DOCSLIB.ORG

The Ubiquitin-Like Modifier FAT10 in Cancer Development

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Ubiquitin-Like Modifier FAT10 in Cancer Development Erschienen in: The International Journal of Biochemistry & Cell Biology ; 79 (2016). - S. 451-461 https://dx.doi.org/10.1016/j.biocel.2016.07.001 The ubiquitin-like modifier FAT10 in cancer development a a,b,∗ Annette Aichem , Marcus Groettrup a Biotechnology Institute Thurgau at the University of Konstanz, CH-8280 Kreuzlingen, Switzerland b Division of Immunology, Department of Biology, University of Konstanz, D-78457 Konstanz, Germany a b s t r a c t During the last years it has emerged that the ubiquitin-like modifier FAT10 is directly involved in cancer development. FAT10 expression is highly up-regulated by pro-inflammatory cytokines IFN-␥ and TNF-␣ in all cell types and tissues and it was also found to be up-regulated in many cancer types such as glioma, colorectal, liver or gastric cancer. While pro-inflammatory cytokines within the tumor microenvironment probably contribute to FAT10 overexpression, an increasing body of evidence argues that pro-malignant capacities of FAT10 itself largely underlie its broad and intense overexpression in tumor tissues. FAT10 thereby regulates pathways involved in cancer development such as the NF-␬B- or Wnt-signaling. More- over, FAT10 directly interacts with and influences downstream targets such as MAD2, p53 or ␤-catenin, leading to enhanced survival, proliferation, invasion and metastasis formation of cancer cells but also of non-malignant cells. In this review we will provide an overview of the regulation of FAT10 expression as well as its function in carcinogenesis. Contents 1. Introduction . 452 2. The ubiquitin-like modifier FAT10, a protein of the immune system . 452 2.1. The structure of FAT10 and how it targets for proteasomal degradation . 452 2.2. FAT10 in adaptive and innate immunity . 452 2.3. Which are the targets of FAT10 and how is it conjugated to its substrates . 453 3. Regulation of FAT10 expression under inflammatory conditions and during cancer development . 454 3.1. FAT10 expression levels in different cancer types . 454 3.2. The transforming capacity of FAT10 . 454 4. What are the mechanisms behind FAT10 overexpression?. .455 5. Functional consequences of FAT10 up-regulation in inflammation and cancer. .455 5.1. MAD2 and chromosomal instability . 455 5.2. p53 . 456 5.3. ␤-catenin . 458 5.4. Smad2 . 459 6. Summary and future prospects . 459 Conflict of interest. .459 Acknowledgements . 459 References . 459 Abbreviations: AIPL1, aryl-hydrocarbon receptor like-1; APC/C, anaphase-promoting complex/cyclosome; DUB, deubiquitylating enzyme; EMT, epithelial-mesenchymal transition; FAT10, HLA-F adjacent transcript 10; GSK, glycogen synthase kinase; HCC, hepatocellular carcinoma; HLA, human leukocyte antigen; HOX, homeobox; IFN, interferon; IL, interleukin; MAD2, mitotic arrest deficient 2; mTEC, medullary thymic epithelial cells; NF-␬B, nuclear factor kappa-B; NUB1L, NEDD8-ultimate buster 1 long; STAT, signal transducer and activator of transcription; SUMO, small-ubiquitin-like modifier; TGF, transforming growth factor; TNF, tumor necrosis factor; UBD, Ubiquitin D; ULM, ubiquitin-like modifier; UPS, ubiquitin proteasome system; USE1, UBA6-specific E2 enzyme 1. ∗ Corresponding author at: Division of Immunology, Department of Biology, University of Konstanz, Universitaetsstr. 10, D-78457 Konstanz, Germany. E-mail address: [email protected] (M. Groettrup). Konstanzer Online-Publikations-System (KOPS) URL: http://nbn-resolving.de/urn:nbn:de:bsz:352-0-347923 452 1. Introduction for activation and covalent attachment to substrate proteins by an E1–E3 enzymatic cascade (Hochstrasser, 2009). Of all these ULMs, A causal link between chronic inflammation or infection and FAT10 is the only modifier which acts as an autonomous transfer- tumorigenesis is nowadays a generally accepted principle leading able signal for degradation by the 26S proteasome and it was shown to the development of various cancer types. The underlying mech- that this process can occur independently of ubiquitin (Hipp et al., anism is in part based on the upregulation and secretion of several 2005; Schmidtke et al., 2009). FAT10 is a protein of the immune sys- proinflammatory cytokines such as tumor necrosis