregulation of Hypoxia-Inducible Factor-1␣ Yoon Kyung Choi,1* Jeong Hun Kim,2* Woo Jean Kim,4* Hae Young Lee,1 Jeong Ae Park,5 Sae-Won Lee,3 Dae-Kwan Yoon,1 Hyun Ho Kim,1 Hum Chung,2 Young Suk Yu,2 and Kyu-Won Kim1 1NeuroVascular Coordination Research Center, College of Pharmacy and Research Institute of Pharmaceutical Sciences, Seoul National University, Seoul 151-742, Korea, 2Department of Ophthalmology, Seoul National University College of Medicine and Seoul Artificial Eye Center, 3Clinical Research Institute, Seoul National University Hospital, Seoul 110-744, Korea, 4Neuroprotection Research Laboratory, Departments of Radiology and Neurology, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts 02115, and 5Department of Marine Biotechnology, College of Liberal Arts and Sciences, Anyang University, Incheon 417-833, Korea Many diseases of the eye such as retinoblastoma, diabetic retinopathy, and retinopathy of prematurity are associated with blood–retinal barrier (BRB) dysfunction. Identifying the factors that contribute to BRB formation during human eye development and maintenance could provide insights into such diseases. Here we show that A-kinase anchor protein 12 (AKAP12) induces BRB formation by increasing angiopoietin-1 and decreasing vascular endothelial growth factor (VEGF) levels in astrocytes. We reveal that AKAP12 downregulates the level of hypoxia-inducible factor-1␣ (HIF-1␣) protein by enhancing the interaction of HIF-1␣ with pVHL (von Hippel-Lindau tumor suppressor protein) and PHD2 (prolyl hydroxylase 2). Conditioned media from AKAP12-overexpressing astrocytes induced barriergen- esis by upregulating the expression of tight junction proteins in human retina microvascular endothelial cells (HRMECs).
    [Show full text]
  • In This Table Protein Name, Uniprot Code, Gene Name P-Value
    Supplementary Table S1: In this table protein name, uniprot code, gene name p-value and Fold change (FC) for each comparison are shown, for 299 of the 301 significantly regulated proteins found in both comparisons (p-value<0.01, fold change (FC) >+/-0.37) ALS versus control and FTLD-U versus control. Two uncharacterized proteins have been excluded from this list Protein name Uniprot Gene name p value FC FTLD-U p value FC ALS FTLD-U ALS Cytochrome b-c1 complex P14927 UQCRB 1.534E-03 -1.591E+00 6.005E-04 -1.639E+00 subunit 7 NADH dehydrogenase O95182 NDUFA7 4.127E-04 -9.471E-01 3.467E-05 -1.643E+00 [ubiquinone] 1 alpha subcomplex subunit 7 NADH dehydrogenase O43678 NDUFA2 3.230E-04 -9.145E-01 2.113E-04 -1.450E+00 [ubiquinone] 1 alpha subcomplex subunit 2 NADH dehydrogenase O43920 NDUFS5 1.769E-04 -8.829E-01 3.235E-05 -1.007E+00 [ubiquinone] iron-sulfur protein 5 ARF GTPase-activating A0A0C4DGN6 GIT1 1.306E-03 -8.810E-01 1.115E-03 -7.228E-01 protein GIT1 Methylglutaconyl-CoA Q13825 AUH 6.097E-04 -7.666E-01 5.619E-06 -1.178E+00 hydratase, mitochondrial ADP/ATP translocase 1 P12235 SLC25A4 6.068E-03 -6.095E-01 3.595E-04 -1.011E+00 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 Protein kinase C and casein Q9BY11 PACSIN1 3.837E-03 -5.863E-01 3.680E-06 -1.824E+00 kinase substrate in neurons protein 1 Tubulin polymerization- O94811 TPPP 6.466E-03 -5.755E-01 6.943E-06 -1.169E+00 promoting protein MIC C9JRZ6 CHCHD3 2.912E-02 -6.187E-01 2.195E-03 -9.781E-01 Mitochondrial 2-
    [Show full text]
  • PKA Compartmentalization Via AKAP220 and AKAP12 Contributes to Endothelial Barrier Regulation
