DOCSLIB.ORG

Effects of Gold Nanorods on Imprinted Genes Expression in TM-4 Sertoli Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Effects of Gold Nanorods on Imprinted Genes Expression in TM-4 Sertoli Cells International Journal of Environmental Research and Public Health Article Effects of Gold Nanorods on Imprinted Genes Expression in TM-4 Sertoli Cells Beilei Yuan 1,2,†, Hao Gu 1,2,†, Bo Xu 1,2,†, Qiuqin Tang 3, Wei Wu 1,2,4,*, Xiaoli Ji 1,2, Yankai Xia 1,2, Lingqing Hu 4, Daozhen Chen 4 and Xinru Wang 1,2,* 1 State Key Laboratory of Reproductive Medicine, Institute of Toxicology, Nanjing Medical University, Nanjing 211166, China; [email protected] (B.Y.); [email protected] (H.G.); [email protected] (B.X.); [email protected] (X.J.); [email protected] (Y.X.) 2 Key Laboratory of Modern Toxicology of Ministry of Education, School of Public Health, Nanjing Medical University, Nanjing 211166, China 3 State Key Laboratory of Reproductive Medicine, Department of Obstetrics, Nanjing Maternity and Child Health Care Hospital Affiliated to Nanjing Medical University, Nanjing 210004, China; [email protected] 4 State Key Laboratory of Reproductive Medicine, Wuxi Maternal and Child Health Care Hospital Affiliated to Nanjing Medical University, Wuxi 214002, China; [email protected] (L.H.); [email protected] (D.C.) * Correspondence: [email protected] (W.W.); [email protected] (X.W.); Tel.: +86-025-8686-8425 (W.W.) † These authors contributed equally to the study and they should be regarded as joint first authors. Academic Editor: Huang-Tsung Chang Received: 25 January 2016; Accepted: 23 February 2016; Published: 1 March 2016 Abstract: Gold nanorods (GNRs) are among the most commonly used nanomaterials. However, thus far, little is known about their harmful effects on male reproduction. Studies from our laboratory have demonstrated that GNRs could decrease glycine synthesis, membrane permeability, mitochondrial membrane potential and disrupt blood-testis barrier factors in TM-4 Sertoli cells. Imprinted genes play important roles in male reproduction and have been identified as susceptible loci to environmental insults by chemicals because they are functionally haploid. In this original study, we investigated the extent to which imprinted genes become deregulated in TM-4 Sertoli cells when treated with low dose of GNRs. The expression levels of 44 imprinted genes were analyzed by quantitative real-time PCR in TM-4 Sertoli cells after a low dose of (10 nM) GNRs treatment for 24 h. We found significantly diminished expression of Kcnq1, Ntm, Peg10, Slc22a2, Pwcr1, Gtl2, Nap1l5, Peg3 and Slc22a2, while Plagl1 was significantly overexpressed. Additionally, four (Kcnq1, Slc22a18, Pwcr1 and Peg3) of 10 abnormally expressed imprinted genes were found to be located on chromosome 7. However, no significant difference of imprinted miRNA genes was observed between the GNRs treated group and controls. Our study suggested that aberrant expression of imprinted genes might be an underlying mechanism for the GNRs-induced reproductive toxicity in TM-4 Sertoli cells. Keywords: GNRs; TM-4 Sertoli cells; imprinted genes; reproductive toxicity 1. Introduction In recent decades, gold nanorods (GNRs) have been investigated extensively for clinical imaging [1], treatment [2], drug delivery [3] and cancer therapy [4,5]. However, whether GNRs have reproductive toxicity has aroused wide concern. Apart from cytotoxicity [6], hepatotoxicity [7] and kidney oxidative damage in mice [8] and cells [9,10], spermatotoxicity of GNRs has been also reported [11]. In our recent study, we investigated the impacts of GNRs on the metabolomics changes in TM-4 Sertoli cells. We found that GNRs treatment could affect male reproduction via a decrease in glycine synthesis, membrane permeability, mitochondrial membrane potential and disrupt blood-testis barrier factors in TM-4 Sertoli cells [12]. Int. J. Environ. Res. Public Health 2016, 13, 271; doi:10.3390/ijerph13030271 www.mdpi.com/journal/ijerph Int. J. Environ. Res. Public Health 2016, 13, 271 2 of 11 The term imprinted gene refers to the monoallelic expression of genes according to the parent of origin [13,14]. This imprinting phenomena is a good example of how multiple epigenetic processes act together via DNA methylation, histone modification and chromatin-modeling elements like non-coding Int. J. Environ. Res. Public 2016, 13, 271 RNAs [13,14]. Genomic