DOCSLIB.ORG

Genesymbol Gene Description AASS Aminoadipate-Semialdehyde

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genesymbol Gene Description AASS Aminoadipate-Semialdehyde GeneSymbol Gene description AASS aminoadipate-semialdehyde synthase ACVR1 activin A receptor, type I ADAM15 ADAM metallopeptidase domain 15 (metargidin) ADH7 alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide amylo-1, 6-glucosidase, 4-alpha-glucanotransferase (glycogen AGL debranching enzyme, glycogen storage disease type III) AKAP12 A kinase (PRKA) anchor protein (gravin) 12 AKR1B10 aldo-keto reductase family 1, member B10 (aldose reductase) aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid AKR1C3 dehydrogenase, type II) ALDH1A1 aldehyde dehydrogenase 1 family, member A1 ALDH2 aldehyde dehydrogenase 2 family (mitochondrial) ALDH3A2 aldehyde dehydrogenase 3 family, member A2 ALS2CL ALS2 C-terminal like ALS2CR3 amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3 AMACR alpha-methylacyl-CoA racemase ANXA1 annexin A1 AOX1 aldehyde oxidase 1 amyloid beta (A4) precursor protein-binding, family B, member 1 APBB1IP interacting protein APOBEC1 apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1 APOE apolipoprotein E APS adaptor protein with pleckstrin homology and src homology 2 domains AQP1 aquaporin 1 (channel-forming integral protein, 28kDa) ARG1 arginase, liver ARHGDIB Rho GDP dissociation inhibitor (GDI) beta ASF1A ASF1 anti-silencing function 1 homolog A (S. cerevisiae) ATF3 activating transcription factor 3 ATF4 activating transcription factor 4 (tax-responsive enhancer element B67) Caution, check this probeset carefully. This probeset may detect an unusual splice variant, alternate termination site, or extended transcript of ATM ataxia telangiectasia mutated ATP6V0B ATPase, H+ transporting, lysosomal 21kDa, V0 subunit c'' AXL AXL receptor tyrosine kinase B3GALT2 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2 BAX BCL2-associated X protein BCAT1 branched chain aminotransferase 1, cytosolic BCKDHA branched chain keto acid dehydrogenase E1, alpha polypeptide BMX BMX non-receptor tyrosine kinase C1QA complement component 1, q subcomponent, alpha polypeptide C1QB complement component 1, q subcomponent, beta polypeptide CACNA1S calcium channel, voltage-dependent, L type, alpha 1S subunit CALCR calcitonin receptor CAPG capping protein (actin filament), gelsolin-like CASK calcium/calmodulin-dependent serine protein kinase (MAGUK family) CAT catalase CBR1 carbonyl reductase 1 Caution, check this probeset carefully. This probeset may detect an unusual splice variant, alternate termination site, or extended transcript of CCKAR cholecystokinin A receptor CCL7 chemokine (C-C motif) ligand 7 CCR1 chemokine (C-C motif) receptor 1 CCR2 chemokine (C-C motif) receptor 2 CCS copper chaperone for superoxide dismutase CD3E CD3E antigen, epsilon polypeptide (TiT3 complex) CDC7 CDC7 cell division cycle 7 (S. cerevisiae) CDH15 cadherin 15, M-cadherin (myotubule) CEBPB CCAAT/enhancer binding protein (C/EBP), beta CENTB2 centaurin, beta 2 cystic fibrosis transmembrane conductance regulator (ATP-binding CFTR cassette sub-family C, member 7) CHML choroideremia-like (Rab