DOCSLIB.ORG

Expression Profiling Based on Graph-Clustering Approach to Determine and Protein Characterization of BRAF- and K-RAS-Mutated Colorectal Colon Cancer Pathway

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Expression Profiling Based on Graph-Clustering Approach to Determine and Protein Characterization of BRAF- and K-RAS-Mutated Colorectal Colon Cancer Pathway Original Article Xiao-qu Zhu1, Expression profiling based on Mei-lan Hu2, Feng Zhang3, graph-clustering approach to determine Yu Tao 4, Chun-ming Wu1, Shang-zhu Lin1, colon cancer pathway Fu-le He2 1Department of ABSTRACT Gastroenterology and Hepatology, Wenzhou Context: Colorectal cancer is the second leading cause of cancer deaths worldwide. DNA microarray-based technologies allow Hospital of Traditional simultaneous analysis of expression of thousands of genes. Chinese Medicine, 27 Dashimen Xinhe Road, Aim: To search for important molecular markers and pathways that hold great promise for further treatment of patients with colorectal Wenzhou, cancer. Zhejiang 325000, 2 Materials and Methods: Here, we performed a comprehensive gene-level assessment of colorectal cancer using 35 colorectal cancer Department of Traditional Chinese and 24 normal samples. Medicine, Hangzhou Results: It was shown that AURKA, MT1G, and AKAP12 had a high degree of response in colorectal cancer. Besides, we further First People’s Hospital, 261 Huansha Road, explored the underlying molecular mechanism within these different genes. Hangzhou, Conclusions: The results indicated calcium signaling pathway and vascular smooth muscle contraction pathway were the two significant Zhejiang 310006, 3 pathways, giving hope to provide insights into the development of novel therapeutic targets and pathways. Postgraduate student of 2011 grade, The First Clinical Medical College of KEY WORDS: Colon cancer, expression profiles, graph cluster, significant pathways Zhejiang Chinese Medical University, 548 Binwen Road, Hangzhou, INTRODUCTION main challenge is to determine which treatment is Zhejiang 310053, most likely to benefit an individual patient. 4Department of Colorectal cancer (CRC) is one of the most frequent Oncology, Wenzhou Hospital of Traditional malignancies in western countries and the third DNA microarray technology offers the ability to Chinese Medicine, most common cause of cancer-related deaths compare gene expression at a genome-wide level 27 Dashimen Xinhe worldwide, despite remarkable progress being made and to explore the transcriptional programs that Road, Wenzhou, Zhejiang 325000, [1] are turned on or off in tumors during progression in surgical techniques and therapeutic options. China from normal through premalignant stages to [6] CRC arises as a consequence of the accumulation cancer. However, extracting such gene sets For correspondence: of genetic and epigenetic alterations.[2] Till date, information from large data sets derived from Dr. Fu-le He, heterogeneous biological samples has proven to Department of inactivation of the tumor suppressor genes, Traditional Chinese Adenomatous polyposis coli (APC) and p53, and be difficult. Pathway analysis programs such as Medicine, Hangzhou graph clustering can be of help.[7] Therefore, in activation of the oncogene, Kirsten-ras (K-ras), are First People’s Hospital, our study, we aimed to yield sets of significant, 261 Huansha Road, thought to be particularly important determinants differentially expressed genes (DEGs) by DNA Hangzhou, of colorectal tumor initiation and progression.[3,4] Zhejiang 310006, microarray analysis. From these confirmed gene Besides, CRC development is also an epigenetic China. sets, relevant pathways’ networks could be E-mail: hfl2000@sina. gene inactivation mechanism by DNA methylation reconstructed, ultimately leading to a more com of its promoter region. CpG island methylation reliable understanding of the underlying biology Access this article online affects a number of genes in colon cancer, and the mechanism in CRC.[8] significance of the epigenetic alterations in the Website: www.cancerjournal.net DOI: 10.4103/0973-1482.119351 pathogenesis of colon cancer has been reported MATERIALS AND METHODS PMID: **** widely, such as the netrin-1 receptors are aberrantly Quick Response Code: methylated in primary CRC and are significantly Microarray analysis was performed between 35 correlated with Dukes’ stage C.