Supporting Information

Nguyen et al. 10.1073/pnas.1604720113

SI Materials and Methods medium containing DMEM, 10% FBS, and 1 mM L-glutamine. Cells Plasmid Construction. Sixty-three human GEF cDNAs were gen- were coated in 0.1% gelatin from porcine skin (Sigma) before plating erated from human brain tissue mRNAs, and the Gateway system on the flask. Cell medium was changed every 24 h. (Invitrogen) was used to construct a library of CFP-conjugated GEF plasmids. The mCherry-Lifeact vector was constructed by inserting siRNA Transfection and Real-Time PCR. The NIH 3T3 cells were the F-actin peptide–encoding sequence into the mCherry-C1 vector transfected with 25 nM mouse siRNA-PLEKHG3 (SC-152313; (22). Raichu-Rac1 and Raichu-Cdc42 were described previously Santa Cruz). The MDA-MB-231 and HUVEC cells were trans- (43). PTriEx-mVenus-PA-Rac1 (Addgene plasmid #22007) was a fected with 10 nM of human PLEKHG3-siRNA (SR308671; gift from K.M.H. GFP-TEM4 was generously provided by Natalia OriGene). Cells were cultured for 30 h after transfection. To Mitin at the University of North Carolina at Chapel Hill, Chapel analyze the expression of PLEKHG3 mRNAs, total RNA was Hill, NC (19). Lyn-CIBN-mCerulean was cloned by inserting the isolated using TRIzol (Life Technologies) and reverse-transcribed to myristoylation and CIBN sequences into the mCerulean-N1 vector. cDNAs using SuperScript III (Invitrogen). The generated cDNA was amplified using a 2× real-time PCR smart kit containing The mCitrine-PHRCRY2-iSH2 construct was cloned by inserting PHR and the iSH2 domain of p85beta (amino acids 420–615) EvaGreen (SolGent). The reaction was run at 95 °C for 10 min, CRY2 followed by 40 cycles of 95 °C for 20 s, 55 °C for 30 s, and 72 °C for into the pmCitrine-C1 vector (Clontech) by fusing an (SG7)3 linker between the PHR and iSH2 domain sequences (30). 30 s, on a CFX96 Real-Time system (Bio-Rad). All PCRs were CRY2 performedinduplicate,andtherelative transcript expression levels Cell Culture and Transfection. The NIH 3T3 cells were maintained in were measured by quantitative real-time PCR using the SYBR DMEM containing 10% (vol/vol) FBS (Life Technologies), 100 U/mL Green-based method. The average fold changes were calculated based on between-sample differences in the threshold cycle (Ct). penicillin, and 100 U/ mL streptomycin in humidified air (10% CO2) at 37 °C. Cells were transfected using a Neon transfection system Reagents and Antibodies. Rapamycin (Calbiochem) was applied at (Invitrogen) under the following conditions: voltage, 1,280 V; μ μ pulse, 2; width, 20 ms. A 96-well glass-bottomed black plate (89626; 0.5 M for 15 min. LY294002 (Sigma) was applied at 50 M for Ibidi) was precoated with fibronectin (1:500) (Invitrogen), and the 60 min. PDGF-BB (PeproTech) was applied at 10 nM for 30 min. −− μ cells were imaged 20–24 h posttransfection. The PLEKHG3 / cells Cytochalasin D (Sigma) was applied at 4 M for 30 min. Anti- bodies used were anti-mouse PLEKHG3 antibody (1:1,000) were transfected using Lipofectamine LTX with Plus Reagent (1:1:1) (X3-D3ZGY7; Abmart); anti-human PLEKHG3 antibody (1:500) (Invitrogen). (AP11167b; AbGent); and Alexa Fluor 594-conjugated phalloidin Generation of the PLEKHG3-Knockout Cell Line. (1:500) (A12381; Molecular Probes). Gene targeting. The guide RNA (gRNA) target sequence was subcloned into hCas9-2A-eGFP expression vector (pX458; Immunofluorescence. Cells were fixed in 4% (vol/vol) formaldehyde for 10 min at room temperature. Cells were washed with PBS and Addgene plasmid no. 48138). The oligonucleotides for gRNA were blocked in PBS and Tween 20 containing 1% BSA. To determine as follows: PLEKHG3-gRNA, forward 5′-CACCcgctgcccggctgttg- the subcellular localization of PLEKHG3, cells were incubated aacg-3′, reverse 5′-AAACcgttcaacagccgggcagcg-3′.H9hESCswere with anti-mouse PLEKHG3 antibody for 1 h at room temperature. nucleofected using Nucleofector 2b (Lonza). Forty-eight hours Cells were incubated with Alexa Fluor 488-conjugated anti-mouse later, the EGFP-expressing cells were FACS purified and plated on IgG antibody (A21202; Invitrogen) (1:500) and Alexa Fluor 594- mouse embryonic fibroblasts (MEFs). The colonies were picked conjugated phalloidin. ∼10–14 d later and were passaged twice before genomic DNA isolation. The PLEKHG3 genomic region flanking the gRNA- ′ F-Actin Cosedimentation Assay. To evaluate the direct association of binding site was PCR amplified (forward primer: 5 -ACCTCTA- F-actin with PLEKHG3, high-speed actin cosedimentation was CCACCTCCTCGTC-3′, reverse primer: 5′-GCACAGCCAGG- ’ ′ performed according to the manufacturer s instructions (Cytoskele- AAACAACAG-3 ). The purified PCR products were subjected ton Inc.). Purified GST-PLEKHG3 (amino acids 890–950) protein to a reannealing process to enable heteroduplex formation and was incubated with F-actin at room temperature for 45 min and were treated with SURVEYOR nuclease and SURVEYOR en- centrifuged in an ultracentrifuge (Optima TLX; Beckman Coulter) hancer S (Integrated DNA Technologies). Simultaneously, the at 270,500 × g for 1.5 h at 24 °C. The supernatant and pellet frac- targeted region of the PLEKHG3 gene was PCR amplified and tions were solubilized in SDS sample buffer, resolved by SDS/ cloned into pCR2.1-TOPO vector (Invitrogen). The insertion PAGE [4–12% (vol/vol)] (Invitrogen), and stained with Coo- sequence was verified by DNA sequencing to ensure that both massie Blue. alleles (from each hESC colony) were represented. The clones with biallelic nonsense mutations were expanded and differenti- LARIAT. LARIAT, which is a method for inhibiting protein func- ated for follow-up assays. tion, uses two modules: a multimeric protein (MP) and a light- + hESC culture and fibroblast differentiation. The undifferentiated H9 mediated heterodimerizer. Here, the MP was a version of Ca2 / hESC line was cultured on mitotically inactivated MEFs (Applied calmodulin-dependent protein kinase IIα (CaMKIIα) that lacked + StemCell, Inc.) in a medium containing DMEM/F12, 20% (vol/vol) Ca2 -responsive catalytic activity. This MP was fused to CIB1, knockout serum replacement, 0.1 mM Eagle’s minimum essen- which binds to CRY2 upon blue light stimulation. A single-domain tial medium-nonessential amino acids (MEM-NEAA), 1 mM GFP-binding antibody, VHH(GFP),wasfusedtoCRY2torecruit L-glutamine, 55 μM β-mercaptoethanol (Life Technologies), and GFP-PLEKHG3 to CIB1-MP clusters (24). 4 ng/mL FGF2 (R&D Systems) (hESC medium) in 5% CO2 at 37 °C (44). For fibroblast differentiation, the culture medium Rac1-GTP and Cdc42-GTP Pull-Down Assay. Measurement of GTP- was changed gradually from hESC medium to a medium containing bound Rac1 and Cdc42 was performed using active Rac1 and Cdc42 MEM α (GlutaMAX supplement, no nucleosides), 10% FBS for pull-down kits (16118 and 16119; Thermo Scientific). Briefly, GST- 2 wk. These cells were maintained further for at least 4 wk in a Pak1-PBD was used to affinity-precipitate GTP-bound Rac1 and

