DOCSLIB.ORG

Organic Cation Transporter 2 Controls Brain Norepinephrine and Serotonin Clearance and Antidepressant Response

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Organic Cation Transporter 2 Controls Brain Norepinephrine and Serotonin Clearance and Antidepressant Response Molecular Psychiatry (2012) 17, 926–939 & 2012 Macmillan Publishers Limited All rights reserved 1359-4184/12 www.nature.com/mp ORIGINAL ARTICLE Organic cation transporter 2 controls brain norepinephrine and serotonin clearance and antidepressant response A Bacq1,2,3, L Balasse1,2,3, G Biala4, B Guiard5, AM Gardier5, A Schinkel6, F Louis1,2,3, V Vialou1,2,3,9, M-P Martres1,2,3, C Chevarin3,7, M Hamon3,7, B Giros1,2,3,8 and S Gautron1,2,3 1INSERM U952, Paris, France; 2CNRS UMR 7224, Paris, France; 3UPMC University Paris 06, Paris, France; 4Department of Pharmacology and Pharmacodynamics, Medical University of Lublin, Lublin, Poland; 5Laboratoire de Neuropharmacologie EA3544, Universite´ Paris-Sud XI, Faculte´ de Pharmacie, Chaˆtenay-Malabry, France; 6Division of Molecular Biology, The Netherlands Cancer Institute, Amsterdam, The Netherlands; 7INSERM UMR 677, Faculte´ de Me´decine Pierre et Marie Curie, Site Pitie´-Salpeˆtrie`re, IFR 70 des Neurosciences, Paris, France and 8Douglas Hospital, Department of Psychiatry, McGill University, Montreal, QC, Canada High-affinity transporters for norepinephrine (NE) and serotonin (5-HT), which ensure neurotransmitter clearance at the synapse, are the principal targets of widely used antidepressant drugs. Antidepressants targeting these high-affinity transporters, however, do not provide positive treatment outcomes for all patients. Other monoamine transport systems, with lower affinity, have been detected in the brain, but their role is largely unknown. Here we report that OCT2, a member of the polyspecific organic cation transporter (OCT) family, is expressed notably in the limbic system and implicated in anxiety and depression- related behaviors in the mouse. Genetic deletion of OCT2 in mice produced a significant reduction in brain tissue concentrations of NE and 5-HT and in ex vivo uptake of both these neurotransmitters in the presence of the dual 5-HT–NE transport blocker, venlafaxine. In vivo clearance of NE and 5-HT evaluated using microiontophoretic electrophysiology was diminished in the hippocampus of OCT2À/À mice in the presence of venlafaxine, thereby affecting postsynaptic neuronal activity. OCT2À/À mice displayed an altered sensitivity to acute treatments with NE- and/or 5-HT-selective transport blockers in the forced-swim test. Moreover, the mutant mice were insensitive to long-term venlafaxine treatment in a more realistic, corticosterone-induced, chronic depression model. Our findings identify OCT2 as an important postsynaptic determinant of aminergic tonus and mood-related behaviors and a potential pharmacological target for mood disorders therapy. Molecular Psychiatry (2012) 17, 926–939; doi:10.1038/mp.2011.87; published online 19 July 2011 Keywords: aminergic neurotransmission; antidepressant response; depression; mood; organic cation transporter Introduction various psychoactive compounds including some of the classical antidepressants, which potently inhibit Neurotransmitter transporters exert a crucial role in the serotonin (SERT) and/or norepinephrine (NET) the control of synaptic transmission by ensuring the transporters.1,2 This notion has been for decades a rapid clearance of the released transmitters from the compelling argument in support of the ‘monoamine’ synaptic cleft and their recycling into the nerve hypothesis of depression, which assumes that endings. In monoaminergic pathways, this clearance hypoactivity of 5-HT and NE pathways occurs during is carried out principally by high-affinity sodium- depression that can be counterbalanced by anti- driven transporters for dopamine (DA), 5-HT and depressant treatment.3 Central serotonergic and nor- norepinephrine (NE), embedded in the plasma mem- adrenergic pathways control a wide range of func- brane of the presynaptic terminal. These high-affinity tions including mood and emotion, and dysfunction reuptake transporters are the primary target for of these circuits has indeed been implicated in the etiology and physiopathology of anxiety and Correspondence: Dr S Gautron, UMRS952/UMR7224, UPMC, 