[5] CRC and 24 normal samples to identify differential genes. The microarray expression data can be Numerous new therapies hold great promise for accessed through the Gene Expression Omnibus the treatment of patients with brain cancer, but the under accession number GSE23878 (http://www. Journal of Cancer Research and Therapeutics - July-September 2013 - Volume 9 - Issue 3 467 Zhu, et al.: Expression profiling determines colon cancer pathway ncbi.nlm.nih.gov/geo/) which is based on the Affymetrix Human Genome U133 Plus 2.0 Array. For the GSE23878 dataset, the limma method[9] was used to identify DEGs. The original expression data sets from all conditions were processed into expression estimates using the Robust Multichip Average (RMA) method with the default settings implemented in bioconductor, and then the linear model was constructed. The DEGs only with the fold change >2 and P value <0.05 were selected. For demonstrating the potential connection, the Spearman rank correlation (r) was used for comparative target genes’ correlations. The significance level was set at r > 0.9 and local false discovery rate (fdr)[10] <0.05. All statistical tests were performed with the R program (http://www.r-project.org/). Figure 1: Expression profiles of 59 DEGs To identify co-expressed groups, we used DPClus,[7] a graph- clustering algorithm that can extract densely connected nodes as a cluster. It is based on density and periphery tracking of clusters. DPClus is freely available from http://kanaya.naist. jp/DPClus/. In this study, we used the overlapping mode with the DPClus settings. We set the parameter settings of cluster property (cp); density values were set to 0.5[11] and minimum cluster size was set to 5. The pathway[12] database records networks of molecular interactions in the cells and variants of them specific to particular organisms (http://www.genome.jp/kegg/). The Gene Ontology (GO)[13] project is a major bioinformatics initiative with the aim of standardizing the representation of gene and gene product attributes across species and databases. Figure 2: Graph clustering of correlated modules in CRC (threshold r ≥ 0.9). Using the DPClus algorithm we extracted 9 clusters in CRC. The internal nodes of the clusters are connected by green edges; [14] InterPro is an integrated database of predictive protein neighboring clusters are connected by red edges “signatures” used for the classification and automatic annotation of proteins and genomes. Table 1: List of enriched KEGG pathways in cluster2 and 9 The DAVID[15] was used to identify over-represented pathways, detected by DPClus InterPro domains, and GO terms in biological process based Cluster Term P value Benjamini on hypergeometric distribution test. P value <0.05 was the Cluster 2 hsa04270: Vascular 0.001422 0.009911 threshold for the analysis. smooth muscle contraction RESULTS Cluster 9 hsa04020: Calcium 0.034612 0.161486 signaling pathway We obtained publicly available microarray data sets GSE23878 from Gene Expression Omnibus (GEO). After microarray analysis, 1383 DEGs with the fold change >2 and P value <0.05 were selected. At r ≥ 0.9, DPClus[7] identified nine clusters in the correlation network for CRC; they ranged in size from 5 to 12 genes [Figure 2]. To get the relationships among DEGs, the co-expressed To assess the significance of the clusters, we used the over- value (r > 0.9 and fdr < 0.05) was chosen as the threshold. represented KEGG pathways (so-called Kyoto Encyclopedia Finally, 324 relationships among 59 DEGs were constructed a of Genes and Genomes (KEGG) enrichment analysis) in the correlation network. The expression profiles of the 59 DEGs clusters. The results of graph clustering with KEGG enrichment are seen in Figure 1. analysis are presented in Table 1. 