DOCSLIB.ORG

Integrin-Linked Kinase Controls Renal Branching Morphogenesis Via Dual Specificity Phosphatase 8

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Integrin-Linked Kinase Controls Renal Branching Morphogenesis Via Dual Specificity Phosphatase 8 BASIC RESEARCH www.jasn.org Integrin-linked Kinase Controls Renal Branching Morphogenesis via Dual Specificity Phosphatase 8 †‡ Joanna Smeeton,* Priya Dhir,* Di Hu,* Meghan M. Feeney,* Lin Chen,* and † Norman D. Rosenblum* § *Program in Developmental and Stem Cell Biology, and §Division of Nephrology, The Hospital for Sick Children, Toronto, Ontario, Canada; and †Departments of Paediatrics, and ‡Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Ontario, Canada ABSTRACT Integrin-linked kinase (ILK) is an intracellular scaffold protein with critical cell-specific functions in the embryonic and mature mammalian kidney. Previously, we demonstrated a requirement for Ilk during ureteric branching and cell cycle regulation in collecting duct cells in vivo. Although in vitro data indicate that ILK controls p38 mitogen-activated protein kinase (p38MAPK) activity, the contribution of ILK- p38MAPK signaling to branching morphogenesis in vivo is not defined. Here, we identified genes that are regulated by Ilk in ureteric cells using a whole-genome expression analysis of whole-kidney mRNA in mice with Ilk deficiency in the ureteric cell lineage. Six genes with expression in ureteric tip cells, including Wnt11, were downregulated, whereas the expression of dual-specificity phosphatase 8 (DUSP8) was upregulated. Phosphorylation of p38MAPK was decreased in kidney tissue with Ilk deficiency, but no significant decrease in the phosphorylation of other intracellular effectors previously shown to control renal morphogenesis was observed. Pharmacologic inhibition of p38MAPK activity in murine inner med- ullary collecting duct 3 (mIMCD3) cells decreased expression of Wnt11, Krt23,andSlo4c1.DUSP8over- expression in mIMCD3 cells significantly inhibited p38MAPK activation and the expression of Wnt11 and Slo4c1. Adenovirus-mediated overexpression of DUSP8 in cultured embryonic murine kidneys decreased ureteric branching and p38MAPK activation. Together, these data demonstrate that Ilk controls branching morphogenesis by regulating the expression of DUSP8, which inhibits p38MAPK activity and decreases branching morphogenesis. J Am Soc Nephrol 27: 1465–1477, 2016. doi: 10.1681/ASN.2015020139 Renal branching morphogenesis, defined as growth contrast, a limited number and variety of intracellular and branching of the ureteric bud (UB) and its molecules that function within these signaling path- derivatives, is essential to mammalian kidney devel- ways to control ureteric branching have been identi- opment. The UB grows, branches, and differentiates fied. In vitro treatment of embryonic urogenital to form the collecting ducts and pelvis of the mature explants with pharmacologic inhibitors revealed dis- kidney. Further, UB tips induce adjacent metanephric tinct roles for extracellular signal-regulated kinase mesenchyme cells to undergo the process of nephro- genesis.1 Defects in renal branching morphogenesis cause congenital renal hypodysplasia, characterized Received February 6, 2015. Accepted August 11, 2015. by abnormal collecting-system morphology and Published online ahead of print. Publication date available at 2 function and low nephron number. www.jasn.org. TheUBarisesasadirectevaginationofthein- fi Correspondence: Dr. Norman D. Rosenblum, The Hospital for termediate mesoderm-derived Wolf an duct. Ex- Sick Children, Peter Gilgan Centre for Research and Learning, tracellular ligands and cell-surface receptors in mul- 686 Bay Street, Toronto, ON M5G 0A4, Canada. Email: norman. tiple distinct molecular signaling pathways function [email protected] during the induction and early patterning of the UB. In Copyright © 2016 by the American Society