DOCSLIB.ORG

Effects of SLC22A2 (Rs201919874) and SLC47A2 (Rs138244461)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Effects of SLC22A2 (Rs201919874) and SLC47A2 (Rs138244461) 155 Effects of SLC22A2 (rs201919874) and SLC47A2 (rs138244461) genetic variants on Metformin Pharmacokinetics in Pakistani T2DM patients Sadaf Moeez,1 Zoya Khalid,2 Fazal Jalil,3 Muhammad Irfan,4 Muhammad Ismail,5 Mohammad Ali Arif,6 Rauf Niazi,7 Sumbul Khalid8 Abstract Objective: To determine the frequencies of single nucleotide polymorphisms rs201919874 and rs138244461 in genes SLC22A2 and SLC47A2 respectively in Pakistani diabetes patients in order to characterise the genetic variants and determine their association with the pharmacokinetics of metformin. Methods: The case-control study was conducted at the International Islamic University, Islamabad, Pakistan, from June 2016 to June 2017, and comprised genotypes of diabetic cases and matching controls which were determined following allele-specific polymerase chain reaction. Cases were further divided into Group A and Group B. The former consisted of diabetics who were on monotherapy of metformin, while the latter consisted of diabetics treated with a combination of metformin and sulfonylureas. In-silico analysis was performed to verify the effect of single nucleotide polymorphisms rs201919874 and rs138244461 on the structure of genes. Association was statistically determined using SPSS 18. Results: Of the 1200 subjects, 800(66.6%) were cases and 400(33.3%) were controls. Among the cases, 400(50%) each were in Group A and Group B. Significant difference was observed in the distribution of rs201919874 between Group A and controls (p<0.05) and between Group B and controls (p<0.05) for heterozygous genotypic frequency and for allelic frequency. Conversely, statistically significant difference was observed in rs138244461 (p<0.05) for all genotypic and allelic frequencies. Genotypes were significantly associated with glycated haemoglobin, random and fasting glucose levels in Group A compared to Group B (p<0.05). In-silico analysis showed that both single nucleotide polymorphisms were expected to create significantly damaging structural changes in domains and helix (p<0.05 each). Conclusions: Both exonic single nucleotide polymorphisms were found to be associated with the pharmacokinetics of metformin. Key Words: Diabetes, Metformin, Pakistan, SNPs. (JPMA 69: 155; 2019). Introduction not undergo under any kind of metabolism by hepatic Metformin has been most commonly used as a first-line enzymes and is excreted unchanged by the kidneys. therapy for treatment of type 2 diabetes mellitus (T2DM) Transporters of metformin play a key role in its distribution for decades due to both its good anti-hyperglycaemic to different tissues and in its elimination through renal effect and safety profile.1 The pharmacological basis of passage.3 A considerable inter-individual variability in how metformin lowers the glucose level is not completely glucose-lowering response to metformin was reported clarified, but it has been established that its key function previously along with reduction of glycated haemoglobin is to inhibit hepatic gluconeogenesis.2 Metformin does (HbA1c) values ranging from 0.8% to 3%. Furthermore, 1,8International Islamic University, Islamabad, 2Sabanci University, Istanbul, less than two-thirds of patients responded adequately to 3Abdul Wali Khan University Mardan, 4Pir Mehr Ali Shah, Arid Agriculture metformin and achieved a desired fasting blood sugar University, Rawalpindi, 5Institute of Biomedical and Genetic Engineering, (FBS) level.4-7 Islamabad, 6,7Pakistan Institute of Medical Sciences (PIMS), Islamabad Correspondence: Sumbul Khalid. e-mail: [email protected] Human organic cation transporters (OCT 1-3) are encoded J Pak Med Assoc Effects of SLC22A2 (rs201919874) and SLC47A2 (rs138244461) genetic variants..... 