Nguyen et al. www.pnas.org/cgi/content/short/1604720113 1of14 Cdc42 from lysed cells. The protein extracts from the HEK293 cell Microscopic and Imaging Analyses. All live images were captured line were separated on a Bolt 12% (vol/vol) Bis-Tris Plus Gel using an A1R confocal (Nikon) or an SIM (Nikon) microscopy (BG00125BOX; Life Technologies), and the protein was transferred system. Migration velocity, fluorescence intensity, kymographs, toaPVDFmembrane(LifeTechnologies).Themembranewas quantitative analysis, and videos were performed with Nikon blockedinblockingsolution(1:1)(LI-COR).PrecipitatedRac1-GTP imaging software (NIS-element) and MetaMorph 7.7 (Molecular and Cdc42-GTP were detected by immunoblot analysis, using mouse Devices). The graph was drawn by an Excel program. monoclonal anti-Rac1 and anti-Cdc42 antibodies (Thermo Sci- entific). Then samples were labeled with 800-nm channel dye (anti- Statistical Methods. Statistical significance was evaluated by a two- mouse; 1:3,000; LI-COR Biosciences). Western blotting tailed unpaired Student’s t test: *P < 0.1 and **P < 0.01. All was analyzed using the Odyssey Imaging System (Odyssey CLx; values represent the means of three independent experiments, LI-COR Biosciences). and error bars where shown represent ± SEM.

NET1 GEF-H1 PLEKHG3 TEM4 Actin filament Nucleus Microtubule

C9orf100 FARP1 FARP2 RALGPS1 SH2D3C Trad Plasma Membrane

ARHGEF5 ARHGEF15 RABIFRASGEF1B RASGEF1C p63RhoGEF Whole cell

ABR AKAP13 ARHGEF1 ARHGEF4 ARHGEF6 ARHGEF7 ARHGEF9 ARHGEF10

ARHGEF16 ARHGEF18 Asef BIG3 CYTH1 CYTH2 CYTH3 CYTH4

FGD1 FGD3 FGD5 GBF1 LBC NGEF PDZ-RhoGEF RABGEF1

RAP1GDS1 RAPGEF2RAPGEF3 RAPGEF4 RAPGEF5 RAPGEF6 RAPGEFL1 RASGEF1A Cytoplasm

RASGRP1 RASGRP2RASGRP3 RASGRP4 RGL RGL1 RGL2 SOS1

SOS2 TIAM1 TIAM2 VAV1 VAV2 VAV3 WBSCR16

Fig. S1. Localization of the 63 human GEFs. Confocal images show the subcellular localization of 63 CFP-conjugated human GEFs in NIH 3T3 cells. The localizations were classified into six categories: one GEF was localized in the nucleus, one GEF was localized in microtubules, two GEFs were localized in actin filaments, six GEFs were localized in the PM, six GEFs were distributed throughout the whole cell, and 47 GEFs were localized in the cytoplasm. (Scale bar, 20 μm.)

