Supporting Information

Total Page:16

File Type:pdf, Size:1020Kb

Supporting Information Supporting Information Bermejo-Alvarez et al. 10.1073/pnas.0913843107 SI Material and Methods lysis buffer was extracted with phenol/chloroform treatment and In Vitro Embryo Production. Selected cumulus–oocyte complexes finally suspended in 16 μL of milliQ water. Eight microliters of each (COCs) obtained from ovaries collected at slaughter were ma- sample were used to perform embryo sexing by PCR as described in tured for 24 h in TCM-199, supplemented with 10% (vol/vol) FCS ref. 1. After embryo sexing, the individually stored poly(A) RNA (FCS) and 10 ng/mL epidermal growth factor at 39 °C under an from 10 (in vitro) or 5 (in vivo) embryos of the same sex or par- atmosphere of 5% CO2 in air with maximum humidity. In vitro thenotes were pooled and RNA extraction continued. Immediately fertilization was performed with X- or Y-sorted sperm from three after extraction, the RT reaction was carried out following the different bulls or unsorted semen from one of the bulls (Bull 1) as manufacturer's instructions (Bioline, Ecogen) using poly(T) primer, described in ref. 1. Matured COCs were inseminated with 12.5 μL random primers, and MMLV reverse transcriptase enzyme in a of frozen-thawed, percoll-separated sperm added to 25-μL total volume of 40 μL to prime the RT reaction and to produce droplets under mineral oil (15–20 oocytes per droplet) at a final cDNA. Tubes were heated to 70 °C for 5 min to denature the sec- concentration of 1 × 106 spermatozoa/mL. Gametes were co- ondary RNA structure and then the RT mix was completed with the incubated at 39 °C under an atmosphere of 5% CO2 in air with addition of 100 units of reverse transcriptase. They were then in- maximum humidity. At ≈20 h postinsemination, presumptive zy- cubated at 42 °C for 60 min to allow the reverse transcription of gotes were denuded and transferred to 25-μL culture droplets (1 RNA, followed by 70 °C for 10 min to denature the RT enzyme. embryo per microliter) under mineral oil. Blastocysts were pro- The quantification of all mRNA transcripts was carried out by duced in 12 independent experiments (equals days of ovary col- real-time qRT-PCR; five groups of cDNA per experimental lection). In all cases, X- and Y-sperm from an individual bull were group, each obtained from 10 embryos, were used with two used on the same day and were never split across days. Depending repetitions for all genes of interest. PCR was performed by adding on the availability of oocytes, one, two, or all three bulls were a2-μL aliquot of each sample to the PCR mix containing the processed on a given day. Details for developmental rates and specific primers to amplify histone H2Az (H2a.z), brain-ex- sexing accuracy of the bulls used in this study can be found in ref. pressed X-linked 1 (BEX1), calpain 6 (CAPN6), GST Mu3 2. Parthenogenetic activation was achieved by incubation of ma- (GSTM3), fragile-X mental retardation 1 neighbor (FMR1NB), ture oocytes in 5 μM ionomycin for 5 min followed by 3 h in- spermidine/spermine N1-acethyltransferase 1 (SAT1), brain-ex- cubation in 2 mM 6-DMAP. Embryo culture took place in SOF + pressed X-linked 2 (BEX2), sushi-repeat-containing protein X- 5% FCS. Plates were incubated for 7 days at 39 °C under an at- linked 2 (SRPX2), progesterone receptor membrane component mosphere of 5% CO2, 90% N2, and 5% O2 with maximum hu- 1 (PGRMC1), ubiquitin-conjugating enzyme E2A (UBE2A), midity. Day-7 blastocysts produced from X- and Y-sorted sperm DEAD box polypeptide 3 Y-linked (DDX3Y), eukaryotic were snap-frozen in groups for microarray analysis and those translation initiation factor 2, subunit 3, structural gene Y-linked produced with unsorted sperm and parthenogenetic activation (EIF2S3Y), laminin alpha 1 (LAMA1), DNA-methyltransferase had their zona pellucida removed with 0.2% pronase and were 3 alpha (DNMT3A), and three nonannotated transcripts present then individually snap-frozen for array validation. Oocytes and in the array and named X24112, YZRSR2 and Y2467. Primer embryos collected at different stages were snap-frozen in groups sequences and the approximate sizes of the amplified fragments of 10 to analyze the evolution of transcription during pre- of all transcripts are shown in Table S6. For quantification, real- implantation stages of different genes presented in the array. time PCR was performed as previously described (3). qPCR conditions were 94 °C for 3 min followed by 35 cycles (94 °C 10 s, In Vivo Embryo Production. In vivo bovine blastocysts were produced 56 °C 30 s, 72 °C 10 s, and 10 s of fluorescence acquisition – using standard superovulation protocol. Briefly, the estrous cycles SYBR-) (Rotor Gene 6000, Corbett Research). Each pair of of crossbred beef heifers were synchronized using a combination of primers were tested to achieve efficiencies close to 1 and then an intravaginal progesterone device (CIDR) and administration