DOCSLIB.ORG

Supplementary Dataset S2

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Dataset S2 mitochondrial translational termination MRPL28 MRPS26 6 MRPS21 PTCD3 MTRF1L 4 MRPL50 MRPS18A MRPS17 2 MRPL20 MRPL52 0 MRPL17 MRPS33 MRPS15 −2 MRPL45 MRPL30 MRPS27 AURKAIP1 MRPL18 MRPL3 MRPS6 MRPS18B MRPL41 MRPS2 MRPL34 GADD45GIP1 ERAL1 MRPL37 MRPS10 MRPL42 MRPL19 MRPS35 MRPL9 MRPL24 MRPS5 MRPL44 MRPS23 MRPS25 ITB ITB ITB ITB ICa ICr ITL original ICr ICa ITL ICa ITL original ICr ITL ICr ICa mitochondrial translational elongation MRPL28 MRPS26 6 MRPS21 PTCD3 MRPS18A 4 MRPS17 MRPL20 2 MRPS15 MRPL45 MRPL52 0 MRPS33 MRPL30 −2 MRPS27 AURKAIP1 MRPS10 MRPL42 MRPL19 MRPL18 MRPL3 MRPS6 MRPL24 MRPS35 MRPL9 MRPS18B MRPL41 MRPS2 MRPL34 MRPS5 MRPL44 MRPS23 MRPS25 MRPL50 MRPL17 GADD45GIP1 ERAL1 MRPL37 ITB ITB ITB ITB ICa ICr original ICr ITL ICa ITL ICa ITL original ICr ITL ICr ICa translational termination MRPL28 MRPS26 6 MRPS21 PTCD3 C12orf65 4 MTRF1L MRPL50 MRPS18A 2 MRPS17 MRPL20 0 MRPL52 MRPL17 MRPS33 −2 MRPS15 MRPL45 MRPL30 MRPS27 AURKAIP1 MRPL18 MRPL3 MRPS6 MRPS18B MRPL41 MRPS2 MRPL34 GADD45GIP1 ERAL1 MRPL37 MRPS10 MRPL42 MRPL19 MRPS35 MRPL9 MRPL24 MRPS5 MRPL44 MRPS23 MRPS25 ITB ITB ITB ITB ICa ICr original ICr ITL ICa ITL ICa ITL original ICr ITL ICr ICa translational elongation DIO2 MRPS18B MRPL41 6 MRPS2 MRPL34 GADD45GIP1 4 ERAL1 MRPL37 2 MRPS10 MRPL42 MRPL19 0 MRPL30 MRPS27 AURKAIP1 −2 MRPL18 MRPL3 MRPS6 MRPS35 MRPL9 EEF2K MRPL50 MRPS5 MRPL44 MRPS23 MRPS25 MRPL24 MRPS33 MRPL52 EIF5A2 MRPL17 SECISBP2 MRPS15 MRPL45 MRPS18A MRPS17 MRPL20 MRPL28 MRPS26 MRPS21 PTCD3 ITB ITB ITB ITB ICa ICr ICr ITL original ITL ICa ICa ITL ICr ICr ICa original ITL cellular protein complex disassembly MRPL28 MRPS26 6 MRPS21 PTCD3 MTRF1L 4 MRPL50 MRPL17 2 DNAJC6 MRPL20 MRPS18A 0 MRPS33 MRPL52 −2 STMN3 MRPL30 MRPS27 AURKAIP1 MRPL3 MRPS6 MRPS10 MRPL42 MRPL19 MRPL9 MRPL24 GADD45GIP1 VPS4B MRPS23 MRPS25 MRPL44 MRPS35 CCSAP ERAL1 MRPL37 MRPS18B MRPL41 MRPS2 MRPL34 ITB ITB ITB ITB ICa ITL ICa ICa ICr original ICr ITL ITL ITL ICr ICa original ICr protein complex disassembly MRPL28 MRPS26 6 MRPS21 PTCD3 MTRF1L 4 MRPL50 MRPL17 DNAJC6 2 MRPL20 MRPS18A 0 MRPS33 MRPL52 STMN3 −2 MRPL30 MRPS27 AURKAIP1 MRPL3 MRPS6 MRPS10 MRPL42 MRPL19 MRPL9 MRPL24 GADD45GIP1 CHMP5 VPS4B MRPS23 MRPS25 MRPL44 MRPS35 CCSAP ERAL1 MRPL37 MRPS18B MRPL41 MRPS2 MRPL34 ITB ITB ITB ITB ICa ITL ICa ICa ICr original ICr ITL ITL ICr ICr ICa original ITL 10 8 6 4 2 0 −2 ACTG2 ACTA2 ACTA1 ACTC1 ICr original ICr ICa ITL ICa ITL original ICr ICa ICr ITL mesenchyme migration mesenchyme ITL ITB ICa ITB ITB ITB 10 8 6 4 2 0 −2 ACTG2 ACTA2 ACTA1 ACTC1 ICr original ICr ICa ITL ICa ITL original ICr ICa ICr tissue migration ITL ITL ITB ICa ITB ITB ITB macromolecular complex disassembly HIST3H2A 8 MRPL28 MRPS26 MRPS21 6 PTCD3 C12orf65 MTRF1L 4 MRPL50 MRPL17 DNAJC6 2 MRPS18A MRPS17 MRPL20 0 MRPS15 MRPL45 MRPS33 −2 MRPL52 STMN3 MRPL30 MRPS27 AURKAIP1 MRPS10 MRPL42 MRPL19 MRPL18 MRPL3 MRPS6 MRPS35 CCSAP ERAL1 