Nguyen et al. www.pnas.org/cgi/content/short/1604720113 2of14 A B C PLEKHG3 F-actin Merge MDA-MB-231 1.3 00:00 MDA-MB-231 ** 1 02:00 NIH3T3 04:00 0.7

Velocity (μm/min) Velocity 06:00 00:00 HUVEC

MDA-MB-231 02:00 HUVEC 1.3 ** 04:00

HUVEC 06:00 1 D (μm) PLEKHG3 F-actin Merge 0 500 0.7 Velocity (μm/min) Velocity Cyto D ̶ E gRNA binding region F PLEKHG3 ATG R + Cyto D F RALGPS1F-actin Merge Indel in human PLEKHG3 exon 2 locus (antisense) PAM GCCCTGCCGCTGCCCGGCTGTTGA-ACGGGGAGAGGGGCCCCTTCACG WT H9 Cyto D GCCCTGCCGCTGCCCGGCTGTTGA-ACGGGGAGAGGGGCCCCTTCACG WT ̶

GCCCTGCCGCTGCCCGGCTGTTGAAACGGGGAGAGGGGCCCCTTCACG +1 PLE3-/- GCCCTGCCGCTGCCCGGCTGTTGAAACGGGGAGAGGGGCCCCTTCACG +1

+ Cyto D *

Fig. S2. PLEKHG3 localizes to the leading edge of the cell and controls cell migration. (A) The localization of overexpressed PLEKHG3 in different cell lines. (B) The average velocity of cell migration was increased MDA-MB-231 cells and HUVECs overexpressing PLEKHG3 compared with control-expressing cells of PKHG3 (n > 70). (C) Cell morphologies and localization during cell migration in MDA-MB-231 and HUVEC cells overexpressing PLEKHG3. (D) The binding of PLEKHG3 to F-actin was examined in cells treated with cytochalasin D. PLEKHG3 showed similar patterns of dissociation from F-actin when cytochalasin D was added. In contrast, the localization of RALGPS1, which localizes to the PM, was not disrupted by cytochalasin D treatment. (E) A schematic for the adjacent region of PLEKHG3 exon2. ATG, start codon of PLEKHG3 CDS. F, forward primer-binding site. R, reverse primer-binding site. (F) Sequences of wild-type and CRISPR/Cas9-induced biallelic nonsense mutations in the targeted region of PLEKHG3−/− clones. A single-nucleotide insertion (+1) leads to a frame shift (the introduction of a premature stop codon) and consequently to gene knockout. The asterisk indicates the insertion of nucleotide “A.” The data represent mean ± SEM; *P < 0.1; **P < 0.01. (Scale bars, 20 μm.)

Nguyen et al. www.pnas.org/cgi/content/short/1604720113 3of14 AC NIH3T3 MDA-MB-231 HUVEC

.) 8 8 8

a.u ** ** 6 6 6 ** 4 4 4 PLEKHG3 2 2 2 0 0 0 F-actin Length to width Length to width ratio (a.u.) Length to width Length to width ratio ( Length to width Length to width ratio (a.u.) Ctrl siRNA Ctrl siRNA Ctrl siRNA PLE3 siRNA PLE3 siRNA B D PLE3 siRNA NIH3T3 MDA-MB-231 HUVEC 1.2 0.5 1 1

0.4 0.8 ** 0.8 ** 0.6 0.6 ** 0.6 0.3 0.4 0.4 * 0.2

Normalized Normalized 0.2 0.2 velocity (μm/mln) velocity velocity (μm/mln) velocity velocity (μm/mln)

fluorescence profile 0 0.1 0 0 Ctrl siRNA Ctrl siRNA Ctrl siRNA Ctrl siRNA PLE3 siRNA PLE3 siRNA PLE3 siRNA PLE3 siRNA

Fig. S3. The loss of PLEKHG3 results in elongated cell morphology and a decrease in cell motility. (A) The endogenous localization of PLEKHG3 and actin filaments in NIH 3T3 cells. PLEKHG3 localizes mostly at the leading edge of migrated cells. (B) Quantification of endogenous PLEKHG3 transfected with control or PLEKHG3 siRNAs. (C) The average shape of cells transfected with control (Ctrl) or PLEKHG3 siRNAs in different cell lines. PLEKHG3-depleted cells showed a longer morphology than control cells (n > 150). (D) The average velocity of cells transfected with control or PLEKHG3 siRNAs in different cell lines. The velocity of cell migration decreased in PLEKHG3-depleted cells (n > 230). The data represent the mean ± SEM; *P < 0.1; **P < 0.01. (Scale bar, 20 μm.)

