-1DWQ6FL)RXQGDWLRQ6UL/DQND DOI: http://dx.doi.org/10.4038/jnsfsr.v47i3.9427
RESEARCH ARTICLE
Some biological aspects and molecular variations in frigate tuna, Auxis thazard of the coastal waters around Sri Lanka †
D.R. Herath 1,3, H.A.C.C. Perera 2 and G.H.C.M. Hettiarachchi 3* 0DULQH%LRORJLFDO5HVRXUFHV'LYLVLRQ1DWLRQDO$TXDWLF5HVRXUFHV5HVHDUFKDQG'HYHORSPHQW$JHQF\&RORPER 'HSDUWPHQWRI=RRORJ\DQG(QYLURQPHQWDO0DQDJHPHQW8QLYHUVLW\RI.HODQL\D.HODQL\D 'HSDUWPHQWRI&KHPLVWU\)DFXOW\RI6FLHQFH8QLYHUVLW\RI&RORPER&RORPER
Submitted: 29 August 2018; Revised: 25 March 2019; Accepted: 24 May 2019
Abstract: (frigate tuna), is a commercially $X[LV WKD]DUG INTRODUCTION LPSRUWDQW ¿VK VSHFLHV LQ 6UL /DQND $OWKRXJK 6UL /DQND LV fortunate to have a large resource of tuna, little information is available on the biology, genetics and stock structure of $X[LV WKD]DUG (frigate tuna), also called $ODJRGXZD $WKD]DUG . Hence, the present study was conducted to study the in the local market, is a very important neritic tuna biology, genetics and stock structure of $WKD]DUG in coastal species in Sri Lanka. There are three species of neritic ZDWHUVDURXQG6UL/DQND7KH¿VKVDPSOHVZHUHFROOHFWHGIURP tuna, (XWK\QQXV D৽QLV (kawakawa), $X[LV WKD]DUG October 2015 to September 2017 from day-boats operating in (frigate tuna) and $X[LVURFKHL (bullet tuna), commonly WKH:HVWHUQ1RUWK:HVWHUQ(DVWHUQDQG6RXWKHUQ3URYLQFHV occurring in the coastal waters of Sri Lanka. The neritic of Sri Lanka. For this period, the length-weight relationship tunas constitute approximately 13 % of the total tuna and Fulton’s condition factor (K) calculated for $ WKD]DUG production of the country (Bandaranayake & Maldeniya, using standard length measured in centimetres and weight 2012). In 2015, $WKD]DUG has contributed 38 % while measured in grams were shown as = 0.1091 3.3385 and 1.93, : / and have contributed 39 % and 23 %, respectively, indicating a relatively healthy growth pattern and $URFKHL (D৽QLV a comparatively unpolluted habitat. Studies on the stomach respectively to the total neritic tuna catch of Sri Lanka contents revealed that $WKD]DUG are non-selective carnivors, (Rathnasuriya et al. , 2017). A higher percentage of neritic IHHGLQJRQGLYHUVHDQLPDOSUH\LWHPVVXFKDVVPDOO¿VKVSHFLHV tuna production has been recorded from the Southern and shrimps and cephalopods available in the surrounding waters. 6RXWKHDVWHUQSDUWVRIWKHFRXQWU\ 3HUHUD et al ., 2014). It The fecundity of female $WKD]DUG was shown to be 48,056 has been reported that in the recent past, Sri Lanka, India, to 267,000 eggs. The calculated GSI values showed that the Indonesia and Iran together have accounted for 90 % of peak spawning period for male $WKD]DUG extends from May to $WKD]DUG catch of the world (IOTC, 2014). Frequently, August and for the females from May to July. The phylogenetic $WKD]DUG LVPLVLGHQWL¿HGDV $URFKHL and the catch is analysis of the mitochondrial D-loop region sequences of 75 reported as a combination of these two species. Neritic selected samples representing all the geographical regions tunas are caught by a variety of gear types, such as VWXGLHGVKRZHGWKDWWKH¿VKRIGL൵HUHQWUHJLRQVDUHFOXVWHULQJ gillnets, handline and troll-line in the coastal waters WRJHWKHU +HQFH IRU ¿VKHULHV PDQDJHPHQW VWUDWHJLHV around the country (IOTC, 2016). $WKD]DUG found in the coastal waters of the Western, North :HVWHUQ(DVWHUQDQG6RXWKHUQ3URYLQFHVRI6UL/DQNDFRXOG be considered as a single stock. However, there is very limited information available on the biology and stock structure of $WKD]DUG of the Keywords: $X[LVWKD]DUG , feeding, frigate tuna, growth, stock Indian Ocean (IOTC, 2016). The biology, genetics LGHQWL¿FDWLRQ DQG ¿VKHU\ RI $ WKD]DUG have been studied in India