156 by genes SLC22A1, SLC22A2 and SLC22A3. These are poly- kidney and its elimination from the organ. Hence, the specific transporters for small and hydrophilic organic present study was planned to evaluate the occurrence of cations like endogenous compounds serotonin and SLC22A2 (rs201919874G>A) and SLC47A2 (rs138244461 dopamine, toxic substances and clinically used drugs. C>T) genetic polymorphisms in T2DM patients that were Among more than 120 clinically used drugs that interact on monotherapy of metformin and those taking with different human OCTs, at least 20 are well-known combination therapy along with sulfonylureas. being transported. These include the anti-diabetic drug metformin, antineoplastic platinum compounds, the Material and Methods antiviral drugs acyclovir, the histamine H2 receptor The case-control study was conducted at the International antagonist cimetidine, ganciclovir, lamivudine and Islamic University, Islamabad, Pakistan, from June 2016 zalcitabine, and the antiarrhythmic drug quinidine.8 to June 2017, and comprised genotypes of diabetic cases All solute carrier superfamily (SLC22) proteins share a and matching controls which were determined following common membrane topology with 12 -helical allele-specific polymerase chain reaction. Cases were transmembrane domains. Mutational analysis and further divided into Group A and Group B. The former homology modelling of the steric structure of the proteins consisted of diabetics who were on monotherapy of led to the conclusion that they possess a large cleft that metformin, while the latter consisted of diabetics treated is accessible from the aqueous phase. Located within this with a combination of metformin and sulfonylureas. 20 cleft is an inner cavity containing different interaction Sample size was calculated by using online calculator sites for different substrates.9 It is involved in the uptake by considering confidence level 95% and confidence 21 of various xenobiotics from the bloodstream and takes interval (CI) in line with literature. Patients in group A them into renal epithelial cells.10 Kimura et al used Human were taking 1500mg of metformin per day for 6 months embryonic kidney (HEK293) cells to check the expression or more, while those in Group B was on 1000mg of of OCT2 and illustrated that metformin is a good substrate metformin and 80mg of sulfonylureas per day for one for this transporter.11 Different functional variants have year or more. Fom each individual, 3-5 ml blood sample been identified in the gene SLC22A2 that encodes OCT2 was taken and collected in ethylenediaminetetraacetic transporter.12 acid (EDTA) tubes. Multidrug and toxin extrusion (MATE) transporters are Cases were defined as subjects of either gender aged 35- encoded by genes SLC47A1 and SLC47A2. They are involved 80 years. Diagnosis of T2DM was based on the World in the efflux of several lipophobic organic cations, Health Organisation (WHO) / American Diabetes 22,23 including metformin. These transporters contain 400 to Association (ADA) definition. Patients with other types 550 amino acid residues and span 12 transmembrane of diabetes, co-treatment with other anti-diabetic drugs, domains.13,14 Genes of these transporters are located on and pregnant women were excluded. Written informed the short arm of the 17th chromosome, 17p11.2.15 Two consent was taken from all individuals prior to the study isoforms of MATE2 have been identified one of which is which was approved by the Pakistan Institute of Medical MATE2K.16 Like MATE1, MATE2K has been involved in the Sciences (PIMS) Hospital, Islamabad, Pakistan. Blood transport of several structurally distinct compounds, sampling from T2DM patients was done in outpatient including metformin.17 Up till now, only few genetic clinics of endocrinology at PIMS. Detailed demographic variants have been identified in MATE2K and very few and clinical data was collected from each individual. have been analysed with respect to metformin.18 Unrelated healthy volunteers of either gender were enrolled through non-probability consecutive sampling. Genetic variation in the genes SLC22A2 and SLC47A2 that encodes OCT2 and MATE2K transporters have been found Genomic deoxyribonucleic acid (DNA) was isolated from to be linked with therapeutic efficacy of metformin in peripheral blood leukocytes using standard phenol O T2DM.10,19 Both single nucleotide polymorphisms (SNPs) chloroform method and stored at -20 C, until use. are present in exon so it was hypothesized that any Genotyping was done using allele-specific polymerase changes in these sequences may reduce transcription chain reaction (PCR) and amplification was done by using rates and thereby reduced OCT2 and MATE2K expression 2700 Applied Biosystems. The