9 depression.4 Quai St Bernard, 75252 Paris Cedex 05, France. Although the critical role of the high-affinity E-mail: [email protected] transporters in monoamine clearance and antidepres- 9 Present address: Fishberg Department of Neuroscience, Mount sant action is firmly established, it has been suspected Sinai School of Medicine, New York, NY 10029, USA. Received 25 January 2011; revised 10 June 2011; accepted 13 June for years that additional monoamine clearance sys- 2011; published online 19 July 2011 tems may exist in the brain. Low-affinity monoamine Role of OCT2 in monoamine clearance and antidepressant response A Bacq et al 927 uptake through non-cognate transporters has been Immunohistochemistry and immunoautoradiography suggested in earlier studies using transport, voltam- Free-floating immunohistochemistry was performed metry or microdialysis approaches, and selective as detailed in Supplementary Material and Methods. blockers and mouse mutants for the high-affinity For immunoautoradiography, kidney or brain cryo- transporters.5–7 The rigorous interpretation of these sections were fixed with 4% paraformaldehyde/PBS studies has been confounded, however, by the limited and incubated successively with OCT2 (1/500), OCT3 knowledge concerning the specificity of the inhibitors (1/500)9 or PMAT antibodies raised against peptide used as pharmacological tools. Thus, the physiologi- sequence YLHHKYPGTSIVF (1/500; Agro-Bio, La Ferte´ cal function of these low-affinity uptake components St Aubin, France), and with [125I] anti-rabbit IgGs (Perkin in central nervous system has remained elusive. Elmer, Boston, MA, USA) and exposed to film for 3–8 Potential candidates that could ensure low-affinity days. Analysis and quantification of autoradiograms monoamine transport in the brain include the organic were carried out with MCID software (Imaging Research, cation transporter (OCT) family8–10 and the plasma Brock University, St Catherines, Ontario, Canada). membrane monoamine transporter (PMAT),11 all of which have the capacity to transport aminergic Monoamine uptake neurotransmitters in vitro. OCTs have been investi- Mice were killed by decapitation and the hippocam- gated principally for their role in the handling of pus and frontal cortex were dissected, minced on ice organic cations in peripheral organs,12,13 and are and resuspended in ice-cold sucrose (0.32 M). The currently emerging as novel but ill-characterized cells were dissociated by filtering through nylon components of aminergic neurotransmission. Mice meshes of decreasing pore size (180–60 mm, Small deficient for OCT3 show changes in the neural and Parts, Miramar, FL, USA) and resuspended in ice-cold behavioral responses to environmentally induced sucrose. The cellular suspension was preincubated variations in osmolarity, altered monoamine neuro- 10 min at 37 1C in 3 vol of Krebs Ringer Hepes LiCl transmission in the brain and increased sensitivity to buffer (25 mM HEPES–KOH, pH 7.4, 125 mM LiCl, 9,14 psychostimulants, suggesting a ‘back-up’ role in 4.8 mM KCl, 5.6 mM D( þ )-glucose, 1.2 mM CaCl2, monoamine clearance, supported by studies of mice 1.2 mM KH2PO4 and 1.2 mM MgSO4) in the presence lacking SERT.15 OCT3 was also shown to have an of 5 mM venlafaxine (Tocris Bioscience, Bristol, UK), important role in 1-methyl-4-phenyl-1,2,3,6-tetrahy- 100 mM GBR12935, 10 mM pargyline and 10 mM reser- dropyridine-induced neurodegeneration in dopami- pine (Sigma-Aldrich, St Louis, MO, USA), and nergic pathways, by allowing the release of the incubated for 15 min at 37 1C in the same buffer neurotoxic derivative MPP þ in the extracellular supplemented with 10 mM [3H] NE, [3H] 5-HT, [3H] DA space.16 or [3H] glutamate (Perkin Elmer). The effect of OCT2 is another member of the OCT family, which citalopram on endogenous OCT2 activity was was detected previously in the brain.10,17 On the basis evaluated in the presence of increasing concentra- of its ability to transport 5-HT and NE, we hypo- tions of this antidepressant (0.1–10 mM) during pre- thesized that this transporter could modulate mono- incubation and uptake. The reaction was terminated aminergic neurotransmission in complement to the by rapid filtration through Unifilter-96 GF/C filters high-affinity transporters, and have a role in the (Perkin Elmer), and after washing the radioactivity control of mood and related functions. To test this retained on the filters was assessed by liquid possibility, we investigated the contribution of OCT2 scintillation. The protein concentration in tissue to monoamine clearance in vivo in the brain and its extracts was measured by Bradford’s method. OCT- functional consequences on postsynaptic neuronal mediated uptake was quantified by inhibition with activity, as well as on anxiety and depression-related the specific inhibitor decynium 22 (D22) (1,10-diethyl- behaviors and the response to antidepressants. 