* Corresponding author ([email protected] ; https://orcid.org/0000-0002-9557-751X) † $PDMRUSDUWRIWKLVUHVHDUFKZDVSUHVHQWHGDQGSXEOLVKHGLQ3URFHHGLQJVRIWKH6RXWK$VLDQ%LRWHFKQRORJ\&RQIHUHQFH This article is published under the Creative Commons CC-BY-ND License (http://creativecommons.org/licenses/by-nd/4.0/). This license permits use, distribution and reproduction, commercial and non-commercial, provided that the original work is properly cited and is not changed in anyway. 0(7+2'2/2*< '5+HUDWKHWDO 6DPSOHFROOHFWLRQ (Ghosh et al. , 2012; Kumar et al ., 2012a) and Indonesia where, : LV WKH ERG\ ZHLJKW RI WKH ¿VK LQ J / is the (Noegroho et al ., 2013; Hamidi et al ., 2018). In addition, standard length in cm, a is the regression intercept and b Johnson et al . (2015) have carried out biological and LVWKHUHJUHVVLRQFRH൶FLHQWRUVORSHRIDSORWRIORJ: vs genetic studies on $ WKD]DUG and stated that a single log L (Froese, 2006). stock of $WKD]DUG exists throughout the Northern waters RI 7DQ]DQLD 3RSXODWLRQ JHQHWLF VWUXFWXUHV RI GL൵HUHQW Fulton’s condition factor (K) was estimated from the tuna species have been studied using various molecular followingܹ ൌ ܽܮ relationship: markers. Kunal et al . (2013) have used the mitochondrial COI region to study the variations in 7KXQQXVDOEDFDUHV ...(2) \HOORZ¿Q WXQD LQ ,QGLDQ ZDWHUV DQG PLWRFKRQGULDO ଷ ܭ ൌ ͳͲͲܹȀܮ D-loop sequencing has been the choice of marker for the where, / is the standard length in cm and : is the weight VWXG\RIORQJWDLOWXQDLQWKH,QGR3DFL¿FEDVLQ :LOOHWWH in g (Sarkar et al ., 2013). et al ., 2015) and for the study of variations in Auxis species ሺሻ in the South China and Java Seas (Habib & Sulaiman, ሺ ሻ ൌ ൈ ͳͲͲ 7KHSK\ORJHQHWLFUHODWLRQVKLSEHWZHHQ¿YHWXQD ሺሻ species has been analysed using the mitochondrial D-loop sequences (Kumar et al ., 2014), and the genetic stocks of skipjack tuna in the Northwestern Indian Ocean have been studied using mitochondrial DNA and microsatellites (Dammannagoda et al. , 2011).
Although a few biological studies have been carried out in Sri Lanka on $ WKD]DUG , genetic studies have not yet been carried out. Hence, studying the biology, reproduction and genetic stock structure of $WKD]DUG is very important as this information can be compared with the information available for the region to manage the VWRFNVRIWKLVYDOXDEOHFRPPHUFLDO¿VKHU\UHVRXUFH
METHODOLOGY
Sample collection
