Supporting Information
Total Page：16
File Type：pdf, Size：1020Kb
Supporting Information Nguyen et al. 10.1073/pnas.1604720113 SI Materials and Methods medium containing DMEM, 10% FBS, and 1 mM L-glutamine. Cells Plasmid Construction. Sixty-three human GEF cDNAs were gen- were coated in 0.1% gelatin from porcine skin (Sigma) before plating erated from human brain tissue mRNAs, and the Gateway system on the flask. Cell medium was changed every 24 h. (Invitrogen) was used to construct a library of CFP-conjugated GEF plasmids. The mCherry-Lifeact vector was constructed by inserting siRNA Transfection and Real-Time PCR. The NIH 3T3 cells were the F-actin peptide–encoding sequence into the mCherry-C1 vector transfected with 25 nM mouse siRNA-PLEKHG3 (SC-152313; (22). Raichu-Rac1 and Raichu-Cdc42 were described previously Santa Cruz). The MDA-MB-231 and HUVEC cells were trans- (43). PTriEx-mVenus-PA-Rac1 (Addgene plasmid #22007) was a fected with 10 nM of human PLEKHG3-siRNA (SR308671; gift from K.M.H. GFP-TEM4 was generously provided by Natalia OriGene). Cells were cultured for 30 h after transfection. To Mitin at the University of North Carolina at Chapel Hill, Chapel analyze the expression of PLEKHG3 mRNAs, total RNA was Hill, NC (19). Lyn-CIBN-mCerulean was cloned by inserting the isolated using TRIzol (Life Technologies) and reverse-transcribed to myristoylation and CIBN sequences into the mCerulean-N1 vector. cDNAs using SuperScript III (Invitrogen). The generated cDNA was amplified using a 2× real-time PCR smart kit containing The mCitrine-PHRCRY2-iSH2 construct was cloned by inserting PHR and the iSH2 domain of p85beta (amino acids 420–615) EvaGreen (SolGent). The reaction was run at 95 °C for 10 min, CRY2 followed by 40 cycles of 95 °C for 20 s, 55 °C for 30 s, and 72 °C for into the pmCitrine-C1 vector (Clontech) by fusing an (SG7)3 linker between the PHR and iSH2 domain sequences (30). 30 s, on a CFX96 Real-Time system (Bio-Rad). All PCRs were CRY2 performedinduplicate,andtherelative transcript expression levels Cell Culture and Transfection. The NIH 3T3 cells were maintained in were measured by quantitative real-time PCR using the SYBR DMEM containing 10% (vol/vol) FBS (Life Technologies), 100 U/mL Green-based method. The average fold changes were calculated based on between-sample differences in the threshold cycle (Ct). penicillin, and 100 U/ mL streptomycin in humidified air (10% CO2) at 37 °C. Cells were transfected using a Neon transfection system Reagents and Antibodies. Rapamycin (Calbiochem) was applied at (Invitrogen) under the following conditions: voltage, 1,280 V; μ μ pulse, 2; width, 20 ms. A 96-well glass-bottomed black plate (89626; 0.5 M for 15 min. LY294002 (Sigma) was applied at 50 M for Ibidi) was precoated with fibronectin (1:500) (Invitrogen), and the 60 min. PDGF-BB (PeproTech) was applied at 10 nM for 30 min. −− μ cells were imaged 20–24 h posttransfection. The PLEKHG3 / cells Cytochalasin D (Sigma) was applied at 4 M for 30 min. Anti- bodies used were anti-mouse PLEKHG3 antibody (1:1,000) were transfected using Lipofectamine LTX with Plus Reagent (1:1:1) (X3-D3ZGY7; Abmart); anti-human PLEKHG3 antibody (1:500) (Invitrogen). (AP11167b; AbGent); and Alexa Fluor 594-conjugated phalloidin Generation of the PLEKHG3-Knockout Cell Line. (1:500) (A12381; Molecular Probes). Gene targeting. The