imprinting is acquired during gametogenesis when genome-wide epigenetic remodelingThe term occurs imprinted and is maintainedgene refers to during the monoallelic development expression [15]. of Imprinting genes according is erased to the in parent the primordial of germorigin cells [13,14]. and newThis imprinting methylation phenomena imprints is are a go establishedod example accordingof how multiple to the epigenetic sex of germ processes line [16,17]. Imprintedact together genes via are DNA maternally methylation, marked histone in the modi maturefication oocyte and andchromatin-modeling paternally marked elements in the like sperm [18]. Manynon-coding imprinted RNAs genes [13,14]. were foundGenomic in clustersimprinting and possessis acquired imprinting during controlgametogenesis regions (ICR)when [19,20]. Recentgenome-wide studies have epigenetic demonstrated remodeling that occurs imprinted and is maintained genes were during tightly development related to [15]. spermatogenesis Imprinting [21], is erased in the primordial germ cells and new methylation imprints are established according to the development of placenta [19], fetal growth [13] and cancer [22]. Previous studies have found that sex of germ line [16,17]. Imprinted genes are maternally marked in the mature oocyte and paternally aberrantmarked DNA in the methylation sperm [18]. Many in spermatozoa imprinted genes was significantlywere found in associatedclusters and with possess male imprinting infertile [21,23]. Besides,control other regions studies (ICR) have [19,20]. showed Recent that studies chemical have demonstrated exposure could that disrupt imprinted the genes expression were tightly and function of imprintedrelated to spermatogenesis genes [20,24]. [21], However, development whether of placenta GNRs [19], could fetal affect growth the [13] expression and cancer of [22]. imprinted genes—whichPrevious studies is important have found for that male aberrant reproduction—remains DNA methylation largelyin spermatozoa undetermined. was significantly The aim of this studyassociated was to with investigate male infertile whether [21,23]. GNRs Besides, treatment other studies could alterhave theshowed expression that chemical of imprinted exposure genes in TM-4could Sertoli disrupt cells. the expression and function of imprinted genes [20,24]. However, whether GNRs ⎯ ⎯ couldAccording affect the toexpression two public of imprinted databases genes forwhich imprinted is important genes for male (www.geneimprint.com reproduction remains and largely undetermined. The aim of this study was to investigate whether GNRs treatment could alter http://igc.otago.ac.nz/home.html) [19], one hundred and twenty-two and 95 imprinted genes have the expression of imprinted genes in TM-4 Sertoli cells. been identifiedAccording in to mouse two andpublic human databases respectively. for imprinted Homologous genes genes(www.geneimprint.com were considered and as playing similarhttp://igc.otago.ac.nz/home.html) roles in functional regulation. [19], one Thus, hundred in the and present twenty-two study, and 44 95 homologous imprinted genes imprinted have genes betweenbeen identified mouse and in mouse human and were human finally respectively selected.for Homologous the expression geneslevel were analysisconsidered in TM-4as playing Sertoli cells treatedsimilar with roles a lowin functional dose of GNRs. regulation. Thus, in the present study, 44 homologous imprinted genes between mouse and human were finally selected for the expression level analysis in TM-4 Sertoli 2. Materialscells treated and with Methods a low dose of GNRs. 2.1.2. Chemicals Materials andand RegentsMethods 2.1.GNRs Chemicals with and dimensions Regents of (9–11) nm ˆ (34–42) nm were obtained from Sigma-Aldrich (Sigma Chemical Co., Saint Louis, MO, USA). Zeta potential (mV) is 23.4 ˘ 2.39. Dimethyl sulfoxide GNRs with dimensions of (9–11) nm × (34–42) nm were obtained from Sigma-Aldrich (Sigma (DMSO), bovine serum albumin (BSA) and diethylpyrocarbonate (DEPC) were also purchased from Chemical Co., Saint Louis, MO, USA). Zeta potential (mV) is 23.4 ± 2.39. Dimethyl sulfoxide Sigma-Aldrich(DMSO), bovine (Sigma serum Chemical albumin (BSA) Co., St. and Louis, diethylpyr MO,ocarbonate USA). DMEN (DEPC) medium, were also fetal purchased bovine serumfrom (FBS), 2+ 2+ streptomycinSigma-Aldrich sulfate, (Sigma penicillin Chemical G Co., sodium St. Louis, and