    PKA Compartmentalization via AKAP220 and AKAP12 Contributes to Endothelial Barrier Regulation Mariya Y. Radeva, Daniela Kugelmann, Volker Spindler, Jens Waschke* Institute of Anatomy and Cell Biology, Ludwig-Maximilians-University Munich, Munich, Germany Abstract cAMP-mediated PKA signaling is the main known pathway involved in maintenance of the endothelial barrier. Tight regulation of PKA function can be achieved by discrete compartmentalization of the enzyme via physical interaction with A- kinase anchoring proteins (AKAPs). Here, we investigated the role of AKAPs 220 and 12 in endothelial barrier regulation. Analysis of human and mouse microvascular endothelial cells as well as isolated rat mesenteric microvessels was performed using TAT-Ahx-AKAPis peptide, designed to competitively inhibit PKA-AKAP interaction. In vivo microvessel hydraulic conductivity and in vitro transendothelial electrical resistance measurements showed that this peptide destabilized endothelial barrier properties, and dampened the cAMP-mediated endothelial barrier stabilization induced by forskolin and rolipram. Immunofluorescence analysis revealed that TAT-Ahx-AKAPis led to both adherens junctions and actin cytoskeleton reorganization. Those effects were paralleled by redistribution of PKA and Rac1 from endothelial junctions and by Rac1 inactivation. Similarly, membrane localization of AKAP220 was also reduced. In addition, depletion of either AKAP12 or AKAP220 significantly impaired endothelial barrier function and AKAP12 was also shown to interfere with cAMP-mediated barrier enhancement. Furthermore, immunoprecipitation analysis demonstrated that AKAP220 interacts not only with PKA but also with VE-cadherin and ß-catenin. Taken together, these results indicate that AKAP-mediated PKA subcellular compartmentalization is involved in endothelial barrier regulation. More specifically, AKAP220 and AKAP12 contribute to endothelial barrier function and AKAP12 is required for cAMP-mediated barrier stabilization.
    [Show full text]
  • Pivotal Role of AKAP12 in the Regulation of Cellular Adhesion Dynamics: Control of Cytoskeletal Architecture, Cell Migration, and Mitogenic Signaling
    Hindawi Publishing Corporation Journal of Signal Transduction Volume 2012, Article ID 529179, 7 pages doi:10.1155/2012/529179 Review Article Pivotal Role of AKAP12 in the Regulation of Cellular Adhesion Dynamics: Control of Cytoskeletal Architecture, Cell Migration, and Mitogenic Signaling Shin Akakura and Irwin H. Gelman Department of Cancer Genetics, Roswell Park Cancer Institute, Elm and Carlton Streets, Buffalo, NY 14263, USA Correspondence should be addressed to Irwin H. Gelman, [email protected] Received 24 February 2012; Accepted 24 May 2012 Academic Editor: Claire Brown Copyright © 2012 S. Akakura and I. H. Gelman. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Cellular dynamics are controlled by key signaling molecules such as cAMP-dependent protein kinase (PKA) and protein kinase C (PKC). AKAP12/SSeCKS/Gravin (AKAP12) is a scaffold protein for PKA and PKC which controls actin-cytoskeleton reorganization in a spatiotemporal manner. AKAP12 also acts as a tumor suppressor which regulates cell-cycle progression and inhibits Src-mediated oncogenic signaling and cytoskeletal pathways. Reexpression of AKAP12 causes cell flattening, reorganization of the actin cytoskeleton, and the production of normalized focal adhesion structures. Downregulation of AKAP12 induces the formation of thickened, longitudinal stress fibers and the proliferation of adhesion complexes. AKAP12-null mouse embryonic fibroblasts exhibit hyperactivation of PKC, premature cellular senescence, and defects in cytokinesis, relating to the loss of PKC scaffolding activity by AKAP12. AKAP12-null mice exhibit increased cell senescence and increased susceptibility to carcinogen-induced oncogenesis.
