Durham Research Online

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Durham Research Online Deposited in DRO: 09 June 2015 Version of attached le: Published Version Peer-review status of attached le: Peer-reviewed Citation for published item: Schmid, R. and Grellscheid, S.N. and Ehrmann, I. and Dalgliesh, C. and Danilenko, M. and Paronetto, M.P. and Pedrotti, S. and Grellscheid, D. and Dixon, R.J. and Sette, C. and Eperon, I.C. and Elliott, D.J. (2013) 'The splicing landscape is globally reprogrammed during male meiosis.', Nucleic acids research., 41 (22). pp. 10170-10184. Further information on publisher's website: http://dx.doi.org/10.1093/nar/gkt811 Publisher's copyright statement: c The Author(s) 2013. Published by Oxford University Press. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. Additional information: Use policy The full-text may be used and/or reproduced, and given to third parties in any format or medium, without prior permission or charge, for personal research or study, educational, or not-for-prot purposes provided that: • a full bibliographic reference is made to the original source • a link is made to the metadata record in DRO • the full-text is not changed in any way The full-text must not be sold in any format or medium without the formal permission of the copyright holders. Please consult the full DRO policy for further details. Durham University Library, Stockton Road, Durham DH1 3LY, United Kingdom Tel : +44 (0)191 334 3042 | Fax : +44 (0)191 334 2971 https://dro.dur.ac.uk 10170–10184 Nucleic Acids Research, 2013, Vol. 41, No. 22 Published online 12 September 2013 doi:10.1093/nar/gkt811 The splicing landscape is globally reprogrammed during male meiosis Ralf Schmid1,*, Sushma Nagaraja Grellscheid2,3,*, Ingrid Ehrmann2, Caroline Dalgliesh2, Marina Danilenko2, Maria Paola Paronetto4,5, Simona Pedrotti5,6, David Grellscheid7, Richard J. Dixon8, Claudio Sette5,6, Ian C. Eperon1,* and David J. Elliott2,* 1Department of Biochemistry, University of Leicester, Leicester, LE1 9HN, UK, 2Institute of Genetic Medicine, Newcastle University, Newcastle upon Tyne, NE1 3BZ, UK, 3School of Biological and Biomedical Sciences, Durham University, Durham, DH1 3LE, UK, 4Department of Health Sciences, University of 00135 Rome ‘Foro Italico’, Rome, Italy, 5Laboratories of Neuroembryology and of Cellular and Molecular Neurobiology, Fondazione Santa Lucia IRCCS, 00143 Rome, Italy, 6Department of Public Health and Cell Biology, University Downloaded from of Rome Tor Vergata, 00133 Rome, Italy, 7Institute of Particle Physics Phenomenology, Durham University, Durham, DH1 3LE, UK and 8Life Technologies Ltd., Paisley PA4 9RF, UK Received January 23, 2013; Revised August 15, 2013; Accepted August 16, 2013 http://nar.oxfordjournals.org/ ABSTRACT INTRODUCTION Meiosis requires conserved transcriptional changes, Most mammalian protein-coding genes are comprised of but it is not known whether there is a corresponding multiple exons and introns. Introns are generally much set of RNA splicing switches. Here, we used RNAseq longer than exons and are removed from the initial tran- of mouse testis to identify changes associated with script by pre-mRNA splicing. In 90% of genes, multiple the progression from mitotic spermatogonia to mRNA isoforms are produced as a result of either the existence of multiple splicing pathways (alternative meiotic spermatocytes. We identified 150 splicing splicing) or the use of different promoters or termination at ESA Society Member Access on June 9, 2015 switches, most of which affect conserved protein- sites (1–3). Many alternative exons have been found (4) coding exons. The expression of many key splicing through sequencing of full-length mRNAs and expressed regulators changed in the course of meiosis, including sequence tags. Each human protein coding gene produces downregulation of polypyrimidine tract binding an average of 11 mRNA isoforms through alternative protein (PTBP1) and heterogeneous nuclear RNP A1, splicing, and recent estimates suggest there are >82 000 and upregulation of nPTB, Tra2b, muscleblind, CELF transcriptional initiation sites and 128 000 alternative proteins, Sam68 and T-STAR. The sequences near the polyadenylation sites for 21 000 human protein coding regulated exons were significantly enriched in target genes (5). As the use of many splice sites and alternative sites for PTB, Tra2b and STAR proteins. Reporter promoters or polyadenylation sites is regulated in minigene experiments investigating representative response to extracellular cues or during development, al- exons in transfected cells showed that PTB binding ternative mRNA isoforms can determine the functions of sites were critical for splicing of a cassette exon in the a gene in different circumstances. Ralgps2 mRNA and a shift in alternative 50 splice site Because splicing amplifies the functional content of the genome, there is currently great interest in how both RNA usage in the Bptf mRNA. We