escort protein 2) CIDEB cell death-inducing DFFA-like effector b Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal CITED1 domain, 1 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal CITED2 domain, 2 CLEC4E C-type lectin domain family 4, member E CNR1 cannabinoid receptor 1 (brain) COL1A1 collagen, type I, alpha 1 Caution, check this probeset carefully. This probeset may detect an alternate termination site or extended transcript of collagen, type III, alpha COL3A1 1 (Ehlers-Danlos syndrome type IV, autosomal dominant) COL4A2 collagen, type IV, alpha 2 COL6A1 collagen, type VI, alpha 1 COL6A3 collagen, type VI, alpha 3 CPN2 carboxypeptidase N, polypeptide 2, 83kD CRY1 cryptochrome 1 (photolyase-like) colony stimulating factor 1 receptor, formerly McDonough feline sarcoma CSF1R viral (v-fms) oncogene homolog CSF3R colony stimulating factor 3 receptor (granulocyte) CTSB cathepsin B CTSC cathepsin C CTSE cathepsin E CTSS cathepsin S CX3CL1 chemokine (C-X3-C motif) ligand 1 CXCL13 chemokine (C-X-C motif) ligand 13 (B-cell chemoattractant) CXCL5 chemokine (C-X-C motif) ligand 5 CXCL6 chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2) CXorf6 chromosome X open reading frame 6 CYBA cytochrome b-245, alpha polypeptide CYP1B1 cytochrome P450, family 1, subfamily B, polypeptide 1 CYP2A6 cytochrome P450, family 2, subfamily A, polypeptide 6 CYP2A7 cytochrome P450, family 2, subfamily A, polypeptide 7 CYP2B6 cytochrome P450, family 2, subfamily B, polypeptide 6 DBT dihydrolipoamide branched chain transacylase E2 DDC dopa decarboxylase (aromatic L-amino acid decarboxylase) DIO2 deiodinase, iodothyronine, type II DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous DMC1 recombination (yeast) DMN desmuslin DNAJA2 DnaJ (Hsp40) homolog, subfamily A, member 2 DNAJB1 DnaJ (Hsp40) homolog, subfamily B, member 1 DNAJB9 DnaJ (Hsp40) homolog, subfamily B, member 9 DUSP8 dual specificity phosphatase 8 DYRK2 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 EDNRA endothelin receptor type A EIF2B4 eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa EMCN endomucin EMILIN1 elastin microfibril interfacer 1 ENPEP glutamyl aminopeptidase (aminopeptidase A) ENTPD5 ectonucleoside triphosphate diphosphohydrolase 5 EPHX1 epoxide hydrolase 1, microsomal (xenobiotic) EPIM epimorphin EPX eosinophil peroxidase excision repair cross-complementing rodent repair deficiency, ERCC2 complementation group 2 (xeroderma pigmentosum D) excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation ERCC5 group G (Cockayne syndrome)) excision repair cross-complementing rodent repair deficiency, ERCC6 complementation group 6 ESD esterase D/formylglutathione hydrolase EVI2A ecotropic viral integration site 2A EXT2 exostoses (multiple) 2 FDXR ferredoxin reductase FGFBP1 fibroblast growth factor binding protein 1 FGR Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog FHL2 four and a half LIM domains 2 FLJ20105 FLJ20105 protein FLT3 fms-related tyrosine kinase 3 FMO2 flavin containing monooxygenase 2 FOS v-fos FBJ murine osteosarcoma viral oncogene homolog FOSL1 FOS-like antigen 1 NM_021784, NM_153675, Caution, check this probeset carefully. This probeset may detect an unusual