A total of 405 $ WKD]DUG ¿VK VDPSOHV ZHUH FROOHFWHG from the coastal areas of Chilaw and Kalpitiya in the 1RUWKZHVWHUQ3URYLQFH 1HJRPERDQG%HUXZHODLQWKH :HVWHUQ 3URYLQFH 'RGDQGXZD *DOOH :HOLJDPD DQG 0LULVVD LQ WKH 6RXWKHUQ 3URYLQFH DQG 7ULQFRPDOHH LQ WKH(DVWHUQ3URYLQFHRI6UL/DQND )LJXUH 6DPSOLQJ )LJXUH 0DSRI6UL/DQNDVKRZLQJWKHVDPSOLQJORFDWLRQVFigure 1: Map of Sri Lanka showing the sampling was carried out from October 2015 to September 2017 locations from day-boats, which had gone to sea in the evening and returned the next day morning. Feeding and spawning of A. thazard Morphological and biological analysis of A. thazard The $ WKD]DUG ¿VK VDPSOHV ZHUH GLVVHFWHG DQG WKH Biological analysis was carried out for the 405 $WKD]DUG stomachs were weighed to the nearest 0.1 g. The ¿VK VDPSOHV WKDW ZHUH FROOHFWHG IURP DOO VDPSOLQJ stomachs were then cut open and according to the locations. Weight to the nearest 0.1 g and standard length stomach fullness observed visually, it was categorised 6/ WRWKHQHDUHVWFPRIWKH¿VKZHUHUHFRUGHG7KH into 5 classes: full, three fourths (3/4) full, half (1/2) full, relationship between standard length and weight of the one fourth (1/4) full and empty. The prey items were VDPSOHG¿VKZDVHYDOXDWHGXVLQJWKHIROORZLQJHTXDWLRQ VHSDUDWHG WR LGHQWLI\ WKH GL൵HUHQW FDWHJRULHV RI IRRG LWHPV ¿VKFUXVWDFHDQVFHSKDORSRGVHWF WKDWFRXOGEH ...(1) found within the stomach cavities. The weight of each ܹ ൌ ܽܮ September 2019 Journal of the National Science Foundation of Sri Lanka 47(3) ଷ ܭ ൌ ͳͲͲܹȀܮ
ሺሻ ሺ ሻ ൌ ൈ ͳͲͲ ሺሻ %LRORJ\DQGJHQHWLFVRI$X[LVWKD]DUGRI6UL/DQND category of prey item was recorded to the nearest 0.1 g samples according to the following equation (Adebiyi, (Hyslop, 1980). The gonads were analysed to determine 2013): WKHVH[RIHDFK¿VKDQGWKHPDWXULW\VWDJHZDVGHWHUPLQHG XVLQJDPDWXULW\VFDOH PRGL¿HGIURP+ROGHQ 5DLWW 1974) given in Table 1. The weight of the gonads and ሺሻ ሺ ሻ ൌ ൈ ͳͲͲ maturity stages were recorded. Fecundity was calculated ሺሻ ...(3) by counting the number of eggs in a known quantity of preserved mature stage IV female gonads. Gonado ZKHUH6RPDWLFZHLJKWRI¿VK >WRWDOZHLJKWRI¿VK± somatic index (GSI) was calculated for male and female (gonad weight + stomach weight)] weighed in g.
Table 1: 0DWXULW\VFDOHXVHGIRUWKHLGHQWL¿FDWLRQRIJRQDGDOVWDJHVRIPDOHDQGIHPDOH $WKD]DUG PRGL¿HGIURP+ROGHQ 5DLWW 1974).
Female Male
6WDJH, 9HU\WKLQDQGWUDQVOXFHQWWXEHOLNH 9HU\WKLQDQGWUDQVOXFHQWHORQJDWHGDQGÀDWWHQHG (Immature) reaching less than 1/3 of the body cavity reaching less than 1/3 of the body cavity, whitish in colour
6WDJH,, 0RUHWKDQWKHERG\FDYLW\WXEHOLNH (ORQJDWHGDQGÀDWWHQHGZKLWLVKPRUHWKDQWKH (Maturing) body cavity
Stage III Reaching 2/3 of the body cavity, tube-like, Reaching 2/3 of the body cavity, elongated, cream coloured (Mature/ripening) reddish in colour
6WDJH,9 5RXQGHGUHGLQFRORXUODUJHDQGIXOORIHJJV (ORQJDWHGFUHDPFRORXUHGZLWKVXSHU¿FLDOUHGEORRGYHVVHOV 5LSH ZLWKVXSHU¿FLDOEORRGYHVVHOV
Stage V Reddish yellow, with remnants of eggs Whitish and shrunken (Spent) visible, shrunken
A. thazard Molecular analysis of MgCl 2. Forward and reverse sequences were obtained for each sample and the consensus sequences were Tissue samples of 75 randomly selected $ WKD]DUG derived by using BioEdit version 7.0.5.3. These samples collected from all the locations were used for VHTXHQFHV ZHUH XVHG WR FRQ¿UP WKH LGHQWLW\ RI WKH total genomic DNA extraction using a standard phenol ¿VK VSHFLHV XVLQJ 1&%, EODVW IDFLOLW\ $ PD[LPXP chloroform method (Green & Sambrook, 2012). The likelihood tree was created for 75 of these sequences PLWRFKRQGULDO '1$ 'ORRS UHJLRQ ZDV DPSOL¿HG using the Mega 7 software programme using a bootstrap using primers from Kumar et al . (2012b) (NTDLF and YDOXH RI WR FRPSDUH WKH RULJLQ RI WKH GL൵HUHQW NTDLR). The forward and reverse primer sequences populations. were as follows: NTDLF - 5'CCGGACGTCGGAGGTTAAAAT3' RESULTS AND DISCUSSION (forward) NTDLR - 5'AGGAACCAAATGCCAGGAATA3' Length weight relationship and Fulton’s condition (reverse) factor K for A. thazard