factor (TNF)␣, tem and it is strongly up-regulated by pro-inflammatory cytokines interferon (IFN)␥ or interleukin-6 (IL-6) by stromal cells as well (Fan et al., 1996; Raasi et al., 1999) and during the maturation as by infiltrating immune cells in the tumor microenvironment, of antigen presenting cells (Buerger et al., 2015; Ebstein et al., or by cytokines, secreted by tumor cells themselves (Zamarron 2009; Lukasiak et al., 2008). Moreover, numerous recent publica- and Chen, 2011). Such inflammatory conditions are generated to tions point to a direct involvement of FAT10 in cancer development. promote healing and regeneration of the affected tissue. How- These recent insights will be presented in this review along with ever, the persisting expression of these cytokines can also provide the current state of knowledge on the regulation and function of a niche for cancer development by promoting DNA damage and FAT10 expression in inflammation and tumorigenesis (Fig. 1). abnormal tissue healing. This is based on the fact that pro- inflammatory cytokines cause the activation of transcription 2. The ubiquitin-like modifier FAT10, a protein of the factors such as nuclear factor kappa-B (NF-␬B) and signal trans- immune system ducer and activator of transcription (STAT)3, which play a central role as activators of anti-apoptotic gene expression and cell prolif- 2.1. The structure of FAT10 and how it targets for proteasomal eration. Furthermore, these cytokines promote optimal conditions degradation for tumor cell proliferation, invasion and metastasis formation, apoptosis resistance as well as angiogenesis, i.e. processes which The Fat10 gene (originally designated Ubiquitin D (Ubd)) was are all prerequisites for cancer development (Grivennikov et al., identified by genomic sequencing of the human major histocom- 2010; Karin, 2006). patibility complex (MHC) by Sherman Weissman and colleagues in The reversible post-translational modification of proteins with 1996 (Fan et al., 1996). The structural model of the 165 amino acid a single ubiquitin or with ubiquitin chains is an important mech- long, 18 kDa protein FAT10 as well as a previously published NMR anism to regulate the function, activity, cellular distribution but structure of the N-terminal ubiquitin-like domain of FAT10 predicts also the stability of proteins by mediating their proteolysis by the two ubiquitin-like domains, both with a typical ␤-grasp fold. The N- 26S proteasome. The ubiquitin proteasome system (UPS) is not and C-terminal ubiquitin-like domains are 29% and 36% identical to only an important regulator of protein degradation but also reg- ubiquitin, respectively, arranged in a tandem array and separated ulates cancer-relevant processes such as cell cycle progression, by a short linker (Fan et al., 1996; Groettrup et al., 2008; Theng et al., proliferation, DNA damage response, angiogenesis and apoptosis 2014). In contrast to ubiquitin and other ubiquitin-like modifiers (Ciechanover, 1998; Haglund and Dikic, 2005). Moreover, inhibitors which are expressed as inactive precursors and which need to be of the proteasome are already in use or under further investiga- activated by proteolytic processing at their C-terminus by specific tion for the development of cancer therapies (Chen and Dou, 2010; proteases (Kerscher et al., 2006), FAT10 is already synthesized as a Tu et al., 2012). Ubiquitylation as well as poly-ubiquitylation is mature protein with a free diglycine motif at its C-terminus and can achieved by an enzymatic cascade where first ubiquitin is adeny- directly be activated and conjugated to substrate proteins (Raasi lated at its C-terminal diglycine residue by one of its two ubiquitin et al., 2001). A central function of FAT10 modification is to target E1 activating enzymes UBE1 (Ciechanover et al., 1981) or UBA6 (Jin proteins for degradation by the proteasome (Hipp et al., 2005; Raasi et al., 2007; Pelzer et al., 2007) and then transferred onto the active et al., 2001; Schmidtke et al., 2014). This process was shown to site-cysteine of the respective E1 enzyme to form a thioester bond. be independent of ubiquitylation but to be dependent on a non- In a second step, ubiquitin is transferred to the active site cysteine of covalent interaction partner of FAT10, namely NEDD8-ultimate a cognate ubiquitin conjugating enzyme (E2) by a transthiolation buster 1 long (NUB1L) (Hipp et al., 2005; Schmidtke et al., 2009, reaction. Finally, different classes of ubiquitin ligases (E3s) catal- 2006). NUB1L, a likewise interferon-inducible protein (Kito et al., yse the isopeptide linkage of ubiquitin to the ␧-amino-group of an 2001), acts as a soluble receptor and brings FAT10 and FAT10ylated internal lysine residue of a substrate protein (Finley, 2009; Kerscher proteins to the proteasome where it binds to the 19S regulatory et al., 2006). Ubiquitin itself contains 7 lysine residues (at positions subunits RPN10 (S5a) and RPN1 (S2). It was shown that FAT10 6, 11, 27, 29, 33, 48 and 63) which are used to build up chains itself could also directly bind to the VWA domain of RPN10 in the of different linkage types conveying different outcomes for such absence of NUB1L but that the docking of NUB1L to the proteasome modified proteins. Modification of a protein with a single ubiqui- was necessary for the accelerated degradation of FAT10 (Rani et al., tin is not enough
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Identification of the Binding Partners for Hspb2 and Cryab Reveals
    Brigham Young University BYU ScholarsArchive Theses and Dissertations 2013-12-12 Identification of the Binding arP tners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non- Redundant Roles for Small Heat Shock Proteins Kelsey Murphey Langston Brigham Young University - Provo Follow this and additional works at: https://scholarsarchive.byu.edu/etd Part of the Microbiology Commons BYU ScholarsArchive Citation Langston, Kelsey Murphey, "Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins" (2013). Theses and Dissertations. 3822. https://scholarsarchive.byu.edu/etd/3822 This Thesis is brought to you for free and open access by BYU ScholarsArchive. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston A thesis submitted to the faculty of Brigham Young University in partial fulfillment of the requirements for the degree of Master of Science Julianne H. Grose, Chair William R. McCleary Brian Poole Department of Microbiology and Molecular Biology Brigham Young University December 2013 Copyright © 2013 Kelsey Langston All Rights Reserved ABSTRACT Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactors and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston Department of Microbiology and Molecular Biology, BYU Master of Science Small Heat Shock Proteins (sHSP) are molecular chaperones that play protective roles in cell survival and have been shown to possess chaperone activity.
    [Show full text]
  • (Ubl-Ptms): Small Peptides with Huge Impact in Liver Fibrosis
    cells Review Ubiquitin-Like Post-Translational Modifications (Ubl-PTMs): Small Peptides with Huge Impact in Liver Fibrosis 1 1, 1, Sofia Lachiondo-Ortega , Maria Mercado-Gómez y, Marina Serrano-Maciá y , Fernando Lopitz-Otsoa 2, Tanya B Salas-Villalobos 3, Marta Varela-Rey 1, Teresa C. Delgado 1,* and María Luz Martínez-Chantar 1 1 Liver Disease Lab, CIC bioGUNE, Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd), 48160 Derio, Spain; [email protected] (S.L.-O.); [email protected] (M.M.-G.); [email protected] (M.S.-M.); [email protected] (M.V.-R.); [email protected] (M.L.M.-C.) 2 Liver Metabolism Lab, CIC bioGUNE, 48160 Derio, Spain; fl[email protected] 3 Department of Biochemistry and Molecular Medicine, School of Medicine, Autonomous University of Nuevo León, Monterrey, Nuevo León 66450, Mexico; [email protected] * Correspondence: [email protected]; Tel.: +34-944-061318; Fax: +34-944-061301 These authors contributed equally to this work. y Received: 6 November 2019; Accepted: 1 December 2019; Published: 4 December 2019 Abstract: Liver fibrosis is characterized by the excessive deposition of extracellular matrix proteins including collagen that occurs in most types of chronic liver disease. Even though our knowledge of the cellular and molecular mechanisms of liver fibrosis has deeply improved in the last years, therapeutic approaches for liver fibrosis remain limited. Profiling and characterization of the post-translational modifications (PTMs) of proteins, and more specifically NEDDylation and SUMOylation ubiquitin-like (Ubls) modifications, can provide a better understanding of the liver fibrosis pathology as well as novel and more effective therapeutic approaches.