primers sets, two forward leading to a decreased transport of metformin into the primers and one reverse primer, were used to amplify Vol. 69, No. 02, February 2019 157 S. Moeez, Z. Khalid, F. Jalil, et al. ACLY Median ranges were used to describe the central tendency SLC22A1 SLC47A2 ALDH18A1 and variability of continuous variables, while frequencies ZNF200 EHMT2 TOP2B TOP2A were used to describe the distribution of categorical SLC22A6 variables. Fisher exact test or non-parametric Mann- YRDC IGF2R SLC22A8 Whitney test was used to compare clinical characteristics RS1A1 SLC22A2 SLC47A2 SLC6A2 SLC22A2 between different patient groups. Chi-square test was SLC2A12 used to assess the deviation from Hardy-Weinberg SLC22A13 equilibrium (HWE). The level of statistical significance was SLC2A13 SLC47A1 set at p<0.05. Data was analysed using SPSS 18. SLC22A5 Results Figure-1: Gene network of SLC22A2 and SLC47A2 predicted by STRING. Of the 1200 subjects, 800(66.6%) were cases and 400(33.3%) were controls. Among the cases, 400(50%) SLC22A2 rs201919874 and SLC47A2 rs138244461
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
    [Show full text]
  • Mouse Slc22a2 Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Slc22a2 Knockout Project (CRISPR/Cas9) Objective: To create a Slc22a2 knockout Mouse model (C57BL/6N) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Slc22a2 gene (NCBI Reference Sequence: NM_013667 ; Ensembl: ENSMUSG00000040966 ) is located on Mouse chromosome 17. 11 exons are identified, with the ATG start codon in exon 1 and the TAA stop codon in exon 11 (Transcript: ENSMUST00000046959). Exon 2 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a knockout allele are viable and fertile and display no obvious phenotypic abnormalities. No significant defects in the renal secretion of a model organic cation are observed. Exon 2 starts from about 25.02% of the coding region. Exon 2 covers 6.27% of the coding region. The size of effective KO region: ~104 bp. The KO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 11 Legends Exon of mouse Slc22a2 Knockout region Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of Exon 2 is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats.
    [Show full text]
  • Interplay Between Metformin and Serotonin Transport in the Gastrointestinal Tract: a Novel Mechanism for the Intestinal Absorption and Adverse Effects of Metformin
    INTERPLAY BETWEEN METFORMIN AND SEROTONIN TRANSPORT IN THE GASTROINTESTINAL TRACT: A NOVEL MECHANISM FOR THE INTESTINAL ABSORPTION AND ADVERSE EFFECTS OF METFORMIN Tianxiang Han A dissertation submitted to the faculty of the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Eshelman School of Pharmacy. Chapel Hill 2013 Approved By: Dhiren R. Thakker, Ph.D. Michael Jay, Ph.D. Kim L. R. Brouwer, Pharm.D., Ph.D. Joseph W. Polli, Ph.D. Xiao Xiao, Ph.D. © 2013 Tianxiang Han ALL RIGHTS RESERVED ii ABSTRACT TIANXIANG HAN: Interplay between Metformin and Serotonin Transport in the Gastrointestinal Tract: A Novel Mechanism for the Intestinal Absorption and Adverse Effects of Metformin (Under the direction of Dhiren R. Thakker, Ph.D.) Metformin is a widely prescribed drug for Type II diabetes mellitus. Previous studies have shown that this highly hydrophilic and charged compound traverses predominantly paracellularly across the Caco-2 cell monolayer, a well-established model for human intestinal epithelium. However, oral bioavailability of metformin is significantly higher than that of the paracellular probe, mannitol (~60% vs ~16%). Based on these observations, the Thakker laboratory proposed a “sponge” hypothesis (Proctor et al., 2008) which states that the functional synergy between apical (AP) transporters and paracellular transport enhances the intestinal absorption of metformin. This dissertation work aims to identify AP uptake transporters of metformin, determine their polarized localization, and elucidate their roles in the intestinal absorption and adverse effects of metformin. Chemical inhibition and transporter-knockdown studies revealed that four transporters, namely, organic cation transporter 1 (OCT1), plasma membrane monoamine transporter (PMAT), serotonin reuptake transporter (SERT) and choline high-affinity transporter (CHT) contribute to AP uptake of metformin in Caco-2 cells.