of Nephrology J Am Soc Nephrol 27: 1465–1477, 2016 ISSN : 1046-6673/2705-1465 1465 BASIC RESEARCH www.jasn.org (ERK), protein kinase B (AKT), and p38 mitogen-activated pro- tein kinase (p38MAPK) during renal development.3 Further- more, ERK and AKT can be activated downstream of the tyrosine kinase receptor, RET, in the UB tip domain, suggesting that in- tracellular kinase signaling is functionally important during ure- teric branching.4,5 Integrin-linked kinase (ILK) is a scaffold protein that was initially identified through its ability to interact with the cytoplasmic domain of b-integrins.6 Investigation of ILK function has revealed a requirement for ILK upstream of in- tracellular kinases AKT,7 glycogen synthase kinase 3b,8 and p38MAPK.9 While each of AKT, glycogen synthase kinase 3b, and p38MAPK have been shown to play a role in control- ling renal branching morphogenesis, their role downstream of ILK in the embryonic kidney has not been defined. Nor is it predicted by their functions in nonrenal tissues because their regulation by ILK is context-dependent.10 Previously, we dem- onstrated that Ilk is required for renal branching morphogen- esis in vivo11 and controls UB branching via p38MAPK in vitro.9,12 However, the role of p38MAPK in vivo and the genes that act downstream of Ilk during the early stages of branching morphogenesis have not been previously defined. In this study we characterize the intracellular signaling pathways and UB transcriptome in the early embryonic Ilk- deficient kidney to determine the primary role of Ilk in the regulation of renal branching. Our results demonstrate that Ilk regulates the expression of a distinct subset of UB branching 2 2 genes through both p38MAPK-independent and -dependent Figure 1. E12.5 Ilk / UB kidneys demonstrate reduced UB pathways. Our data also demonstrate upregulation of a phos- branching and abnormal gene regulation. (A,B) GFP branching 2/2UB phatase, dual-specificity phosphatase 8 (DUSP8), not previ- pattern of (A) GFP+ heterozygote and (B) Ilk kidneys con- fi 2/2UB ously implicated in kidney development. We demonstrate a rmed the branching defect in E12.5 Ilk kidneys selected for microarray analysis. (C) Gene expression differs between WT functional role for DUSP8 in attenuating activation of 2/2UB and Ilk mutant (MUT) kidneys with similar expression pat- p38MAPK and p38MAPK-dependent genes and inhibiting terns clustering within the WT and mutant samples. Expression branching morphogenesis. Together, these results describe a values of differentially regulated genes (P,0.003) are shown in novel DUSP8-mediated mechanism by which ILK controls this heatmap, with red indicating lower expression and yellow renal branching morphogenesis. higher expression. RESULTS To determine changes in expression levels for individual genes, the top table of genes based on the t-statistic ranking was gen- Mice with conditional deletion of Ilk in the developing UB erated. Using a statistical cutoff of P,0.003 to identify changes 2 2 (Ilk / UB) have decreased UB branching at E12.5.11 However, in the expression of individual genes, we identified 131 down- the underlying molecular mechanisms are unknown. We in- regulated probe sets and 96 upregulated (Figure 1C, Supple- vestigated these mechanisms using whole-genome–based anal- mental Tables 2 and 3). The magnitude of changes in gene ysis of gene expression in intact kidney tissue isolated at E12.5 expression, particularly for downregulated genes, was twofold (n=6 kidneys per sample, three biologic replicates per geno- or lower. This may be due to the fact that UB gene expression type). At the time of dissection, the presence of a branching was assayed in whole tissue in which UB cells constitute a mi- phenotype in Ilk-deficient kidneys was documented using nority of cells. While a gene expression analysis in isolated UB green fluorescent protein (GFP) expression driven by the cells may