3&5 ZDV FDUULHG RXW LQ / UHDFWLRQV ZLWK QJ Length and weight parameters were measured for a of the extracted genomic DNA, 2.5 units of Taq total of 405 $WKD]DUG ¿VKVDPSOHVFROOHFWHGIURPDOO SRO\PHUDVH 3URPHJD 86$ / RI î 3&5 the locations. Table 2 gives the mean values (± standard EX൵HU/RI0IRUZDUGDQGUHYHUVHSULPHUV deviations) of the weight, standard length and K values / RI P0 G173V DQG RI / RI P0 IRU WKH VDPSOHV FROOHFWHGIURP GL൵HUHQWORFDWLRQV7KH
Journal of the National Science Foundation of Sri Lanka 47(3) September 2019 '5+HUDWKHWDO
highest mean weight and standard length was recorded The Fulton’s condition factor K for the sampled $WKD]DUG from the Southern province and the highest K value was was 1.93. The K factor can be used for understanding the from the Western province. The standard length of the JURZWKFRQGLWLRQRIWKH¿VK 0RXWRSRXORV 6WHUJLRX collected samples varied from 19.4 to 40.7 cm and the 2002). A K value of more than 1 indicates a healthy weight of the samples varied from 118.9 to 1430.9 g. The condition while a value less than 1 indicates a poor OHQJWKUDQJHRIWKH¿VKVDPSOHGLQWKHSUHVHQWVWXG\LVLQ condition (Hall & Van Den Avylle, 1986). In general, the congruence with the length range of $WKD]DUG caught higher the K value, the better is the physical condition in the Indian Ocean, which has been reported as 20 cm – RI WKH ¿VK )URHVH ,Q WKH SUHVHQW VWXG\ WKH . 50 cm (IOTC, 2016). The length weight relationship was value obtained for $ WKD]DUG LV FRQ¿UPLQJ WKDW represented by the equation : = 0.1091 / 3.3385 obtained WKH¿VKDUHFRPSDUDWLYHO\KHDOWK\DQGWKDWWKHLUSK\VLFDO according to the LW relationship (Figure 2). condition is relatively good.
7KHOHQJWKZHLJKWUHODWLRQVKLSRID¿VKLVLPSRUWDQW Feeding and spawning of A. thazard because it can be used in the estimation of growth with increases in length. The b value of the length-weight Feeding was evaluated according to Hyslop (1980) by relationship equation is used to determine the type of ,27& 7KHOHQJWKZHLJKWUHODWLRQVKLSZDVUHSUHVHQWHGE\WKHHTXDWLRQ : / the frequency of occurrence method. The percentage somatic growth. The b value being 3.3385 in this study, of each group of prey item was calculated to show REWDLQHGDFFRUGLQJWRWKH/:UHODWLRQVKLS )LJXUH UHÀHFWVWKDWWKH¿VKDUHLQDVXLWDEOHKHDOWK\HQYLURQPHQW WKH IRRG SUHIHUHQFHV RI WKH VDPSOHG ¿VK 7KH DQDO\VLV showing a positive allometric growth pattern (Froese, of $ WKD]DUG VWRPDFKV VKRZHG WKDW RI WKH ¿VK 2006). stomachs were full and 19 %, 17 %, 24 %, 9 % and 6 % were three quarters full, half full, quarter full, one eighth full and empty respectively (Figure 3). This revealed WKDW RXW RI DOO WKH ¿VK VWRPDFKV DQDO\VHG PRUH WKDQ 90 % of them were at least one eighth full. To study the food habits and feeding habits of $ WKD]DUG , the stomach contents were examined. The results showed the presence of diverse prey items such as shrimps, VPDOO¿VKVSHFLHVFHSKDORSRGVDQGVWRPDWRSRGODUYDH indicating that $ WKD]DUG is