speculate that nPTB splicing regulators and mRNA isoforms are modulated in might functionally replace PTBP1 during meiosis for development (6). Extensive splicing switches have been some target exons, with changes in the expression of found in the heart, the immune system and brain (7–11), other splicing factors helping to establish meiotic and some human diseases such as myotonic dystrophy splicing patterns. Our data suggest that there are sub- are caused by defects in developmental splicing (12). stantial changes in the determinants and patterns of Spermatogenesis is one of the most radical pathways alternative splicing in the mitotic-to-meiotic transition of development still maintained in adult animals. of the germ cell cycle. Spermatogenesis involves alterations in both chromosome *To whom correspondence should be addressed. Tel: +44 191 241 8694; Fax: +44 191 241 8666; Email: [email protected] Correspondence may also be addressed to Ian C. Eperon. Tel: +44 116 229 7012; Fax: +44 116 229 7018; Email: [email protected] Correspondence may also be addressed to Ralf Schmid. Tel: +44 116 229 7023; Fax: +44 116 229 7018; Email: [email protected] Correspondence may also be addressed to Sushma N. Grellscheid. Tel: +44 791 362 2690; Fax: +44 191 334 1201; Email: [email protected] The authors wish it to be known that, in their opinion, the first two authors should be regarded as Joint First Authors. ß The Author(s) 2013. Published by Oxford University Press. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. Nucleic Acids Research, 2013, Vol. 41, No. 22 10171 number and cell morphology to convert a diploid stem cell production over meiosis and to comprehensively monitor in which chromatin is packaged with histones into a motile the expression of RNA splicing regulator proteins over haploid cell with a compact nucleus containing chromatin this timeframe. Interestingly, PTB is essential for male packaged with protamines. Exon-specific microarrays germ cell development in fruitflies (30,31). We speculate have detected more alternative splicing in the whole that although polypyrimidine tract binding protein adult testis than in any other tissue except the brain (PTBP1) is downregulated in meiosis, nPTB might func- (13), although at what stage in spermatogenesis this tionally replace it and thus ensure correct regulation of splicing regulation originates is not known. Perhaps the PTB-dependent splicing events during germ cell differen- most important question concerning changes in alterna- tiation. Moreover, other RNA splicing regulators also tive splicing patterns during male germ cell development is change in abundance during germ cell differentiation, sug- whether it is connected to meiosis. Unlike cells in mitosis, gesting that they contribute to the meiotic patterns of in which transcription is turned off, meiotic cells are splicing that we observe. highly transcriptionally active (14). In the single-celled yeast Saccharomyces cerevisiae, meiosis is the only stage in the lifecycle to include alternative splicing. In fact, the MATERIALS AND METHODS timing of the gene expression changes that drive meiotic RNA sequencing Downloaded from progression in yeast is determined by a hierarchy of meiotic splicing events (12,15). Sequencing reactions were done on pooled RNA samples Adult male germ cell development takes around 30 days from 6 and 21 dpp mouse testis by Source Bioscience, in the testis (Figure 1A). Male mice are not born with a Nottingham, UK. Four lanes of the flowcell were used for the sequencing of the 6 and 21 dpp samples on the fully developed male germ cell development pathway, and http://nar.oxfordjournals.org/ instead the first wave of spermatogenesis is initiated syn- Genome Analyzer II. The Genome Analyzer (GA) was chronously after birth (17). The testes of newborn mice run for 38 cycles. The images from the GA were contain germ cells arrested at the G0 and G1 stages of analyzed with the GA pipeline software (v1.3, Illumina the cell cycle. By 6 days post partum (dpp), these germ software) on cycles 1–38 to undertake image analysis, cells have differentiated into spermatogonia, a cell popu- base calling and sequence alignment to the reference lation that includes stem cells. At 10 dpp, some genome. In all, 5 345 040 and 5 561 352 quality filtered spermatogonia differentiate into meiotic spermatocytes. reads were obtained for the 6 dpp sample, and 7 629 529 Meiosis commences 12 dpp. The first meiotic division and 7 610 503 were obtained for the 21 dpp sample. The (meiosis I) is complete by 21 dpp, after which there is a mouse NCBI Build 37.1 (mm9) was used as a reference at ESA Society Member Access on June 9, 2015 rapid second cell division (meiosis II) followed by progres- genome used for the read alignment.
Recommended publications
  • A 475 Years-Old Founder Effect Involving IL12RB1: a Highly Prevalent Mutation Conferring Mendelian Susceptibility to Mycobacterial Diseases in European Descendants