MRPL37 GADD45GIP1 VTA1 CHMP5 VPS4B MRPS18B MRPL41 MRPS2 MRPL34 MRPL9 MRPL24 MRPS5 MRPL44 MRPS23 MRPS25 ITB ITB ITB ITB ICa ICr original ICr ICa ICa ITL ITL ITL original ITL ICr ICr ICa 8 6 4 2 0 −2 FGF10 FGF7 ITL original ITL ITL ICa ICr ICa ICr ICr ICr ICa ITL original ITB ITB ITB ITB secretion by lung epithelial cell involved in lung growth lung epithelial cell involved secretion by ICa cell division FGFR2 PARD6A ZWILCH 8 HAUS4 MAD2L2 ZFYVE19 DYNLT3 6 TERF1 KNSTRN STRA13 CENPV 4 CENPJ CTDP1 CDCA2 CDC25C CENPE 2 C9orf114 RGS14 SIRT2 PMF1 0 CABLES2 SPICE1 PARD6B AURKA −2 CENPF CDC25B GOLGA2 TACC3 CDCA8 ANKLE2 CDCA5 BIRC5 CKS1B DSN1 REEP3 ANAPC13 PSRC1 FBXO5 BUB1 ZWINT CDCA3 SPDL1 NCAPG2 SKA1 BUB1B SPECC1L CDK1 SKA2 MIS18BP1 NCAPH KIF14 KIFC1 NSL1 PTTG1 HAUS5 SPG20 KIF20B CCSAP BABAM1 HAUS2 NEK2 DYNLT1 ANAPC16 MIS12 TIMELESS SDCCAG3 SGOL2 NUP43 ASPM HAUS6 ITB ITB ITB ITB ICa ITL ITL ICr original ICr ICa ICr ITL ITL original ICr ICa ICa 8 6 4 2 0 −2 FGF10 FGF7 ITL original ITL ITL ICa ICr ICa ICr ICr ICr ICa ITL original ITB ITB ITB ITB ICa regulation of branching involved in salivary gland morphogenesis by mesenchymal−epithelial signaling mesenchymal−epithelial gland morphogenesis in salivary by involved regulation of branching 8 6 4 2 0 −2 WNT2 GJA4 HTR1B DSG2 HILPDA FGF7 BDNF SLC1A6 NGF FGF10 ICa ICr ICr ITL ICr ICr original ICa ICa ITL original ITL ITL single organism signaling single organism ITB ITB ITB ITB ICa 6 4 2 0 −2 NOG FGF10 ITL original ITL ITL ICr original ICr ICr ICr ITL ICa ICa prostatic bud formation bud prostatic ICa ITB ITB ITB ITB ICa 8 6 4 2 0 −2 WNT2 GJA4 HTR1B DSG2 HILPDA FGF7 BDNF SLC1A6 NGF FGF10 ICa ICr ICr ITL ICr ICr original ICa ICa ITL signaling original ITL ITL ITB ITB ITB ITB ICa cellular component disassembly MMP16 HIST3H2A 8 POM121 NUP50 NUP43 CAPNS1 6 MRPS27 AURKAIP1 MRPL30 4 GOLGA2 CTSL MRPS10 2 GADD45GIP1 CHMP5 VPS4B MRPS5 0 MRPL44 MRPS23 MRPS25 −2 MRPS2 MRPL34 MRPL19 MRPL42 CDK1 MRPL3 MRPS6 LPIN1 MRPS35 CCSAP ERAL1 MRPL37 C12orf65 MRPS18B MRPL41 MRPL9 MRPL24 NUP210 WASH1 STMN3 MRPL28 FIS1 MRPS26 SHARPIN MRPS21 PTCD3 MRPL20 MRPS18A MRPS33 FUNDC2 MRPL50 NUPL2 MTRF1L MRPL52 MRPL17 DNAJC6 ITB ITB ITB ITB ICa ICr original ICr ICa ICa ITL ITL original ITL ITL ICr ICr ICa 8 6 4 2 0 −2 WNT2 FGF7 NOG FGF10 ITL original ITL ITL ICr ICr ITL ICa ICr ICr ICa ICa original ITB ITB ITB ITB regulation of morphogenesis structure of a branching ICa 8 6 4 2 0 −2 WNT2 FGF7 FGFR2 ICa ICr ICr ICa original ITL ICr ICr ICa ITL ITL ITL original ITB ITB ITB ITB ICa positive regulation of epithelial cell proliferation involved in lung morphogenesis involved positive regulation of epithelial cell proliferation mitotic nuclear division AURKA CENPF 8 CDC25B CDCA5 ANKLE2 6 ANAPC16 NUP43 TIMELESS 4 STRA13 DYNLT3 ZWILCH 2 PBK MAD2L2 HAUS4 0 CDCA2 CENPA CDC25C −2 PMF1 RGS14 SIRT2 DSN1 REEP3 ANAPC13 ASPM HAUS6 FBXO5 BUB1 CENPN KIF20B CCSAP BABAM1 HAUS2 NEK2 DYNLT1 NCAPG2 SKA1 BUB1B KIF22 MIS18BP1 SKA2 CDK1 HAUS5 CDCA3 PTTG1 