2,20-cyanine iodide)18 (500 mM; Sigma-Aldrich). Data are expressed as mean±s.e.m. of D22-sensitive uptake for 4–6 independent experiments performed in triplicate. Materials and methods Determination of monoamine brain content Animals Brain structures were assessed for monoamine and OCT2À/À mice were previously generated by homo- metabolite content by high-performance liquid chro- logous recombination.13 Heterozygous animals with matography as previously reported.19 10 backcross generations into C57BL6/J were bred to generate wild-type and knockout littermates, which
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Mouse Slc22a2 Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Slc22a2 Knockout Project (CRISPR/Cas9) Objective: To create a Slc22a2 knockout Mouse model (C57BL/6N) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Slc22a2 gene (NCBI Reference Sequence: NM_013667 ; Ensembl: ENSMUSG00000040966 ) is located on Mouse chromosome 17. 11 exons are identified, with the ATG start codon in exon 1 and the TAA stop codon in exon 11 (Transcript: ENSMUST00000046959). Exon 2 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a knockout allele are viable and fertile and display no obvious phenotypic abnormalities. No significant defects in the renal secretion of a model organic cation are observed. Exon 2 starts from about 25.02% of the coding region. Exon 2 covers 6.27% of the coding region. The size of effective KO region: ~104 bp. The KO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 11 Legends Exon of mouse Slc22a2 Knockout region Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of Exon 2 is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats.
    [Show full text]
  • Interplay Between Metformin and Serotonin Transport in the Gastrointestinal Tract: a Novel Mechanism for the Intestinal Absorption and Adverse Effects of Metformin
    INTERPLAY BETWEEN METFORMIN AND SEROTONIN TRANSPORT IN THE GASTROINTESTINAL TRACT: A NOVEL MECHANISM FOR THE INTESTINAL ABSORPTION AND ADVERSE EFFECTS OF METFORMIN Tianxiang Han A dissertation submitted to the faculty of the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Eshelman School of Pharmacy. Chapel Hill 2013 Approved By: Dhiren R. Thakker, Ph.D. Michael Jay, Ph.D. Kim L. R. Brouwer, Pharm.D., Ph.D. Joseph W. Polli, Ph.D. Xiao Xiao, Ph.D. © 2013 Tianxiang Han ALL RIGHTS RESERVED ii ABSTRACT TIANXIANG HAN: Interplay between Metformin and Serotonin Transport in the Gastrointestinal Tract: A Novel Mechanism for the Intestinal Absorption and Adverse Effects of Metformin (Under the direction of Dhiren R. Thakker, Ph.D.) Metformin is a widely prescribed drug for Type II diabetes mellitus. Previous studies have shown that this highly hydrophilic and charged compound traverses predominantly paracellularly across the Caco-2 cell monolayer, a well-established model for human intestinal epithelium. However, oral bioavailability of metformin is significantly higher than that of the paracellular probe, mannitol (~60% vs ~16%). Based on these observations, the Thakker laboratory proposed a “sponge” hypothesis (Proctor et al., 2008) which states that the functional synergy between apical (AP) transporters and paracellular transport enhances the intestinal absorption of metformin. This dissertation work aims to identify AP uptake transporters of metformin, determine their polarized localization, and elucidate their roles in the intestinal absorption and adverse effects of metformin. Chemical inhibition and transporter-knockdown studies revealed that four transporters, namely, organic cation transporter 1 (OCT1), plasma membrane monoamine transporter (PMAT), serotonin reuptake transporter (SERT) and choline high-affinity transporter (CHT) contribute to AP uptake of metformin in Caco-2 cells.