    A 475 Years-Old Founder Effect Involving IL12RB1: a Highly Prevalent Mutation Conferring Mendelian Susceptibility to Mycobacterial Diseases in European Descendants

    Infection, Genetics and Evolution 9 (2009) 574–580 Contents lists available at ScienceDirect Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid A 475 years-old founder effect involving IL12RB1: A highly prevalent mutation conferring Mendelian Susceptibility to Mycobacterial Diseases in European descendants J. Yancoski a, C. Rocco a, A. Bernasconi a, M. Oleastro a, L. Bezrodnik b, C. Vra´tnica c, F. Haerynck d, S.D. Rosenzweig a,* a Hospital Nacional de Pediatrı´a J. P. Garrahan, Buenos Aires, Argentina b Hospital de Nin˜os Ricardo Gutierrez, Buenos Aires, Argentina c Hospital de Nin˜os Juan Pablo II, Corrientes, Argentina d Ghent University Hospital, Ghent, Belgium ARTICLE INFO ABSTRACT Article history: Mutations in IFNGR1, IFNGR2, IL12RB1, IL12B, STAT1 and NEMO result in a common clinical phenotype Received 11 December 2008 known as Mendelian Susceptibility to Mycobacterial Diseases (MSMD). Interleukin-12 receptor b1 (IL- Received in revised form 13 February 2009 12Rb1) deficiency is the most common genetic etiology for MSMD. Known mutations affecting IL12RB1 Accepted 16 February 2009 are recessively inherited and are associated with null response to both IL-12 and IL-23. Mutation IL12RB1 Available online 9 March 2009 1623_1624delinsTT was originally described in 5 families from European origin (2 from Germany; 1 from Cyprus, France and Belgium). Interestingly, this same mutation was found in an unexpectedly high Keywords: prevalence among IL-12Rb1 deficient patients in Argentina: 5-out-of-6 individuals born to unrelated Hot spot families carried this particular change. To determine whether mutation 1623_1624delinsTT represents a Salmonella Bacillus Calmette Guerin DNA mutational hotspot or a founder effect, 34 polymorphic markers internal or proximal to IL12RB1 Interferon gamma were studied in the Argentinean and the Belgian patients.
  • NASP Polyclonal Antibody