    [Show full text]
  • Regulation of NUB1 Activity Through Non-Proteolytic Mdm2-Mediated Ubiquitination
    RESEARCH ARTICLE Regulation of NUB1 Activity through Non- Proteolytic Mdm2-Mediated Ubiquitination Thomas Bonacci, SteÂphane Audebert, Luc Camoin, Emilie Baudelet, Juan-Lucio Iovanna, Philippe Soubeyran* Centre de Recherche en CanceÂrologie de Marseille (CRCM), INSERM U1068, CNRS UMR 7258, Aix- Marseille Universite and Institut Paoli-Calmettes, Parc Scientifique et Technologique de Luminy, Marseille, France * [email protected] a1111111111 a1111111111 a1111111111 a1111111111 Abstract a1111111111 NUB1 (Nedd8 ultimate buster 1) is an adaptor protein which negatively regulates the ubiqui- tin-like protein Nedd8 as well as neddylated proteins levels through proteasomal degrada- tion. However, molecular mechanisms underlying this function are not completely understood. Here, we report that the oncogenic E3 ubiquitin ligase Mdm2 is a new NUB1 OPEN ACCESS interacting protein which induces its ubiquitination. Interestingly, we found that Mdm2-medi- Citation: Bonacci T, Audebert S, Camoin L, ated ubiquitination of NUB1 is not a proteolytic signal. Instead of promoting the conjugation Baudelet E, Iovanna J-L, Soubeyran P (2017) of polyubiquitin chains and the subsequent proteasomal degradation of NUB1, Mdm2 rather Regulation of NUB1 Activity through Non- Proteolytic Mdm2-Mediated Ubiquitination. PLoS induces its di-ubiquitination on lysine 159. Importantly, mutation of lysine 159 into arginine ONE 12(1): e0169988. doi:10.1371/journal. inhibits NUB1 activity by impairing its negative regulation of Nedd8 and of neddylated pro- pone.0169988 teins. We conclude that Mdm2 acts as a positive regulator of NUB1 function, by modulating Editor: Chunhong Yan, Augusta University, NUB1 ubiquitination on lysine 159. UNITED STATES Received: August 2, 2016 Accepted: December 27, 2016 Published: January 18, 2017 Introduction Copyright: © 2017 Bonacci et al.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • NUB1 Rabbit Pab
    Leader in Biomolecular Solutions for Life Science NUB1 Rabbit pAb Catalog No.: A18665 Basic Information Background Catalog No. This gene encodes a protein that functions as a negative regulator of NEDD8, a A18665 ubiquitin-like protein that conjugates with cullin family members in order to regulate vital biological events. The protein encoded by this gene regulates the NEDD8 Observed MW conjugation system post-transcriptionally by recruiting NEDD8 and its conjugates to the 71kDa proteasome for degradation. This protein interacts with the product of the AIPL1 gene, which is associated with Leber congenital amaurosis, an inherited retinopathy, and Calculated MW mutations in that gene can abolish interaction with this protein, which may contribute to 69kDa/70kDa the pathogenesis. This protein is also known to accumulate in Lewy bodies in Parkinson's disease and dementia with Lewy bodies, and in glial cytoplasmic inclusions Category in multiple system atrophy, with this abnormal accumulation being specific to alpha- synucleinopathy lesions. Alternative splicing of this gene results in multiple transcript Primary antibody variants. Applications WB, IF Cross-Reactivity Human, Mouse, Rat Recommended Dilutions Immunogen Information WB 1:500 - 1:2000 Gene ID Swiss Prot 51667 Q9Y5A7 IF 1:50 - 1:200 Immunogen Recombinant protein of human IFT140. Synonyms NUB1; BS4; NUB1L; NYREN18; NEDD8 ultimate buster 1 Contact Product Information 400-999-6126 Source Isotype Purification Rabbit IgG Affinity purification [email protected] www.abclonal.com.cn Storage Store at -20℃. Avoid freeze / thaw cycles. Buffer: PBS with 0.02% sodium azide,50% glycerol,pH7.3. Validation Data Western blot analysis of extracts of various cell lines, using NUB1 Rabbit pAb (A18665) at 1:1000 dilution.