phosphate-bufferedMO, USA). DMEN medium, saline with fetal Cabovineand serum Mg (PBS) were(FBS), obtained streptomycin from Gibcosulfate, BRLpenicillin (Grand G sodium Island, and NY, phosphate-buffered USA). All chemicals saline werewith Ca of2+ analyticaland Mg2+ grade. GNRs(PBS) were were stored obtained at 4from˝C, Gibco and then BRL diluted(Grand Island, to 10 nMNY, inUSA). culture All chemicals medium immediatelywere of analytical before use. GNRsgrade. were GNRs well were dispersed stored at in 4 the°C, mediumand then dilut anded no to aggregation 10 nM in culture was me founddium (Figure immediately1). before use. GNRs were well dispersed in the medium and no aggregation was found (Figure 1). FigureFigure 1. 1.Transmission Transmissionelectron electron microscopy image image of ofgold gold nanorods nanorods (GNRs). (GNRs). Int. J. Environ. Res. Public Health 2016, 13, 271 3 of 11 2.2. Cell Culture and GNRs Treatment TM-4
Load more

Recommended publications
  • Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)
    BRIEF COMMUNICATION www.jasn.org Renal Fanconi Syndrome and Hypophosphatemic Rickets in the Absence of Xenotropic and Polytropic Retroviral Receptor in the Nephron Camille Ansermet,* Matthias B. Moor,* Gabriel Centeno,* Muriel Auberson,* † † ‡ Dorothy Zhang Hu, Roland Baron, Svetlana Nikolaeva,* Barbara Haenzi,* | Natalya Katanaeva,* Ivan Gautschi,* Vladimir Katanaev,*§ Samuel Rotman, Robert Koesters,¶ †† Laurent Schild,* Sylvain Pradervand,** Olivier Bonny,* and Dmitri Firsov* BRIEF COMMUNICATION *Department of Pharmacology and Toxicology and **Genomic Technologies Facility, University of Lausanne, Lausanne, Switzerland; †Department of Oral Medicine, Infection, and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts; ‡Institute of Evolutionary Physiology and Biochemistry, St. Petersburg, Russia; §School of Biomedicine, Far Eastern Federal University, Vladivostok, Russia; |Services of Pathology and ††Nephrology, Department of Medicine, University Hospital of Lausanne, Lausanne, Switzerland; and ¶Université Pierre et Marie Curie, Paris, France ABSTRACT Tight control of extracellular and intracellular inorganic phosphate (Pi) levels is crit- leaves.4 Most recently, Legati et al. have ical to most biochemical and physiologic processes. Urinary Pi is freely filtered at the shown an association between genetic kidney glomerulus and is reabsorbed in the renal tubule by the action of the apical polymorphisms in Xpr1 and primary fa- sodium-dependent phosphate transporters, NaPi-IIa/NaPi-IIc/Pit2. However, the milial brain calcification disorder.5 How- molecular identity of the protein(s) participating in the basolateral Pi efflux remains ever, the role of XPR1 in the maintenance unknown. Evidence has suggested that xenotropic and polytropic retroviral recep- of Pi homeostasis remains unknown. Here, tor 1 (XPR1) might be involved in this process. Here, we show that conditional in- we addressed this issue in mice deficient for activation of Xpr1 in the renal tubule in mice resulted in impaired renal Pi Xpr1 in the nephron.
    [Show full text]
  • (SLC22A18) (NM 183233) Human Recombinant Protein Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TP304889 Solute carrier family 22 member 18 (SLC22A18) (NM_183233) Human Recombinant Protein Product data: Product Type: Recombinant Proteins Description: Recombinant protein of human solute carrier family 22, member 18 (SLC22A18), transcript variant 2 Species: Human Expression Host: HEK293T Tag: C-Myc/DDK Predicted MW: 44.7 kDa Concentration: >50 ug/mL as determined by microplate BCA method Purity: > 80% as determined by SDS-PAGE and Coomassie blue staining Buffer: 25 mM Tris.HCl, pH 7.3, 100 mM glycine, 10% glycerol Preparation: Recombinant protein was captured through anti-DDK affinity column followed by conventional chromatography steps. Storage: Store at -80°C. Stability: Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. RefSeq: NP_899056 Locus ID: 5002 UniProt ID: Q96BI1 RefSeq Size: 1563 Cytogenetics: 11p15.4 RefSeq ORF: 1272 Synonyms: BWR1A; BWSCR1A; HET; IMPT1; ITM; ORCTL2; p45-BWR1A; SLC22A1L; TSSC5 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 Solute carrier family 22 member 18 (SLC22A18) (NM_183233) Human Recombinant Protein – TP304889 Summary: This gene is one of several tumor-suppressing subtransferable fragments located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer.