    NASP Polyclonal Antibody

    For Research Use Only NASP Polyclonal antibody Catalog Number:11323-1-AP Featured Product 7 Publications www.ptgcn.com Catalog Number: GenBank Accession Number: Recommended Dilutions: Basic Information 11323-1-AP BC010105 WB 1:500-1:2400 Size: GeneID (NCBI): IP 0.5-4.0 ug for IP and 1:500-1:2000 700 μg/ml 4678 for WB IHC 1:20-1:200 Source: Full Name: IF 1:10-1:100 Rabbit nuclear autoantigenic sperm protein Isotype: (histone-binding) IgG Calculated MW: Purification Method: 788 aa, 85 kDa Antigen affinity purification Observed MW: Immunogen Catalog Number: 138 kDa AG1824 Applications Tested Applications: Positive Controls: IF, IHC, IP, WB, ELISA WB : mouse testis tissue; Cited Applications: IP : mouse testis tissue; IHC, WB IHC : human testis tissue; human lymphoma tissue Species Specificity: human, mouse, rat IF : MCF-7 cells; Cited Species: human, mouse, rat Note-IHC: suggested antigen retrieval with TE buffer pH 9.0; (*) Alternatively, antigen retrieval may be performed with citrate buffer pH 6.0 NASP (nuclear autoantigenic sperm protein) is associated with DNA replication, cell proliferation and cell cycle Background Information progression through functioning as a Histone H1 binding protein that mediates histone transport to the nucleus. NASP had two isoforms, tNASP (testis type) and sNASP (somatic type). The tNASP was mainly expressed in testis, a variety of malignant tumors, stem cells and embryonic tissues, while sNASP existed in all somatic mitosis cells. This antibody can recognize both isoforms. Notable Publications Author Pubmed ID Journal Application Qing Yuan 25378924 Int J Nanomedicine WB Nishibu Takahiro T 23229118 Biosci Trends WB Sofie De Munter 28032891 FEBS Lett WB Storage: Storage Store at -20ºC.
  • SFRS14 Antibody (Monoclonal) (M01) Mouse Monoclonal Antibody Raised Against a Partial Recombinant SFRS14

    SFRS14 Antibody (Monoclonal) (M01) Mouse Monoclonal Antibody Raised Against a Partial Recombinant SFRS14

    苏州工业园区双圩路9号1幢 邮 编 : 215000 电 话 : 0512-88856768 SFRS14 Antibody (monoclonal) (M01) Mouse monoclonal antibody raised against a partial recombinant SFRS14. Catalog # AT3845a Specification SFRS14 Antibody (monoclonal) (M01) - Product info Application WB, IHC, IF, E Primary Accession Q8IX01 Other Accession NM_014884 Reactivity Human Host mouse Clonality monoclonal Isotype IgG2a Kappa Clone Names 3C5 Calculated MW 120207 SFRS14 Antibody (monoclonal) (M01) - Additional info Gene ID 10147 Antibody Reactive Against Recombinant Protein.Western Blot detection against Other Names Immunogen (36.3 KDa) . SURP and G-patch domain-containing protein 2, Arginine/serine-rich-splicing factor 14, Splicing factor, arginine/serine-rich 14, SUGP2, KIAA0365, SFRS14 Target/Specificity SFRS14 (NP_055699, 579 a.a. ~ 674 a.a) partial recombinant protein with GST tag. MW of the GST tag alone is 26 KDa. Dilution WB~~1:500~1000 Format Clear, colorless solution in phosphate buffered saline, pH 7.2 . Storage Store at -20°C or lower. Aliquot to avoid repeated freezing and thawing. SFRS14 monoclonal antibody (M01), Precautions clone 3C5 Western Blot analysis of SFRS14 Antibody (monoclonal) (M01) is for research use only SFRS14 expression in Hela S3 NE ( (Cat # and not for use in diagnostic or therapeutic procedures. AT3845a ) SFRS14 Antibody (monoclonal) (M01) - Protocols Provided below are standard protocols that you may find useful for product applications. • Western Blot • Blocking Peptides • Dot Blot • Immunohistochemistry • Immunofluorescence • Immunoprecipitation Immunoperoxidase of monoclonal • Flow Cytomety antibody to SFRS14 on formalin-fixed • Cell Culture paraffin-embedded human testis. SFRS14 Antibody (monoclonal) (M01) - Background [antibody concentration 3 ug/ml] This gene encodes a member of the arginine/serine-rich family of splicing factors.
  • Molecular Evolution of NASP and Conserved Histone H3/H4 Transport Pathway Syed Nabeel-Shah1, Kanwal Ashraf2, Ronald E Pearlman2 and Jeffrey Fillingham1*