have generated gene expression changes of higher Hoxb7 promoter (Figure 1). Gene expression changes were in- magnitude, the quality of RNA isolated from flow-sorted UB vestigated through microarray analysis using Affymetrix cells derived from mutant mice precluded a whole-genome GeneChip Mouse 430 2.0 arrays. Expression levels were nor- gene expression analysis. Notwithstanding these considera- malized to wild-type (WT) and then analyzed for differential tions, consistent with genetic deletion of Ilk, the most statisti- 2 2 expression between Ilk / UB and WT samples using cally significant gene expression change was a downregulation 2 2 the Bioconductor limma package in R statistical program.13 of Ilk in Ilk / UB kidneys. 1466 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 1465–1477, 2016 www.jasn.org BASIC RESEARCH Gene Ontology Analysis Suggests Abnormal statistical significance for six genes by qRT-PCR (n=6/genotype, Regulation of Tube Morphogenesis Genes two technical replicates) and these were further confirmed by in To define the global state of gene expression in an Ilk-deficient situ hybridization in tissue sections at E12.5 (Figure 2). In con- state, we performed pathway analysis to identify gene ontology trast to UB tip genes Ret and Sox9, the mRNA expression of which (GO) biologic processes that are enriched within the down- was not significantly altered, in situ hybridization analysis con- regulated gene set. Sixty-one biologic process GO terms were firmed decreased expression of Sox8, Wnt11, Myb, CXCR4, Krt23, 2 2 statistically enriched in the downregulated gene list (Supple- and Slco4c1 in the UB of E12.5 Ilk / UB kidneys (Figure 2). mental Table 4). Within the downregulated gene set, GO terms involved in epithelial tube development as well as the regula- Ilk Deficiency Causes a Specific Decrease in the tion of organ morphogenesis were enriched (Table 1). These Activation of p38MAPK terms are highly consistent
Load more

Recommended publications
  • The Mineralocorticoid Receptor Leads to Increased Expression of EGFR
    www.nature.com/scientificreports OPEN The mineralocorticoid receptor leads to increased expression of EGFR and T‑type calcium channels that support HL‑1 cell hypertrophy Katharina Stroedecke1,2, Sandra Meinel1,2, Fritz Markwardt1, Udo Kloeckner1, Nicole Straetz1, Katja Quarch1, Barbara Schreier1, Michael Kopf1, Michael Gekle1 & Claudia Grossmann1* The EGF receptor (EGFR) has been extensively studied in tumor biology and recently a role in cardiovascular pathophysiology was suggested. The mineralocorticoid receptor (MR) is an important efector of the renin–angiotensin–aldosterone‑system and elicits pathophysiological efects in the cardiovascular system; however, the underlying molecular mechanisms are unclear. Our aim was to investigate the importance of EGFR for MR‑mediated cardiovascular pathophysiology because MR is known to induce EGFR expression. We identifed a SNP within the EGFR promoter that modulates MR‑induced EGFR expression. In RNA‑sequencing and qPCR experiments in heart tissue of EGFR KO and WT mice, changes in EGFR abundance led to diferential expression of cardiac ion channels, especially of the T‑type calcium channel CACNA1H. Accordingly, CACNA1H expression was increased in WT mice after in vivo MR activation by aldosterone but not in respective EGFR KO mice. Aldosterone‑ and EGF‑responsiveness of CACNA1H expression was confrmed in HL‑1 cells by Western blot and by measuring peak current density of T‑type calcium channels. Aldosterone‑induced CACNA1H protein expression could be abrogated by the EGFR inhibitor AG1478. Furthermore, inhibition of T‑type calcium channels with mibefradil or ML218 reduced diameter, volume and BNP levels in HL‑1 cells. In conclusion the MR regulates EGFR and CACNA1H expression, which has an efect on HL‑1 cell diameter, and the extent of this regulation seems to depend on the SNP‑216 (G/T) genotype.