splice variant, alternate termination site, FOXA2 or extended transcript of forkhead box A2 FOXC1 forkhead box C1 FPRL1 formyl peptide receptor-like 1 FRK fyn-related kinase FTH1 ferritin, heavy polypeptide 1 FTHP1 ferritin, heavy polypeptide pseudogene 1 G6PD glucose-6-phosphate dehydrogenase GAA glucosidase, alpha; acid (Pompe disease, glycogen storage disease type II) GAB1 GRB2-associated binding protein 1 GABPB2 GA binding protein transcription factor, beta subunit 2 GADD45A growth arrest and DNA-damage-inducible, alpha phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole GART synthetase GAS1 growth arrest-specific 1 GCLC glutamate-cysteine ligase, catalytic subunit GCLM glutamate-cysteine ligase, modifier subunit GDF15 growth differentiation factor 15 GFPT2 glutamine-fructose-6-phosphate transaminase 2 GGCX gamma-glutamyl carboxylase GGT1 gamma-glutamyltransferase 1 GK glycerol kinase guanine nucleotide binding protein (G protein), alpha transducing activity GNAT1 polypeptide 1 GP1BB glycoprotein Ib (platelet), beta polypeptide GP9 glycoprotein IX (platelet) GPC1 glypican 1 GPI glucose phosphate isomerase GPX1 glutathione peroxidase 1 GPX2 glutathione peroxidase 2 (gastrointestinal) GPX3 glutathione peroxidase 3 (plasma) GPX4 glutathione peroxidase 4 (phospholipid hydroperoxidase) GPX5 glutathione peroxidase 5 (epididymal androgen-related protein) GPX7 glutathione peroxidase 7 GRIA1 glutamate receptor, ionotropic, AMPA 1 GRPR gastrin-releasing peptide receptor GSR glutathione reductase GSTA3 glutathione S-transferase A3 GSTM1 glutathione S-transferase M1 GSTM3 glutathione S-transferase M3 (brain) GSTM5 glutathione S-transferase M5 homocysteine-inducible, endoplasmic reticulum stress-inducible, HERPUD1 ubiquitin-like domain member 1 hypoxia-inducible factor 1, alpha subunit (basic helix-loop-helix HIF1A transcription factor) HMHA1 histocompatibility (minor) HA-1 HMOX1 heme oxygenase (decycling) 1 HNRPA1 heterogeneous nuclear ribonucleoprotein A1 HNRPDL heterogeneous nuclear ribonucleoprotein D-like HOXB5 homeo box B5 HPGD hydroxyprostaglandin dehydrogenase 15-(NAD) HPN hepsin (transmembrane protease, serine 1) HPX hemopexin HPX hemopexin HSPA1A heat shock 70kDa protein 1A HSPA1B heat shock 70kDa protein 1B HSPA1L heat shock 70kDa protein 1-like HSPA5 heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) HSPA6 heat shock 70kDa protein 6 (HSP70B') HSPH1 heat shock 105kDa/110kDa protein 1 ICOS inducible T-cell co-stimulator IDH1 isocitrate dehydrogenase 1 (NADP+), soluble IGF1 insulin-like growth factor 1 (somatomedin C) IGFBP2 insulin-like growth factor binding protein 2, 36kDa IGFBP5 insulin-like growth factor binding protein 5 IL13RA1 interleukin 13 receptor, alpha 1 IL4R interleukin 4 receptor IL6 interleukin 6 (interferon, beta 2) IMPDH1 IMP (inosine monophosphate) dehydrogenase 1 ING1 inhibitor of growth family, member 1 INHBB inhibin, beta B (activin AB beta polypeptide) ISGF3G interferon-stimulated transcription factor 3, gamma 48kDa integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated ITGB2 antigen 1; macrophage antigen 1 (mac-1)
Load more

Recommended publications
  • Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis.