Nguyen et al. www.pnas.org/cgi/content/short/1604720113 4of14 A C ̶Cyto D + Cyto D 11219DH PH ABD PLEKHG3 (FL) )

PLEKHG3 (1-950) -940 PLEKHG3 (1-600) (910 PLEKHG3 (900-1100) PLEKHG3 PLEKHG3 (940-1100) PLEKHG3 (910-940) PLEKHG3 (910-930) F-actin

B Full length 1-600 940-1100 Merge D

F-actin F-actin F-actin F-actin α-actinin PLE3 α-actinin PLE3 BSA spspsp spspsp F-actin PLEKHG3

910-940 910-930 1-950

1

2 F-actin PLEKHG3

1. F-actin 2. GST-PLEKHG3 (890-950) E PLEKHG3 FLJ00018 PDZ-RhoGEF TEM4 FRABIN

Fig. S4. PLEKHG3 binds directly to F-actin through an actin-binding domain. (A) A schematic of PLEKHG3 constructs. (B) The localization of the full-length (FL) and truncated forms of PLEKHG3. Amino acids 910–940 (designated the ABD) are required for binding to actin filaments. (C) Cells overexpressing PLEKHG3 (amino acids 910–940) were treated with cytochalasin D to confirm its ability to bind F-actin (n > 50). (D) The direct binding of PLEKHG3 (amino acids 890–950) and F-actin was examined using actin cosedimentation assays. After high-speed centrifugation, the supernatant (S) and pellet (P) fractions were resolved by SDS/PAGE and stained with Coomassie Blue. In the absence of F-actin, GST-PLEKHG3 (amino acids 890–950) was found in the supernatant. In the presence of F-actin, recombinant GST-PLEKHG3 (amino acids 890–950) was found predominantly in the F-actin–containing pellet. α-Actinin was used as the positive control. BSA was used as the negative control. (E) Multiple alignment of the ABDs from several GEFs known to bind to actin filaments, as performed using DNASTAR software: human PLEKHG3 (amino acids 910–940); human FLJ00018 (amino acids 158–213); human PDZ-RHOGEF (amino acids 564–600); human TEM4 (amino acids 81–135); and rat FRABIN (amino acids 19–69). (Scale bar, 20 μm.)

Nguyen et al. www.pnas.org/cgi/content/short/1604720113 5of14 PLEKHG3 xrsigclso LKG.( PLEKHG3. of cells expressing ( cells. 3T3 ( NIH migration. in PLEKHG3 of forms S5. Fig. gyne al. et Nguyen − ohteDH the Both / − C el hnPEH3(mn cd 1 acids (amino PLEKHG3 when cells www.pnas.org/cgi/content/short/1604720113 h vrg eoiyo elmgainwsicesdi I T el vrxrsigPEH3(mn cd 1 acids (amino PLEKHG3 overexpressing cells 3T3 NIH in increased was migration cell of velocity average The ) – Hdmi n h B fPEH3aerqie o h nuto fcl oaiy ( polarity. cell of induction the for required are PLEKHG3 of ABD the and domain PH A C D Merge F-actinPLEKHG 3 h oaiaino LKG aioais1 acids (amino PLEKHG3 of localization The ) Normalized ullnt 910-940 Full length fluorescence profile 0.2 0.4 0.6 0.8 B 0 LKG aioais1 acids (amino PLEKHG3 ) NIH3T3 ** -0 1-950 1-600 – 5)wsoeepesd h aarpeettemean the represent data The overexpressed. was 950) ** DE –

5) hc otisbt h DH the both contains which 950), 1-950 Full length PLEKHG3 – 5)i PLEKHG3 in 950) F-actin 90 m60 m 0 m B Full length Merge − / − -0 1-950 1-600 el.( cells. – Hdmi n h B,idcscl oaiydrn cell during polarity cell induces ABD, the and domain PH E ± h vrg eoiyo elmgainicesdin increased migration cell of velocity average The ) A E;** SEM; Normalized 910-940 h oaiaino h ullnt n truncated and full-length the of localization The ) fluorescence profile 0.1 0.2 0.3 0.4 0.5 0 P PLEKHG3 < .1 Saebr 20 bar, (Scale 0.01. ** ** – -/- 5)a oprdwt control- with compared as 950) μ m.) 6of14 ih tmlto oprdwt h orsodn ausi oto el.( cells. control in values corresponding the with compared stimulation light oee,teclsrgie oaiywe h ih a undof A2ddntidc oaiybfr ratrlgtsiuain opooia cha Morphological stimulation. light after or before polarity induce not did VAV2 off. turned ( was mCherry-Lifeact. ( light using the when in monitored polarity shown were regained stimulation cells light the the However, after and before LKG eoeadatrtelgtsiuainsonin shown stimulation light the after and before PLEKHG3 -ci.( F-actin. Cer-iec,adPEH3GP h el hakwe h ih a uno n eandplrt hntelgtwstre f.Mrhlgclchan Morphological off. turned was light the when polarity regained and ( on mCherry-Lifeact. turn using was light monitored the when shrank cells The PLEKHG3-GFP. and mCherry-Lifeact, ( S3.) Movie (See stimulation. light upon position different a in repolarized LKG hteetal hne h ieto ftecls h ht otdcrl niae h oiinsiuae ylgt iei hw nminut in shown is Time light. by stimulated position the indicates circle dotted white The cells. the ( of S2.) direction Movie the changed eventually that PLEKHG3 S6. Fig. gyne al. et Nguyen uig n fe ih tmlto ( stimulation light after and during, ersn h mean the represent H esrmn ftecl rabfr,drn,adatrlgtsiuain( stimulation light after and during, before, area cell the of Measurement ) B niiino LKG irpscl oaiy ( polarity. cell disrupts PLEKHG3 of Inhibition I T el eectasetdwt Cer-H-LKG n I1EF-iec.Teilmntdrgosehbtda cuuainof accumulation an exhibited regions illuminated The CIB1-EGFP-Lifeact. and mCherry-PHR-PLEKHG3 with cotransfected were cells 3T3 NIH ) C www.pnas.org/cgi/content/short/1604720113 el eectasetdwt Cer-iec,PEH3GP SNAP-CRY2-V PLEKHG3-GFP, mCherry-Lifeact, with cotransfected were Cells ) ± E;* SEM; mCherry P F A IK DE <