    [Show full text]
  • Autism Multiplex Family with 16P11.2P12.2 Microduplication Syndrome in Monozygotic Twins and Distal 16P11.2 Deletion in Their Brother
    European Journal of Human Genetics (2012) 20, 540–546 & 2012 Macmillan Publishers Limited All rights reserved 1018-4813/12 www.nature.com/ejhg ARTICLE Autism multiplex family with 16p11.2p12.2 microduplication syndrome in monozygotic twins and distal 16p11.2 deletion in their brother Anne-Claude Tabet1,2,3,4, Marion Pilorge2,3,4, Richard Delorme5,6,Fre´de´rique Amsellem5,6, Jean-Marc Pinard7, Marion Leboyer6,8,9, Alain Verloes10, Brigitte Benzacken1,11,12 and Catalina Betancur*,2,3,4 The pericentromeric region of chromosome 16p is rich in segmental duplications that predispose to rearrangements through non-allelic homologous recombination. Several recurrent copy number variations have been described recently in chromosome 16p. 16p11.2 rearrangements (29.5–30.1 Mb) are associated with autism, intellectual disability (ID) and other neurodevelopmental disorders. Another recognizable but less common microdeletion syndrome in 16p11.2p12.2 (21.4 to 28.5–30.1 Mb) has been described in six individuals with ID, whereas apparently reciprocal duplications, studied by standard cytogenetic and fluorescence in situ hybridization techniques, have been reported in three patients with autism spectrum disorders. Here, we report a multiplex family with three boys affected with autism, including two monozygotic twins carrying a de novo 16p11.2p12.2 duplication of 8.95 Mb (21.28–30.23 Mb) characterized by single-nucleotide polymorphism array, encompassing both the 16p11.2 and 16p11.2p12.2 regions. The twins exhibited autism, severe ID, and dysmorphic features, including a triangular face, deep-set eyes, large and prominent nasal bridge, and tall, slender build. The eldest brother presented with autism, mild ID, early-onset obesity and normal craniofacial features, and carried a smaller, overlapping 16p11.2 microdeletion of 847 kb (28.40–29.25 Mb), inherited from his apparently healthy father.
    [Show full text]
  • Supporting Online Material
    1 2 3 4 5 6 7 Supplementary Information for 8 9 Fractalkine-induced microglial vasoregulation occurs within the retina and is altered early in diabetic 10 retinopathy 11 12 *Samuel A. Mills, *Andrew I. Jobling, *Michael A. Dixon, Bang V. Bui, Kirstan A. Vessey, Joanna A. Phipps, 13 Ursula Greferath, Gene Venables, Vickie H.Y. Wong, Connie H.Y. Wong, Zheng He, Flora Hui, James C. 14 Young, Josh Tonc, Elena Ivanova, Botir T. Sagdullaev, Erica L. Fletcher 15 * Joint first authors 16 17 Corresponding author: 18 Prof. Erica L. Fletcher. Department of Anatomy & Neuroscience. The University of Melbourne, Grattan St, 19 Parkville 3010, Victoria, Australia. 20 Email: [email protected] ; Tel: +61-3-8344-3218; Fax: +61-3-9347-5219 21 22 This PDF file includes: 23 24 Supplementary text 25 Figures S1 to S10 26 Tables S1 to S7 27 Legends for Movies S1 to S2 28 SI References 29 30 Other supplementary materials for this manuscript include the following: 31 32 Movies S1 to S2 33 34 35 36 1 1 Supplementary Information Text 2 Materials and Methods 3 Microglial process movement on retinal vessels 4 Dark agouti rats were anaesthetized, injected intraperitoneally with rhodamine B (Sigma-Aldrich) to label blood 5 vessels and retinal explants established as described in the main text. Retinal microglia were labelled with Iba-1 6 and imaging performed on an inverted confocal microscope (Leica SP5). Baseline images were taken for 10 7 minutes, followed by the addition of PBS (10 minutes) and then either fractalkine or fractalkine + candesartan 8 (10 minutes) using concentrations outlined in the main text.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Identification and Characterization of RHOA-Interacting Proteins in Bovine Spermatozoa1