    [Show full text]
  • CRISPR Screening of Porcine Sgrna Library Identifies Host Factors
    ARTICLE https://doi.org/10.1038/s41467-020-18936-1 OPEN CRISPR screening of porcine sgRNA library identifies host factors associated with Japanese encephalitis virus replication Changzhi Zhao1,5, Hailong Liu1,5, Tianhe Xiao1,5, Zichang Wang1, Xiongwei Nie1, Xinyun Li1,2, Ping Qian2,3, Liuxing Qin3, Xiaosong Han1, Jinfu Zhang1, Jinxue Ruan1, Mengjin Zhu1,2, Yi-Liang Miao 1,2, Bo Zuo1,2, ✉ ✉ Kui Yang4, Shengsong Xie 1,2 & Shuhong Zhao 1,2 1234567890():,; Japanese encephalitis virus (JEV) is a mosquito-borne zoonotic flavivirus that causes ence- phalitis and reproductive disorders in mammalian species. However, the host factors critical for its entry, replication, and assembly are poorly understood. Here, we design a porcine genome-scale CRISPR/Cas9 knockout (PigGeCKO) library containing 85,674 single guide RNAs targeting 17,743 protein-coding genes, 11,053 long ncRNAs, and 551 microRNAs. Subsequently, we use the PigGeCKO library to identify key host factors facilitating JEV infection in porcine cells. Several previously unreported genes required for JEV infection are highly enriched post-JEV selection. We conduct follow-up studies to verify the dependency of JEV on these genes, and identify functional contributions for six of the many candidate JEV- related host genes, including EMC3 and CALR. Additionally, we identify that four genes associated with heparan sulfate proteoglycans (HSPGs) metabolism, specifically those responsible for HSPGs sulfurylation, facilitate JEV entry into porcine cells. Thus, beyond our development of the largest CRISPR-based functional genomic screening platform for pig research to date, this study identifies multiple potentially vulnerable targets for the devel- opment of medical and breeding technologies to treat and prevent diseases caused by JEV.
    [Show full text]
  • DBT Gene Dihydrolipoamide Branched Chain Transacylase E2
    DBT gene dihydrolipoamide branched chain transacylase E2 Normal Function The DBT gene provides instructions for making part of a group of enzymes called the branched-chain alpha-keto acid dehydrogenase (BCKD) enzyme complex. Specifically, the protein produced from the DBT gene forms a critical piece of the enzyme complex called the E2 component. The BCKD enzyme complex is responsible for one step in the normal breakdown of three protein building blocks (amino acids). These amino acids—leucine, isoleucine, and valine—are obtained from the diet. They are present in many kinds of food, particularly protein-rich foods such as milk, meat, and eggs. The BCKD enzyme complex is active in mitochondria, which are specialized structures inside cells that serve as energy-producing centers. The breakdown of leucine, isoleucine, and valine produces molecules that can be used for energy. Health Conditions Related to Genetic Changes Maple syrup urine disease More than 70 mutations in the DBT gene have been identified in people with maple syrup urine disease, most often in individuals with mild variants of the disorder. These variant forms become apparent later in infancy or childhood, and they lead to delayed development and other health problems if not treated. Mutations in the DBT gene include changes in single DNA building blocks (base pairs) and insertions or deletions of a small amount of DNA in the DBT gene. These changes disrupt the normal function of the E2 component, preventing the BCKD enzyme complex from effectively breaking down leucine, isoleucine, and valine. As a result, these amino acids and their byproducts build up in the body.
    [Show full text]
  • The Aldehyde Dehydrogenase ALDH2*2 Allele Exhibits Dominance Over ALDH2*1 in Transduced Hela Cells
    The aldehyde dehydrogenase ALDH2*2 allele exhibits dominance over ALDH2*1 in transduced HeLa cells. Q Xiao, … , T Johnston, D W Crabb J Clin Invest. 1995;96(5):2180-2186. https://doi.org/10.1172/JCI118272. Research Article Individuals heterozygous or homozygous for the variant aldehyde dehydrogenase (ALDH2) allele (ALDH2*2), which encodes a protein differing only at residue 487 from the normal protein, have decreased ALDH2 activity in liver extracts and experience cutaneous flushing when they drink alcohol. The mechanisms by which this allele exerts its dominant effect is unknown. To study this effect, the human ALDH2*1 cDNA was cloned and the ALDH2*2 allele was generated by site-directed mutagenesis. These cDNAs were transduced using retroviral vectors into HeLa and CV1 cells, which do not express ALDH2. The normal allele directed synthesis of immunoreactive ALDH2 protein (ALDH2E) with the expected isoelectric point. Extracts of these cells contained increased aldehyde dehydrogenase activity with low Km for the aldehyde substrate. The ALDH2*2 allele directed synthesis of mRNA and immunoreactive protein (ALDH2K), but the protein lacked enzymatic activity. When ALDH2*1-expressing cells were transduced with ALDH2*2 vectors, both mRNAs were expressed and immunoreactive proteins with isoelectric points ranging between those of ALDH2E and ALDH2K were present, indicating that the subunits formed heteromers. ALDH2 activity in these cells was reduced below that of the parental ALDH2*1-expressing cells. Thus, the ALDH2*2 allele is sufficient to cause ALDH2 deficiency in vitro. Find the latest version: https://jci.me/118272/pdf The Aldehyde Dehydrogenase ALDH2*2 Allele Exhibits Dominance over ALDH2*1 in Transduced HeLa Cells Qing Xiao, * Henry Weiner,* Timothy Johnston,* and David W.