    [Show full text]
  • Correlation Between Apparent Substrate Affinity and OCT2 Transport Turnover S
    Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2017/06/14/jpet.117.242552.DC1 1521-0103/362/3/405–412$25.00 https://doi.org/10.1124/jpet.117.242552 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 362:405–412, September 2017 Copyright ª 2017 by The American Society for Pharmacology and Experimental Therapeutics Correlation between Apparent Substrate Affinity and OCT2 Transport Turnover s Alyscia Cory Severance, Philip J. Sandoval, and Stephen H. Wright Department of Physiology, College of Medicine, University of Arizona, Tucson, Arizona Received April 28, 2017; accepted June 12, 2017 ABSTRACT Organic cation (OC) transporter 2 (OCT2) mediates the first step for six structurally distinct OCT2 substrates and found a strong Downloaded from in the renal secretion of many cationic drugs: basolateral uptake correlation between Jmax and Ktapp; high-affinity substrates from blood into proximal tubule cells. The impact of this process [Ktapp values ,50 mM, including 1-methyl-4-phenylpyridinium, on the pharmacokinetics of drug clearance as estimated using a or 1-methyl-4-phenylpyridinium (MPP), and cimetidine] dis- 22 21 physiologically-based pharmacokinetic approach relies on an played systematically lower Jmax values (,50 pmol cm min ) accurate understanding of the kinetics of transport because the than did low-affinity substrates (Ktapp .200 mM, including choline ratio of the maximal rate of transport to the Michaelis constant and metformin). Similarly, preloading OCT2-expressing cells with (i.e., Jmax/Kt) provides an estimate of the intrinsic clearance (Clint) low-affinity substrates resulted in systematically larger trans- jpet.aspetjournals.org used in in vitro–in vivo extrapolation of experimentally determined stimulated rates of MPP uptake than did preloading with high- transport data.
    [Show full text]
  • Screening of Genetic Variations of SLC15A2, SLC22A1, SLC22A2 and SLC22A6 Genes
    Journal of Human Genetics (2011) 56, 666–670 & 2011 The Japan Society of Human Genetics All rights reserved 1434-5161/11 $32.00 www.nature.com/jhg ORIGINAL ARTICLE Screening of genetic variations of SLC15A2, SLC22A1, SLC22A2 and SLC22A6 genes Hyun Sub Cheong1,4, Hae Deun Kim2,4, Han Sung Na2,JiOnKim1, Lyoung Hyo Kim1, Seung Hee Kim2, Joon Seol Bae3, Myeon Woo Chung2 and Hyoung Doo Shin1,3 A growing list of membrane-spanning proteins involved in the transport of a large variety of drugs has been recognized and characterized to include peptide and organic anion/cation transporters. Given such an important role of transporter genes in drug disposition process, the role of single-nucleotide polymorphisms (SNPs) in such transporters as potential determinants of interindividual variability in drug disposition and pharmacological response has been investigated. To define the distribution of transporter gene SNPs across ethnic groups, we screened 450 DNAs in cohorts of 250 Korean, 50 Han Chinese, 50 Japanese, 50 African-American and 50 European-American ancestries for 64 SNPs in four transporter genes encoding proteins of the solute carrier family (SLC15A2, SLC22A1, SLC22A2 and SLC22A6). Of the 64 SNPs, 19 were core pharmacogenetic variants and 45 were HapMap tagging SNPs. Polymorphisms were genotyped using the golden gate genotyping assay. After genetic variability, haplotype structures and ethnic diversity were analyzed, we observed that the distributions of SNPs in a Korean population were similar to other Asian groups (Chinese and Japanese), and significantly different from African-American and European-American cohorts. Findings from this study would be valuable for further researches, including pharmacogenetic studies for drug responses.
    [Show full text]
  • Analysis of OAT, OCT, OCTN, and Other Family Members Reveals 8
    bioRxiv preprint doi: https://doi.org/10.1101/2019.12.23.887299; this version posted December 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Reclassification of SLC22 Transporters: Analysis of OAT, OCT, OCTN, and other Family Members Reveals 8 Functional Subgroups Darcy Engelhart1, Jeffry C. Granados2, Da Shi3, Milton Saier Jr.4, Michael Baker6, Ruben Abagyan3, Sanjay K. Nigam5,6 1Department of Biology, University of California San Diego, La Jolla 92093 2Department of Bioengineering, University of California San Diego, La Jolla 92093 3School of Pharmacy and Pharmaceutical Sciences, University of California San Diego, La Jolla 92093 4Department of Molecular Biology, Division of Biological Sciences, University of California at San Diego, San Diego, CA, USA 5Department of Pediatrics, University of California San Diego, La Jolla 92093 6Department of Medicine, University of California San Diego, La Jolla 92093 *To whom correspondence should be addressed: [email protected] Running title: Functional subgroups for SLC22 1 bioRxiv preprint doi: https://doi.org/10.1101/2019.12.23.887299; this version posted December 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Among transporters, the SLC22 family is emerging as a central hub of endogenous physiology.