    [Show full text]
  • Correlation Between Apparent Substrate Affinity and OCT2 Transport Turnover S
    Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2017/06/14/jpet.117.242552.DC1 1521-0103/362/3/405–412$25.00 https://doi.org/10.1124/jpet.117.242552 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 362:405–412, September 2017 Copyright ª 2017 by The American Society for Pharmacology and Experimental Therapeutics Correlation between Apparent Substrate Affinity and OCT2 Transport Turnover s Alyscia Cory Severance, Philip J. Sandoval, and Stephen H. Wright Department of Physiology, College of Medicine, University of Arizona, Tucson, Arizona Received April 28, 2017; accepted June 12, 2017 ABSTRACT Organic cation (OC) transporter 2 (OCT2) mediates the first step for six structurally distinct OCT2 substrates and found a strong Downloaded from in the renal secretion of many cationic drugs: basolateral uptake correlation between Jmax and Ktapp; high-affinity substrates from blood into proximal tubule cells. The impact of this process [Ktapp values ,50 mM, including 1-methyl-4-phenylpyridinium, on the pharmacokinetics of drug clearance as estimated using a or 1-methyl-4-phenylpyridinium (MPP), and cimetidine] dis- 22 21 physiologically-based pharmacokinetic approach relies on an played systematically lower Jmax values (,50 pmol cm min ) accurate understanding of the kinetics of transport because the than did low-affinity substrates (Ktapp .200 mM, including choline ratio of the maximal rate of transport to the Michaelis constant and metformin). Similarly, preloading OCT2-expressing cells with (i.e., Jmax/Kt) provides an estimate of the intrinsic clearance (Clint) low-affinity substrates resulted in systematically larger trans- jpet.aspetjournals.org used in in vitro–in vivo extrapolation of experimentally determined stimulated rates of MPP uptake than did preloading with high- transport data.
    [Show full text]
  • Screening of Genetic Variations of SLC15A2, SLC22A1, SLC22A2 and SLC22A6 Genes
    Journal of Human Genetics (2011) 56, 666–670 & 2011 The Japan Society of Human Genetics All rights reserved 1434-5161/11 $32.00 www.nature.com/jhg ORIGINAL ARTICLE Screening of genetic variations of SLC15A2, SLC22A1, SLC22A2 and SLC22A6 genes Hyun Sub Cheong1,4, Hae Deun Kim2,4, Han Sung Na2,JiOnKim1, Lyoung Hyo Kim1, Seung Hee Kim2, Joon Seol Bae3, Myeon Woo Chung2 and Hyoung Doo Shin1,3 A growing list of membrane-spanning proteins involved in the transport of a large variety of drugs has been recognized and characterized to include peptide and organic anion/cation transporters. Given such an important role of transporter genes in drug disposition process, the role of single-nucleotide polymorphisms (SNPs) in such transporters as potential determinants of interindividual variability in drug disposition and pharmacological response has been investigated. To define the distribution of transporter gene SNPs across ethnic groups, we screened 450 DNAs in cohorts of 250 Korean, 50 Han Chinese, 50 Japanese, 50 African-American and 50 European-American ancestries for 64 SNPs in four transporter genes encoding proteins of the solute carrier family (SLC15A2, SLC22A1, SLC22A2 and SLC22A6). Of the 64 SNPs, 19 were core pharmacogenetic variants and 45 were HapMap tagging SNPs. Polymorphisms were genotyped using the golden gate genotyping assay. After genetic variability, haplotype structures and ethnic diversity were analyzed, we observed that the distributions of SNPs in a Korean population were similar to other Asian groups (Chinese and Japanese), and significantly different from African-American and European-American cohorts. Findings from this study would be valuable for further researches, including pharmacogenetic studies for drug responses.