    Molecular Evolution of NASP and Conserved Histone H3/H4 Transport Pathway Syed Nabeel-Shah1, Kanwal Ashraf2, Ronald E Pearlman2 and Jeffrey Fillingham1*

    Nabeel-Shah et al. BMC Evolutionary Biology 2014, 14:139 http://www.biomedcentral.com/1471-2148/14/139 RESEARCH ARTICLE Open Access Molecular evolution of NASP and conserved histone H3/H4 transport pathway Syed Nabeel-Shah1, Kanwal Ashraf2, Ronald E Pearlman2 and Jeffrey Fillingham1* Abstract Background: NASP is an essential protein in mammals that functions in histone transport pathways and maintenance of a soluble reservoir of histones H3/H4. NASP has been studied exclusively in Opisthokonta lineages where some functional diversity has been reported. In humans, growing evidence implicates NASP miss-regulation in the development of a variety of cancers. Although a comprehensive phylogenetic analysis is lacking, NASP-family proteins that possess four TPR motifs are thought to be widely distributed across eukaryotes. Results: We characterize the molecular evolution of NASP by systematically identifying putative NASP orthologs across diverse eukaryotic lineages ranging from excavata to those of the crown group. We detect extensive silent divergence at the nucleotide level suggesting the presence of strong purifying selection acting at the protein level. We also observe a selection bias for high frequencies of acidic residues which we hypothesize is a consequence of their critical function(s), further indicating the role of functional constraints operating on NASP evolution. Our data indicate that TPR1 and TPR4 constitute the most rapidly evolving functional units of NASP and may account for the functional diversity observed among well characterized family members. We also show that NASP paralogs in ray-finned fish have different genomic environments with clear differences in their GC content and have undergone significant changes at the protein level suggesting functional diversification.
  • 1 Mutational Heterogeneity in Cancer Akash Kumar a Dissertation

    1 Mutational Heterogeneity in Cancer Akash Kumar a Dissertation

    Mutational Heterogeneity in Cancer Akash Kumar A dissertation Submitted in partial fulfillment of requirements for the degree of Doctor of Philosophy University of Washington 2014 June 5 Reading Committee: Jay Shendure Pete Nelson Mary Claire King Program Authorized to Offer Degree: Genome Sciences 1 University of Washington ABSTRACT Mutational Heterogeneity in Cancer Akash Kumar Chair of the Supervisory Committee: Associate Professor Jay Shendure Department of Genome Sciences Somatic mutation plays a key role in the formation and progression of cancer. Differences in mutation patterns likely explain much of the heterogeneity seen in prognosis and treatment response among patients. Recent advances in massively parallel sequencing have greatly expanded our capability to investigate somatic mutation. Genomic profiling of tumor biopsies could guide the administration of targeted therapeutics on the basis of the tumor’s collection of mutations. Central to the success of this approach is the general applicability of targeted therapies to a patient’s entire tumor burden. This requires a better understanding of the genomic heterogeneity present both within individual tumors (intratumoral) and amongst tumors from the same patient (intrapatient). My dissertation is broadly organized around investigating mutational heterogeneity in cancer. Three projects are discussed in detail: analysis of (1) interpatient and (2) intrapatient heterogeneity in men with disseminated prostate cancer, and (3) investigation of regional intratumoral heterogeneity in
  • Mouse Nasp Conditional Knockout Project (CRISPR/Cas9)