    BIOLOGY OF REPRODUCTION 78, 184–192 (2008) Published online before print 10 October 2007. DOI 10.1095/biolreprod.107.062943 Identification and Characterization of RHOA-Interacting Proteins in Bovine Spermatozoa1 Sarah E. Fiedler, Malini Bajpai, and Daniel W. Carr2 Department of Medicine, Oregon Health & Sciences University and Veterans Affairs Medical Center, Portland, Oregon 97239 ABSTRACT Guanine nucleotide exchange factors (GEFs) catalyze the GDP for GTP exchange [2]. Activation is negatively regulated by In somatic cells, RHOA mediates actin dynamics through a both guanine nucleotide dissociation inhibitors (RHO GDIs) GNA13-mediated signaling cascade involving RHO kinase and GTPase-activating proteins (GAPs) [1, 2]. Endogenous (ROCK), LIM kinase (LIMK), and cofilin. RHOA can be RHO can be inactivated via C3 exoenzyme ADP-ribosylation, negatively regulated by protein kinase A (PRKA), and it and studies have demonstrated RHO involvement in actin-based interacts with members of the A-kinase anchoring (AKAP) cytoskeletal response to extracellular signals, including lyso- family via intermediary proteins. In spermatozoa, actin poly- merization precedes the acrosome reaction, which is necessary phosphatidic acid (LPA) [2–4]. LPA is known to signal through for normal fertility. The present study was undertaken to G-protein-coupled receptors (GPCRs) [4, 5]; specifically, LPA- determine whether the GNA13-mediated RHOA signaling activated GNA13 (formerly Ga13) promotes RHO activation pathway may be involved in acrosome reaction in bovine through GEFs [4, 6]. Activated RHO-GTP then signals RHO caudal sperm, and whether AKAPs may be involved in its kinase (ROCK), resulting in the phosphorylation and activation targeting and regulation. GNA13, RHOA, ROCK2, LIMK2, and of LIM-kinase (LIMK), which in turn phosphorylates and cofilin were all detected by Western blot in bovine caudal inactivates cofilin, an actin depolymerizer, the end result being sperm.
    [Show full text]
  • Transcriptomic Analysis of Native Versus Cultured Human and Mouse Dorsal Root Ganglia Focused on Pharmacological Targets Short
    bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Transcriptomic analysis of native versus cultured human and mouse dorsal root ganglia focused on pharmacological targets Short title: Comparative transcriptomics of acutely dissected versus cultured DRGs Andi Wangzhou1, Lisa A. McIlvried2, Candler Paige1, Paulino Barragan-Iglesias1, Carolyn A. Guzman1, Gregory Dussor1, Pradipta R. Ray1,#, Robert W. Gereau IV2, # and Theodore J. Price1, # 1The University of Texas at Dallas, School of Behavioral and Brain Sciences and Center for Advanced Pain Studies, 800 W Campbell Rd. Richardson, TX, 75080, USA 2Washington University Pain Center and Department of Anesthesiology, Washington University School of Medicine # corresponding authors [email protected], [email protected] and [email protected] Funding: NIH grants T32DA007261 (LM); NS065926 and NS102161 (TJP); NS106953 and NS042595 (RWG). The authors declare no conflicts of interest Author Contributions Conceived of the Project: PRR, RWG IV and TJP Performed Experiments: AW, LAM, CP, PB-I Supervised Experiments: GD, RWG IV, TJP Analyzed Data: AW, LAM, CP, CAG, PRR Supervised Bioinformatics Analysis: PRR Drew Figures: AW, PRR Wrote and Edited Manuscript: AW, LAM, CP, GD, PRR, RWG IV, TJP All authors approved the final version of the manuscript. 1 bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Transcriptome Analysis of Gravitational Effects on Mouse Skeletal Muscles Under Microgravity and Artificial 1 G Onboard Environm