    [Show full text]
  • Effects of Gold Nanorods on Imprinted Genes Expression in TM-4 Sertoli Cells
    Int. J. Environ. Res. Public Health 2016, 13, 271; doi:10.3390/ijerph13030271 S1 of S5 Supplementary Materials: Effects of Gold Nanorods on Imprinted Genes Expression in TM-4 Sertoli Cells Beilei Yuan, Hao Gu, Bo Xu, Qiuqin Tang, Wei Wu, Xiaoli Ji, Yankai Xia, Lingqing Hu, Daozhen Chen and Xinru Wang Table S1. List of primers used to test the expression of the 44 imprinted genes and the reference genes Gapdh and U6. Gene Primer-F (5’-3’) Primer-R (5’-3’) Ano1 CTGATGCCGAGTGCAAGTATG AGGGCCTCTTGTGATGGTACA Cdkn1c CCCATCTAGCTTGCAGTCTCTT CAGACGGCTCAGGAACCATT Ddc TGGGGACCACAACATGCTG TCAGGGCAGATGAATGCACTG Dlk1 AGCTGCACCCCCAACC CTGCTGGCGCAGTTGGTC Gnas TGCAAGGAGCAACAGCGAT GCGGCCACAATGGTTTCAAT Gpr1 GCTGGGAGTTGTTCACTGGG GACGATGGCATTTCCTGGAAT Grb10 AACCCAGCTTTTGCAGGAA TCAGGGAGAAGATGTTGCTGT Gtl2 GTTTCTGGACTGTGGGCTGT CAACAGCAACAAAACTCAGAACATTCA H19 GCACCTTGGACATCTGGAGT TTCTTTCCAGCCCTAGCTCA Hymai TGCCTTTCAGTGTTGAACCA TGCATCCCTAAACAACAGCTT Igf2 AGCCGTGGCATCGTTGAG GACTGCTTCCAGGTGTCATATTG Igf2as TCTTTGCCCTCTTTCGTCTC CTCCAGGTGCTTCCGTCTAG Igf2r CTGCCGCTATGAAATTGAGTGG CGCCGCTCAGAGAACAAGTT Inpp5f V2 ACTGAACCTGAGCAGATTTCCA CCACCCCACTCCAAAAGGTT Kcnk9 GATGAAACGCCGGAAGTC GTGTTCGGCTTTGGCAGT Kcnq1 GCGTCTCCATCTACAGCACG GAAGTGGTAAACGAAGCATTTCC Klf14 TTTCCCTCACACTTGATTACCC AGCGAGGGAGGGACTAAGAT Magel2 GGGCTCCGCTAAATCATTG CCCCTGCGGTCTATAGAAGA Magi2 GGACTAGCAGGGTTCACGAA GCTCCGACGTACGGAAACT Mest TGACCACATTAGCCACTATCCA CCTGCTGGCTTCTTCCTATACA Mir296 ACACTCCAGCTGGGAGGGCCCCCCCTCAA CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACAGGATT Mir298 ACACTCCAGCTGGGAGCAGAAGCAGGGAGGTT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTGGGAGAA
    [Show full text]
  • Characterization of Centrally Expressed Solute Carriers
    Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1215 Characterization of Centrally Expressed Solute Carriers Histological and Functional Studies with Transgenic Mice SAHAR ROSHANBIN ACTA UNIVERSITATIS UPSALIENSIS ISSN 1651-6206 ISBN 978-91-554-9555-8 UPPSALA urn:nbn:se:uu:diva-282956 2016 Dissertation presented at Uppsala University to be publicly examined in B:21, Husargatan. 75124 Uppsala, Uppsala, Friday, 3 June 2016 at 13:15 for the degree of Doctor of Philosophy (Faculty of Medicine). The examination will be conducted in English. Faculty examiner: Biträdande professor David Engblom (Institutionen för klinisk och experimentell medicin, Cellbiologi, Linköpings Universitet). Abstract Roshanbin, S. 2016. Characterization of Centrally Expressed Solute Carriers. Histological and Functional Studies with Transgenic Mice. (. His). Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1215. 62 pp. Uppsala: Acta Universitatis Upsaliensis. ISBN 978-91-554-9555-8. The Solute Carrier (SLC) superfamily is the largest group of membrane-bound transporters, currently with 456 transporters in 52 families. Much remains unknown about the tissue distribution and function of many of these transporters. The aim of this thesis was to characterize select SLCs with emphasis on tissue distribution, cellular localization, and function. In paper I, we studied the leucine transporter B0AT2 (Slc6a15). Localization of B0AT2 and Slc6a15 in mouse brain was determined using in situ hybridization (ISH) and immunohistochemistry (IHC), localizing it to neurons, epithelial cells, and astrocytes. Furthermore, we observed a lower reduction of food intake in Slc6a15 knockout mice (KO) upon intraperitoneal injections with leucine, suggesting B0AT2 is involved in mediating the anorexigenic effects of leucine.