    [Show full text]
  • Analysis of OAT, OCT, OCTN, and Other Family Members Reveals 8
    bioRxiv preprint doi: https://doi.org/10.1101/2019.12.23.887299; this version posted December 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Reclassification of SLC22 Transporters: Analysis of OAT, OCT, OCTN, and other Family Members Reveals 8 Functional Subgroups Darcy Engelhart1, Jeffry C. Granados2, Da Shi3, Milton Saier Jr.4, Michael Baker6, Ruben Abagyan3, Sanjay K. Nigam5,6 1Department of Biology, University of California San Diego, La Jolla 92093 2Department of Bioengineering, University of California San Diego, La Jolla 92093 3School of Pharmacy and Pharmaceutical Sciences, University of California San Diego, La Jolla 92093 4Department of Molecular Biology, Division of Biological Sciences, University of California at San Diego, San Diego, CA, USA 5Department of Pediatrics, University of California San Diego, La Jolla 92093 6Department of Medicine, University of California San Diego, La Jolla 92093 *To whom correspondence should be addressed: [email protected] Running title: Functional subgroups for SLC22 1 bioRxiv preprint doi: https://doi.org/10.1101/2019.12.23.887299; this version posted December 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Among transporters, the SLC22 family is emerging as a central hub of endogenous physiology.
    [Show full text]
  • Effects of Gold Nanorods on Imprinted Genes Expression in TM-4 Sertoli Cells
    Int. J. Environ. Res. Public Health 2016, 13, 271; doi:10.3390/ijerph13030271 S1 of S5 Supplementary Materials: Effects of Gold Nanorods on Imprinted Genes Expression in TM-4 Sertoli Cells Beilei Yuan, Hao Gu, Bo Xu, Qiuqin Tang, Wei Wu, Xiaoli Ji, Yankai Xia, Lingqing Hu, Daozhen Chen and Xinru Wang Table S1. List of primers used to test the expression of the 44 imprinted genes and the reference genes Gapdh and U6. Gene Primer-F (5’-3’) Primer-R (5’-3’) Ano1 CTGATGCCGAGTGCAAGTATG AGGGCCTCTTGTGATGGTACA Cdkn1c CCCATCTAGCTTGCAGTCTCTT CAGACGGCTCAGGAACCATT Ddc TGGGGACCACAACATGCTG TCAGGGCAGATGAATGCACTG Dlk1 AGCTGCACCCCCAACC CTGCTGGCGCAGTTGGTC Gnas TGCAAGGAGCAACAGCGAT GCGGCCACAATGGTTTCAAT Gpr1 GCTGGGAGTTGTTCACTGGG GACGATGGCATTTCCTGGAAT Grb10 AACCCAGCTTTTGCAGGAA TCAGGGAGAAGATGTTGCTGT Gtl2 GTTTCTGGACTGTGGGCTGT CAACAGCAACAAAACTCAGAACATTCA H19 GCACCTTGGACATCTGGAGT TTCTTTCCAGCCCTAGCTCA Hymai TGCCTTTCAGTGTTGAACCA TGCATCCCTAAACAACAGCTT Igf2 AGCCGTGGCATCGTTGAG GACTGCTTCCAGGTGTCATATTG Igf2as TCTTTGCCCTCTTTCGTCTC CTCCAGGTGCTTCCGTCTAG Igf2r CTGCCGCTATGAAATTGAGTGG CGCCGCTCAGAGAACAAGTT Inpp5f V2 ACTGAACCTGAGCAGATTTCCA CCACCCCACTCCAAAAGGTT Kcnk9 GATGAAACGCCGGAAGTC GTGTTCGGCTTTGGCAGT Kcnq1 GCGTCTCCATCTACAGCACG GAAGTGGTAAACGAAGCATTTCC Klf14 TTTCCCTCACACTTGATTACCC AGCGAGGGAGGGACTAAGAT Magel2 GGGCTCCGCTAAATCATTG CCCCTGCGGTCTATAGAAGA Magi2 GGACTAGCAGGGTTCACGAA GCTCCGACGTACGGAAACT Mest TGACCACATTAGCCACTATCCA CCTGCTGGCTTCTTCCTATACA Mir296 ACACTCCAGCTGGGAGGGCCCCCCCTCAA CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACAGGATT Mir298 ACACTCCAGCTGGGAGCAGAAGCAGGGAGGTT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTGGGAGAA
    [Show full text]
  • Identification of GLUT12/SLC2A12 As a Urate Transporter That