guide RNA (gRNA) target sequence was subcloned into hCas9-2A-eGFP expression vector (pX458; Immunofluorescence. Cells were fixed in 4% (vol/vol) formaldehyde for 10 min at room temperature. Cells were washed with PBS and Addgene plasmid no. 48138). The oligonucleotides for gRNA were blocked in PBS and Tween 20 containing 1% BSA. To determine as follows: PLEKHG3-gRNA, forward 5′-CACCcgctgcccggctgttg- the subcellular localization of PLEKHG3, cells were incubated aacg-3′, reverse 5′-AAACcgttcaacagccgggcagcg-3′.H9hESCswere with anti-mouse PLEKHG3 antibody for 1 h at room temperature. nucleofected using Nucleofector 2b (Lonza). Forty-eight hours Cells were incubated with Alexa Fluor 488-conjugated anti-mouse later, the EGFP-expressing cells were FACS purified and plated on IgG antibody (A21202; Invitrogen) (1:500) and Alexa Fluor 594- mouse embryonic fibroblasts (MEFs). The colonies were picked conjugated phalloidin. ∼10–14 d later and were passaged twice before genomic DNA isolation. The PLEKHG3 genomic region flanking the gRNA- ′ F-Actin Cosedimentation Assay. To evaluate the direct association of binding site was PCR amplified (forward primer: 5 -ACCTCTA- F-actin with PLEKHG3, high-speed actin cosedimentation was CCACCTCCTCGTC-3′, reverse primer: 5′-GCACAGCCAGG- ’ ′ performed according to the manufacturer s instructions (Cytoskele- AAACAACAG-3 ). The purified PCR products were subjected ton Inc.). Purified GST-PLEKHG3 (amino acids 890–950) protein to a reannealing process to enable heteroduplex formation and was incubated with F-actin at room temperature for 45 min and were treated with SURVEYOR nuclease and SURVEYOR en- centrifuged in an ultracentrifuge (Optima TLX; Beckman Coulter) hancer S (Integrated DNA Technologies). Simultaneously, the at 270,500 × g for 1.5 h at 24 °C. The supernatant and pellet frac- targeted region of the PLEKHG3 gene was PCR amplified and tions were solubilized in SDS sample buffer, resolved by SDS/ cloned into pCR2.1-TOPO vector (Invitrogen). The insertion PAGE [4–12% (vol/vol)] (Invitrogen), and stained with Coo- sequence was verified by DNA sequencing to ensure that both massie Blue. alleles (from each hESC colony) were represented. The clones with biallelic nonsense mutations were expanded and differenti- LARIAT. LARIAT, which is a method for inhibiting protein func- ated for follow-up assays. tion, uses two modules: a multimeric protein (MP) and a light- + hESC culture and fibroblast differentiation. The undifferentiated H9 mediated heterodimerizer. Here, the MP was a version of Ca2 / hESC line was cultured on mitotically inactivated MEFs (Applied calmodulin-dependent protein kinase IIα (CaMKIIα) that lacked + StemCell, Inc.) in a medium containing DMEM/F12, 20% (vol/vol) Ca2 -responsive catalytic activity. This MP was fused to CIB1, knockout serum replacement, 0.1 mM Eagle’s minimum essen- which binds to CRY2 upon blue light stimulation. A single-domain tial medium-nonessential amino acids (MEM-NEAA), 1 mM GFP-binding antibody, VHH(GFP),wasfusedtoCRY2torecruit L-glutamine, 55 μM β-mercaptoethanol (Life Technologies), and GFP-PLEKHG3 to CIB1-MP clusters (24). 