CENPV TERF1 KLHL9 KLHL13 ITB ITB ITB ITB ICa ITL ITL ICr original ICr ICa ICa ICa ITL ITL ICr original ICr 6 4 2 0 −2 NOG FGF10 ITL original ITL ITL ICr original ICr ICr ICr ITL ICa ICa ICa ITB morphogenesis of an epithelial bud ITB ITB ITB ICa 8 6 4 2 0 −2 WNT2 GJA4 HTR1B HILPDA FGF7 BDNF SLC1A6 NGF FGF10 ICa ICr ICr ITL ICr ICr original ICa ICa ITL original cell−cell signaling ITL ITL ITB ITB ITB ITB ICa 8 6 4 2 0 −2 FGF10 FGF7 ITL original ITL ITL ICa ICr ICa ICr ICr ICr ICa ITL original ITB ITB ITB positive regulation of keratinocyte proliferation positive regulation of keratinocyte ITB ICa 8 6 4 2 0 −2 FGF10 FGF7 ITL original ITL ITL ICa ICr ICa ICr ICr ICr ICa ITL original ITB ITB positive regulation of keratinocyte migration positive regulation of keratinocyte ITB ITB ICa protein−DNA complex assembly POLR1E 8 HJURP 6 GTF3C5 SART3 4 GTF2H3 2 ASF1B 0 XRCC3 MIS18BP1 −2 TAF11 HIST2H2BF HIST1H2BN HIST3H2BB DACH1 HIST1H2BI HIST1H2BL HIST1H2BH HIST1H4K HIST1H4J HIST2H3D HIST1H4I HIST1H2BE HIST1H2BO ITL ITL ITL ICa ICa ICr original ICr ITL ICr ICr original ICa ICa ITB ITB ITB ITB 8 6 4 2 0 −2 WNT2 FGF7 FGFR2 ICa ICr ICr ICa original ITL ICr ICr ICa ITL ITL ITL original ITB ITB ITB ITB ICa regulation of epithelial cell proliferation involved in lung morphogenesis involved regulation of epithelial cell proliferation 6 4 2 0 −2 FGF10 WNT2 FOXC2 NOG FGFR2 SLIT2 GJA4 TFAP2B ITL original ICr ITL ICa ICr ITL ICr ICr ICa original ICa epithelium development ITL ITB ITB ITB ICa ITB 8 6 4 2 0 −2 FGF10 FGF7 ITL original ITL ITL ICa ICr ICa ICr ICr ICr ICa ITL original ITB regulation of keratinocyte migration regulation of keratinocyte ITB ITB ITB ICa 8 6 4 2 0 −2 FGF10 FGF7 ITL original ITL ITL ICa ICr ICa ICr ICr ICr ICa ITL original ITB mesenchymal−epithelial cell signaling mesenchymal−epithelial ITB ITB ITB ICa 6 4 2 0 −2 NOG FGFR2 FGF10 ICa ITL ICr ICr ITL original ITL ICr ICr ICa ICa original ITL ITB lateral sprouting from an epithelium from lateral sprouting ITB ITB ITB ICa 8 6 4 2 0 −2 WNT2 GJA4 HTR1B DAP HILPDA FGF7 BDNF SLC1A6 NGF FGF10 ITB ITB ITB ITB ICa ICa ICr ICr ITL ICr ICr original cell communication ICa ICa ITL original ITL ITL 8 6 4 2 0 −2 FGF10 FGF7 ITL original ITL ITL ICa ICr ICa ICr ICr ICr ICa ITL original ITB ITB ITB ITB ICa regulation of branching involved in salivary gland morphogenesis in salivary involved regulation of branching 6 4 2 0 −2 FGFR2 FGF10 ICr original ICr ICa ICa ITL ITL ICr ICa ITL ICr original ITL ITB ITB ITB ITB ICa mesenchymal cell differentiation involved in lung development involved cell differentiation mesenchymal 6 4 2 0 −2 FGFR2 FGF10 ICr original ICr ICa ICa ITL ITL ICr ICa ITL ICr original ITL ITB ITB ITB ITB ICa branch elongation involved in salivary gland morphogenesis in salivary elongation involved branch 6 4 2 0 −2 FGFR2 FGF10 ICr original ICr ICa ICa ITL ITL ICr ICa ITL ICr original ITL mammary gland bud formation mammary gland bud ITB ITB ITB ITB ICa 6 4 2 0 −2 FGFR2 FGF10 ICr original