    [Show full text]
  • ZNF44 (NM 016264) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC224254 ZNF44 (NM_016264) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: ZNF44 (NM_016264) Human Tagged ORF Clone Tag: Myc-DDK Symbol: ZNF44 Synonyms: GIOT-2; KOX7; ZNF; ZNF55; ZNF58; ZNF504 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 ZNF44 (NM_016264) Human Tagged ORF Clone – RC224254 ORF Nucleotide >RC224254 representing NM_016264 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACTCAGTGGCCTTTGAGGATGTGGCTGTGAACTTCACCCATGAGGAGTGGGCTTTGCTGGGTCCAT CACAGAAGAATCTCTACAGAGATGTGATGCGAGAAACCATTAGGAACCTGAACTGTATAGGAATGAAATG GGAAAACCAGAACATTGATGATCAGCACCAAAATCTCAGGAGAAATCCAAGGTGTGATGTGGTAGAGAGA TTTGGTAAAAGTAAAGATGGTAGTCAGTGTGGAGAAACCTTAAGCCAGATTCGAAATAGTATTGTAAACA AGAACACTCCCGCCAGAGTAGATGCATGTGGAAGCAGTGTGAATGGAGAAGTCATAATGGGTCATTCATC CCTGAATTGCTACATCAGAGTTGATACTGGACACAAACACCGGGAGTGTCATGAATATGCAGAGAAGTCA TATACACATAAGCAGTGTGGGAAAGGCTTAAGTTATCGCCACTCCTTTCAAACATGTGAAAGGCCTCACA CTGGAAAGAAACCCTATGATTGTAAGGAATGTGGAAAAACCTTCAGTTCTCCTGGAAACCTTCGAAGACA TATGGTAGTAAAAGGTGGAGATGGACCTTATAAATGTGAATTGTGTGGGAAAGCCTTTTTTTGGCCCAGT
    [Show full text]
  • Thiamine Dependency and Related Gene Mutations: Recent Aspects
    Int J Anal Bio-Sci Vol. 3, No 4 (2015) 〈Review Article〉 Thiamine dependency and related gene mutations: recent aspects Sachiko Kiuchi1, Hiroshi Ihara1, Yoshikazu Nishiguchi2, Nobue Ito3, Hiromitsu Yokota3 and Naotaka Hashizume4 Summary Thiamine dependency is an inherited metabolic disorder from which patients exhibit severe symptoms of deficiency, although they are fed more than the normal requirement of this vitamin. Deficiency symptoms can be treated with pharmacologic doses of thiamine as high as 100 to 1,000 times the Dietary Reference Values. Thiamine dependency is nowadays classified as a disorder caused by genetic mutations affecting thiamine-dependent enzymes or thiamine transporter, which transports thiamine to cells. The former mutation on enzyme is known as a pyruvate dehydrogenase complex deficiency (i.e., congenital lactic acidemia and Leigh syndrome) and a deficiency in branched- chain α-ketoacid dehydrogenase complex (i.e., maple syrup urine disease). The latter are known as mutations in thiamine transporter gene that makes protein transporting thiamine into cells (encoded by SLC19A2 and SLC19A3 genes) and protein transporting thiamine diphosphate into the mitochon- dria (encoded by SLC25A19 gene). Thiamine-responsive megaloblastic anemia (TRMA), an autosomal recessive disease, is caused by loss of functional mutation in the SLC19A2 (ThTr-1). Key words: Vitamin B1 dependency, Thiamine deficiency, Maple syrup urine disease, Megaloblastic anemia, Thiamine transporter 1. Introduction the normal daily requirement from diets, dietary supplements, or intravenous dosage. The deficiency To maintain normal carbohydrate metabolism in symptoms were better treated by taking amounts of the body, we have to ingest thiamine from our diet. thiamine 100-fold greater or more than that of the The daily required amounts are 1.4 mg (4.2 µmol) for daily requirement, but the symptoms would reappear men and 1.1 mg (3.3 µmol) for women for Japanese if the treatment was stopped4.