468 Journal of Cancer Research and Therapeutics - July-September 2013 - Volume 9 - Issue 3 Zhu, et al.: Expression profiling determines colon cancer pathway Table 2: List of enriched GO terms in clusters 1–9 detected by DPClus Cluster Term P valuemin Benjamini Cluster 1 GO:0006955~immune response 3.40E-07 6.81E-07 Cluster 2 GO:0031032~actomyosin structure 0.008254 0.467374 organization Cluster 3 GO:0010038~response to metal ion 0.018981 0.331313 Cluster 4 NA - - Cluster 5 GO:0007017~microtubule-based process 0.001032 0.079304 Cluster 6 NA - - Cluster 7 NA - - Cluster 8 GO:0030198~extracellular matrix organization 0.030402 0.981364 Cluster 9 NA - - GO, gene ontology; NA, no term was detected Table 3: List of enriched InterPro domains in clusters 1–9 encoded protein is found at the centrosome in interphase cells detected by DPClus and at the spindle poles in mitosis. AURKA overexpression Cluster Term P valuemin Benjamini was detected in colorectal carcinogenesis, especially in Cluster 1 IPR003597: 2.04E-11 1.83E-10 chromosomal instable carcinomas.[6] Immunoglobulin C1-set Cluster 2 NA - - MT1G gene belongs to the MT family encoding a class of Cluster 3 IPR018064: 1.56E-20 4.67E-20 metal-binding proteins involved in several cellular processes, Metallothionein, including potent antioxidant function against various types vertebrate, metal-binding site of oxidative damage as well as regulation of zinc and copper Clusters 4–8 NA - - homeostasis, and their expression is often dysregulated in Cluster 9 IPR013098: 0.048692 0.776316 human tumors. In a human colon cancer cell line, the level Immunoglobulin I-set of MT achieves its maximum near the G1/S stage of the cell NA, No term was detected cycle, suggesting that MT plays a physiological role in cell proliferation. MT expression was stronger in CRC at early stage than in advanced carcinomas.[16] Furthermore, MT1G genes The enrichment analysis method yields two significant were found to be up-regulated in CRC cell lines HCT116 and pathways, vascular smooth muscle contraction pathway and SW620 cells after f-adiponectin treatment and were suggested calcium signaling pathway [Table 1]. to have an anticarcinogenic role in colorectal carcinogenesis based on previous reports.[17] Several GO categories were enriched among these genes in the correlation network, including immune response, actomyosin AKAP12 gene encodes a member of the A-kinase anchor protein structure organization, response to metal ion, etc.
Load more

Recommended publications
  • Analysis of the Indacaterol-Regulated Transcriptome in Human Airway
    Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2018/04/13/jpet.118.249292.DC1 1521-0103/366/1/220–236$35.00 https://doi.org/10.1124/jpet.118.249292 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 366:220–236, July 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Analysis of the Indacaterol-Regulated Transcriptome in Human Airway Epithelial Cells Implicates Gene Expression Changes in the s Adverse and Therapeutic Effects of b2-Adrenoceptor Agonists Dong Yan, Omar Hamed, Taruna Joshi,1 Mahmoud M. Mostafa, Kyla C. Jamieson, Radhika Joshi, Robert Newton, and Mark A. Giembycz Departments of Physiology and Pharmacology (D.Y., O.H., T.J., K.C.J., R.J., M.A.G.) and Cell Biology and Anatomy (M.M.M., R.N.), Snyder Institute for Chronic Diseases, Cumming School of Medicine, University of Calgary, Calgary, Alberta, Canada Received March 22, 2018; accepted April 11, 2018 Downloaded from ABSTRACT The contribution of gene expression changes to the adverse and activity, and positive regulation of neutrophil chemotaxis. The therapeutic effects of b2-adrenoceptor agonists in asthma was general enriched GO term extracellular space was also associ- investigated using human airway epithelial cells as a therapeu- ated with indacaterol-induced genes, and many of those, in- tically relevant target. Operational model-fitting established that cluding CRISPLD2, DMBT1, GAS1, and SOCS3, have putative jpet.aspetjournals.org the long-acting b2-adrenoceptor agonists (LABA) indacaterol, anti-inflammatory, antibacterial, and/or antiviral activity. Numer- salmeterol, formoterol, and picumeterol were full agonists on ous indacaterol-regulated genes were also induced or repressed BEAS-2B cells transfected with a cAMP-response element in BEAS-2B cells and human primary bronchial epithelial cells by reporter but differed in efficacy (indacaterol $ formoterol .