Normalized GFP PLEKHG3 mCherry VAV2 PLEKHG3 mCherry CRY2 .;** 0.1;

fluorescence profile Lifeact J CIB1 0 2 4 pnlgtsiuain el eetapdadrpdybcm iil scutr.( clusters. as visible became rapidly and trapped were cells stimulation, light Upon ) ̶ n ̶ ih + Light Light ih + Light Light > PLEKHG3 P F-actin 0.Teaesocpe yPEH3wr eue pnlgtsiuaincmae ihtecnrlcls h data The cells. control the with compared stimulation light upon reduced were PLEKHG3 by occupied areas The 30). < G pnlgtsiuain el eetapdadbcm ail iil scutr.Tm ssoni minutes. in shown is Time clusters. as visible rapidly became and trapped were cells stimulation, light Upon ) .1 Saebr 20 bar, (Scale 0.01. ** + Light ̶ Light C ( n

Normalized mCherry > A GFP

ceai ftelgtmdae ieie ytm CRY2 system, dimerizer light-mediated the of schematic A ) fluorescence profile 0.6 1.2 CRY2 ̶ ̶ 0.( 30). CIB1 B Light Light 0 ( n μ > F m.) ̶ F-actin PLEKHG3 pnlgtsiuain el vrxrsigPEH3GPsrn n otterpolarity. their lost and shrank PLEKHG3-GFP overexpressing cells stimulation, light Upon ) ih + Light Light Lifeact 0.( 30). G PLEKHG3 GFP J VAV2PLEKHG3 GFP E loecneitniypoie ersnigteepeso eeso mCherry-Lifeact of levels expression the representing profiles intensity Fluorescence ) ̶ ** ̶ ih + Light Light D Light loecneitniypoie ersnigteepeso eeso mCherry-PHR- of levels expression the representing profiles intensity Fluorescence ) n I B > )PLEKHG3

0.Tecl ra cuidb LKG n A2wr togyrdcdupon reduced strongly were VAV2 and PLEKHG3 by occupied areas cell The 50). 60 m 30 m 0 m mCherry + Light − / − el eetasetdwt I1SA-P SNAP-CRY2-V CIB1-SNAP-MP, with transfected were cells H PLEKHG3 (F) n I1SA-P h LKG inlrtatdand retracted signal PLEKHG3 The CIB1-SNAP-MP. and H(GFP),

Normalize area H 0.3 0.6 0.9 1.2 0 Normalized area 0.3 0.6 0.9 1.2 Cer LKG VAV2 PLEKHG3 mCherry 0 C ̶ ̶ Cer PLEKHG3 mCherry ih + Light Light ih + Light Light ̶Light + Light ̶Light mCherry ** K – * PLEKHG3 esrmn ftecl rabefore, area cell the of Measurement ) I1 sdt eri LKG othe to PLEKHG3 recruit to used CIB1, ̶ ̶ * Light Light e were ges H s (See es. H(GFP), 7of14 nges A C TEM4 PLEKHG3 D ABD ABD ̶Rap + Rap CFP-FKBP F-actin PLEKHG3 TEM4 (DH-PH)

PLEKHG3 Lamellipodia Merge Merge

B 2 TEM4 PLEKHG3 e (DH-PH) l

PLEKHG3 Filopodia i f o

r E

p Leading edge e

c Trailing edge ̶Rap Low FRET+ Rap High FRET n 1 e PM c s CFP e CFP Normalized Normalized