ICr ICa ICa ITL ITL ICr ICa ITL ICr original ITL ITB ITB ITB ITB ICa fibroblast growth factor receptor signaling pathway involved in mammary gland specification involved factor receptor signaling pathway growth fibroblast defense response to virus BCL2 MICA 8 TICAM1 APOBEC3C 6 PLSCR1 4 IFIT5 IL10RB 2 ISG15 IFIT3 0 IRF3 FADD −2 SLFN11 IFNAR2 TRIM5 POLR3G GBP3 PML SERINC5 IFNGR1 SERINC3 TRIM56 IRF1 STAT2 TRIM25 ZC3HAV1 PMAIP1 MAVS IFITM3 IFI16 IFNAR1 FAM111A ITB ITB ITB ITB ICa ICr original ICr ITL ITL ICa ICa ITL original ICr ICr ITL ICa 6 4 2 0 −2 NOG WNT2 ITL ICr ICr ICr ICr ICa ICa ICa ITL original ITL original ITL ITB ITB atrial cardiac muscle tissue morphogenesis muscle atrial cardiac ICa ITB ITB 8 6 4 2 0 −2 SC5D EBP DHCR7 ICr ICr ITL ICa ITL original
Load more

Recommended publications
  • Supplementary Materials: Evaluation of Cytotoxicity and Α-Glucosidase Inhibitory Activity of Amide and Polyamino-Derivatives of Lupane Triterpenoids
    Supplementary Materials: Evaluation of cytotoxicity and α-glucosidase inhibitory activity of amide and polyamino-derivatives of lupane triterpenoids Oxana B. Kazakova1*, Gul'nara V. Giniyatullina1, Akhat G. Mustafin1, Denis A. Babkov2, Elena V. Sokolova2, Alexander A. Spasov2* 1Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences, 71, pr. Oktyabrya, 450054 Ufa, Russian Federation 2Scientific Center for Innovative Drugs, Volgograd State Medical University, Novorossiyskaya st. 39, Volgograd 400087, Russian Federation Correspondence Prof. Dr. Oxana B. Kazakova Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences 71 Prospeсt Oktyabrya Ufa, 450054 Russian Federation E-mail: [email protected] Prof. Dr. Alexander A. Spasov Scientific Center for Innovative Drugs of the Volgograd State Medical University 39 Novorossiyskaya st. Volgograd, 400087 Russian Federation E-mail: [email protected] Figure S1. 1H and 13C of compound 2. H NH N H O H O H 2 2 Figure S2. 1H and 13C of compound 4. NH2 O H O H CH3 O O H H3C O H 4 3 Figure S3. Anticancer screening data of compound 2 at single dose assay 4 Figure S4. Anticancer screening data of compound 7 at single dose assay 5 Figure S5. Anticancer screening data of compound 8 at single dose assay 6 Figure S6. Anticancer screening data of compound 9 at single dose assay 7 Figure S7. Anticancer screening data of compound 12 at single dose assay 8 Figure S8. Anticancer screening data of compound 13 at single dose assay 9 Figure S9. Anticancer screening data of compound 14 at single dose assay 10 Figure S10.
    [Show full text]
  • Translational Control in Cancer Etiology