a nonselective feeder DQG WKDW WKH DSSHWLWH RI WKLV ¿VK FRXOG EH VDWLV¿HG E\ anything that is abundantly found in the surrounding environment. Further, the highest percentage (47.8 %) of prey items was crustaceans, including shrimps, crabs and stomatopod larvae (Figure 4). The next most )LJXUH /HQJWKZHLJKWUHODWLRQVKLSIRU VDPSOHVDQDO\VHG DEXQGDQWSUH\LWHPZDVVPDOO¿VK FRQVLVWLQJ Figure 2: Length weight relationship for $WKD]DUG of species such as $PEO\JDVWHU VLUP , 6DUGLQHOOD , and /HQJWKZHLJKWUHODWLRQVKLSRIDILVKLVLPSRUWDQWEHFDXVHLWFDQEHXVHGLQWKHHVWLPDWLRQRI
WKHJURZWKZLWKLQFUHDVHVLQOHQJWK7KHEYDOXHRIWKHOHQJWKZHLJKWUHODWLRQVKLSHTXDWLRQLV XVHGWRGHWHUPLQHWKHW\SHRIVRPDWLFJURZWK7KHEYDOXHRIEHLQJVLJQLILFDQWDWS
LQ WKLV VWXG\ UHIOHFWV WKDW WKH ILVK DUH LQ D VXLWDEOH KHDOWK\ HQYLURQPHQW VKRZLQJ D
SRVLWLYHDOORPHWULFJURZWKSDWWHUQ )URHVH
Figure 4: Figure 3: 3HUFHQWDJHIXOOQHVVRIVWRPDFKVRI $WKD]DUG 3HUFHQWDJHVRISUH\LWHPFDWHJRULHVLQVWRPDFKVRI $WKD]DUG
September 2019 Journal of the National Science Foundation of Sri Lanka 47(3)
%LRORJ\DQGJHQHWLFVRI$X[LVWKD]DUGRI6UL/DQND
OL]DUG¿VK &HSKDORSRGV KROG WKH WKLUG SODFH The $WKD]DUG gonads were analysed to determine the ZLWK FXWWOH¿VK DQG VTXLG EHLQJ SUHVHQW LQ WKH VWRPDFK VH[DQGWKHPDWXULW\VWDJHRIHDFK¿VK)LJXUHVKRZV content. Fish and crustaceans together could be seen in WKH GL൵HUHQW PDWXULW\ VWDJHV RI WKH PDOH DQG IHPDOH RIWKHVWRPDFKVDQG¿VKDQGFHSKDORSRGVWRJHWKHU $WKD]DUG JRQDGVLGHQWL¿HGDFFRUGLQJWRWKHVFDOHJLYHQ could be seen in 1.9 % of the stomachs. In addition to in Table 1. WKHVH¿VKVWRPDFKV FRQWDLQHGQHPDWRGHZRUPV and 3 stomachs (1.9 %) contained plastic and polythene. 7KH*6,YDOXHVFDOFXODWHGIRUWKHIHPDOH¿VKVKRZWKDW A major proportion of all the stomachs analysed (55.4 %) the GSI peaked during the period May to July (Figure 6) contained totally digested food material, which could not and in males from May to August, indicating that their EHLGHQWL¿HG7KHPDLQSUH\LWHPVRI $WKD]DUG studied from the Sri Lankan waters are in accordance with the spawning season is during this period. The ovaries of feeding patterns of $ WKD]DUG caught along the Indian mature females carrying eggs increase in size just before coast (Rohit et al ., 2017). spawning and the GSI value decreases after spawning.
)LJXUH 'LIIHUHQWJRQDGDOVWDJHVRIPDOHDQGIHPDOHFigure 5: 'L൵HUHQWJRQDGDOVWDJHVRIPDOHDQGIHPDOH $WKD]DUG
Journal of the National Science Foundation of Sri Lanka 47(3) September 2019 '5+HUDWKHWDO
Table 2: Mean values (mean ± SD) of weight, standard length and K factor for $WKD]DUG RIGL൵HUHQW provinces
3DUDPHWHU Mean of weight Mean of standard K factor 3URYLQFH 6' J OHQJWK6' FP PHDQ 6'
1RUWKZHVWHUQ3URYLQFH :HVWHUQ3URYLQFH 6RXWKHUQ3URYLQFH (DVWHUQ3URYLQFH
ESESES
Figure 7: 3&5SURGXFWVREWDLQHGIRUWKHPLWRFKRQGULDO 'ORRSDPSOL¿FDWLRQUHDFWLRQV (Lane 1: 1 kb DNA marker, lanes 2-11: $WKD]DUG samples) Figure 6: Gonado-somatic index for male and female $WKD]DUG )LJXUH *RQDGRVRPDWLF,QGH[IRUPDOHDQGIHPDOH The highest GSI values of male and female $WKD]DUG MH557821). The blasting of these sequences using the being during the period May and August 7KHVHVHTXHQFHVZHUHXVHGIRUWKHPD[LPXPOLNHOLKRRGWUHHFRQVWUXFWLRQ )LJXUHindicates that NCBI blast facility resulted in identity of the species DQGWKH the species’ spawning period is from