    [Show full text]
  • Strand Breaks for P53 Exon 6 and 8 Among Different Time Course of Folate Depletion Or Repletion in the Rectosigmoid Mucosa
    SUPPLEMENTAL FIGURE COLON p53 EXONIC STRAND BREAKS DURING FOLATE DEPLETION-REPLETION INTERVENTION Supplemental Figure Legend Strand breaks for p53 exon 6 and 8 among different time course of folate depletion or repletion in the rectosigmoid mucosa. The input of DNA was controlled by GAPDH. The data is shown as ΔCt after normalized to GAPDH. The higher ΔCt the more strand breaks. The P value is shown in the figure. SUPPLEMENT S1 Genes that were significantly UPREGULATED after folate intervention (by unadjusted paired t-test), list is sorted by P value Gene Symbol Nucleotide P VALUE Description OLFM4 NM_006418 0.0000 Homo sapiens differentially expressed in hematopoietic lineages (GW112) mRNA. FMR1NB NM_152578 0.0000 Homo sapiens hypothetical protein FLJ25736 (FLJ25736) mRNA. IFI6 NM_002038 0.0001 Homo sapiens interferon alpha-inducible protein (clone IFI-6-16) (G1P3) transcript variant 1 mRNA. Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15 GALNTL5 NM_145292 0.0001 (GALNT15) mRNA. STIM2 NM_020860 0.0001 Homo sapiens stromal interaction molecule 2 (STIM2) mRNA. ZNF645 NM_152577 0.0002 Homo sapiens hypothetical protein FLJ25735 (FLJ25735) mRNA. ATP12A NM_001676 0.0002 Homo sapiens ATPase H+/K+ transporting nongastric alpha polypeptide (ATP12A) mRNA. U1SNRNPBP NM_007020 0.0003 Homo sapiens U1-snRNP binding protein homolog (U1SNRNPBP) transcript variant 1 mRNA. RNF125 NM_017831 0.0004 Homo sapiens ring finger protein 125 (RNF125) mRNA. FMNL1 NM_005892 0.0004 Homo sapiens formin-like (FMNL) mRNA. ISG15 NM_005101 0.0005 Homo sapiens interferon alpha-inducible protein (clone IFI-15K) (G1P2) mRNA. SLC6A14 NM_007231 0.0005 Homo sapiens solute carrier family 6 (neurotransmitter transporter) member 14 (SLC6A14) mRNA.
    [Show full text]
  • 1 Negative Regulator of Ubiquitin-Like Protein 1 Modulates the Autophagy-Lysosomal Pathway Via P62 to Facilitate the Extracellul
    Title Negative Regulator of Ubiquitin-Like Protein 1 modulates the autophagy-lysosomal pathway via p62 to facilitate the extracellular release of tau following proteasome impairment Rosellina Guarascio1, Dervis Salih2, Marina Yasvoina2, Frances A. Edwards2, Michael E. Cheetham1, Jacqueline van der Spuy1* 1UCL Institute of Ophthalmology, 11 – 43 Bath Street, London EC1V 9EL 2UCL Department of Neuroscience, Physiology, Pharmacology, Gower Street, London WC1E 6BT *UCL Institute of ophthalmology, 11 – 43 Bath Street, London EC1V 9EL, +44 (0)20 7608 4066, [email protected] 1 Abstract Negative Regulator of Ubiquitin-Like Protein 1 (NUB1) and its longer isoform NUB1L are ubiquitin-like (UBL)/ ubiquitin-associated (UBA) proteins that facilitate the targeting of proteasomal substrates, including tau, synphilin-1 and huntingtin. Previous data revealed that NUB1 also mediated a reduction in tau phosphorylation and aggregation following proteasome inhibition, suggesting a switch in NUB1 function from targeted proteasomal degradation to a role in autophagy. Here, we delineate the mechanisms of this switch and show that NUB1 interacted specifically with p62 and induced an increase in p62 levels in a manner facilitated by inhibition of the proteasome. NUB1 moreover increased autophagosomes and the recruitment of lysosomes to aggresomes following proteasome inhibition. Autophagy flux assays revealed that NUB1 affected the autophagy-lysosomal pathway primarily via the UBA domain. NUB1 localized to cytosolic inclusions with pathological forms of tau, as well as LAMP1 and p62 in the hippocampal neurons of tauopathy mice. Finally, NUB1 facilitated the extracellular release of tau following proteasome inhibition. This study thus shows that NUB1 plays a role in regulating the autophagy-lysosomal pathway when the ubiquitin proteasome system is compromised, thus contributing to the mechanisms targeting the removal of aggregation-prone proteins upon proteasomal impairment.