    [Show full text]
  • The Role of the Mtor Pathway in Developmental Reprogramming Of
    THE ROLE OF THE MTOR PATHWAY IN DEVELOPMENTAL REPROGRAMMING OF HEPATIC LIPID METABOLISM AND THE HEPATIC TRANSCRIPTOME AFTER EXPOSURE TO 2,2',4,4'- TETRABROMODIPHENYL ETHER (BDE-47) An Honors Thesis Presented By JOSEPH PAUL MCGAUNN Approved as to style and content by: ________________________________________________________** Alexander Suvorov 05/18/20 10:40 ** Chair ________________________________________________________** Laura V Danai 05/18/20 10:51 ** Committee Member ________________________________________________________** Scott C Garman 05/18/20 10:57 ** Honors Program Director ABSTRACT An emerging hypothesis links the epidemic of metabolic diseases, such as non-alcoholic fatty liver disease (NAFLD) and diabetes with chemical exposures during development. Evidence from our lab and others suggests that developmental exposure to environmentally prevalent flame-retardant BDE47 may permanently reprogram hepatic lipid metabolism, resulting in an NAFLD-like phenotype. Additionally, we have demonstrated that BDE-47 alters the activity of both mTOR complexes (mTORC1 and 2) in hepatocytes. The mTOR pathway integrates environmental information from different signaling pathways, and regulates key cellular functions such as lipid metabolism, innate immunity, and ribosome biogenesis. Thus, we hypothesized that the developmental effects of BDE-47 on liver lipid metabolism are mTOR-dependent. To assess this, we generated mice with liver-specific deletions of mTORC1 or mTORC2 and exposed these mice and their respective controls perinatally to
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Mouse Slc22a2 Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Slc22a2 Knockout Project (CRISPR/Cas9) Objective: To create a Slc22a2 knockout Mouse model (C57BL/6N) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Slc22a2 gene (NCBI Reference Sequence: NM_013667 ; Ensembl: ENSMUSG00000040966 ) is located on Mouse chromosome 17. 11 exons are identified, with the ATG start codon in exon 1 and the TAA stop codon in exon 11 (Transcript: ENSMUST00000046959). Exon 2 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a knockout allele are viable and fertile and display no obvious phenotypic abnormalities. No significant defects in the renal secretion of a model organic cation are observed. Exon 2 starts from about 25.02% of the coding region. Exon 2 covers 6.27% of the coding region. The size of effective KO region: ~104 bp. The KO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 11 Legends Exon of mouse Slc22a2 Knockout region Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of Exon 2 is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats.