4 ng/mL FGF2 (R&D Systems) (hESC medium) in 5% CO2 at 37 °C (44). For fibroblast differentiation, the culture medium Rac1-GTP and Cdc42-GTP Pull-Down Assay. Measurement of GTP- was changed gradually from hESC medium to a medium containing bound Rac1 and Cdc42 was performed using active Rac1 and Cdc42 MEM α (GlutaMAX supplement, no nucleosides), 10% FBS for pull-down kits (16118 and 16119; Thermo Scientific). Briefly, GST- 2 wk. These cells were maintained further for at least 4 wk in a Pak1-PBD was used to affinity-precipitate GTP-bound Rac1 and Nguyen et al. www.pnas.org/cgi/content/short/1604720113 1of14 Cdc42 from lysed cells. The protein extracts from the HEK293 cell Microscopic and Imaging Analyses. All live images were captured line were separated on a Bolt 12% (vol/vol) Bis-Tris Plus Gel using an A1R confocal (Nikon) or an SIM (Nikon) microscopy (BG00125BOX; Life Technologies), and the protein was transferred system. Migration velocity, fluorescence intensity, kymographs, toaPVDFmembrane(LifeTechnologies).Themembranewas quantitative analysis, and videos were performed with Nikon blockedinblockingsolution(1:1)(LI-COR).PrecipitatedRac1-GTP imaging software (NIS-element) and MetaMorph 7.7 (Molecular and Cdc42-GTP were detected by immunoblot analysis, using mouse Devices). The graph was drawn by an Excel program. monoclonal anti-Rac1 and anti-Cdc42 antibodies (Thermo Sci- entific). Then samples were labeled with 800-nm channel dye (anti- Statistical Methods. Statistical significance was evaluated by a two- mouse; 1:3,000; LI-COR Biosciences). Western blotting tailed unpaired Student’s t test: *P < 0.1 and **P < 0.01. All was analyzed using the Odyssey Imaging System (Odyssey CLx; values represent the means of three independent experiments, LI-COR Biosciences). and error bars where shown represent ± SEM. NET1 GEF-H1 PLEKHG3 TEM4 Actin filament Nucleus Microtubule C9orf100 FARP1 FARP2 RALGPS1 SH2D3C Trad Plasma Membrane ARHGEF5 ARHGEF15 RABIFRASGEF1B RASGEF1C p63RhoGEF Whole cell ABR AKAP13 ARHGEF1 ARHGEF4 ARHGEF6 ARHGEF7 ARHGEF9 ARHGEF10 ARHGEF16 ARHGEF18 Asef BIG3 CYTH1 CYTH2 CYTH3 CYTH4 FGD1 FGD3 FGD5 GBF1 LBC NGEF PDZ-RhoGEF RABGEF1 RAP1GDS1 RAPGEF2RAPGEF3 RAPGEF4 RAPGEF5 RAPGEF6 RAPGEFL1 RASGEF1A Cytoplasm RASGRP1 RASGRP2RASGRP3 RASGRP4 RGL RGL1 RGL2 SOS1 SOS2 TIAM1 TIAM2 VAV1 VAV2 VAV3 WBSCR16 Fig. S1. Localization of the 63 human GEFs. Confocal images show the subcellular localization of 63 CFP-conjugated human GEFs in NIH 3T3 cells. The localizations were classified into six categories: one GEF was localized in the nucleus, one GEF was localized in microtubules, two GEFs were localized in actin filaments, six GEFs were localized in the PM, six GEFs were distributed throughout the whole cell, and 47 GEFs were localized in the cytoplasm. (Scale bar, 20 μm.) Nguyen et al. www.pnas.org/cgi/content/short/1604720113 2of14 A B C PLEKHG3 F-actin Merge MDA-MB-231 1.3 00:00 MDA-MB-231 ** 1 02:00 NIH3T3 04:00 0.7 Velocity (μm/min) Velocity 06:00 00:00 HUVEC MDA-MB-231 02:00 HUVEC 1.3 ** 04:00 HUVEC 06:00 1 D (μm) PLEKHG3 F-actin Merge 0 500 0.7 Velocity (μm/min) Velocity Cyto D ̶ E gRNA binding region F PLEKHG3 ATG R + Cyto D F RALGPS1F-actin Merge Indel in human PLEKHG3 exon 2 locus (antisense) PAM GCCCTGCCGCTGCCCGGCTGTTGA-ACGGGGAGAGGGGCCCCTTCACG WT H9 Cyto D GCCCTGCCGCTGCCCGGCTGTTGA-ACGGGGAGAGGGGCCCCTTCACG WT ̶ GCCCTGCCGCTGCCCGGCTGTTGAAACGGGGAGAGGGGCCCCTTCACG +1 PLE3-/- GCCCTGCCGCTGCCCGGCTGTTGAAACGGGGAGAGGGGCCCCTTCACG +1 + Cyto D * Fig. S2. PLEKHG3 localizes to the leading edge of the cell and controls cell migration.