    [Show full text]
  • Ubiquitin Modifications
    npg Cell Research (2016) 26:399-422. REVIEW www.nature.com/cr Ubiquitin modifications Kirby N Swatek1, David Komander1 1Medical Research Council Laboratory of Molecular Biology, Francis Crick Avenue, Cambridge, CB2 0QH, UK Protein ubiquitination is a dynamic multifaceted post-translational modification involved in nearly all aspects of eukaryotic biology. Once attached to a substrate, the 76-amino acid protein ubiquitin is subjected to further modi- fications, creating a multitude of distinct signals with distinct cellular outcomes, referred to as the ‘ubiquitin code’. Ubiquitin can be ubiquitinated on seven lysine (Lys) residues or on the N-terminus, leading to polyubiquitin chains that can encompass complex topologies. Alternatively or in addition, ubiquitin Lys residues can be modified by ubiq- uitin-like molecules (such as SUMO or NEDD8). Finally, ubiquitin can also be acetylated on Lys, or phosphorylated on Ser, Thr or Tyr residues, and each modification has the potential to dramatically alter the signaling outcome. While the number of distinctly modified ubiquitin species in cells is mind-boggling, much progress has been made to characterize the roles of distinct ubiquitin modifications, and many enzymes and receptors have been identified that create, recognize or remove these ubiquitin modifications. We here provide an overview of the various ubiquitin modifications present in cells, and highlight recent progress on ubiquitin chain biology. We then discuss the recent findings in the field of ubiquitin acetylation and phosphorylation, with a focus on Ser65-phosphorylation and its role in mitophagy and Parkin activation. Keywords: ubiquitin; proteasomal degradation; phosphorylation; post-translational modification; Parkin Cell Research (2016) 26:399-422.
    [Show full text]
  • Regulation of NUB1 Activity Through Non- Proteolytic Mdm2-Mediated Ubiquitination
    Regulation of NUB1 Activity through Non- Proteolytic Mdm2-Mediated Ubiquitination Thomas Bonacci, Stéphane Audebert, Luc Camoin, Emilie Baudelet, Juan-Lucio Iovanna, Philippe Soubeyran To cite this version: Thomas Bonacci, Stéphane Audebert, Luc Camoin, Emilie Baudelet, Juan-Lucio Iovanna, et al.. Regulation of NUB1 Activity through Non- Proteolytic Mdm2-Mediated Ubiquitination. PLoS ONE, Public Library of Science, 2017. hal-01787875 HAL Id: hal-01787875 https://hal.archives-ouvertes.fr/hal-01787875 Submitted on 7 May 2018 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. RESEARCH ARTICLE Regulation of NUB1 Activity through Non- Proteolytic Mdm2-Mediated Ubiquitination Thomas Bonacci, SteÂphane Audebert, Luc Camoin, Emilie Baudelet, Juan-Lucio Iovanna, Philippe Soubeyran* Centre de Recherche en CanceÂrologie de Marseille (CRCM), INSERM U1068, CNRS UMR 7258, Aix- Marseille Universite and Institut Paoli-Calmettes, Parc Scientifique et Technologique de Luminy, Marseille, France * [email protected] a1111111111 a1111111111 a1111111111 a1111111111 Abstract a1111111111 NUB1 (Nedd8 ultimate buster 1) is an adaptor protein which negatively regulates the ubiqui- tin-like protein Nedd8 as well as neddylated proteins levels through proteasomal degrada- tion. However, molecular mechanisms underlying this function are not completely understood. Here, we report that the oncogenic E3 ubiquitin ligase Mdm2 is a new NUB1 OPEN ACCESS interacting protein which induces its ubiquitination.