of the comparative cycle threshold (CT) method was used to a prostaglandin F2α analog to ensure luteolysis. Beginning on day quantify expression levels as described (4). To avoid primer- 10 of the synchronized cycle, each animal received twice daily in- dimmers artifacts, fluorescence was acquired in each cycle at a jections of Folltropin (Bioniche Animal Health) for 4 days, with temperature higher than the melting temperature of primer- prostaglandin given with the sixth injection. Animals were in- dimmers (specific for each product, 80–86 °C). Then, the seminated at estrus and embryos were recovered by flushing the threshold cycle or the cycle during the log-linear phase of the reproductive tract at slaughter. Blastocysts were snap-frozen in- reaction at which fluorescence increased above background was dividually in liquid nitrogen for subsequent analysis.All ex- determined for each sample. When the efficiency is close to 1, perimental procedures involving animals were licensed by the within this region of the amplification curve, a difference of one Department of Health and Children, Ireland, in accordance with cycle is equivalent to doubling of the amplified PCR product. the Cruelty to Animals Act (Ireland 1897) and the European According to the comparative CT method, the ΔCT value was Community Directive 86/609/EC and were sanctioned by the determined by subtracting the endogenous control (H2a.z) CT Animal Research Ethics Committee of University College Dublin. value for each sample from each gene CT value of the sample. Calculation of ΔΔCT involved using the highest sample ΔCT Independent Verification of Array Data Using Rea-lTime RT-PCR. Poly value (i.e., the sample with the lowest target expression) as a (A)RNAwasextractedfromindividualblastocystsproducedinvitro constant to subtract from all other ΔCT sample values. Fold- with unsorted semen or by parthenogenetic activation or derived in changes in the relative gene expression of the target were de- vivo following the manufacturer’s instructions, using the Dynabeads termined using the equation 2–ΔΔCT. mRNA Direct Extraction KIT (Dynal Biotech) with minor mod- ifications. After 5 min incubation in lysis buffer with Dynabeads, Expression Analysis on Preimplantation Stages and Tissues. RNA poly(A) RNA attached to the Dynabeads was extracted with a extraction and DNA synthesis of denuded oocytes and pre- magnet, suspended in washing buffer A and stored at 4 °C while implantation embryos was performed as described above. Male and DNA extraction and sexing was performed. The DNA present in femaleadulttissues(brain,medulla,testes,spleen,kidney,lung,and Bermejo-Alvarez et al. www.pnas.org/cgi/content/short/0913843107 1of7 muscle) were collected from a local slaughterhouse and imme- by DNase treatment following the protocol described in ref. 4 with diately snap-frozen in liquid nitrogen. RNA extraction was per- minor modifications. PCR was performed and products were vi- formedwithULTRASPEC(Ecogen)avoidingDNAcontamination sualized in 2% ethidium bromide stained gels under UV light. 1. Bermejo-Alvarez P, Rizos D, Rath D, Lonergan P, Gutierrez-Adan A (2008) Can bovine in 3. Bermejo-Alvarez P, Rizos D, Rath D, Lonergan P, Gutierrez-Adan A (2008) Epigenetic vitro-matured oocytes selectively process X- or Y-sorted sperm differentially? Biol differences between male and female bovine blastocysts produced in vitro. Physiol – Reprod 79:594 597. Genomics 32:264–272. 2. Bermejo-Alvarez P, Lonergan P, Rath D, Gutierrez-Adan A, Rizos D (2010) 4. Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative C(T) Developmental kinetics and gene expression in male and female bovine embryos method. Nat Protoc 3:1101–1108. produced in vitro with sex-sorted spermatozoa. Reprod Fertil Dev 22:426–436 . A B C D F M Fig. S1. Analysis of microarray data for male and female bovine blastocysts between the three individual bulls. Venn diagrams showing the number of transcripts common or specific to each bull comparison using three statistical corrections: (A) False-discovery rate (FDR) at P < 0.05; (B) FDR at P < 0.01; and (C) Bonferroni at P < 0.05. (D) Principal component analysis mapping of the 18 analyzed samples showing the aggregation of the samples according to the sex and to the bull. Bermejo-Alvarez et al. www.pnas.org/cgi/content/short/0913843107 2of7 Fig. S2. Chromosome distribution of the expressed X-linked transcripts. The position along the X-chromosome is shown on a Megabase vertical scale. For rep- resentation, the chromosome was divided into 30 3-Mb length sections and a scatter chart on the right shows the percentage of X-linked transcripts up-regulated in females located on each section compared with the total X-linked transcripts up-regulated in females with known location. The location of the genes analyzed for putative imprinting plus XIST are noted by red arrows (Right); gene names in bold letters are preferentially or totally paternally expressed.
Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • (Ubl-Ptms): Small Peptides with Huge Impact in Liver Fibrosis
    cells Review Ubiquitin-Like Post-Translational Modifications (Ubl-PTMs): Small Peptides with Huge Impact in Liver Fibrosis 1 1, 1, Sofia Lachiondo-Ortega , Maria Mercado-Gómez y, Marina Serrano-Maciá y , Fernando Lopitz-Otsoa 2, Tanya B Salas-Villalobos 3, Marta Varela-Rey 1, Teresa C. Delgado 1,* and María Luz Martínez-Chantar 1 1 Liver Disease Lab, CIC bioGUNE, Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd), 48160 Derio, Spain; [email protected] (S.L.-O.); [email protected] (M.M.-G.); [email protected] (M.S.-M.); [email protected] (M.V.-R.); [email protected] (M.L.M.-C.) 2 Liver Metabolism Lab, CIC bioGUNE, 48160 Derio, Spain; fl[email protected] 3 Department of Biochemistry and Molecular Medicine, School of Medicine, Autonomous University of Nuevo León, Monterrey, Nuevo León 66450, Mexico; [email protected] * Correspondence: [email protected]; Tel.: +34-944-061318; Fax: +34-944-061301 These authors contributed equally to this work. y Received: 6 November 2019; Accepted: 1 December 2019; Published: 4 December 2019 Abstract: Liver fibrosis is characterized by the excessive deposition of extracellular matrix proteins including collagen that occurs in most types of chronic liver disease. Even though our knowledge of the cellular and molecular mechanisms of liver fibrosis has deeply improved in the last years, therapeutic approaches for liver fibrosis remain limited. Profiling and characterization of the post-translational modifications (PTMs) of proteins, and more specifically NEDDylation and SUMOylation ubiquitin-like (Ubls) modifications, can provide a better understanding of the liver fibrosis pathology as well as novel and more effective therapeutic approaches.
    [Show full text]
  • Transcriptome Sequencing and Genome-Wide Association Analyses Reveal Lysosomal Function and Actin Cytoskeleton Remodeling in Schizophrenia and Bipolar Disorder
    Molecular Psychiatry (2015) 20, 563–572 © 2015 Macmillan Publishers Limited All rights reserved 1359-4184/15 www.nature.com/mp ORIGINAL ARTICLE Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder Z Zhao1,6,JXu2,6, J Chen3,6, S Kim4, M Reimers3, S-A Bacanu3,HYu1, C Liu5, J Sun1, Q Wang1, P Jia1,FXu2, Y Zhang2, KS Kendler3, Z Peng2 and X Chen3 Schizophrenia (SCZ) and bipolar disorder (BPD) are severe mental disorders with high heritability. Clinicians have long noticed the similarities of clinic symptoms between these disorders. In recent years, accumulating evidence indicates some shared genetic liabilities. However, what is shared remains elusive. In this study, we conducted whole transcriptome analysis of post-mortem brain tissues (cingulate cortex) from SCZ, BPD and control subjects, and identified differentially expressed genes in these disorders. We found 105 and 153 genes differentially expressed in SCZ and BPD, respectively. By comparing the t-test scores, we found that many of the genes differentially expressed in SCZ and BPD are concordant in their expression level (q ⩽ 0.01, 53 genes; q ⩽ 0.05, 213 genes; q ⩽ 0.1, 885 genes). Using genome-wide association data from the Psychiatric Genomics Consortium, we found that these differentially and concordantly expressed genes were enriched in association signals for both SCZ (Po10 − 7) and BPD (P = 0.029). To our knowledge, this is the first time that a substantially large number of genes show concordant expression and association for both SCZ and BPD. Pathway analyses of these genes indicated that they are involved in the lysosome, Fc gamma receptor-mediated phagocytosis, regulation of actin cytoskeleton pathways, along with several cancer pathways.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • WNT16 Is a New Marker of Senescence