    www.nature.com/scientificreports OPEN Transcriptome analysis of gravitational efects on mouse skeletal muscles under microgravity and artifcial 1 g onboard environment Risa Okada1,2, Shin‑ichiro Fujita3,4, Riku Suzuki5,6, Takuto Hayashi3,5, Hirona Tsubouchi5, Chihiro Kato5,7, Shunya Sadaki5, Maho Kanai5,6, Sayaka Fuseya3,5, Yuri Inoue3,5, Hyojung Jeon5, Michito Hamada5, Akihiro Kuno5,6, Akiko Ishii8, Akira Tamaoka8, Jun Tanihata9, Naoki Ito10, Dai Shiba1,2, Masaki Shirakawa1,2, Masafumi Muratani1,4, Takashi Kudo1,5* & Satoru Takahashi1,5* Spacefight causes a decrease in skeletal muscle mass and strength. We set two murine experimental groups in orbit for 35 days aboard the International Space Station, under artifcial earth‑gravity (artifcial 1 g; AG) and microgravity (μg; MG), to investigate whether artifcial 1 g exposure prevents muscle atrophy at the molecular level. Our main fndings indicated that AG onboard environment prevented changes under microgravity in soleus muscle not only in muscle mass and fber type composition but also in the alteration of gene expression profles. In particular, transcriptome analysis suggested that AG condition could prevent the alterations of some atrophy‑related genes. We further screened novel candidate genes to reveal the muscle atrophy mechanism from these gene expression profles. We suggest the potential role of Cacng1 in the atrophy of myotubes using in vitro and in vivo gene transductions. This critical project may accelerate the elucidation of muscle atrophy mechanisms. Gravity is the most constant factor afecting the entire process of evolution of organisms on Earth. As adapting to a changing environment is key for any organism’s survival, the constant mechanical stimulus of gravitational force has been shared by all organisms on Earth through evolution 1.
    [Show full text]
  • Ubiquitylome Profiling of Parkin-Null Brain Reveals Dysregulation Of
    Neurobiology of Disease 127 (2019) 114–130 Contents lists available at ScienceDirect Neurobiology of Disease journal homepage: www.elsevier.com/locate/ynbdi Ubiquitylome profiling of Parkin-null brain reveals dysregulation of calcium T homeostasis factors ATP1A2, Hippocalcin and GNA11, reflected by altered firing of noradrenergic neurons Key J.a,1, Mueller A.K.b,1, Gispert S.a, Matschke L.b, Wittig I.c, Corti O.d,e,f,g, Münch C.h, ⁎ ⁎ Decher N.b, , Auburger G.a, a Exp. Neurology, Goethe University Medical School, 60590 Frankfurt am Main, Germany b Institute for Physiology and Pathophysiology, Vegetative Physiology and Marburg Center for Mind, Brain and Behavior - MCMBB; Clinic for Neurology, Philipps-University Marburg, 35037 Marburg, Germany c Functional Proteomics, SFB 815 Core Unit, Goethe University Medical School, 60590 Frankfurt am Main, Germany d Institut du Cerveau et de la Moelle épinière, ICM, Paris, F-75013, France e Inserm, U1127, Paris, F-75013, France f CNRS, UMR 7225, Paris, F-75013, France g Sorbonne Universités, Paris, F-75013, France h Institute of Biochemistry II, Goethe University Medical School, 60590 Frankfurt am Main, Germany ARTICLE INFO ABSTRACT Keywords: Parkinson's disease (PD) is the second most frequent neurodegenerative disorder in the old population. Among Parkinson's disease its monogenic variants, a frequent cause is a mutation in the Parkin gene (Prkn). Deficient function of Parkin Mitochondria triggers ubiquitous mitochondrial dysfunction and inflammation in the brain, but it remains unclear howse- Parkin lective neural circuits become vulnerable and finally undergo atrophy. Ubiquitin We attempted to go beyond previous work, mostly done in peripheral tumor cells, which identified protein Calcium targets of Parkin activity, an ubiquitin E3 ligase.