    [Show full text]
  • Human Intestinal Nutrient Transporters
    Gastrointestinal Functions, edited by Edgard E. Delvin and Michael J. Lentze. Nestle Nutrition Workshop Series. Pediatric Program. Vol. 46. Nestec Ltd.. Vevey/Lippincott Williams & Wilkins, Philadelphia © 2001. Human Intestinal Nutrient Transporters Ernest M. Wright Department of Physiology, UCLA School of Medicine, Los Angeles, California, USA Over the past decade, advances in molecular biology have revolutionized studies on intestinal nutrient absorption in humans. Before the advent of molecular biology, the study of nutrient absorption was largely limited to in vivo and in vitro animal model systems. This did result in the classification of the different transport systems involved, and in the development of models for nutrient transport across enterocytes (1). Nutrients are either absorbed passively or actively. Passive transport across the epithelium occurs down the nutrient's concentration gradient by simple or facilitated diffusion. The efficiency of simple diffusion depends on the lipid solubility of the nutrient in the plasma membranes—the higher the molecule's partition coefficient, the higher the rate of diffusion. Facilitated diffusion depends on the presence of simple carriers (uniporters) in the plasma membranes, and the kinetic properties of these uniporters. The rate of facilitated diffusion depends on the density, turnover number, and affinity of the uniporters in the brush border and basolateral membranes. The ' 'active'' transport of nutrients simply means that energy is provided to transport molecules across the gut against their concentration gradient. It is now well recog- nized that active nutrient transport is brought about by Na+ or H+ cotransporters (symporters) that harness the energy stored in ion gradients to drive the uphill trans- port of a solute.
    [Show full text]
  • Tandem Repeats in the Cpg Islands of Imprinted Genes ⁎ Barbara Hutter A, Volkhard Helms A, Martina Paulsen B
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Genomics 88 (2006) 323–332 www.elsevier.com/locate/ygeno Tandem repeats in the CpG islands of imprinted genes ⁎ Barbara Hutter a, Volkhard Helms a, Martina Paulsen b, a Bioinformatik, FR 8.3 Biowissenschaften, Universität des Saarlandes, Postfach 151150, D-66041 Saarbrücken, Germany b Genetik/Epigenetik, FR 8.3 Biowissenschaften, Universität des Saarlandes, Postfach 151150, D-66041 Saarbrücken, Germany Received 21 December 2005; accepted 30 March 2006 Available online 11 May 2006 Abstract In contrast to most genes in mammalian genomes, imprinted genes are monoallelically expressed depending on the parental origin of the alleles. Imprinted gene expression is regulated by distinct DNA elements that exhibit allele-specific epigenetic modifications, such as DNA methylation. These so-called differentially methylated regions frequently overlap with CpG islands. Thus, CpG islands of imprinted genes may contain special DNA elements that distinguish them from CpG islands of biallelically expressed genes. Here, we present a detailed study of CpG islands of imprinted genes in mouse and in human. Our study shows that imprinted genes more frequently contain tandem repeat arrays in their CpG islands than randomly selected genes in both species. In addition, mouse imprinted genes more frequently possess intragenic CpG islands that may serve as promoters of allele-specific antisense transcripts. This feature is much less pronounced in human, indicating an interspecies variability in the evolution of imprinting control elements. © 2006 Elsevier Inc. All rights reserved. Keywords: Imprinting; CpG islands; Tandem repeats; DNA methylation; Repetitive elements; Epigenetics; Regulatory elements To date, approximately 40 imprinted genes have been likely that additional elements are needed.