May7KHVHVHTXHQFHVZHUHXVHGIRUWKHPD[LPXPOLNHOLKRRGWUHHFRQVWUXFWLRQ )LJXUH to August in with more than 97 % similarity. DQGWKH the waters around Sri Lanka. However,7KHVHVHTXHQFHVZHUHXVHGIRUWKHPD[LPXPOLNHOLKRRGWUHHFRQVWUXFWLRQ )LJXUH IOTCUHVXOWVVKRZHGWKDWDOOWKHVDPSOHVREWDLQHGIURPWKHGLIIHUHQW (2016) has UHJLRQVDUHFOXVWHULQJWRJHWKHU DQGWKH reported that the spawning period for the northernUHVXOWVVKRZHGWKDWDOOWKHVDPSOHVREWDLQHGIURPWKHGLIIHUHQWDQGFDQEHFRQVLGHUHGDVRULJLQDWLQJIURPRQHFRPPRQVWRFN Indian These sequences were used forUHJLRQVDUHFOXVWHULQJWRJHWKHU the maximum Ocean frigate tuna species is from JanuaryUHVXOWVVKRZHGWKDWDOOWKHVDPSOHVREWDLQHGIURPWKHGLIIHUHQW to April. This likelihood tree construction (Figure 8)UHJLRQVDUHFOXVWHULQJWRJHWKHU and the results deviation could be due to the variation in temperaturesDQGFDQEHFRQVLGHUHGDVRULJLQDWLQJIURPRQHFRPPRQVWRFN of VKRZHGWKDWDOOWKHVDPSOHVREWDLQHGIURPWKHGL൵HUHQW WKHGL൵HUHQWDUHDVRIWKH,QGLDQ2FHDQDQGFDQEHFRQVLGHUHGDVRULJLQDWLQJIURPRQHFRPPRQVWRFNregions are clustering together and can be considered as 0ROHFXODUDQDO\VLVRI originating from one common stock. The fecundity of female $ WKD]DUG was shown to be 48,056 to 267,000 eggs. These results show that the The knowledge about stock structure is very fecundity of $WKD]DUG is lower than shown in previous LPSRUWDQWLQWKHPDQDJHPHQWRI¿VKHU\:KHQDVLQJOH studies (Tampubolon et al ., 2016), indicating that there PDQDJHPHQWSODQLVIRUPXODWHGIRUGL൵HUHQWSRSXODWLRQV could be variations in the nutritional status, salinity or the it is assumed that the stocks being managed comprise of DJHRIWKH¿VKFROOHFWHG a single stock. This is due to the reproductive potential, mortality and adaptations to exploitation, changing Molecular analysis of A. thazard GUDVWLFDOO\ IRU GL൵HUHQW SRSXODWLRQV .XPDU et al ., 2012b). The phylogenetic analysis of the 75 sequences The mitochondrial D-loop region of 75 randomly LQWKLVVWXG\VKRZLQJWKHVHTXHQFHVRIGL൵HUHQWUHJLRQV selected $ WKD]DUG samples collected from the coastal being mixed within clusters indicates that the stocks of waters of the four provinces of Sri Lanka were WKHGL൵HUHQWUHJLRQVVWXGLHGKDYHDOORULJLQDWHGIURPRQH DPSOL¿HG 7KH ES IUDJPHQWV )LJXUH ZHUH WKHQ common stock, indicating that they can all be managed sequenced (GenBank accession numbers MH557799 to as one stock in the future.
September 2019 Journal of the National Science Foundation of Sri Lanka 47(3) %LRORJ\DQGJHQHWLFVRI$X[LVWKD]DUGRI6UL/DQND
$WKD]DUG in the Sri Lankan coastal areas is from May CONCLUSIONS to August. Molecular analysis revealed that individuals of $WKD]DUG LQYHVWLJDWHGIURPGL൵HUHQWUHJLRQVRIWKH The frigate tuna found in the Sri Lankan coastal areas country appear to belong to the same stock. have a healthy growth pattern and live in an environment that is favourable for their growth. They are non-selective Acknowledgements carnivorous feeders, feeding on a range of prey items available in the environment. The spawning season of This work was supported by the National Aquatic Resources Research and Development Agency (NARA), 6UL/DQND7KHDXWKRUVZRXOGOLNHWRWKDQN'U533. Jayasinghe and Mr. R.A.M. Jayathilake for collecting samples from Kalpitiya and Trincomalee. Laboratory assistance given by V.K. Ranasinghe and G. Amarakoon is greatly appreciated.