    [Show full text]
  • Apba, a New Genetic Locus Involved in Thiamine Biosynthesis in Salmonella Typhimurium DIANA M
    JOURNAL OF BACrERIOLOGY, Aug. 1994, p. 4858-4864 Vol. 176, No. 16 0021-9193/94/$04.00+0 Copyright X 1994, American Society for Microbiology apbA, a New Genetic Locus Involved in Thiamine Biosynthesis in Salmonella typhimurium DIANA M. DOWNS* AND LESLIE PETERSEN Department of Bacteriology, University of Wisconsin-Madison, Madison, Wisconsin 53706 Received 3 February 1994/Returned for modification 14 April 1994/Accepted 3 June 1994 In Salnonella typhimurium, the synthesis of the pyrimidine moiety of thiamine can occur by utilization of the first five steps in de novo purine biosynthesis or independently of the pur genes through the alternative pyrimidine biosynthetic, or APB, pathway (D. M. Downs, J. Bacteriol. 174:1515-1521, 1992). We have isolated the first mutations defective in the APB pathway. These mutations define the apbA locus and map at 10.5 min on the S. typhimurium chromosome. We have cloned and sequenced the apbA gene and found it to encode a 32-kDa polypeptide whose sequence predicts an NAD/flavin adenine dinucleotide-binding pocket in the protein. The phenotypes of apbA mutants suggest that, under some conditions, the APB pathway is the sole source of the pyrimidine moiety of thiamine in wild-type S. typhimurium, and furthermore, the pur genetic background of the strain influences whether this pathway can function under aerobic and/or anaerobic growth conditions. Thiamine (vitamin B1) is a required nutrient for the cell and thiamine biosynthesis still required the remainingpur genes for in its coenzymic form, thiamine pyrophosphate, participates as the formation of HMP (9). a carrier of C2 units in reactions such as the ones catalyzed by Recently, we demonstrated the existence of a pathway that transketolase and pyruvate dehydrogenase.
    [Show full text]
  • G-Protein-Coupled Receptor Signaling and Polarized Actin Dynamics Drive
    RESEARCH ARTICLE elifesciences.org G-protein-coupled receptor signaling and polarized actin dynamics drive cell-in-cell invasion Vladimir Purvanov, Manuel Holst, Jameel Khan, Christian Baarlink, Robert Grosse* Institute of Pharmacology, University of Marburg, Marburg, Germany Abstract Homotypic or entotic cell-in-cell invasion is an integrin-independent process observed in carcinoma cells exposed during conditions of low adhesion such as in exudates of malignant disease. Although active cell-in-cell invasion depends on RhoA and actin, the precise mechanism as well as the underlying actin structures and assembly factors driving the process are unknown. Furthermore, whether specific cell surface receptors trigger entotic invasion in a signal-dependent fashion has not been investigated. In this study, we identify the G-protein-coupled LPA receptor 2 (LPAR2) as a signal transducer specifically required for the actively invading cell during entosis. We find that 12/13G and PDZ-RhoGEF are required for entotic invasion, which is driven by blebbing and a uropod-like actin structure at the rear of the invading cell. Finally, we provide evidence for an involvement of the RhoA-regulated formin Dia1 for entosis downstream of LPAR2. Thus, we delineate a signaling process that regulates actin dynamics during cell-in-cell invasion. DOI: 10.7554/eLife.02786.001 Introduction Entosis has been described as a specialized form of homotypic cell-in-cell invasion in which one cell actively crawls into another (Overholtzer et al., 2007). Frequently, this occurs between tumor cells such as breast, cervical, or colon carcinoma cells and can be triggered by matrix detachment (Overholtzer et al., 2007), suggesting that loss of integrin-mediated adhesion may promote cell-in-cell invasion.