    Mouse Nasp Conditional Knockout Project (CRISPR/Cas9)

    https://www.alphaknockout.com Mouse Nasp Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Nasp conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Nasp gene (NCBI Reference Sequence: NM_016777 ; Ensembl: ENSMUSG00000028693 ) is located on Mouse chromosome 4. 16 exons are identified, with the ATG start codon in exon 2 and the TAA stop codon in exon 16 (Transcript: ENSMUST00000030456). Exon 6~7 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Nasp gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP24-72F14 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a null mutation display embryonic lethality before implantation. Exon 6 starts from about 12.94% of the coding region. The knockout of Exon 6~7 will result in frameshift of the gene. The size of intron 5 for 5'-loxP site insertion: 2248 bp, and the size of intron 7 for 3'-loxP site insertion: 4639 bp. The size of effective cKO region: ~2179 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 5 6 7 16 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Nasp Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats.
  • Genome Wide Association Study of Hippocampal Subfield Volume in PTSD Cases and Trauma-Exposed Controls

    Genome Wide Association Study of Hippocampal Subfield Volume in PTSD Cases and Trauma-Exposed Controls

    bioRxiv preprint doi: https://doi.org/10.1101/456988; this version posted October 30, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Hippocampal subfield GWAS in PTSD Revision date: October 18, 2018 Genome wide association study of hippocampal subfield volume in PTSD cases and trauma-exposed controls Rajendra A. Morey, M.D., M.S. a, b, c, Melanie E. Garrett, M.S. a, d, Jennifer S. Stevens, Ph.D. e, Emily Clarke, M.A. a, c, Courtney C. Haswell, M.S. a, c, Sanne J.H. van Rooij, Ph.D. e, Negar Fani, Ph.D. e, Adriana Lori, Ph.D. e, VA Mid-Atlantic MIRECC Workgroup†, Christine E. Marx, M.D. a, b, Jean C. Beckham, Ph.D. a, Gregory McCarthy, Ph.D. f, Michael A. Hauser, Ph.D. a, d, Allison E. Ashley-Koch, Ph.D. a, d †The VA Mid-Atlantic MIRECC Workgroup includes the following contributors: Mira Brancu, Ph.D., Patrick S. Calhoun, Ph.D., Eric Dedert, Ph.D., Eric B. Elbogen, Ph.D., John A. Fairbank, Ph.D., Robin A. Hurley, M.D., Jason D. Kilts, Ph.D., Nathan Kimbrel, Ph.D., Angela Kirby, M.S., Scott D. McDonald, Ph.D., Ph.D., Scott D. Moore, M.D., Ph.D., Jennifer C. Naylor, Ph.D., Jared Rowland, Ph.D., Cindy Swinkels, Ph.D., Steven T. Szabo, M.D., Ph.D., Katherine H. Taber, Ph.D., Larry A. Tupler, Ph.D., Elizabeth E. Van Voorhees, Ph.D., H.
  • Open Data for Differential Network Analysis in Glioma