    [Show full text]
  • AKAP12 Regulates Human Blood–Retinal Barrier Formation by Downregulation of Hypoxia-Inducible Factor-1Α
    4472 • The Journal of Neuroscience, April 18, 2007 • 27(16):4472–4481 Cellular/Molecular AKAP12 Regulates Human Blood–Retinal Barrier Formation by Downregulation of Hypoxia-Inducible Factor-1␣ Yoon Kyung Choi,1* Jeong Hun Kim,2* Woo Jean Kim,4* Hae Young Lee,1 Jeong Ae Park,5 Sae-Won Lee,3 Dae-Kwan Yoon,1 Hyun Ho Kim,1 Hum Chung,2 Young Suk Yu,2 and Kyu-Won Kim1 1NeuroVascular Coordination Research Center, College of Pharmacy and Research Institute of Pharmaceutical Sciences, Seoul National University, Seoul 151-742, Korea, 2Department of Ophthalmology, Seoul National University College of Medicine and Seoul Artificial Eye Center, 3Clinical Research Institute, Seoul National University Hospital, Seoul 110-744, Korea, 4Neuroprotection Research Laboratory, Departments of Radiology and Neurology, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts 02115, and 5Department of Marine Biotechnology, College of Liberal Arts and Sciences, Anyang University, Incheon 417-833, Korea Many diseases of the eye such as retinoblastoma, diabetic retinopathy, and retinopathy of prematurity are associated with blood–retinal barrier (BRB) dysfunction. Identifying the factors that contribute to BRB formation during human eye development and maintenance could provide insights into such diseases. Here we show that A-kinase anchor protein 12 (AKAP12) induces BRB formation by increasing angiopoietin-1 and decreasing vascular endothelial growth factor (VEGF) levels in astrocytes. We reveal that AKAP12 downregulates the level of hypoxia-inducible factor-1␣ (HIF-1␣) protein by enhancing the interaction of HIF-1␣ with pVHL (von Hippel-Lindau tumor suppressor protein) and PHD2 (prolyl hydroxylase 2). Conditioned media from AKAP12-overexpressing astrocytes induced barriergen- esis by upregulating the expression of tight junction proteins in human retina microvascular endothelial cells (HRMECs).
    [Show full text]
  • In This Table Protein Name, Uniprot Code, Gene Name P-Value
    Supplementary Table S1: In this table protein name, uniprot code, gene name p-value and Fold change (FC) for each comparison are shown, for 299 of the 301 significantly regulated proteins found in both comparisons (p-value<0.01, fold change (FC) >+/-0.37) ALS versus control and FTLD-U versus control. Two uncharacterized proteins have been excluded from this list Protein name Uniprot Gene name p value FC FTLD-U p value FC ALS FTLD-U ALS Cytochrome b-c1 complex P14927 UQCRB 1.534E-03 -1.591E+00 6.005E-04 -1.639E+00 subunit 7 NADH dehydrogenase O95182 NDUFA7 4.127E-04 -9.471E-01 3.467E-05 -1.643E+00 [ubiquinone] 1 alpha subcomplex subunit 7 NADH dehydrogenase O43678 NDUFA2 3.230E-04 -9.145E-01 2.113E-04 -1.450E+00 [ubiquinone] 1 alpha subcomplex subunit 2 NADH dehydrogenase O43920 NDUFS5 1.769E-04 -8.829E-01 3.235E-05 -1.007E+00 [ubiquinone] iron-sulfur protein 5 ARF GTPase-activating A0A0C4DGN6 GIT1 1.306E-03 -8.810E-01 1.115E-03 -7.228E-01 protein GIT1 Methylglutaconyl-CoA Q13825 AUH 6.097E-04 -7.666E-01 5.619E-06 -1.178E+00 hydratase, mitochondrial ADP/ATP translocase 1 P12235 SLC25A4 6.068E-03 -6.095E-01 3.595E-04 -1.011E+00 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 Protein kinase C and casein Q9BY11 PACSIN1 3.837E-03 -5.863E-01 3.680E-06 -1.824E+00 kinase substrate in neurons protein 1 Tubulin polymerization- O94811 TPPP 6.466E-03 -5.755E-01 6.943E-06 -1.169E+00 promoting protein MIC C9JRZ6 CHCHD3 2.912E-02 -6.187E-01 2.195E-03 -9.781E-01 Mitochondrial 2-
    [Show full text]
  • PKA Compartmentalization Via AKAP220 and AKAP12 Contributes to Endothelial Barrier Regulation
    PKA Compartmentalization via AKAP220 and AKAP12 Contributes to Endothelial Barrier Regulation Mariya Y. Radeva, Daniela Kugelmann, Volker Spindler, Jens Waschke* Institute of Anatomy and Cell Biology, Ludwig-Maximilians-University Munich, Munich, Germany Abstract cAMP-mediated PKA signaling is the main known pathway involved in maintenance of the endothelial barrier. Tight regulation of PKA function can be achieved by discrete compartmentalization of the enzyme via physical interaction with A- kinase anchoring proteins (AKAPs). Here, we investigated the role of AKAPs 220 and 12 in endothelial barrier regulation. Analysis of human and mouse microvascular endothelial cells as well as isolated rat mesenteric microvessels was performed using TAT-Ahx-AKAPis peptide, designed to competitively inhibit PKA-AKAP interaction. In vivo microvessel hydraulic conductivity and in vitro transendothelial electrical resistance measurements showed that this peptide destabilized endothelial barrier properties, and dampened the cAMP-mediated endothelial barrier stabilization induced by forskolin and rolipram. Immunofluorescence analysis revealed that TAT-Ahx-AKAPis led to both adherens junctions and actin cytoskeleton reorganization. Those effects were paralleled by redistribution of PKA and Rac1 from endothelial junctions and by Rac1 inactivation. Similarly, membrane localization of AKAP220 was also reduced. In addition, depletion of either AKAP12 or AKAP220 significantly impaired endothelial barrier function and AKAP12 was also shown to interfere with cAMP-mediated barrier enhancement. Furthermore, immunoprecipitation analysis demonstrated that AKAP220 interacts not only with PKA but also with VE-cadherin and ß-catenin. Taken together, these results indicate that AKAP-mediated PKA subcellular compartmentalization is involved in endothelial barrier regulation. More specifically, AKAP220 and AKAP12 contribute to endothelial barrier function and AKAP12 is required for cAMP-mediated barrier stabilization.