    [Show full text]
  • Type of the Paper (Article
    Supplementary Material A Proteomics Study on the Mechanism of Nutmeg-induced Hepatotoxicity Wei Xia 1, †, Zhipeng Cao 1, †, Xiaoyu Zhang 1 and Lina Gao 1,* 1 School of Forensic Medicine, China Medical University, Shenyang 110122, P. R. China; lessen- [email protected] (W.X.); [email protected] (Z.C.); [email protected] (X.Z.) † The authors contributed equally to this work. * Correspondence: [email protected] Figure S1. Table S1. Peptide fraction separation liquid chromatography elution gradient table. Time (min) Flow rate (mL/min) Mobile phase A (%) Mobile phase B (%) 0 1 97 3 10 1 95 5 30 1 80 20 48 1 60 40 50 1 50 50 53 1 30 70 54 1 0 100 1 Table 2. Liquid chromatography elution gradient table. Time (min) Flow rate (nL/min) Mobile phase A (%) Mobile phase B (%) 0 600 94 6 2 600 83 17 82 600 60 40 84 600 50 50 85 600 45 55 90 600 0 100 Table S3. The analysis parameter of Proteome Discoverer 2.2. Item Value Type of Quantification Reporter Quantification (TMT) Enzyme Trypsin Max.Missed Cleavage Sites 2 Precursor Mass Tolerance 10 ppm Fragment Mass Tolerance 0.02 Da Dynamic Modification Oxidation/+15.995 Da (M) and TMT /+229.163 Da (K,Y) N-Terminal Modification Acetyl/+42.011 Da (N-Terminal) and TMT /+229.163 Da (N-Terminal) Static Modification Carbamidomethyl/+57.021 Da (C) 2 Table S4. The DEPs between the low-dose group and the control group. Protein Gene Fold Change P value Trend mRNA H2-K1 0.380 0.010 down Glutamine synthetase 0.426 0.022 down Annexin Anxa6 0.447 0.032 down mRNA H2-D1 0.467 0.002 down Ribokinase Rbks 0.487 0.000
    [Show full text]
  • Interplay Between Metformin and Serotonin Transport in the Gastrointestinal Tract: a Novel Mechanism for the Intestinal Absorption and Adverse Effects of Metformin
    INTERPLAY BETWEEN METFORMIN AND SEROTONIN TRANSPORT IN THE GASTROINTESTINAL TRACT: A NOVEL MECHANISM FOR THE INTESTINAL ABSORPTION AND ADVERSE EFFECTS OF METFORMIN Tianxiang Han A dissertation submitted to the faculty of the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Eshelman School of Pharmacy. Chapel Hill 2013 Approved By: Dhiren R. Thakker, Ph.D. Michael Jay, Ph.D. Kim L. R. Brouwer, Pharm.D., Ph.D. Joseph W. Polli, Ph.D. Xiao Xiao, Ph.D. © 2013 Tianxiang Han ALL RIGHTS RESERVED ii ABSTRACT TIANXIANG HAN: Interplay between Metformin and Serotonin Transport in the Gastrointestinal Tract: A Novel Mechanism for the Intestinal Absorption and Adverse Effects of Metformin (Under the direction of Dhiren R. Thakker, Ph.D.) Metformin is a widely prescribed drug for Type II diabetes mellitus. Previous studies have shown that this highly hydrophilic and charged compound traverses predominantly paracellularly across the Caco-2 cell monolayer, a well-established model for human intestinal epithelium. However, oral bioavailability of metformin is significantly higher than that of the paracellular probe, mannitol (~60% vs ~16%). Based on these observations, the Thakker laboratory proposed a “sponge” hypothesis (Proctor et al., 2008) which states that the functional synergy between apical (AP) transporters and paracellular transport enhances the intestinal absorption of metformin. This dissertation work aims to identify AP uptake transporters of metformin, determine their polarized localization, and elucidate their roles in the intestinal absorption and adverse effects of metformin. Chemical inhibition and transporter-knockdown studies revealed that four transporters, namely, organic cation transporter 1 (OCT1), plasma membrane monoamine transporter (PMAT), serotonin reuptake transporter (SERT) and choline high-affinity transporter (CHT) contribute to AP uptake of metformin in Caco-2 cells.
    [Show full text]
  • Promoter Methylation and Downregulation of SLC22A18 Are Associated with the Development and Progression of Human Glioma Chu Et Al
    Promoter methylation and downregulation of SLC22A18 are associated with the development and progression of human glioma Chu et al. Chu et al. Journal of Translational Medicine 2011, 9:156 http://www.translational-medicine.com/content/9/1/156 (21 September 2011) Chu et al. Journal of Translational Medicine 2011, 9:156 http://www.translational-medicine.com/content/9/1/156 RESEARCH Open Access Promoter methylation and downregulation of SLC22A18 are associated with the development and progression of human glioma Sheng-Hua Chu1*, Dong-Fu Feng1, Yan-Bin Ma1, Hong Zhang1, Zhi-An Zhu1, Zhi-Qiang Li2 and Pu-Cha Jiang2 Abstract Background: Downregulation of the putative tumor suppressor gene SLC22A18 has been reported in a number of human cancers. The aim of this study was to investigate the relationship between SLC22A18 downregulation, promoter methylation and the development and progression of human glioma. Method: SLC22A18 expression and promoter methylation was examined in human gliomas and the adjacent normal tissues. U251 glioma cells stably overexpressing SLC22A18 were generated to investigate the effect of SLC22A18 on cell growth and adherence in vitro using the methyl thiazole tetrazolium assay. Apoptosis was quantified using flow cytometry and the growth of SLC22A18 overexpressing U251 cells was measured in an in vivo xenograft model. Results: SLC22A18 protein expression is significantly decreased in human gliomas compared to the adjacent normal brain tissues. SLC22A18 protein expression is significantly lower in gliomas which recurred within six months after surgery than gliomas which did not recur within six months. SLC22A18 promoter methylation was detected in 50% of the gliomas, but not in the adjacent normal tissues of any patient.