    Downloaded from http://cshperspectives.cshlp.org/ on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press Translational Control in Cancer Etiology Davide Ruggero Helen Diller Cancer Center, School of Medicine, University of California, San Francisco, California 94158 Correspondence: [email protected] The link between perturbations in translational control and cancer etiology is becoming a primary focus in cancer research. It has now been established that genetic alterations in several components of the translational apparatus underlie spontaneous cancers as well as an entire class of inherited syndromes known as “ribosomopathies” associated with in- creased cancer susceptibility. These discoveries have illuminated the importance of dereg- ulations in translational control to very specific cellular processes that contribute to cancer etiology. In addition, a growing body of evidence supports the view that deregulation of translational control is a common mechanism by which diverse oncogenic pathways promote cellular transformation and tumor development. Indeed, activation of these key oncogenic pathways induces rapid and dramatic translational reprogramming both by in- creasing overall protein synthesis and by modulating specific mRNA networks. These trans- lational changes promote cellular transformation, impacting almost every phase of tumor development. This paradigm represents a new frontier in the multihit model of cancer for- mation and offers significant promise for innovative cancer therapies. Current research,
    [Show full text]
  • Analysis of Gene Expression Data for Gene Ontology
    ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins.
    [Show full text]
  • Organ Level Protein Networks As a Reference for the Host Effects of the Microbiome
    Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press 1 Organ level protein networks as a reference for the host effects of the microbiome 2 3 Robert H. Millsa,b,c,d, Jacob M. Wozniaka,b, Alison Vrbanacc, Anaamika Campeaua,b, Benoit 4 Chassainge,f,g,h, Andrew Gewirtze, Rob Knightc,d, and David J. Gonzaleza,b,d,# 5 6 a Department of Pharmacology, University of California, San Diego, California, USA 7 b Skaggs School of Pharmacy and Pharmaceutical Sciences, University of California, San Diego, 8 California, USA 9 c Department of Pediatrics, and Department of Computer Science and Engineering, University of 10 California, San Diego California, USA 11 d Center for Microbiome Innovation, University of California, San Diego, California, USA 12 e Center for Inflammation, Immunity and Infection, Institute for Biomedical Sciences, Georgia State 13 University, Atlanta, GA, USA 14 f Neuroscience Institute, Georgia State University, Atlanta, GA, USA 15 g INSERM, U1016, Paris, France. 16 h Université de Paris, Paris, France. 17 18 Key words: Microbiota, Tandem Mass Tags, Organ Proteomics, Gnotobiotic Mice, Germ-free Mice, 19 Protein Networks, Proteomics 20 21 # Address Correspondence to: 22 David J. Gonzalez, PhD 23 Department of Pharmacology and Pharmacy 24 University of California, San Diego 25 La Jolla, CA 92093 26 E-mail: [email protected] 27 Phone: 858-822-1218 28 1 Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press 29 Abstract 30 Connections between the microbiome and health are rapidly emerging in a wide range of 31 diseases.