    Table S1. A. Complete list of 177 genes overexpressed in replicative senescence Value Gene Description UniGene RefSeq 2.440 WNT16 wingless-type MMTV integration site family, member 16 (WNT16), transcript variant 2, mRNA. Hs.272375 NM_016087 2.355 MMP10 matrix metallopeptidase 10 (stromelysin 2) (MMP10), mRNA. Hs.2258 NM_002425 2.344 MMP3 matrix metallopeptidase 3 (stromelysin 1, progelatinase) (MMP3), mRNA. Hs.375129 NM_002422 2.300 HIST1H2AC Histone cluster 1, H2ac Hs.484950 2.134 CLDN1 claudin 1 (CLDN1), mRNA. Hs.439060 NM_021101 2.119 TSPAN13 tetraspanin 13 (TSPAN13), mRNA. Hs.364544 NM_014399 2.112 HIST2H2BE histone cluster 2, H2be (HIST2H2BE), mRNA. Hs.2178 NM_003528 2.070 HIST2H2BE histone cluster 2, H2be (HIST2H2BE), mRNA. Hs.2178 NM_003528 2.026 DCBLD2 discoidin, CUB and LCCL domain containing 2 (DCBLD2), mRNA. Hs.203691 NM_080927 2.007 SERPINB2 serpin peptidase inhibitor, clade B (ovalbumin), member 2 (SERPINB2), mRNA. Hs.594481 NM_002575 2.004 HIST2H2BE histone cluster 2, H2be (HIST2H2BE), mRNA. Hs.2178 NM_003528 1.989 OBFC2A Oligonucleotide/oligosaccharide-binding fold containing 2A Hs.591610 1.962 HIST2H2BE histone cluster 2, H2be (HIST2H2BE), mRNA. Hs.2178 NM_003528 1.947 PLCB4 phospholipase C, beta 4 (PLCB4), transcript variant 2, mRNA. Hs.472101 NM_182797 1.934 PLCB4 phospholipase C, beta 4 (PLCB4), transcript variant 1, mRNA. Hs.472101 NM_000933 1.933 KRTAP1-5 keratin associated protein 1-5 (KRTAP1-5), mRNA. Hs.534499 NM_031957 1.894 HIST2H2BE histone cluster 2, H2be (HIST2H2BE), mRNA. Hs.2178 NM_003528 1.884 CYTL1 cytokine-like 1 (CYTL1), mRNA. Hs.13872 NM_018659 tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain (TNFRSF10D), 1.848 TNFRSF10D Hs.213467 NM_003840 mRNA.
    [Show full text]
  • BUB3 Antibody
    Efficient Professional Protein and Antibody Platforms BUB3 Antibody Basic information: Catalog No.: UPA63666 Source: Rabbit Size: 50ul/100ul Clonality: Monoclonal Concentration: 1mg/ml Isotype: Rabbit IgG Purification: Protein A affinity purified Useful Information: WB:1:500-1:2000 ICC:1:50-1:200 Applications: IHC:1:50-1:200 IP:1:10-1:50 FC:1:50-1:100 Reactivity: Human, Mouse, Rat Specificity: This antibody recognizes BUB3 protein. Immunogen: Recombinant protein corresponding to the N-terminus of human Bub3. BUB3 (budding uninhibited by benzimidazoles 3 homolog), also known as BUB3L or hBUB3, is a conserved component of the mitotic spindle assembly complex (MCC). It contains five WD repeat domains and forms cell cycle constitutive complexes with BUB1 and BUBR1. BUB3 is essential for the ki- netochore localization of BUB1 and BUBR1. As a component of the MCC, BUB3 is involved in the essential spindle checkpoint pathway that operates Description: during early embryogenesis. The spindle checkpoint pathway functions to postpone the initiation of anaphase until chromosomes are properly at- tached to the spindle. This acts to ensure accurate chromosome segrega- tion. In addition, BUB3 plays a role in regulating the establishment of cor- rect kinetochore-microtubule attachments. BUB3 is also thought to bind Tctex1L (or DYNLT3), a dynein light chain. Uniprot: O43684(Human) Q9WVA3(Mouse) BiowMW: 37 kDa Buffer: 1*TBS (pH7.4), 1%BSA, 40%Glycerol. Preservative: 0.05% Sodium Azide. Storage: Store at 4°C short term and -20°C long term. Avoid freeze-thaw cycles. Note: For research use only, not for use in diagnostic procedure. Data: Gene Universal Technology Co.