    [Show full text]
  • Correlation Between Apparent Substrate Affinity and OCT2 Transport Turnover S
    Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2017/06/14/jpet.117.242552.DC1 1521-0103/362/3/405–412$25.00 https://doi.org/10.1124/jpet.117.242552 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 362:405–412, September 2017 Copyright ª 2017 by The American Society for Pharmacology and Experimental Therapeutics Correlation between Apparent Substrate Affinity and OCT2 Transport Turnover s Alyscia Cory Severance, Philip J. Sandoval, and Stephen H. Wright Department of Physiology, College of Medicine, University of Arizona, Tucson, Arizona Received April 28, 2017; accepted June 12, 2017 ABSTRACT Organic cation (OC) transporter 2 (OCT2) mediates the first step for six structurally distinct OCT2 substrates and found a strong Downloaded from in the renal secretion of many cationic drugs: basolateral uptake correlation between Jmax and Ktapp; high-affinity substrates from blood into proximal tubule cells. The impact of this process [Ktapp values ,50 mM, including 1-methyl-4-phenylpyridinium, on the pharmacokinetics of drug clearance as estimated using a or 1-methyl-4-phenylpyridinium (MPP), and cimetidine] dis- 22 21 physiologically-based pharmacokinetic approach relies on an played systematically lower Jmax values (,50 pmol cm min ) accurate understanding of the kinetics of transport because the than did low-affinity substrates (Ktapp .200 mM, including choline ratio of the maximal rate of transport to the Michaelis constant and metformin). Similarly, preloading OCT2-expressing cells with (i.e., Jmax/Kt) provides an estimate of the intrinsic clearance (Clint) low-affinity substrates resulted in systematically larger trans- jpet.aspetjournals.org used in in vitro–in vivo extrapolation of experimentally determined stimulated rates of MPP uptake than did preloading with high- transport data.
    [Show full text]
  • Screening of Genetic Variations of SLC15A2, SLC22A1, SLC22A2 and SLC22A6 Genes
    Journal of Human Genetics (2011) 56, 666–670 & 2011 The Japan Society of Human Genetics All rights reserved 1434-5161/11 $32.00 www.nature.com/jhg ORIGINAL ARTICLE Screening of genetic variations of SLC15A2, SLC22A1, SLC22A2 and SLC22A6 genes Hyun Sub Cheong1,4, Hae Deun Kim2,4, Han Sung Na2,JiOnKim1, Lyoung Hyo Kim1, Seung Hee Kim2, Joon Seol Bae3, Myeon Woo Chung2 and Hyoung Doo Shin1,3 A growing list of membrane-spanning proteins involved in the transport of a large variety of drugs has been recognized and characterized to include peptide and organic anion/cation transporters. Given such an important role of transporter genes in drug disposition process, the role of single-nucleotide polymorphisms (SNPs) in such transporters as potential determinants of interindividual variability in drug disposition and pharmacological response has been investigated. To define the distribution of transporter gene SNPs across ethnic groups, we screened 450 DNAs in cohorts of 250 Korean, 50 Han Chinese, 50 Japanese, 50 African-American and 50 European-American ancestries for 64 SNPs in four transporter genes encoding proteins of the solute carrier family (SLC15A2, SLC22A1, SLC22A2 and SLC22A6). Of the 64 SNPs, 19 were core pharmacogenetic variants and 45 were HapMap tagging SNPs. Polymorphisms were genotyped using the golden gate genotyping assay. After genetic variability, haplotype structures and ethnic diversity were analyzed, we observed that the distributions of SNPs in a Korean population were similar to other Asian groups (Chinese and Japanese), and significantly different from African-American and European-American cohorts. Findings from this study would be valuable for further researches, including pharmacogenetic studies for drug responses.