REFERENCES
Adebiyi F.A. (2013). The sex ratio, gonadosomatic index, stages of gonadal development and fecundity of Sompat Grunt, 3RPDGDV\V MXEHOLQL (Cuvier, 1830). Pakistan -RXUQDORI=RRORJ\ 45 (1): 41–46. Bandaranayake K.H.K. & Maldeniya R. (2012). A review on neritic tuna resources in Sri Lanka. 3URFHHGLQJVRIWKH QG :RUNLQJ3DUW\RQ1HULWLF7XQDV ,27&±±:317± 5HYB $YDLODEOH DW KWWS LRWFRUJVLWHVGHIDXOW ILOHVGRFXPHQWVSURFHHGLQJVZSQW,27& :317 5HYBSGI &RUWpV( $FULWLFDOUHYLHZRIPHWKRGVRIVWXG\LQJ¿VK feeding based on analysis of stomach contents: application WRHODVPREUDQFK¿VKHV &DQDGLDQ-RXUQDORI)LVKHULHVDQG $TXDWLF6FLHQFHV 54 : 726–738. DOI: https://doi.org/10.1139/f96-316 'DPPDQQDJRGD67+XUZRRG'$ 0DWKHU3% Genetic analysis reveals two stocks of skipjack tuna (.DWVXZRQXV SHODPLV ) in the northwestern Indian Ocean. &DQDGLDQ-RXUQDORI)LVKHULHVDQG$TXDWLF6FLHQFHV 68 (2): 210–223. DOI: https://doi.org/10.1139/F10-136 Froese R. (2006). Cube law, condition factor and weight-length relationships: history, meta-analysis and recommendations. -RXUQDORI$SSOLHG,FKWK\RORJ\ 22 (4): 241–253. DOI: https://doi.org/10.1111/j.1439-0426.2006.00805.x Ghosh S. et al . (11 authors) (2012). Fishery, population dynamics and stock structure of frigate tuna $X[LVWKD]DUG (Lacepede, 1800) exploited from Indian waters. ,QGLDQ -RXUQDORI)LVKHULHV 59 (2): 95–100. Green M.R. & Sambrook J. (2012) 0ROHFXODU &ORQLQJ $ /DERUDWRU\ 0DQXDO , 4 th edition. Cold Spring Harbor /DERUDWRU\3UHVV&ROG6SULQJ+DUERXU1HZ
Journal of the National Science Foundation of Sri Lanka 47(3) September 2019 '5+HUDWKHWDO
Hamidi J. & Rizal M. (2018). Structure of size and growth \HOORZ¿Q WXQD 7KXQQXV DOEDFDUHV (Bonnaterre, 1788) in pattern of frigate mackerel ( $X[LVWKD]DUG LQ¿VKODQGLQJ Indian waters. &RQVHUYDWLRQ*HQHWLFV 14 (1): 205–213. base of ujong baroh meulaboh. ,QWHUQDWLRQDO -RXUQDO RI DOI: https://doi.org/10.1007/s10592-013-0445-3 )LVKHULHVDQG$TXDWLF5HVHDUFK 3(1): 16–21. Moutopoulos D.K. & Stergiou K.I. (2002). Length-weight and Holden M.H. & Raitt D.F.S. (1974). 0DQXDO RI )LVKHULHV OHQJWKOHQJWKUHODWLRQVKLSVRI¿VKVSHFLHVIURPWKH$HJHDQ 6FLHQFH 3DUW0HWKRGVRI5HVRXUFH,QYHVWLJDWLRQDQG Sea (Greece). -RXUQDORI$SSOLHG,FKWK\RORJ\ 18 : 200–203. WKHLU $SSOLFDWLRQ . Food and Agriculture Organization of DOI: https://doi.org/10.1046/j.1439-0426.2002.00281.x the United Nations, Rome, Italy. Noegroho T., Hidayat T. & Amri K. (2013). Some biological Hyslop E.J. (1980). Stomach contents analysis-a review of aspects of frigate tuna ( $X[LVWKD]DUG ), bullet tuna ( Auxis methods and their application. -RXUQDORI)LVK%LRORJ\ 17 : URFKHL ), and kawakawa ( (XWK\QQXVD৽QLV ) in West Coasts 411–429. Sumatera IFMA 572, Eastern Indian Ocean. IOTC–2013– DOI: https://doi.org/10.1111/j.1095-8649.1980.tb02775.x :317± Indian Ocean Tuna Commission (IOTC) (2014). 5HYLHZRIWKH 3HUHUD +$&& 0DOGHQL\D 5 %DQGDUDQD\DNH .+. 6WDWLVWLFDO 'DWD $YDLODEOH IRU WKH 1HULWLF 7XQD 6SHFLHV ,PSRUWDQFHRIQHULWLFWXQDLQODUJHSHODJLF¿VKHULHV ,27&±±:317±B5HY in Sri Lanka. 