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • Corning® Supersomes™ Ultra Human Aldehyde Oxidase
    Corning® Supersomes™ Ultra Human Aldehyde Oxidase Aldehyde Oxidase (AO) is a cytosolic enzyme that plays an important role in non-CYP mediated drug metabolism and pharmacokinetics. AO has garnered significant attention in the pharmaceutical industry due to multiple drug failures during clinical trials that were associated with the AO pathway and an increase in the number of aromatic aza-heterocycle moieties found in drug leads that have been identified as substrates for AO. Traditionally, recombinant AO (rAO) is expressed in bacteria. However, this approach has disadvantages such as different protein post-translation modifications that lead to different function as compared to mammalian cells. Corning has developed Corning Supersomes Ultra Aldehyde Oxidase, a recombinant human AO enzyme utilizing a mammalian cell-based expression system to address these issues. This product will enable early assessment of the liability of AO for drug metabolism and clearance. Corning Supersomes Ultra Human Aldehyde Oxidase has been over-expressed in HEK-293 cells and exhibited a significantly higher activity as compared to AO expressed in E. coli. Time- dependent enzyme kinetics, using known substrates and inhibitors, between the rAO and the native form found in human liver cytosol produced a good correlation. Features and Benefits of Corning Supersomes Ultra Aldehyde Oxidase Mammalian cell expression system Corning Supersomes Ultra Human Aldehyde Oxidase Performance Corning Supersomes Ultra AO have been engineered in HEK-293 mammalian cells, thereby eliminating the biosafety concerns Activity Comparison Utilizing Probe Substrate (Zaleplon, 250 µM) associated with baculovirus. Stable and reliable in vitro tool 25 Corning Supersomes Ultra AO are a stable and reliable in vitro tool for the study of AO-mediated metabolism, which provides a 20 quantitative contribution of drug clearance.
    [Show full text]
  • Potassium Channels in Epilepsy
    Downloaded from http://perspectivesinmedicine.cshlp.org/ on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press Potassium Channels in Epilepsy Ru¨diger Ko¨hling and Jakob Wolfart Oscar Langendorff Institute of Physiology, University of Rostock, Rostock 18057, Germany Correspondence: [email protected] This review attempts to give a concise and up-to-date overview on the role of potassium channels in epilepsies. Their role can be defined from a genetic perspective, focusing on variants and de novo mutations identified in genetic studies or animal models with targeted, specific mutations in genes coding for a member of the large potassium channel family. In these genetic studies, a demonstrated functional link to hyperexcitability often remains elusive. However, their role can also be defined from a functional perspective, based on dy- namic, aggravating, or adaptive transcriptional and posttranslational alterations. In these cases, it often remains elusive whether the alteration is causal or merely incidental. With 80 potassium channel types, of which 10% are known to be associated with epilepsies (in humans) or a seizure phenotype (in animals), if genetically mutated, a comprehensive review is a challenging endeavor. This goal may seem all the more ambitious once the data on posttranslational alterations, found both in human tissue from epilepsy patients and in chronic or acute animal models, are included. We therefore summarize the literature, and expand only on key findings, particularly regarding functional alterations found in patient brain tissue and chronic animal models. INTRODUCTION TO POTASSIUM evolutionary appearance of voltage-gated so- CHANNELS dium (Nav)andcalcium (Cav)channels, Kchan- nels are further diversified in relation to their otassium (K) channels are related to epilepsy newer function, namely, keeping neuronal exci- Psyndromes on many different levels, ranging tation within limits (Anderson and Greenberg from direct control of neuronal excitability and 2001; Hille 2001).