    Identification of GLUT12/SLC2A12 as a urate BRIEF REPORT transporter that regulates the blood urate level in hyperuricemia model mice Yu Toyodaa,1, Tappei Takadaa,1,2, Hiroshi Miyataa,1, Hirotaka Matsuob, Hidetoshi Kassaic, Kazuki Nakaoc, Masahiro Nakatochid, Yusuke Kawamurab, Seiko Shimizub, Nariyoshi Shinomiyab, Kimiyoshi Ichidae, Makoto Hosoyamadaf, Atsu Aibac, and Hiroshi Suzukia aDepartment of Pharmacy, The University of Tokyo Hospital, Bunkyo-ku, 113-8655 Tokyo, Japan; bDepartment of Integrative Physiology and Bio-Nano Medicine, National Defense Medical College, Tokorozawa, 359-8513 Saitama, Japan; cLaboratory of Animal Resources, Center for Disease Biology and Integrative Medicine, Graduate School of Medicine, The University of Tokyo, Bunkyo-ku, 113-0033 Tokyo, Japan; dDivision of Public Health Informatics, Department of Integrative Health Science, Nagoya University Graduate School of Medicine, 461-8673 Nagoya, Japan; eDepartment of Pathophysiology, Tokyo University of Pharmacy and Life Sciences, Hachioji, 192-0392 Tokyo, Japan; and fDepartment of Human Physiology and Pathology, Faculty of Pharma-Sciences, Teikyo University, Itabashi-ku, 173-8605 Tokyo, Japan Edited by Francisco Bezanilla, The University of Chicago, Chicago, IL, and approved June 29, 2020 (received for review April 14, 2020) Recent genome-wide association studies have revealed some ge- affected the urate transport activity of GLUT12 (Fig. 1D); netic loci associated with serum uric acid levels and susceptibility GLUT12 is more active at lower pH (Fig. 1E). As GLUT12- to gout/hyperuricemia which contain potential candidates of mediated urate uptake increased linearly with time over physiologically important urate transporters. One of these novel 10 min (Fig. 1F), uptake at 5 min was evaluated in subsequent loci is located upstream of SGK1 and SLC2A12, suggesting that kinetic analysis.
    [Show full text]
  • Characterization of Centrally Expressed Solute Carriers
    Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1215 Characterization of Centrally Expressed Solute Carriers Histological and Functional Studies with Transgenic Mice SAHAR ROSHANBIN ACTA UNIVERSITATIS UPSALIENSIS ISSN 1651-6206 ISBN 978-91-554-9555-8 UPPSALA urn:nbn:se:uu:diva-282956 2016 Dissertation presented at Uppsala University to be publicly examined in B:21, Husargatan. 75124 Uppsala, Uppsala, Friday, 3 June 2016 at 13:15 for the degree of Doctor of Philosophy (Faculty of Medicine). The examination will be conducted in English. Faculty examiner: Biträdande professor David Engblom (Institutionen för klinisk och experimentell medicin, Cellbiologi, Linköpings Universitet). Abstract Roshanbin, S. 2016. Characterization of Centrally Expressed Solute Carriers. Histological and Functional Studies with Transgenic Mice. (. His). Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1215. 62 pp. Uppsala: Acta Universitatis Upsaliensis. ISBN 978-91-554-9555-8. The Solute Carrier (SLC) superfamily is the largest group of membrane-bound transporters, currently with 456 transporters in 52 families. Much remains unknown about the tissue distribution and function of many of these transporters. The aim of this thesis was to characterize select SLCs with emphasis on tissue distribution, cellular localization, and function. In paper I, we studied the leucine transporter B0AT2 (Slc6a15). Localization of B0AT2 and Slc6a15 in mouse brain was determined using in situ hybridization (ISH) and immunohistochemistry (IHC), localizing it to neurons, epithelial cells, and astrocytes. Furthermore, we observed a lower reduction of food intake in Slc6a15 knockout mice (KO) upon intraperitoneal injections with leucine, suggesting B0AT2 is involved in mediating the anorexigenic effects of leucine.