    [Show full text]
  • Akap12 (NM 031185) Mouse Untagged Clone – MC224827 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MC224827 Akap12 (NM_031185) Mouse Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Akap12 (NM_031185) Mouse Untagged Clone Tag: Tag Free Symbol: Akap12 Synonyms: AI317366; Srcs5; SSeCKS; Tsga12 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >MC224827 representing NM_031185 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGTGCAGGCAGTTCCACCGAGCAGCGGAGCCCCGAGCAGCCGGCGGAGAGCGACACGCCGAGCGAGC TGGAGCTCAGTGGCCATGGGCCCGCAGCGGAAGCGTCGGGAGCAGCTGGAGATCCCGCTGACGCGGACCC CGCCACCAAGCTCCCACAGAAGAATGGTCAGCTGTCTGCCGTCAATGGTGTAGCTGAACAAGAAGATGTC CACGTCCAAGAGGAAAGCCAGGATGGGCAAGAGGAAGAAGTCACTGTTGAAGATGTTGGACAGAGAGAGT CAGAAGATGTGAAAGAAAAAGACCGAGCTAAAGAAATGGCAGCCAGTTCCACAGTTGTTGAAGATATCAC AAAGGACGAGCAGGAGGAAACACCGGAAATAATCGAACAGATCCCTGCTTCAGAGAGCAATGTGGAAGAA ATGGCGCAGGCTGCTGAGTCCCAAGCTAATGACGTCGGCTTCAAGAAGGTATTTAAATTTGTTGGTTTTA AATTCACGGTGAAGAAGGATAAAAACGAAAAGTCAGATACCGTCCAGCTACTCACTGTCAAGAAGGATGA AGGCGAAGGGGCAGAAGCCTCCGTCGGAGCAGGAGACCACCAAGAGCCCGGAGTGGAGACCGTCGGCGAA TCAGCATCCAAAGAAAGTGAGCTGAAGCAATCCACAGAGAAGCAAGAAGGCACCCTGAAGCAAGCACAGA GCAGCACAGAAATTCCCCTTCAAGCCGAATCTGGTCAAGGGACCGAGGAAGAAGCAGCCAAAGATGGAGA AGAAAACCGAGAGAAAGAACCTACCAAGCCCCTAGAATCTCCGACCAGCCCTGTCAGCAATGAGACAACA TCTTCCTTCAAGAAATTCTTCACTCACGGCTGGGCCGGCTGGCGCAAGAAGACCAGCTTCAAGAAACCAA
    [Show full text]
  • Promoter Methylation of Genes in and Around the Candidate Lung Cancer Susceptibility Locus 6Q23-25
    Research Article Promoter Methylation of Genes in and around the Candidate Lung Cancer Susceptibility Locus 6q23-25 Mathewos Tessema,1 Randy Willink,1 Kieu Do,1 Yang Y. Yu,1 Wayne Yu,3 Emi O. Machida,3 Malcolm Brock,3 Leander Van Neste,4 Christine A. Stidley,2 Stephen B. Baylin,3 and Steven A. Belinsky1 1Lung Cancer Program, Lovelace Respiratory Research Institute; 2Department of Internal Medicine, University of New Mexico, Albuquerque, New Mexico; 3Cancer Biology Division, The Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins, Baltimore, Maryland; and 4Department of Molecular Biotechnology, Faculty of Biosciences Engineering, Ghent University, Ghent, Belgium Abstract epithelium of smokers include loss of heterozygosity (LOH) at chromosomes 3p21, 9p21, and 17p13 (3). Within these areas of Chromosomal aberrations associated with lung cancer are allelic loss, inactivation of the remaining allele by promoter frequently observed in the long arm of chromosome 6. A hypermethylation of RASSF1A and p16 genes and by mutation of candidate susceptibility locus at 6q23-25 for lung cancer was the p53 gene is commonly seen in non–small cell lung cancers recently identified; however, no tumor suppressor genes (NSCLC) (4). Methylation of the p16 gene is one of the earliest inactivated by mutation have been identified in this locus. changes in lung cancer development, occurring in the field of Genetic, epigenetic, gene expression, and in silico screening epithelial damage induced by carcinogens within tobacco and approaches were used to select 43 genes located in 6q12-27 increasing in prevalence during histologic progression of adeno- for characterization of methylation status. Twelve (28%) genes carcinoma and squamous cell carcinoma (5–7).