    Open Data for Differential Network Analysis in Glioma

    International Journal of Molecular Sciences Article Open Data for Differential Network Analysis in Glioma , Claire Jean-Quartier * y , Fleur Jeanquartier y and Andreas Holzinger Holzinger Group HCI-KDD, Institute for Medical Informatics, Statistics and Documentation, Medical University Graz, Auenbruggerplatz 2/V, 8036 Graz, Austria; [email protected] (F.J.); [email protected] (A.H.) * Correspondence: [email protected] These authors contributed equally to this work. y Received: 27 October 2019; Accepted: 3 January 2020; Published: 15 January 2020 Abstract: The complexity of cancer diseases demands bioinformatic techniques and translational research based on big data and personalized medicine. Open data enables researchers to accelerate cancer studies, save resources and foster collaboration. Several tools and programming approaches are available for analyzing data, including annotation, clustering, comparison and extrapolation, merging, enrichment, functional association and statistics. We exploit openly available data via cancer gene expression analysis, we apply refinement as well as enrichment analysis via gene ontology and conclude with graph-based visualization of involved protein interaction networks as a basis for signaling. The different databases allowed for the construction of huge networks or specified ones consisting of high-confidence interactions only. Several genes associated to glioma were isolated via a network analysis from top hub nodes as well as from an outlier analysis. The latter approach highlights a mitogen-activated protein kinase next to a member of histondeacetylases and a protein phosphatase as genes uncommonly associated with glioma. Cluster analysis from top hub nodes lists several identified glioma-associated gene products to function within protein complexes, including epidermal growth factors as well as cell cycle proteins or RAS proto-oncogenes.
  • Intrinsic Disorder in Tetratricopeptide Repeat Proteins

    Intrinsic Disorder in Tetratricopeptide Repeat Proteins

    International Journal of Molecular Sciences Article Intrinsic Disorder in Tetratricopeptide Repeat Proteins 1, 1, 1, 2 Nathan W. Van Bibber y, Cornelia Haerle y, Roy Khalife y, Bin Xue and Vladimir N. Uversky 1,3,4,* 1 Department of Molecular Medicine Morsani College of Medicine, University of South Florida, 12901 Bruce B. Downs Blvd., Tampa, FL 33612, USA; [email protected] (N.W.V.B.); [email protected] (C.H.); [email protected] (R.K.) 2 Department of Cell Biology, Microbiology and Molecular Biology, School of Natural Sciences and Mathematics, College of Arts and Sciences, University of South Florida, Tampa, FL 33620, USA; [email protected] 3 USF Health Byrd Alzheimer’s Research Institute, Morsani College of Medicine, University of South Florida, 12901 Bruce B. Downs Blvd., Tampa, FL 33612, USA 4 Institute for Biological Instrumentation, Russian Academy of Sciences, Federal Research Center “Pushchino Scientific Center for Biological Research of the Russian Academy of Sciences”, 4 Institutskaya St., Pushchino, 142290 Moscow Region, Russia * Correspondence: [email protected]; Tel.: +1-813-974-5816; Fax: +1-813-974-7357 These authors contributed equally to this work. y Received: 21 April 2020; Accepted: 22 May 2020; Published: 25 May 2020 Abstract: Among the realm of repeat containing proteins that commonly serve as “scaffolds” promoting protein-protein interactions, there is a family of proteins containing between 2 and 20 tetratricopeptide repeats (TPRs), which are functional motifs consisting of 34 amino acids. The most distinguishing feature of TPR domains is their ability to stack continuously one upon the other, with these stacked repeats being able to affect interaction with binding partners either sequentially or in combination.
  • Primepcr™Assay Validation Report

    Primepcr™Assay Validation Report

    PrimePCR™Assay Validation Report Gene Information Gene Name nuclear autoantigenic sperm protein (histone-binding) Gene Symbol NASP Organism Human Gene Summary This gene encodes a H1 histone binding protein that is involved in transporting histones into the nucleus of dividing cells. Multiple isoforms are encoded by transcript variants of this gene. The somatic form is expressed in all mitotic cells is localized to the nucleus and is coupled to the cell cycle. The testicular form is expressed in embryonic tissues tumor cells and the testis. In male germ cells this protein is localized to the cytoplasm of primary spermatocytes the nucleus of spermatids and the periacrosomal region of mature spermatozoa. Gene Aliases DKFZp547F162, FLB7527, FLJ31599, FLJ35510, MGC19722, MGC20372, MGC2297, PRO1999 RefSeq Accession No. NC_000001.10, NT_032977.9 UniGene ID Hs.319334 Ensembl Gene ID ENSG00000132780 Entrez Gene ID 4678 Assay Information Unique Assay ID qHsaCED0005564 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000350030 Amplicon Context Sequence GTTCTGGCCTTCTGTACTGATCTGTGTTCCTGATCCTAATTCCTATCTGTCTAACG TGGAGGTGATCAAGTGTGGCTGTAGGCCTTTGTTTTCCAATGGTGCTATATTCTG TTTTCAAACACTTCACTGAACCCAGCTGTCTTGCAAACTTTCAGTGGTGCTGTCC CTGGATGGGGGCTACAAAAACAAGAATTGGTGAAGATCTTGCTCTTCAGTGCTG AAAATGGATG Amplicon Length (bp) 200 Chromosome Location 1:46084006-46084235 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 100 R2 0.9994 Page 1/5 PrimePCR™Assay Validation Report cDNA Cq 20.64 cDNA Tm (Celsius) 83 gDNA Cq 22.63 Specificity
  • A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family