    [Show full text]
  • Pivotal Role of AKAP12 in the Regulation of Cellular Adhesion Dynamics: Control of Cytoskeletal Architecture, Cell Migration, and Mitogenic Signaling
    Hindawi Publishing Corporation Journal of Signal Transduction Volume 2012, Article ID 529179, 7 pages doi:10.1155/2012/529179 Review Article Pivotal Role of AKAP12 in the Regulation of Cellular Adhesion Dynamics: Control of Cytoskeletal Architecture, Cell Migration, and Mitogenic Signaling Shin Akakura and Irwin H. Gelman Department of Cancer Genetics, Roswell Park Cancer Institute, Elm and Carlton Streets, Buffalo, NY 14263, USA Correspondence should be addressed to Irwin H. Gelman, [email protected] Received 24 February 2012; Accepted 24 May 2012 Academic Editor: Claire Brown Copyright © 2012 S. Akakura and I. H. Gelman. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Cellular dynamics are controlled by key signaling molecules such as cAMP-dependent protein kinase (PKA) and protein kinase C (PKC). AKAP12/SSeCKS/Gravin (AKAP12) is a scaffold protein for PKA and PKC which controls actin-cytoskeleton reorganization in a spatiotemporal manner. AKAP12 also acts as a tumor suppressor which regulates cell-cycle progression and inhibits Src-mediated oncogenic signaling and cytoskeletal pathways. Reexpression of AKAP12 causes cell flattening, reorganization of the actin cytoskeleton, and the production of normalized focal adhesion structures. Downregulation of AKAP12 induces the formation of thickened, longitudinal stress fibers and the proliferation of adhesion complexes. AKAP12-null mouse embryonic fibroblasts exhibit hyperactivation of PKC, premature cellular senescence, and defects in cytokinesis, relating to the loss of PKC scaffolding activity by AKAP12. AKAP12-null mice exhibit increased cell senescence and increased susceptibility to carcinogen-induced oncogenesis.
    [Show full text]
  • Akap12 (NM 031185) Mouse Untagged Clone – MC224827 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MC224827 Akap12 (NM_031185) Mouse Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Akap12 (NM_031185) Mouse Untagged Clone Tag: Tag Free Symbol: Akap12 Synonyms: AI317366; Srcs5; SSeCKS; Tsga12 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >MC224827 representing NM_031185 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGTGCAGGCAGTTCCACCGAGCAGCGGAGCCCCGAGCAGCCGGCGGAGAGCGACACGCCGAGCGAGC TGGAGCTCAGTGGCCATGGGCCCGCAGCGGAAGCGTCGGGAGCAGCTGGAGATCCCGCTGACGCGGACCC CGCCACCAAGCTCCCACAGAAGAATGGTCAGCTGTCTGCCGTCAATGGTGTAGCTGAACAAGAAGATGTC CACGTCCAAGAGGAAAGCCAGGATGGGCAAGAGGAAGAAGTCACTGTTGAAGATGTTGGACAGAGAGAGT CAGAAGATGTGAAAGAAAAAGACCGAGCTAAAGAAATGGCAGCCAGTTCCACAGTTGTTGAAGATATCAC AAAGGACGAGCAGGAGGAAACACCGGAAATAATCGAACAGATCCCTGCTTCAGAGAGCAATGTGGAAGAA ATGGCGCAGGCTGCTGAGTCCCAAGCTAATGACGTCGGCTTCAAGAAGGTATTTAAATTTGTTGGTTTTA AATTCACGGTGAAGAAGGATAAAAACGAAAAGTCAGATACCGTCCAGCTACTCACTGTCAAGAAGGATGA AGGCGAAGGGGCAGAAGCCTCCGTCGGAGCAGGAGACCACCAAGAGCCCGGAGTGGAGACCGTCGGCGAA TCAGCATCCAAAGAAAGTGAGCTGAAGCAATCCACAGAGAAGCAAGAAGGCACCCTGAAGCAAGCACAGA GCAGCACAGAAATTCCCCTTCAAGCCGAATCTGGTCAAGGGACCGAGGAAGAAGCAGCCAAAGATGGAGA AGAAAACCGAGAGAAAGAACCTACCAAGCCCCTAGAATCTCCGACCAGCCCTGTCAGCAATGAGACAACA TCTTCCTTCAAGAAATTCTTCACTCACGGCTGGGCCGGCTGGCGCAAGAAGACCAGCTTCAAGAAACCAA
    [Show full text]
  • Promoter Methylation of Genes in and Around the Candidate Lung Cancer Susceptibility Locus 6Q23-25