    [Show full text]
  • (AKAP12) Gene and Their Effects on Growth Traits
    animals Article Exploration of Genetic Variants within the Goat A-Kinase Anchoring Protein 12 (AKAP12) Gene and Their Effects on Growth Traits Yangyang Bai 1,2,3,†, Rongrong Yuan 1,3,†, Yunyun Luo 2, Zihong Kang 2, Haijing Zhu 1,3,4, Lei Qu 1,3,4, Xianyong Lan 2,* and Xiaoyue Song 1,3,4,* 1 Shaanxi Provincial Engineering and Technology Research Center of Cashmere Goats, Yulin University, Yulin 719000, China; [email protected] (Y.B.); [email protected] (R.Y.); [email protected] (H.Z.); [email protected] (L.Q.) 2 Key Laboratory of Animal Genetics, Breeding and Reproduction of Shaanxi Province, College of Animal Science and Technology, Northwest A&F University, Yangling 712100, China; [email protected] (Y.L.); [email protected] (Z.K.) 3 Life Science Research Center, Yulin University, Yulin 719000, China 4 Shaanxi Province “Four Subjects One Union” Sheep and Goat Engineering & Technology University & Enterprise Alliance Research Center, Yulin 719000, China * Correspondence: [email protected] (X.L.); [email protected] (X.S.) † These authors equally contributed to this work. Simple Summary: AKAP12, the family of A-kinase anchoring proteins (AKAPs), plays an important role in the regulation of growth and development. There have been no corresponding studies of the effect of the AKAP12 gene on growth traits in goats. In our previous study, 7 bp (intron 3) and 13 bp (30UTR) indels within the AKAP12 gene significantly influenced AKAP12 gene expression. This study Citation: Bai, Y.; Yuan, R.; Luo, Y.; expected to identify the association between these two genetic variations and growth-related traits in Kang, Z.; Zhu, H.; Qu, L.; Lan, X.; 1405 Shaanbei white cashmere (SBWC) goats.
    [Show full text]
  • Expression Profiling Based on Graph-Clustering Approach to Determine and Protein Characterization of BRAF- and K-RAS-Mutated Colorectal Colon Cancer Pathway
    Original Article Xiao-qu Zhu1, Expression profiling based on Mei-lan Hu2, Feng Zhang3, graph-clustering approach to determine Yu Tao 4, Chun-ming Wu1, Shang-zhu Lin1, colon cancer pathway Fu-le He2 1Department of ABSTRACT Gastroenterology and Hepatology, Wenzhou Context: Colorectal cancer is the second leading cause of cancer deaths worldwide. DNA microarray-based technologies allow Hospital of Traditional simultaneous analysis of expression of thousands of genes. Chinese Medicine, 27 Dashimen Xinhe Road, Aim: To search for important molecular markers and pathways that hold great promise for further treatment of patients with colorectal Wenzhou, cancer. Zhejiang 325000, 2 Materials and Methods: Here, we performed a comprehensive gene-level assessment of colorectal cancer using 35 colorectal cancer Department of Traditional Chinese and 24 normal samples. Medicine, Hangzhou Results: It was shown that AURKA, MT1G, and AKAP12 had a high degree of response in colorectal cancer. Besides, we further First People’s Hospital, 261 Huansha Road, explored the underlying molecular mechanism within these different genes. Hangzhou, Conclusions: The results indicated calcium signaling pathway and vascular smooth muscle contraction pathway were the two significant Zhejiang 310006, 3 pathways, giving hope to provide insights into the development of novel therapeutic targets and pathways. Postgraduate student of 2011 grade, The First Clinical Medical College of KEY WORDS: Colon cancer, expression profiles, graph cluster, significant pathways Zhejiang Chinese
    [Show full text]
  • AKAP12/Gravin Is Inactivated by Epigenetic Mechanism in Human Gastric Carcinoma and Shows Growth Suppressor Activity
    Oncogene (2004) 23, 7095–7103 & 2004 Nature Publishing Group All rights reserved 0950-9232/04 $30.00 www.nature.com/onc AKAP12/Gravin is inactivated by epigenetic mechanism in human gastric carcinoma and shows growth suppressor activity Moon-Chang Choi1, Hyun-Soon Jong*,1, Tai Young Kim1, Sang-Hyun Song1, Dong Soon Lee2, Jung Weon Lee1, Tae-You Kim1,3, Noe Kyeong Kim3 and Yung-Jue Bang*,1,3 1National Research Laboratory for Cancer Epigenetics, Cancer Research Institute, Seoul National University College of Medicine, 28 Yongon-dong, Chongro-gu, Seoul 110-799, Korea; 2Department of Clinical Pathology, Seoul National University College of Medicine, Seoul 110-744, Korea; 3Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744, Korea AKAP12/Gravin, one of the A-kinase anchoring proteins Introduction (AKAPs), functions as a kinase scaffold protein and as a dynamic regulator of the b2-adrenergic receptor complex. AKAP12/Gravin, one of the A-kinase anchoring However, the biological role of AKAP12 in cancer proteins (Dell’Acqua and Scott, 1997; Nauert et al., development is not well understood. The AKAP12 gene 1997; Diviani and Scott, 2001; Feliciello et al., 2001), encodes two major isoforms of 305 and 287 kDa was first isolated as a protein recognized by serum (designated AKAP12A and AKAP12B, respectively, in from myasthenia gravis patients (Gordon et al., 1992). this report). We found that these two isoforms are AKAP12 organizes the complex of PKA and PKC independently expressed and that they are probably under (Nauert et al., 1997), and is an important regulator the control of two different promoters.