3URFHHGLQJVRIWKH)RXUWK:RUNLQJ3DUW\RQ Indian Ocean Tuna Commission (IOTC) (2016). )ULJDWH7XQD 1HULWLF7XQDV 3KXNHW7KDLODQG ±-XQH,27&±± 6XSSRUWLQJ ,QIRUPDWLRQ ,27& . Available at KWWS ZZZ :317± LRWFRUJVLWHVGHIDXOWILOHVGRFXPHQWVVFLHQFHVSHFLHVB Rathnasuriya M.I., Weerasekera S.J., Bandaranayake K.H. VXPPDULHVHQJOLVK)ULJDWHWXQD6XSSRUWLQJ & Haputhantri S.S. (2017). Neritic tuna catch, species ,QIRUPDWLRQSGI composition and monthly average landings in Sri Lankan Johnson M.G., Mgaya Y.D. & Shaghude Y.W. (2015). WXQD JLOOQHW ¿VKHU\ RSHUDWH ZLWKLQ ((= ,27& Mitochondrial DNA analysis reveals a single stock of :317 frigate tuna $X[LVWKD]DUG (Lacepède, 1800) in the northern 5RKLW3-DVPLQH6 $EGXVVDPDG(0 'LVWULEXWLRQ FRDVWDO ZDWHUV RI 7DQ]DQLD ,27&:317 DQG¿VKHU\RIWKHEXOOHWWXQD $X[LVURFKHL (Risso, 1810) 5HYB DORQJWKH,QGLDQFRDVW,27&±±:317± .XPDU*.XQDO630HQH]HV05 0HHQD50 D 5RKLW3$EGXVVDPDG(00LQL.* 5DMHVK.0 Three genetic stocks of frigate tuna $X[LVWKD]DUGWKD]DUG Neritic tunas with special reference to distribution and (Lacepede, 1800) along the Indian coast revealed from Auxis spp. along the Indian coast. IOTC-2017- sequence analyses of mitochondrial DNA D-loop region. ¿VKHU\RI :317 0DULQH%LRORJ\5HVHDUFK 8: 992–1002. DOI: https://doi.org/10.1080/17451000.2012.702913 6DUNDU 8. .KDQ *( 'DEDV $ 3DWKDN $. 0LU -, .XPDU*.XQDO63 0HQH]HV05 E /RZJHQHWLF 5HEHOOR6&3DO$ 6LQJK63 /HQJWKZHLJKW variation suggest single stock of kawakawa Euthynnus relationship and condition factor of selected freshwater D৽QLV (Cantor, 1849) along the Indian Coast. Turkish ¿VKVSHFLHVIRXQGLQULYHU*DQJD*RPWLDQG5DSWL,QGLD -RXUQDORI)LVKHULHVDQG$TXDWLF6FLHQFHV 12 : 555–564. -RXUQDORI(QYLURQPHQWDO%LRORJ\ 34 (5): 951–956. DOI: KWWSV GRLRUJ YBB 7DPSXERORQ 3$53 1RYLDQWR ' +DUWDW\ + .XUQLDZDQ .XPDU*.XQDO630HQH]HV05 .RFRXU05 R., Setyadji B. & Nugraha B. (2016). Size distribution Genetic divergence between $X[LVWKD]DUG and $URFKHL and reproductive aspects of Auxis spp. from West Coast EDVHG RQ 3&55)/3 DQDO\VLV RI PW'1$ 'ORRS UHJLRQ 6XPDWUD(DVWHUQ,QGLDQ2FHDQ,27&:317 7XUNLVK -RXUQDO RI )LVKHULHV DQG $TXDWLF 6FLHQFHV 14 : :DUG 5' 3RSXODWLRQ JHQHWLFV RI WXQDV Journal of 539–546. )LVK%LRORJ\ 47 (sA): 259–280. DOI: KWWSV GRLRUJ YBB DOI: https://doi.org/10.1111/j.1095-8649.1995.tb06060.x .XPDU* .RFRXU0 3RSXODWLRQJHQHWLFVWUXFWXUHRI Willette D.A., Santos M.D. & Leadbitter D. (2015). Longtail tunas inferred from molecular markers: a review. 5HYLHZV tuna 7KXQQXV WRQJJRO (Bleeker, 1851) shows genetic LQ)LVKHULHV6FLHQFHDQG$TXDFXOWXUH 23 : 72–89. partitioning across, but not within, basins of the Indo- DOI: https://doi.org/10.1080/23308249.2015.1024826 3DFL¿FEDVHGRQPLWRFKRQGULDO'1$ -RXUQDORI$SSOLHG .XQDO63.XPDU*0HQH]HV05 0HHQD50 ,FKWK\RORJ\ 32 : 318–323. Mitochondrial DNA analysis reveals three stocks of DOI: https://doi.org/10.1111/jai.12991
September 2019 Journal of the National Science Foundation of Sri Lanka 47(3)