    Research Article Promoter Methylation of Genes in and around the Candidate Lung Cancer Susceptibility Locus 6q23-25 Mathewos Tessema,1 Randy Willink,1 Kieu Do,1 Yang Y. Yu,1 Wayne Yu,3 Emi O. Machida,3 Malcolm Brock,3 Leander Van Neste,4 Christine A. Stidley,2 Stephen B. Baylin,3 and Steven A. Belinsky1 1Lung Cancer Program, Lovelace Respiratory Research Institute; 2Department of Internal Medicine, University of New Mexico, Albuquerque, New Mexico; 3Cancer Biology Division, The Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins, Baltimore, Maryland; and 4Department of Molecular Biotechnology, Faculty of Biosciences Engineering, Ghent University, Ghent, Belgium Abstract epithelium of smokers include loss of heterozygosity (LOH) at chromosomes 3p21, 9p21, and 17p13 (3). Within these areas of Chromosomal aberrations associated with lung cancer are allelic loss, inactivation of the remaining allele by promoter frequently observed in the long arm of chromosome 6. A hypermethylation of RASSF1A and p16 genes and by mutation of candidate susceptibility locus at 6q23-25 for lung cancer was the p53 gene is commonly seen in non–small cell lung cancers recently identified; however, no tumor suppressor genes (NSCLC) (4). Methylation of the p16 gene is one of the earliest inactivated by mutation have been identified in this locus. changes in lung cancer development, occurring in the field of Genetic, epigenetic, gene expression, and in silico screening epithelial damage induced by carcinogens within tobacco and approaches were used to select 43 genes located in 6q12-27 increasing in prevalence during histologic progression of adeno- for characterization of methylation status. Twelve (28%) genes carcinoma and squamous cell carcinoma (5–7).
    [Show full text]
  • (AKAP12) Gene and Their Effects on Growth Traits
    animals Article Exploration of Genetic Variants within the Goat A-Kinase Anchoring Protein 12 (AKAP12) Gene and Their Effects on Growth Traits Yangyang Bai 1,2,3,†, Rongrong Yuan 1,3,†, Yunyun Luo 2, Zihong Kang 2, Haijing Zhu 1,3,4, Lei Qu 1,3,4, Xianyong Lan 2,* and Xiaoyue Song 1,3,4,* 1 Shaanxi Provincial Engineering and Technology Research Center of Cashmere Goats, Yulin University, Yulin 719000, China; [email protected] (Y.B.); [email protected] (R.Y.); [email protected] (H.Z.); [email protected] (L.Q.) 2 Key Laboratory of Animal Genetics, Breeding and Reproduction of Shaanxi Province, College of Animal Science and Technology, Northwest A&F University, Yangling 712100, China; [email protected] (Y.L.); [email protected] (Z.K.) 3 Life Science Research Center, Yulin University, Yulin 719000, China 4 Shaanxi Province “Four Subjects One Union” Sheep and Goat Engineering & Technology University & Enterprise Alliance Research Center, Yulin 719000, China * Correspondence: [email protected] (X.L.); [email protected] (X.S.) † These authors equally contributed to this work. Simple Summary: AKAP12, the family of A-kinase anchoring proteins (AKAPs), plays an important role in the regulation of growth and development. There have been no corresponding studies of the effect of the AKAP12 gene on growth traits in goats. In our previous study, 7 bp (intron 3) and 13 bp (30UTR) indels within the AKAP12 gene significantly influenced AKAP12 gene expression. This study Citation: Bai, Y.; Yuan, R.; Luo, Y.; expected to identify the association between these two genetic variations and growth-related traits in Kang, Z.; Zhu, H.; Qu, L.; Lan, X.; 1405 Shaanbei white cashmere (SBWC) goats.