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Promiscuity and Specificity of Eukaryotic Glycosyltransferases
    Biochemical Society Transactions (2020) 48 891–900 https://doi.org/10.1042/BST20190651 Review Article Promiscuity and specificity of eukaryotic glycosyltransferases Ansuman Biswas and Mukund Thattai Simons Centre for the Study of Living Machines, National Centre for Biological Sciences, TIFR, Bangalore, India Correspondence: Mukund Thattai ([email protected]) Glycosyltransferases are a large family of enzymes responsible for covalently linking sugar monosaccharides to a variety of organic substrates. These enzymes drive the synthesis of complex oligosaccharides known as glycans, which play key roles in inter-cellular interac- tions across all the kingdoms of life; they also catalyze sugar attachment during the syn- thesis of small-molecule metabolites such as plant flavonoids. A given glycosyltransferase enzyme is typically responsible for attaching a specific donor monosaccharide, via a spe- cific glycosidic linkage, to a specific moiety on the acceptor substrate. However these enzymes are often promiscuous, able catalyze linkages between a variety of donors and acceptors. In this review we discuss distinct classes of glycosyltransferase promiscuity, each illustrated by enzymatic examples from small-molecule or glycan synthesis. We high- light the physical causes of promiscuity, and its biochemical consequences. Structural studies of glycosyltransferases involved in glycan synthesis show that they make specific contacts with ‘recognition motifs’ that are much smaller than the full oligosaccharide sub- strate. There is a wide range in the sizes of glycosyltransferase recognition motifs: highly promiscuous enzymes recognize monosaccharide or disaccharide motifs across multiple oligosaccharides, while highly specific enzymes recognize large, complex motifs found on few oligosaccharides. In eukaryotes, the localization of glycosyltransferases within compartments of the Golgi apparatus may play a role in mitigating the glycan variability caused by enzyme promiscuity.
    [Show full text]
  • Expression Profiling of Ion Channel Genes Predicts Clinical Outcome in Breast Cancer
    UCSF UC San Francisco Previously Published Works Title Expression profiling of ion channel genes predicts clinical outcome in breast cancer Permalink https://escholarship.org/uc/item/1zq9j4nw Journal Molecular Cancer, 12(1) ISSN 1476-4598 Authors Ko, Jae-Hong Ko, Eun A Gu, Wanjun et al. Publication Date 2013-09-22 DOI http://dx.doi.org/10.1186/1476-4598-12-106 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Ko et al. Molecular Cancer 2013, 12:106 http://www.molecular-cancer.com/content/12/1/106 RESEARCH Open Access Expression profiling of ion channel genes predicts clinical outcome in breast cancer Jae-Hong Ko1, Eun A Ko2, Wanjun Gu3, Inja Lim1, Hyoweon Bang1* and Tong Zhou4,5* Abstract Background: Ion channels play a critical role in a wide variety of biological processes, including the development of human cancer. However, the overall impact of ion channels on tumorigenicity in breast cancer remains controversial. Methods: We conduct microarray meta-analysis on 280 ion channel genes. We identify candidate ion channels that are implicated in breast cancer based on gene expression profiling. We test the relationship between the expression of ion channel genes and p53 mutation status, ER status, and histological tumor grade in the discovery cohort. A molecular signature consisting of ion channel genes (IC30) is identified by Spearman’s rank correlation test conducted between tumor grade and gene expression. A risk scoring system is developed based on IC30. We test the prognostic power of IC30 in the discovery and seven validation cohorts by both Cox proportional hazard regression and log-rank test.
    [Show full text]