r YFP

o GDP FRB FRB u l FKBP

f Rac1 PLE3 0

(μm) Rac1 CRIB

PLE3 CRIB GTP F FKBP Rac1 YFP 1.3 ̶Rap + Rap G

P mCherry PLEKHG3 VAV2 F ** I C ** / P

F 1.1 12345

Y kDa Rap o ̶ i Rac1 t a

R 25 0.8 20

kDa + Rap Cdc42 25 Cdc42 H 1.3 mCherry PLEKHG3 VAV2 20

P ** F C / * 1: GDP P Rap F

1.1 ̶ 2: GTPγS Y o i t 3. GFP a 1.2 R 0.8 4. VAV2 5. PLEKHG3 + Rap 0.8

Fig. S7. PLEKHG3 activates Rac1 and Cdc42. (A) GFP-TEM4 and mCherry-PLEKHG3 showed different localization patterns in polarized coexpressing cells. PLEKHG3 localizes mostly to the leading edge, whereas TEM4 is observed predominantly at the trailing edge. (B) Intensity profiles for GFP-TEM4 and mCherry- PLEKHG3. (C) The ABD domains of both PLEKHG3 and TEM4 bind to F-actin but fail to induce cell polarity in the same manner as full-length PLEKHG3 and TEM4. (D) Lamellipodia and filopodia were induced when the PLEKHG3 (DH–PH domain) fragment was recruited into the PM following rapamycin treatment. An enlarged view of the boxed region is shown at the right. (Magnification: 1.5×.) (E) Schematic of the FRET biosensor strategy used to activate small GTPases. (F) Cells were cotransfected with Lyn-FRB and mCherry-FKBP-PLEKHG3 (DH–PH) together with the FRET biosensor and were serum-starved to reduce basal small GTPase activity. PLEKHG3 (DH–PH) then was activated by rapamycin-induced translocation to the PM. Quantitative analyses of rapamycin-induced ratio changes (FRET/CFP) show that PLEKHG3 activates Rac1 and Cdc42. mCherry-FKBP-VAV2 and mCherry-FKBP-C1 were used as positive and negative controls, respectively (n > 120). (G) The FRET/CFP ratio images of Raichu-Rac1 FRET biosensors indicate the recruitment of control (mCherry), PLEKHG3 (DH–PH domain), and VAV2 (DH–PH domain) in the PM. (H) The FRET/CFP ratio images of Raichu-Cdc42 FRET biosensors. (I) Cells overexpressing PLEKHG3 showed increased levels of the active forms of Rac1-GTP and Cdc42-GTP. VAV2 is used as the positive control. Cell lysates were treated with GTPγS (positive control) or GDP (negative control) to activate or inactivate Rac1 and Cdc42. (Scale bars, 20 μm.)

Nguyen et al. www.pnas.org/cgi/content/short/1604720113 8of14 A B C PLEKHG3 F-actin Merge 0 m 5 m 15 m ̶Light + Light PLEKHG3 PLEKHG3 1 h F-actin F-actin

+ DMSO ̶Light + Light 2 h 0 h Merge PLEKHG3 4 h E 10 ̶Light + Light D ** F-actin e l i ** f PLEKHG3 F-actin + LY29 o

r 1.2 d

p ̶Light + Light e z

e 5 i l c a n e m

r 0.6 c Normalized o s e N r fluorescence profile o PLEKHG3 u l f 0 (μm) 0 actin + LY29 + DMSO + Cyto D F-

+ Cyto D

Fig. S8. PLEKHG3 enhances polarized cell migration via a positive feedback loop at the leading edge of the cell. (A) The expressions of PLEKHG3 and F-actin show a similar oscillating pattern during cell migration (n > 75). (B) The localization of PLEKHG3-GFP and mCherry-Lifeact at the leading edge of the cell was observed for 15 min using a confocal microscope with a 100× objective lens. (C) Cells were transfected with PA-Rac1, mCherry-PLEKHG3, and iRFP-Lifeact and were stimulated with light in the presence of DMSO, LY29, or cytochalasin D (Cyto D). Upon light stimulation, PLEKHG3 accumulation was observed in the protrusion area in the presence of LY29 treatment. However, PA-Rac1 failed to induce protrusion, and PLEKHG3 and F-actin were disrupted by cytochalasin D treatment. mCherry-PLEKHG3 and iRFP-Lifeact are shown in a pseudocolored intensity image. The white dotted circles indicate the position stimulated by light. (D) Intensity profiles representing the expression levels of PLEKHG3 and F-actin in B.(E) Fluorescence intensity profiles representing the expression levels of mCherry-PLEKHG3 before and after light stimulation in the presence of DMSO, LY29, or cytochalasin D (n > 25). The data represent the mean ± SEM; *P < 0.1; **P < 0.01. (Scale bar, 20 μm.)

Nguyen et al. www.pnas.org/cgi/content/short/1604720113 9of14 D( h xrsinlvl fCPPEH3uo Y9tetet Y9tetetdcesdteitniyo h LKG inla h edn deo h cell the of edge leading the at signal PLEKHG3 the of intensity the ( decreased cell. treatment the PLE LY29 of of edge treatment. redistribution leading LY29 the the upon however, at polarity; signal CFP-PLEKHG3 ( PLEKHG3 cell of the induce levels of to expression intensity failed the the ( PI3K increased minutes. endogenous treatment in lost PDGF D, cells shown treatment. cytochalasin result, is PDGF a of Time as presence observed. edges; was the trailing (arrowheads) In and leading localization starved. the serum at were localization its and lose PLEKHG3 to PLEKHG3 caused treatment This ( PI3K. inactivate to LY29 with treated IKatvto,adP3 ciiywsmntrduigYFP-PH using monitored was activity PI3K and activation, PI3K LKG a rnlctdt h edn n riigegst nuecl oaiyadmgain ( migration. and polarity cell induce to edges trailing and leading the to translocated was PLEKHG3 i.S9. Fig. gyne al. et Nguyen F C loecneitniypoie ersnigteepeso eeso F-LKG eoeadatrrpmcnteteti h rsneo cytoch of presence the in treatment rapamycin after and before CFP-PLEKHG3 of levels expression the representing profiles intensity Fluorescence ) h erimn fPEH3t h edn dewscue yteatvto fP3.Clswr ornfce ihLnFB F-KPiH,adCFP- and YFP-FKBP-iSH2, Lyn-FRB, with cotransfected were Cells PI3K. of activation the by caused was edge leading the to PLEKHG3 of recruitment The ) n > 0.Tedt ersn h mean the represent data The 20). IKi nusra agto LKG.( PLEKHG3. of target upstream an is PI3K www.pnas.org/cgi/content/short/1604720113 D Akt-PH PLEKHG3 Akt-PH CFP A ̶ ̶ PDGF PDGF Normalized PDGF fluorescence profile 0.5 1.5 0 1 ± E;* SEM; + PDGF + PDGF ** A P el oxrsigCPPEH3adYFP-PH and CFP-PLEKHG3 coexpressing Cells ) < .;** 0.1; B E Akt-PH PLEKHG3Akt-PH CFP P Akt1 < ̶ Normalized ̶ .1 Saebr,20 bars, (Scale 0.01. LY29 + LY29 LY29 + LY29 ne eu train LKG aldt nuecl oaiy hnPG a added, was PDGF When polarity. cell induce to failed PLEKHG3 starvation, serum Under .