    [Show full text]
  • Altered AKAP12 Expression in Portal Fibroblasts and Liver Sinusoids
    Lee et al. Experimental & Molecular Medicine (2018) 50:48 DOI 10.1038/s12276-018-0074-5 Experimental & Molecular Medicine ARTICLE Open Access Altered AKAP12 expression in portal fibroblasts and liver sinusoids mediates transition from hepatic fibrogenesis to fibrosis resolution Hye Shin Lee1, Jinhyeok Choi1,TaekwonSon1,Hee-JunWee1,Sung-JinBae1,JiHaeSeo2,JiHyunPark1, Soo Hyung Ryu3, Danbi Lee4,MyoungKukJang5,EunsilYu6, Young-Hwa Chung4 and Kyu-Won Kim1,7 Abstract Liver fibrosis can be reversed by removing its causative injuries; however, the molecular mechanisms mediating the resolution of liver fibrogenesis are poorly understood. We investigate the role of a scaffold protein, A-Kinase Anchoring Protein 12 (AKAP12), during liver fibrosis onset, and resolution. Biliary fibrogenesis and fibrosis resolution was induced in wild-type (WT) or AKAP12-deficient C57BL/6 mice through different feeding regimens with 0.1% 3,5- diethoxycarbonyl-1,4-dihydrocollidine (DDC)-containing chow. AKAP12 expression in portal fibroblasts (PFs) and liver sinusoidal endothelial cells (LSECs) gradually decreased as fibrosis progressed but was restored after cessation of the fibrotic challenge. Histological analysis of human liver specimens with varying degrees of fibrosis of different etiologies revealed that AKAP12 expression diminishes in hepatic fibrosis from its early stages onward. AKAP12 KO mice displayed reduced fibrosis resolution in a DDC-induced biliary fibrosis model, which was accompanied by impaired 1234567890():,; 1234567890():,; normalization of myofibroblasts and capillarized sinusoids. RNA sequencing of the liver transcriptome revealed that genes related to ECM accumulation and vascular remodeling were mostly elevated in AKAP12 KO samples. Gene ontology (GO) and bioinformatic pathway analyses identified that the differentially expressed genes were significantly enriched in GO categories and pathways, such as the adenosine 3′,5′-cyclic monophosphate (cAMP) pathway.
    [Show full text]
  • AKAP12/Gravin Is Inactivated by Epigenetic Mechanism in Human Gastric Carcinoma and Shows Growth Suppressor Activity
    Oncogene (2004) 23, 7095–7103 & 2004 Nature Publishing Group All rights reserved 0950-9232/04 $30.00 www.nature.com/onc AKAP12/Gravin is inactivated by epigenetic mechanism in human gastric carcinoma and shows growth suppressor activity Moon-Chang Choi1, Hyun-Soon Jong*,1, Tai Young Kim1, Sang-Hyun Song1, Dong Soon Lee2, Jung Weon Lee1, Tae-You Kim1,3, Noe Kyeong Kim3 and Yung-Jue Bang*,1,3 1National Research Laboratory for Cancer Epigenetics, Cancer Research Institute, Seoul National University College of Medicine, 28 Yongon-dong, Chongro-gu, Seoul 110-799, Korea; 2Department of Clinical Pathology, Seoul National University College of Medicine, Seoul 110-744, Korea; 3Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744, Korea AKAP12/Gravin, one of the A-kinase anchoring proteins Introduction (AKAPs), functions as a kinase scaffold protein and as a dynamic regulator of the b2-adrenergic receptor complex. AKAP12/Gravin, one of the A-kinase anchoring However, the biological role of AKAP12 in cancer proteins (Dell’Acqua and Scott, 1997; Nauert et al., development is not well understood. The AKAP12 gene 1997; Diviani and Scott, 2001; Feliciello et al., 2001), encodes two major isoforms of 305 and 287 kDa was first isolated as a protein recognized by serum (designated AKAP12A and AKAP12B, respectively, in from myasthenia gravis patients (Gordon et al., 1992). this report). We found that these two isoforms are AKAP12 organizes the complex of PKA and PKC independently expressed and that they are probably under (Nauert et al., 1997), and is an important regulator the control of two different promoters.