    [Show full text]
  • Angiopoietin 4 (ANGPT4) (NM 015985) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC304373 Angiopoietin 4 (ANGPT4) (NM_015985) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Angiopoietin 4 (ANGPT4) (NM_015985) Human Untagged Clone Tag: Tag Free Symbol: ANGPT4 Synonyms: ANG3; ANG4 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 Angiopoietin 4 (ANGPT4) (NM_015985) Human Untagged Clone – SC304373 Fully Sequenced ORF: >OriGene sequence for NM_015985 edited CAGGCAAGCCTGGCCACTGTTGGCTGCAGCAGGACATCCCAGGCACAGCCCCTAGGGCTC TGAGCAGACATCCCTCGCCATTGACACATCTTCAGATGCTCTCCCAGCTAGCCATGCTGC AGGGCAGCCTCCTCCTTGTGGTTGCCACCATGTCTGTGGCTCAACAGACAAGGCAGGAGG CGGATAGGGGCTGCGAGACACTTGTAGTCCAGCACGGCCACTGTAGCTACACCTTCTTGC TGCCCAAGTCTGAGCCCTGCCCTCCGGGGCCTGAGGTCTCCAGGGACTCCAACACCCTCC AGAGAGAATCACTGGCCAACCCACTGCACCTGGGGAAGTTGCCCACCCAGCAGGTGAAAC AGCTGGAGCAGGCACTGCAGAACAACACGCAGTGGCTGAAGAAGCTAGAGAGGGCCATCA AGACGATCTTGAGGTCGAAGCTGGAGCAGGTCCAGCAGCAAATGGCCCAGAATCAGACGG CCCCCATGCTAGAGCTGGGCACCAGCCTCCTGAACCAGACCACTGCCCAGATCCGCAAGC TGACCGACATGGAGGCTCAGCTCCTGAACCAGACATCAAGAATGGATGCCCAGATGCCAG AGACCTTTCTGTCCACCAACAAGCTGGAGAACCAGCTGCTGCTACAGAGGCAGAAGCTCC AGCAGCTTCAGGGCCAAAACAGCGCGCTCGAGAAGCGGTTGCAGGCCCTGGAGACCAAGC
    [Show full text]
  • Dominance of SARS-Cov-2 D614G Variant Explained by the Requirement of COVID-19 for Calcium; Proximate Therapeutic Implication(S) for COVID-19
    Cashman DP, J Clin Immunol Immunother 2020, 6: 048 DOI: 10.24966/CIIT-8844/1000048 HSOA Journal of Clinical Immunology and Immunotherapy Research Article Decreased SPCA1 expression causes Hailey-Hailey disease, a rare Dominance of SARS-CoV-2 skin disorder that impairs a cells’ ability to transport Ca2+ (i.e., human ATP2C1 gene). Clinically, the hypocalcemia associated with hospi- D614G Variant Explained by talized COVID-19 patients can effectively impair Ca2+ transport in an analogous manner to the SPCA1 deficiency. Here, the D614G the Requirement of COVID-19 SAR-CoV-2 mutant strain can make use of clinical hypocalcemia like the D104G mutated hPIV-3 virus takes advantage of SPCA1 deficient cells to increase infectivity. These data demonstrate the for Calcium; Proximate critical importance of calcium for effective SARS-CoV-2/COVID-19 infection and how understanding this mechanism can be exploited Therapeutic Implication(s) for for therapeutic gain to stop, or otherwise attenuate virus infection at the earliest steps. Calcium chelation by pharmaceutical EDTA, has COVID-19 been, and can be safely delivered via nebulizer or oral ingestion. Daniel P Cashman M.D.* EDTA treatment is available in outpatient and inpatient settings and can be self-administered during “quarantine” periods. These proven PO Box 841, Los Altos, CA, United States and safe EDTA treatments should effectively disrupt SARS-CoV-2 spread at the earliest step in the virus lifecycle and warrant investi- Abstract gation and optimization to save lives post haste. The current dominance of D614G mutation in the SARS-CoV-2 Keywords: Calcium; Covid-19; Pandemic; SARS-CoV-2; D614G; pandemic implies increased infectivity of the virus S protein that Spike Protein Variant; EDTA; Nebulizer; Treatment; Zinc drives cellular entry which is triggered by binding to the angioten- sin converting enzyme-2 (ACE2) receptor and calcium-dependent Introduction protease-mediated activation.
    [Show full text]