    [Show full text]
  • Strand Breaks for P53 Exon 6 and 8 Among Different Time Course of Folate Depletion Or Repletion in the Rectosigmoid Mucosa
    SUPPLEMENTAL FIGURE COLON p53 EXONIC STRAND BREAKS DURING FOLATE DEPLETION-REPLETION INTERVENTION Supplemental Figure Legend Strand breaks for p53 exon 6 and 8 among different time course of folate depletion or repletion in the rectosigmoid mucosa. The input of DNA was controlled by GAPDH. The data is shown as ΔCt after normalized to GAPDH. The higher ΔCt the more strand breaks. The P value is shown in the figure. SUPPLEMENT S1 Genes that were significantly UPREGULATED after folate intervention (by unadjusted paired t-test), list is sorted by P value Gene Symbol Nucleotide P VALUE Description OLFM4 NM_006418 0.0000 Homo sapiens differentially expressed in hematopoietic lineages (GW112) mRNA. FMR1NB NM_152578 0.0000 Homo sapiens hypothetical protein FLJ25736 (FLJ25736) mRNA. IFI6 NM_002038 0.0001 Homo sapiens interferon alpha-inducible protein (clone IFI-6-16) (G1P3) transcript variant 1 mRNA. Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15 GALNTL5 NM_145292 0.0001 (GALNT15) mRNA. STIM2 NM_020860 0.0001 Homo sapiens stromal interaction molecule 2 (STIM2) mRNA. ZNF645 NM_152577 0.0002 Homo sapiens hypothetical protein FLJ25735 (FLJ25735) mRNA. ATP12A NM_001676 0.0002 Homo sapiens ATPase H+/K+ transporting nongastric alpha polypeptide (ATP12A) mRNA. U1SNRNPBP NM_007020 0.0003 Homo sapiens U1-snRNP binding protein homolog (U1SNRNPBP) transcript variant 1 mRNA. RNF125 NM_017831 0.0004 Homo sapiens ring finger protein 125 (RNF125) mRNA. FMNL1 NM_005892 0.0004 Homo sapiens formin-like (FMNL) mRNA. ISG15 NM_005101 0.0005 Homo sapiens interferon alpha-inducible protein (clone IFI-15K) (G1P2) mRNA. SLC6A14 NM_007231 0.0005 Homo sapiens solute carrier family 6 (neurotransmitter transporter) member 14 (SLC6A14) mRNA.
    [Show full text]
  • Ubiquitin Modifications
    npg Cell Research (2016) 26:399-422. REVIEW www.nature.com/cr Ubiquitin modifications Kirby N Swatek1, David Komander1 1Medical Research Council Laboratory of Molecular Biology, Francis Crick Avenue, Cambridge, CB2 0QH, UK Protein ubiquitination is a dynamic multifaceted post-translational modification involved in nearly all aspects of eukaryotic biology. Once attached to a substrate, the 76-amino acid protein ubiquitin is subjected to further modi- fications, creating a multitude of distinct signals with distinct cellular outcomes, referred to as the ‘ubiquitin code’. Ubiquitin can be ubiquitinated on seven lysine (Lys) residues or on the N-terminus, leading to polyubiquitin chains that can encompass complex topologies. Alternatively or in addition, ubiquitin Lys residues can be modified by ubiq- uitin-like molecules (such as SUMO or NEDD8). Finally, ubiquitin can also be acetylated on Lys, or phosphorylated on Ser, Thr or Tyr residues, and each modification has the potential to dramatically alter the signaling outcome. While the number of distinctly modified ubiquitin species in cells is mind-boggling, much progress has been made to characterize the roles of distinct ubiquitin modifications, and many enzymes and receptors have been identified that create, recognize or remove these ubiquitin modifications. We here provide an overview of the various ubiquitin modifications present in cells, and highlight recent progress on ubiquitin chain biology. We then discuss the recent findings in the field of ubiquitin acetylation and phosphorylation, with a focus on Ser65-phosphorylation and its role in mitophagy and Parkin activation. Keywords: ubiquitin; proteasomal degradation; phosphorylation; post-translational modification; Parkin Cell Research (2016) 26:399-422.