    [Show full text]
  • Deregulated Expression of Fat and Muscle Genes in B-Cell Chronic Lymphocytic Leukemia with High Lipoprotein Lipase Expression
    Leukemia (2006) 20, 1080–1088 & 2006 Nature Publishing Group All rights reserved 0887-6924/06 $30.00 www.nature.com/leu ORIGINAL ARTICLE Deregulated expression of fat and muscle genes in B-cell chronic lymphocytic leukemia with high lipoprotein lipase expression M Bilban1,2,8, D Heintel3,8, T Scharl4, T Woelfel4, MM Auer2,3, E Porpaczy3, B Kainz3, A Kro¨ber5, VJ Carey6, M Shehata2,3, C Zielinski2, W Pickl7, S Stilgenbauer5, A Gaiger2,3,6, O Wagner1,2,UJa¨ger2,3 and the German CLL Study Group 1Department of Laboratory Medicine, Medical University of Vienna, Vienna, Austria; 2Ludwig Boltzmann Institute for Clinical and Experimental Oncology, Vienna, Austria; 3Department of Internal Medicine I, Division of Hematology and Hemostaseology, Medical University of Vienna; Vienna, Austria; 4Department of Statistics and Probability Theory, Vienna University of Technology, Vienna, Austria; 5Department of Internal Medicine III, University of Ulm, Ulm, Germany; 6Department of Medicine, Harvard Medical School, Boston, MA, USA and 7Institute of Immunology, Medical University of Vienna, Vienna, Austria Lipoprotein lipase (LPL) is a prognostic marker in B-cell studies was the identification of a novel prognostic marker, the chronic lymphocytic leukemia (B-CLL) related to immunoglo- ZAP-70 protein, which has already entered routine diagnos- bulin VH gene (IgVH)mutational status. We determined gene tics.3,4,9,26–31 However, microarray analysis has identified a expression profiles using Affymetrix U133A GeneChips in two groups of B-CLLs selected for either high (‘LPL þ ’, n ¼ 10) or number of other potential prognostic or therapeutic targets that low (‘LPLÀ’, n ¼ 10) LPL mRNA expression.
    [Show full text]
  • Atlas Journal
    Atlas of Genetics and Cytogenetics in Oncology and Haematology Home Genes Leukemias Solid Tumours Cancer-Prone Deep Insight Portal Teaching X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA Atlas Journal Atlas Journal versus Atlas Database: the accumulation of the issues of the Journal constitutes the body of the Database/Text-Book. TABLE OF CONTENTS Volume 11, Number 2, Apr-Jun 2007 Previous Issue / Next Issue Genes BOK (BCL2-related ovarian killer) (2q37.3). Alexander G Yakovlev. Atlas Genet Cytogenet Oncol Haematol 2007; 11 (2): 119-123. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/BOKID824ch2q37.html BIRC6 (Baculoviral IAP repeat-containing 6) (2p22). Christian Pohl, Stefan Jentsch. Atlas Genet Cytogenet Oncol Haematol 2007; 11 (2): 124-129. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/BIRC6ID798ch2p22.html AKAP12 (A kinase (PRKA) anchor protein 1) (6q25). Irwin H Gelman. Atlas Genet Cytogenet Oncol Haematol 2007; 11 (2): 130-136. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/AKAP12ID607ch6q25.html TRIM 24 (tripartite motif-containing 24) (7q34). Jean Loup Huret. Atlas Genet Cytogenet Oncol Haematol 2007; 11 (2): 137-141. [Full Text] [PDF] Atlas Genet Cytogenet Oncol Haematol 2007; 2 - I - URL : http://AtlasGeneticsOncology.org/Genes/TRIM24ID504ch7q34.html RUNX 2 (Runt-related transcription factor 2) (6p21). Athanasios G Papavassiliou, Panos Ziros. Atlas Genet Cytogenet Oncol Haematol 2007; 11 (2): 142-147. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/RUNX2ID42183ch6p21.html PTPRG (protein tyrosine phosphatase, receptor type, G) (3p14.2). Cornelis P Tensen, Remco van Doorn.
    [Show full text]