D fluorescence profile 0.5 1.5 loecneitniypoie ersnigteepeso eeso F-LKG upon CFP-PLEKHG3 of levels expression the representing profiles intensity Fluorescence ) 0 1 ** μ C F m.)

YF-iSH2 PLEKHG3 YF-iSH2 F-actin

Normalized Akt1 fluorescence profile yoD + Cyto D + Cyto B 0 1 2 3 4 2510 -2 5 10 -2 5 eesrmsavdfr6h DFwsaddt induce to added was PDGF h, 6 for starved serum were el oxrsigCPPEH3adYFP-PH and CFP-PLEKHG3 coexpressing Cells ) E loecneitniypoie representing profiles intensity Fluorescence ) ̶ Rap + Rap + Rap + Rap + Rap ** hi polarity. their Akt1 0o 14 of 10 KHG3 alasin were . Table S1. Data for 63 human GEFs No. Name NCBI ID GEF information GEF family

1 ABR NM_021962.3 673 aa: RasGEF(197–426) Ras GEF 2 AKAP13 AF127481.1 893 aa: RhoGEF(75–269) PH(258–414) Rho GEF 3 ARHGEF1 NM_198977.1 879 aa: RhoGEF(384–570) PH(585–730) Rho GEF 4 ARHGEF4 NM_015320.2 690 aa: RhoGEF(285–460) PH(472–611) Rho GEF 5 ARHGEF5 NM_005435.3 1,597 aa: RhoGEF(1175–1356) PH(1378–1504) Rho GEF 6 ARHGEF6 NM_004840.2 776 aa: RhoGEF(242–419) PH(450–549) Rho GEF 7 ARHGEF7 NM_001113513.1 646 aa: RhoGEF(94–271) PH(302–400) Rho GEF 8 ARHGEF9 BC117406.1 516 aa: RhoGEF(104–285) PH(291–430) Rho GEF 9 ARHGEF10 NM_014629.2 1,344 aa: RhoGEF(397–581) PH(614–678) Rho GEF 10 ARHGEF15 BC036749.1 841 aa: RhoGEF(418–598) PH(622–742) Rho GEF 11 ARHGEF16 BC002681.1 421 aa: RhoGEF(1–178) PH(201–334) Rho GEF 12 ARHGEF18 NM_015318.3 1,015 aa: RhoGEF(102–296) PH(336–454) Rho GEF 13 ASEF AB042199.1 619 aa: RhoGEF(214–395) PH(401–540) Rho GEF 14 BIG3 AF413080.1 1,770 aa: Sec7(185–391) Arf GEF 15 C9orf100 BC033666.1 335 aa: RhoGEF(27–195) PH(228–331) Rho GEF 16 CYTH1 BC038385.1 398 aa: Sec7(62–244) PH(259–379) Arf GEF 17 CYTH2 BC004361.1 400 aa: Sec7(61–243) PH(258–378) Arf GEF 18 CYTH3 BC028717.1 399 aa: Sec7(66–248) PH(263–382) Arf GEF 19 CYTH4 BC041161.1 394 aa: Sec7(62–243) PH(258–376) Arf GEF 20 FARP1 BC041595.1 1,045 aa: RhoGEF(542–728) PH(739–861) PH(916–1028) Rho GEF 21 FARP2 NM_014808.2 1,054 aa: RhoGEF(537–720) PH(735–855) PH(913–1025) Rho GEF 22 FGD1 BC034530.1 961 aa: RhoGEF(376–559) PH(592–698) PH(815–920) Rho GEF 23 FGD3 AY211386.1 634 aa: RhoGEF(160–339) PH(372–478) Rho GEF 24 FGD5 BC035364.1 540 aa: RhoGEF(27–160) PH(179–301) PH(444–533) Rho GEF 25 GBF1 NM_004193.2 1,855 aa: 2xSec7(397–552 699–884) Arf GEF 26 GEF–H1 NM_004723.3 958 aa: RhoGEF(208–402) PH(442–557) Rho GEF 27 GEFT BC012860.1 474 aa: RhoGEF(57–228) PH(233–375) Rho GEF 28 LBC XM_012429.3 581 aa: RhoGEF(244–431) PH(478–578) Rho GEF 29 NET1 BC053553.1 596 aa: RhoGEF(175–354) PH(358–500) Rho GEF 30 NGEF BC031573.1 710 aa: RhoGEF(274–455) PH(477–603) Rho GEF 31 PDZ–RhoGEF BC057394.1 1,562 aa: RhoGEF(775–961) PH(979–1121) Rho GEF 32 PLEKHG3 BC129953.1 1,219 aa: RhoGEF(96–270) PH(252–396) Rho GEF 33 RABGEF1 NM_014504.2 491 aa: VPS9(270–370) Rab GEF 34 RABIF BC018488 123 aa: RabGEF(19–123) Rab GEF 35 RALGPS1 NM_001190729.1 1,614 aa: RasGEF(46–284) PH(391–506) Ras GEF 36 RAP1GDS1 BC098334.1 558 aa: ARM(43–162, 268–381, 390–458) Rap GEF 37 RAPGEF2 NM_014247.2 1,499 aa: RasGEF(713–938) Ras GEF 38 RAPGEF3 NM_001098532.2 881 aa: RasGEF(616–848) Ras GEF 39 RAPGEF4 NM_007023.3 1,011 aa: RasGEF(768–1005) Ras GEF 40 RAPGEF5 NM_012294.3 730 aa: RasGEF(491–725) Ras GEF 41 RAPGEF6 NM_001164386.1 1,609 aa: RasGEF(857–1081) Ras GEF 42 RAPGEFL1 NM_016339.3 456 aa: RasGEF(217–450) Ras GEF 43 RASGEF1A BC022548.1 481 aa: RasGEF(214–457) Ras GEF 44 RASGEF1B BC121003.1 472 aa: RasGEF(202–448) Ras GEF 45 RASGEF1C BC057759.1 238 aa: RasGEF(49–195) Ras GEF 46 RASGRP1 BC109297.1 797 aa: RasGEF(201–430) Ras GEF 47 RASGRP2 XM_045647.1 671 aa: RasGEF(212–445) Ras GEF 48 RASGRP3 NM_015376.2 689 aa: RasGEF(148–378) Ras GEF 49 RASGRP4 AF448437.1 673 aa: RasGEF(197–426) Ras GEF 50 RGL AF186779.1 768 aa: RasGEF(228–497) Ras GEF 51 RGL1 NM_001297670.1 766 aa: RasGEF(226–495) Ras GEF 52 RGL2 BC032681.1 777 aa: RasGEF(239–509) Ras GEF 53 SH2D3C BC032365.1 860 aa: RasGEF(585–754) Ras GEF 54 SOS1 NM_005633.3 1,333 aa: RhoGEF(201–388) PH(439–545) RasGEF(776–1015) Rho GEF 55 SOS2 NM_006939.2 1,332 aa: RhoGEF(199–386) PH(437–543) RasGEF(774–1013) Rho GEF 56 TEM4 AF378754.1 2,063 aa: RhoGEF(1067–1252) PH(1284–1432) Rho GEF 57 TIAM1 NM_003253.2 1,591 aa: RhoGEF(1041–1232) PH(1235–1406) Rho GEF 58 TIAM2 NM_012454.3 1,701 aa: RhoGEF(1100–1291) PH(1294–1466) Rho GEF 59 TRAD AB011422 1,289 aa: RhoGEF(233–405) PH(410–544) Rho GEF 60 VAV1 NM_005428.2 845 aa: RhoGEF(195–371) PH(385–508) Rho GEF 61 VAV2 NM_003371 839 aa: RhoGEF(194–369) PH(384–506) Rho GEF 62 VAV3 AF067817.1 847 aa: RhoGEF(193–369) PH(383–506) Rho GEF 63 WBSCR16 NM_030798.3 464 aa: 6xRCC Ran GEF

Nguyen et al. www.pnas.org/cgi/content/short/1604720113 11 of 14 Movie S1. The cell migration of overexpressed PLEKHG3 during 6 h. Time is shown in hours and minutes.

Movie S1

Movie S2. The illuminated region shows an accumulation of PLEKHG3 and the eventual change in the direction of the cell. The white circle indicates the position that was stimulated by light. The white arrow indicates the cell direction. Time is shown in minutes.

Movie S2

Nguyen et al. www.pnas.org/cgi/content/short/1604720113 12 of 14 Movie S3. Upon light stimulation, the PLEKHG3 signal retracted and repositioned to create another polarity at a different position. The white circle indicates the position that was stimulated by light. Time is shown in minutes.

Movie S3

Movie S4. The localization of PLEKHG3-GFP and mCherry-Lifeact to the leading edge was observed using SIM microscopy with a 100× objective lens. PLEKHG3 accumulates near newly formed actin filaments. Time is shown in seconds.

Movie S4

Nguyen et al. www.pnas.org/cgi/content/short/1604720113 13 of 14 Movie S5. PLEKHG3 is recruited to the newly formed protrusion area where Rac1 is repeatedly activated by light. The white circle indicates the position that was stimulated by light. Time is shown in minutes.

Movie S5

Movie S6. The accumulation of PLEKHG3 at the stimulated region and a change in cell direction upon optoPI3K stimulation are observed. The white rectangle indicates the position that was stimulated by light. Time is shown in hours and minutes.

Movie S6

Nguyen et al. www.pnas.org/cgi/content/short/1604720113 14 of 14