    [Show full text]
  • Team Publications UMR3244 – Dynamics of Genetic Information
    Team Publications UMR3244 – Dynamics of Genetic Information Year of publication 2021 Ana Martins Figueiredo, Pedro Barbacena, Ana Russo, Silvia Vaccaro, Daniela Ramalho, Andreia Pena, Aida Pires Lima, Rita Rua Ferreira, Marta Alves Fidalgo, Fatima El-Marjou, Yulia Carvalho, Francisca Ferreira Vasconcelos, Ana-Maria Lennon-Duménil, Danijela Matic Vignjevic, Claudio Areias Franco (2021 Apr 27) Endothelial cell invasion is controlled by dactylopodia. Proceedings of the National Academy of Sciences of the United States of America : DOI : e2023829118 Summary Sprouting angiogenesis is fundamental for development and contributes to cancer, diabetic retinopathy, and cardiovascular diseases. Sprouting angiogenesis depends on the invasive properties of endothelial tip cells. However, there is very limited knowledge on how tip cells invade into tissues. Here, we show that endothelial tip cells use dactylopodia as the main cellular protrusion for invasion into nonvascular extracellular matrix. We show that dactylopodia and filopodia protrusions are balanced by myosin IIA (NMIIA) and actin-related protein 2/3 (Arp2/3) activity. Endothelial cell-autonomous ablation of NMIIA promotes excessive dactylopodia formation in detriment of filopodia. Conversely, endothelial cell- autonomous ablation of Arp2/3 prevents dactylopodia development and leads to excessive filopodia formation. We further show that NMIIA inhibits Rac1-dependent activation of Arp2/3 by regulating the maturation state of focal adhesions. Our discoveries establish a comprehensive model of how endothelial tip cells regulate its protrusive activity and will pave the way toward strategies to block invasive tip cells during sprouting angiogenesis. Shanna L Bowman, Linh Le, Yueyao Zhu, Dawn C Harper, Anand Sitaram, Alexander C Theos, Elena V Sviderskaya, Dorothy C Bennett, Graça Raposo-Benedetti, David J Owen, Megan K Dennis, Michael S Marks (2021 Apr 22) A BLOC-1-AP-3 super-complex sorts a cis-SNARE complex into endosome-derived tubular transport carriers.
    [Show full text]
  • 1 Fibrillar Αβ Triggers Microglial Proteome Alterations and Dysfunction in Alzheimer Mouse 1 Models 2 3 4 Laura Sebastian
    bioRxiv preprint doi: https://doi.org/10.1101/861146; this version posted December 2, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Fibrillar triggers microglial proteome alterations and dysfunction in Alzheimer mouse 2 models 3 4 5 Laura Sebastian Monasor1,10*, Stephan A. Müller1*, Alessio Colombo1, Jasmin König1,2, Stefan 6 Roth3, Arthur Liesz3,4, Anna Berghofer5, Takashi Saito6,7, Takaomi C. Saido6, Jochen Herms1,4,8, 7 Michael Willem9, Christian Haass1,4,9, Stefan F. Lichtenthaler 1,4,5# & Sabina Tahirovic1# 8 9 1 German Center for Neurodegenerative Diseases (DZNE) Munich, 81377 Munich, Germany 10 2 Faculty of Chemistry, Technical University of Munich, Garching, Germany 11 3 Institute for Stroke and Dementia Research (ISD), Ludwig-Maximilians Universität München, 12 81377 Munich, Germany 13 4 Munich Cluster for Systems Neurology (SyNergy), Munich, Germany 14 5 Neuroproteomics, School of Medicine, Klinikum Rechts der Isar, Technical University of Munich, 15 Munich, Germany 16 6 Laboratory for Proteolytic Neuroscience, RIKEN Center for Brain Science Institute, Wako, 17 Saitama 351-0198, Japan 18 7 Department of Neurocognitive Science, Nagoya City University Graduate School of Medical 19 Science, Nagoya, Aichi 467-8601, Japan 20 8 Center for Neuropathology and Prion Research, Ludwig-Maximilians-Universität München, 81377 21 Munich, Germany 22 9 Biomedical Center (BMC), Ludwig-Maximilians Universität München, 81377 Munich, Germany 23 10 Graduate School of Systemic Neuroscience, Ludwig-Maximilians-University Munich, Munich, 24 Germany. 25 *Contributed equally 26 #Correspondence: [email protected] and [email protected] 27 28 Running title: 29 Microglial proteomic signatures of AD 30 Keywords: Alzheimer’s disease / microglia / proteomic signatures / neuroinflammation / 31 phagocytosis 32 1 bioRxiv preprint doi: https://doi.org/10.1101/861146; this version posted December 2, 2019.
    [Show full text]