    [Show full text]
  • Human Intestinal Nutrient Transporters
    Gastrointestinal Functions, edited by Edgard E. Delvin and Michael J. Lentze. Nestle Nutrition Workshop Series. Pediatric Program. Vol. 46. Nestec Ltd.. Vevey/Lippincott Williams & Wilkins, Philadelphia © 2001. Human Intestinal Nutrient Transporters Ernest M. Wright Department of Physiology, UCLA School of Medicine, Los Angeles, California, USA Over the past decade, advances in molecular biology have revolutionized studies on intestinal nutrient absorption in humans. Before the advent of molecular biology, the study of nutrient absorption was largely limited to in vivo and in vitro animal model systems. This did result in the classification of the different transport systems involved, and in the development of models for nutrient transport across enterocytes (1). Nutrients are either absorbed passively or actively. Passive transport across the epithelium occurs down the nutrient's concentration gradient by simple or facilitated diffusion. The efficiency of simple diffusion depends on the lipid solubility of the nutrient in the plasma membranes—the higher the molecule's partition coefficient, the higher the rate of diffusion. Facilitated diffusion depends on the presence of simple carriers (uniporters) in the plasma membranes, and the kinetic properties of these uniporters. The rate of facilitated diffusion depends on the density, turnover number, and affinity of the uniporters in the brush border and basolateral membranes. The ' 'active'' transport of nutrients simply means that energy is provided to transport molecules across the gut against their concentration gradient. It is now well recog- nized that active nutrient transport is brought about by Na+ or H+ cotransporters (symporters) that harness the energy stored in ion gradients to drive the uphill trans- port of a solute.
    [Show full text]
  • Pflugers Final
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Serveur académique lausannois A comprehensive analysis of gene expression profiles in distal parts of the mouse renal tubule. Sylvain Pradervand2, Annie Mercier Zuber1, Gabriel Centeno1, Olivier Bonny1,3,4 and Dmitri Firsov1,4 1 - Department of Pharmacology and Toxicology, University of Lausanne, 1005 Lausanne, Switzerland 2 - DNA Array Facility, University of Lausanne, 1015 Lausanne, Switzerland 3 - Service of Nephrology, Lausanne University Hospital, 1005 Lausanne, Switzerland 4 – these two authors have equally contributed to the study to whom correspondence should be addressed: Dmitri FIRSOV Department of Pharmacology and Toxicology, University of Lausanne, 27 rue du Bugnon, 1005 Lausanne, Switzerland Phone: ++ 41-216925406 Fax: ++ 41-216925355 e-mail: [email protected] and Olivier BONNY Department of Pharmacology and Toxicology, University of Lausanne, 27 rue du Bugnon, 1005 Lausanne, Switzerland Phone: ++ 41-216925417 Fax: ++ 41-216925355 e-mail: [email protected] 1 Abstract The distal parts of the renal tubule play a critical role in maintaining homeostasis of extracellular fluids. In this review, we present an in-depth analysis of microarray-based gene expression profiles available for microdissected mouse distal nephron segments, i.e., the distal convoluted tubule (DCT) and the connecting tubule (CNT), and for the cortical portion of the collecting duct (CCD) (Zuber et al., 2009). Classification of expressed transcripts in 14 major functional gene categories demonstrated that all principal proteins involved in maintaining of salt and water balance are represented by highly abundant transcripts. However, a significant number of transcripts belonging, for instance, to categories of G protein-coupled receptors (GPCR) or serine-threonine kinases exhibit high expression levels but remain unassigned to a specific renal function.
    [Show full text]