    [Show full text]
  • Analysis of OAT, OCT, OCTN, and Other Family Members Reveals 8
    bioRxiv preprint doi: https://doi.org/10.1101/2019.12.23.887299; this version posted December 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Reclassification of SLC22 Transporters: Analysis of OAT, OCT, OCTN, and other Family Members Reveals 8 Functional Subgroups Darcy Engelhart1, Jeffry C. Granados2, Da Shi3, Milton Saier Jr.4, Michael Baker6, Ruben Abagyan3, Sanjay K. Nigam5,6 1Department of Biology, University of California San Diego, La Jolla 92093 2Department of Bioengineering, University of California San Diego, La Jolla 92093 3School of Pharmacy and Pharmaceutical Sciences, University of California San Diego, La Jolla 92093 4Department of Molecular Biology, Division of Biological Sciences, University of California at San Diego, San Diego, CA, USA 5Department of Pediatrics, University of California San Diego, La Jolla 92093 6Department of Medicine, University of California San Diego, La Jolla 92093 *To whom correspondence should be addressed: [email protected] Running title: Functional subgroups for SLC22 1 bioRxiv preprint doi: https://doi.org/10.1101/2019.12.23.887299; this version posted December 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Among transporters, the SLC22 family is emerging as a central hub of endogenous physiology.
    [Show full text]
  • Effects of Gold Nanorods on Imprinted Genes Expression in TM-4 Sertoli Cells
    Int. J. Environ. Res. Public Health 2016, 13, 271; doi:10.3390/ijerph13030271 S1 of S5 Supplementary Materials: Effects of Gold Nanorods on Imprinted Genes Expression in TM-4 Sertoli Cells Beilei Yuan, Hao Gu, Bo Xu, Qiuqin Tang, Wei Wu, Xiaoli Ji, Yankai Xia, Lingqing Hu, Daozhen Chen and Xinru Wang Table S1. List of primers used to test the expression of the 44 imprinted genes and the reference genes Gapdh and U6. Gene Primer-F (5’-3’) Primer-R (5’-3’) Ano1 CTGATGCCGAGTGCAAGTATG AGGGCCTCTTGTGATGGTACA Cdkn1c CCCATCTAGCTTGCAGTCTCTT CAGACGGCTCAGGAACCATT Ddc TGGGGACCACAACATGCTG TCAGGGCAGATGAATGCACTG Dlk1 AGCTGCACCCCCAACC CTGCTGGCGCAGTTGGTC Gnas TGCAAGGAGCAACAGCGAT GCGGCCACAATGGTTTCAAT Gpr1 GCTGGGAGTTGTTCACTGGG GACGATGGCATTTCCTGGAAT Grb10 AACCCAGCTTTTGCAGGAA TCAGGGAGAAGATGTTGCTGT Gtl2 GTTTCTGGACTGTGGGCTGT CAACAGCAACAAAACTCAGAACATTCA H19 GCACCTTGGACATCTGGAGT TTCTTTCCAGCCCTAGCTCA Hymai TGCCTTTCAGTGTTGAACCA TGCATCCCTAAACAACAGCTT Igf2 AGCCGTGGCATCGTTGAG GACTGCTTCCAGGTGTCATATTG Igf2as TCTTTGCCCTCTTTCGTCTC CTCCAGGTGCTTCCGTCTAG Igf2r CTGCCGCTATGAAATTGAGTGG CGCCGCTCAGAGAACAAGTT Inpp5f V2 ACTGAACCTGAGCAGATTTCCA CCACCCCACTCCAAAAGGTT Kcnk9 GATGAAACGCCGGAAGTC GTGTTCGGCTTTGGCAGT Kcnq1 GCGTCTCCATCTACAGCACG GAAGTGGTAAACGAAGCATTTCC Klf14 TTTCCCTCACACTTGATTACCC AGCGAGGGAGGGACTAAGAT Magel2 GGGCTCCGCTAAATCATTG CCCCTGCGGTCTATAGAAGA Magi2 GGACTAGCAGGGTTCACGAA GCTCCGACGTACGGAAACT Mest TGACCACATTAGCCACTATCCA CCTGCTGGCTTCTTCCTATACA Mir296 ACACTCCAGCTGGGAGGGCCCCCCCTCAA CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACAGGATT Mir298 ACACTCCAGCTGGGAGCAGAAGCAGGGAGGTT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTGGGAGAA
    [Show full text]