    [Show full text]
  • Deregulated Expression of Fat and Muscle Genes in B-Cell Chronic Lymphocytic Leukemia with High Lipoprotein Lipase Expression
    Leukemia (2006) 20, 1080–1088 & 2006 Nature Publishing Group All rights reserved 0887-6924/06 $30.00 www.nature.com/leu ORIGINAL ARTICLE Deregulated expression of fat and muscle genes in B-cell chronic lymphocytic leukemia with high lipoprotein lipase expression M Bilban1,2,8, D Heintel3,8, T Scharl4, T Woelfel4, MM Auer2,3, E Porpaczy3, B Kainz3, A Kro¨ber5, VJ Carey6, M Shehata2,3, C Zielinski2, W Pickl7, S Stilgenbauer5, A Gaiger2,3,6, O Wagner1,2,UJa¨ger2,3 and the German CLL Study Group 1Department of Laboratory Medicine, Medical University of Vienna, Vienna, Austria; 2Ludwig Boltzmann Institute for Clinical and Experimental Oncology, Vienna, Austria; 3Department of Internal Medicine I, Division of Hematology and Hemostaseology, Medical University of Vienna; Vienna, Austria; 4Department of Statistics and Probability Theory, Vienna University of Technology, Vienna, Austria; 5Department of Internal Medicine III, University of Ulm, Ulm, Germany; 6Department of Medicine, Harvard Medical School, Boston, MA, USA and 7Institute of Immunology, Medical University of Vienna, Vienna, Austria Lipoprotein lipase (LPL) is a prognostic marker in B-cell studies was the identification of a novel prognostic marker, the chronic lymphocytic leukemia (B-CLL) related to immunoglo- ZAP-70 protein, which has already entered routine diagnos- bulin VH gene (IgVH)mutational status. We determined gene tics.3,4,9,26–31 However, microarray analysis has identified a expression profiles using Affymetrix U133A GeneChips in two groups of B-CLLs selected for either high (‘LPL þ ’, n ¼ 10) or number of other potential prognostic or therapeutic targets that low (‘LPLÀ’, n ¼ 10) LPL mRNA expression.
    [Show full text]
  • Atlas Journal
    Atlas of Genetics and Cytogenetics in Oncology and Haematology Home Genes Leukemias Solid Tumours Cancer-Prone Deep Insight Portal Teaching X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA Atlas Journal Atlas Journal versus Atlas Database: the accumulation of the issues of the Journal constitutes the body of the Database/Text-Book. TABLE OF CONTENTS Volume 11, Number 2, Apr-Jun 2007 Previous Issue / Next Issue Genes BOK (BCL2-related ovarian killer) (2q37.3). Alexander G Yakovlev. Atlas Genet Cytogenet Oncol Haematol 2007; 11 (2): 119-123. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/BOKID824ch2q37.html BIRC6 (Baculoviral IAP repeat-containing 6) (2p22). Christian Pohl, Stefan Jentsch. Atlas Genet Cytogenet Oncol Haematol 2007; 11 (2): 124-129. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/BIRC6ID798ch2p22.html AKAP12 (A kinase (PRKA) anchor protein 1) (6q25). Irwin H Gelman. Atlas Genet Cytogenet Oncol Haematol 2007; 11 (2): 130-136. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/AKAP12ID607ch6q25.html TRIM 24 (tripartite motif-containing 24) (7q34). Jean Loup Huret. Atlas Genet Cytogenet Oncol Haematol 2007; 11 (2): 137-141. [Full Text] [PDF] Atlas Genet Cytogenet Oncol Haematol 2007; 2 - I - URL : http://AtlasGeneticsOncology.org/Genes/TRIM24ID504ch7q34.html RUNX 2 (Runt-related transcription factor 2) (6p21). Athanasios G Papavassiliou, Panos Ziros. Atlas Genet Cytogenet Oncol Haematol 2007; 11 (2): 142-147. [Full Text] [PDF] URL : http://AtlasGeneticsOncology.org/Genes/RUNX2ID42183ch6p21.html PTPRG (protein tyrosine phosphatase, receptor type, G) (3p14.2). Cornelis P Tensen, Remco van Doorn.
    [Show full text]