    [Show full text]
  • The Linear Ubiquitin Assembly Complex (LUBAC) Is Essential for NLRP3 Inflammasome Activation
    Article The linear ubiquitin assembly complex (LUBAC) is essential for NLRP3 inflammasome activation Mary A. Rodgers,1 James W. Bowman,1 Hiroaki Fujita,2 Nicole Orazio,1 Mude Shi,1 Qiming Liang,1 Rina Amatya,1 Thomas J. Kelly,1 Kazuhiro Iwai,2 Jenny Ting,3 and Jae U. Jung1 1Department of Molecular Microbiology and Immunology, Keck School of Medicine, University of Southern California, Los Angeles, CA 90033 2Department of Molecular and Cellular Physiology, Graduate School of Medicine, Kyoto University, Sakyo-ku, Kyoto 606-8501, Japan 3Department of Microbiology-Immunology, Lineberger Comprehensive Cancer Center, Center for Translational Immunology and Institute for Inflammatory Diseases, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599 Linear ubiquitination is a newly discovered posttranslational modification that is currently restricted to a small number of known protein substrates. The linear ubiquitination assem- bly complex (LUBAC), consisting of HOIL-1L, HOIP, and Sharpin, has been reported to activate NF-B–mediated transcription in response to receptor signaling by ligating linear ubiquitin chains to Nemo and Rip1. Despite recent advances, the detailed roles of LUBAC in immune cells remain elusive. We demonstrate a novel HOIL-1L function as an essential regulator of the activation of the NLRP3/ASC inflammasome in primary bone marrow– derived macrophages (BMDMs) independently of NF-B activation. Mechanistically, HOIL- 1L is required for assembly of the NLRP3/ASC inflammasome and the linear ubiquitination of ASC, which we identify as a novel LUBAC substrate. Consequently, we find that HOIL- 1L/ mice have reduced IL-1 secretion in response to in vivo NLRP3 stimulation and survive lethal challenge with LPS.
    [Show full text]
  • Human Social Genomics in the Multi-Ethnic Study of Atherosclerosis
    Getting “Under the Skin”: Human Social Genomics in the Multi-Ethnic Study of Atherosclerosis by Kristen Monét Brown A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Epidemiological Science) in the University of Michigan 2017 Doctoral Committee: Professor Ana V. Diez-Roux, Co-Chair, Drexel University Professor Sharon R. Kardia, Co-Chair Professor Bhramar Mukherjee Assistant Professor Belinda Needham Assistant Professor Jennifer A. Smith © Kristen Monét Brown, 2017 [email protected] ORCID iD: 0000-0002-9955-0568 Dedication I dedicate this dissertation to my grandmother, Gertrude Delores Hampton. Nanny, no one wanted to see me become “Dr. Brown” more than you. I know that you are standing over the bannister of heaven smiling and beaming with pride. I love you more than my words could ever fully express. ii Acknowledgements First, I give honor to God, who is the head of my life. Truly, without Him, none of this would be possible. Countless times throughout this doctoral journey I have relied my favorite scripture, “And we know that all things work together for good, to them that love God, to them who are called according to His purpose (Romans 8:28).” Secondly, I acknowledge my parents, James and Marilyn Brown. From an early age, you two instilled in me the value of education and have been my biggest cheerleaders throughout my entire life. I thank you for your unconditional love, encouragement, sacrifices, and support. I would not be here today without you. I truly thank God that out of the all of the people in the world that He could have chosen to be my parents, that He chose the two of you.
    [Show full text]