    [Show full text]
  • Frontiersin.Org 1 April 2015 | Volume 9 | Article 123 Saunders Et Al
    ORIGINAL RESEARCH published: 28 April 2015 doi: 10.3389/fnins.2015.00123 Influx mechanisms in the embryonic and adult rat choroid plexus: a transcriptome study Norman R. Saunders 1*, Katarzyna M. Dziegielewska 1, Kjeld Møllgård 2, Mark D. Habgood 1, Matthew J. Wakefield 3, Helen Lindsay 4, Nathalie Stratzielle 5, Jean-Francois Ghersi-Egea 5 and Shane A. Liddelow 1, 6 1 Department of Pharmacology and Therapeutics, University of Melbourne, Parkville, VIC, Australia, 2 Department of Cellular and Molecular Medicine, University of Copenhagen, Copenhagen, Denmark, 3 Walter and Eliza Hall Institute of Medical Research, Parkville, VIC, Australia, 4 Institute of Molecular Life Sciences, University of Zurich, Zurich, Switzerland, 5 Lyon Neuroscience Research Center, INSERM U1028, Centre National de la Recherche Scientifique UMR5292, Université Lyon 1, Lyon, France, 6 Department of Neurobiology, Stanford University, Stanford, CA, USA The transcriptome of embryonic and adult rat lateral ventricular choroid plexus, using a combination of RNA-Sequencing and microarray data, was analyzed by functional groups of influx transporters, particularly solute carrier (SLC) transporters. RNA-Seq Edited by: Joana A. Palha, was performed at embryonic day (E) 15 and adult with additional data obtained at University of Minho, Portugal intermediate ages from microarray analysis. The largest represented functional group Reviewed by: in the embryo was amino acid transporters (twelve) with expression levels 2–98 times Fernanda Marques, University of Minho, Portugal greater than in the adult. In contrast, in the adult only six amino acid transporters Hanspeter Herzel, were up-regulated compared to the embryo and at more modest enrichment levels Humboldt University, Germany (<5-fold enrichment above E15).
    [Show full text]
  • Effects of SLC22A2 (Rs201919874) and SLC47A2 (Rs138244461)
    155 Effects of SLC22A2 (rs201919874) and SLC47A2 (rs138244461) genetic variants on Metformin Pharmacokinetics in Pakistani T2DM patients Sadaf Moeez,1 Zoya Khalid,2 Fazal Jalil,3 Muhammad Irfan,4 Muhammad Ismail,5 Mohammad Ali Arif,6 Rauf Niazi,7 Sumbul Khalid8 Abstract Objective: To determine the frequencies of single nucleotide polymorphisms rs201919874 and rs138244461 in genes SLC22A2 and SLC47A2 respectively in Pakistani diabetes patients in order to characterise the genetic variants and determine their association with the pharmacokinetics of metformin. Methods: The case-control study was conducted at the International Islamic University, Islamabad, Pakistan, from June 2016 to June 2017, and comprised genotypes of diabetic cases and matching controls which were determined following allele-specific polymerase chain reaction. Cases were further divided into Group A and Group B. The former consisted of diabetics who were on monotherapy of metformin, while the latter consisted of diabetics treated with a combination of metformin and sulfonylureas. In-silico analysis was performed to verify the effect of single nucleotide polymorphisms rs201919874 and rs138244461 on the structure of genes. Association was statistically determined using SPSS 18. Results: Of the 1200 subjects, 800(66.6%) were cases and 400(33.3%) were controls. Among the cases, 400(50%) each were in Group A and Group B. Significant difference was observed in the distribution of rs201919874 between Group A and controls (p<0.05) and between Group B and controls (p<0.05) for heterozygous genotypic frequency and for allelic frequency. Conversely, statistically significant difference was observed in rs138244461 (p<0.05) for all genotypic and allelic frequencies.
    [Show full text]