    A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family

    Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2018 A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family Linda Molla Follow this and additional works at: https://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Linda Molla June 2018 © Copyright by Linda Molla 2018 A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY Linda Molla, Ph.D. The Rockefeller University 2018 APOBEC2 is a member of the AID/APOBEC cytidine deaminase family of proteins. Unlike most of AID/APOBEC, however, APOBEC2’s function remains elusive. Previous research has implicated APOBEC2 in diverse organisms and cellular processes such as muscle biology (in Mus musculus), regeneration (in Danio rerio), and development (in Xenopus laevis). APOBEC2 has also been implicated in cancer. However the enzymatic activity, substrate or physiological target(s) of APOBEC2 are unknown. For this thesis, I have combined Next Generation Sequencing (NGS) techniques with state-of-the-art molecular biology to determine the physiological targets of APOBEC2. Using a cell culture muscle differentiation system, and RNA sequencing (RNA-Seq) by polyA capture, I demonstrated that unlike the AID/APOBEC family member APOBEC1, APOBEC2 is not an RNA editor. Using the same system combined with enhanced Reduced Representation Bisulfite Sequencing (eRRBS) analyses I showed that, unlike the AID/APOBEC family member AID, APOBEC2 does not act as a 5-methyl-C deaminase.
  • Novel Targets of Apparently Idiopathic Male Infertility

    Novel Targets of Apparently Idiopathic Male Infertility

    International Journal of Molecular Sciences Review Molecular Biology of Spermatogenesis: Novel Targets of Apparently Idiopathic Male Infertility Rossella Cannarella * , Rosita A. Condorelli , Laura M. Mongioì, Sandro La Vignera * and Aldo E. Calogero Department of Clinical and Experimental Medicine, University of Catania, 95123 Catania, Italy; [email protected] (R.A.C.); [email protected] (L.M.M.); [email protected] (A.E.C.) * Correspondence: [email protected] (R.C.); [email protected] (S.L.V.) Received: 8 February 2020; Accepted: 2 March 2020; Published: 3 March 2020 Abstract: Male infertility affects half of infertile couples and, currently, a relevant percentage of cases of male infertility is considered as idiopathic. Although the male contribution to human fertilization has traditionally been restricted to sperm DNA, current evidence suggest that a relevant number of sperm transcripts and proteins are involved in acrosome reactions, sperm-oocyte fusion and, once released into the oocyte, embryo growth and development. The aim of this review is to provide updated and comprehensive insight into the molecular biology of spermatogenesis, including evidence on spermatogenetic failure and underlining the role of the sperm-carried molecular factors involved in oocyte fertilization and embryo growth. This represents the first step in the identification of new possible diagnostic and, possibly, therapeutic markers in the field of apparently idiopathic male infertility. Keywords: spermatogenetic failure; embryo growth; male infertility; spermatogenesis; recurrent pregnancy loss; sperm proteome; DNA fragmentation; sperm transcriptome 1. Introduction Infertility is a widespread condition in industrialized countries, affecting up to 15% of couples of childbearing age [1]. It is defined as the inability to achieve conception after 1–2 years of unprotected sexual intercourse [2].