    [Show full text]
  • Allele-Specific Expression of Ribosomal Protein Genes in Interspecific Hybrid Catfish
    Allele-specific Expression of Ribosomal Protein Genes in Interspecific Hybrid Catfish by Ailu Chen A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy Auburn, Alabama August 1, 2015 Keywords: catfish, interspecific hybrids, allele-specific expression, ribosomal protein Copyright 2015 by Ailu Chen Approved by Zhanjiang Liu, Chair, Professor, School of Fisheries, Aquaculture and Aquatic Sciences Nannan Liu, Professor, Entomology and Plant Pathology Eric Peatman, Associate Professor, School of Fisheries, Aquaculture and Aquatic Sciences Aaron M. Rashotte, Associate Professor, Biological Sciences Abstract Interspecific hybridization results in a vast reservoir of allelic variations, which may potentially contribute to phenotypical enhancement in the hybrids. Whether the allelic variations are related to the downstream phenotypic differences of interspecific hybrid is still an open question. The recently developed genome-wide allele-specific approaches that harness high- throughput sequencing technology allow direct quantification of allelic variations and gene expression patterns. In this work, I investigated allele-specific expression (ASE) pattern using RNA-Seq datasets generated from interspecific catfish hybrids. The objective of the study is to determine the ASE genes and pathways in which they are involved. Specifically, my study investigated ASE-SNPs, ASE-genes, parent-of-origins of ASE allele and how ASE would possibly contribute to heterosis. My data showed that ASE was operating in the interspecific catfish system. Of the 66,251 and 177,841 SNPs identified from the datasets of the liver and gill, 5,420 (8.2%) and 13,390 (7.5%) SNPs were identified as significant ASE-SNPs, respectively.
    [Show full text]
  • Supplementary Table 1. Primer Sequences Used in RT-PCR Analysis
    Supplementary Table 1. Primer sequences used in RT-PCR analysis L32 Forward TGAAGCAGGCATCTGAGGG Reverse CGAAGGTGGAAGAG TGGGAG LIFR Forward CTCTCAGGCCAGAGTTGAGC Reverse GCTGTTCAGTCAGCCCTCTC CCR2 Forward TGTCTTCCCTGAATTGAGCC Reverse AAACGCATTAGTGGACAGGG IL12R Forward CGCAATACGTCGTGCGCTGC Reverse CACTCTGACTCCCACGCGCC CSF1R Forward GCTGGTGCGGATTCGAGGGG Reverse TTCGGCGTTAGTGGCCGAGC TGFbR1 Forward ACGCGCTGACATCTATGCAA Reverse CGTCGAGCAATTTCCCAGAA TGFbR2 Forward GCGCATCGCCAGCACGATCC Reverse TGGGCTTCCATTTCCACATCCGA CXCR1 Forward TCCTCCTGCCGCTGCTCACT Reverse CATGCGCAGTGTGAGCCCGT CXCR2 Forward CCTCGTGCCGCTGCTCATCA Reverse GGTGCGCAGTGTGAACCCGT CXCR3 Forward GGTCGCACTGCTCTGCGTGT Reverse GGGGCAGCAGGAAACCAGCC CXCR4 Forward GAGGCGTTTGGTGCTCCGGT Reverse TCGGTTCCATGGCAACACTCGC VEGFR1 (Flt1) Forward CGCGTGAAGAGTGGGTCCT Reverse CACATGCACGGAGGTGTTG VEGFR2 (Flk1) Forward AGCCCAGACTGTGTCCCGCA Reverse GGTGTCCGCGGAATCGGGTC VEGFR3 (Flt4) Forward GCCCGAGGACGAGGGTGACT Reverse CCTGGCTGCGCCTATCCTGC human Flt1 Forward GCACGTCAGCGAAGGCAAGC Reverse CCAGCTCAGCGTGGTCGTAGG Supplementary Table 2. List of putative miR-200 target genes amplified in human cancers amplified in cancers (Tumorscape)a Gene Symbol Title various cancers NSCLC PCT Errfi1 ERBB receptor feedback inhibitor 1 - yes 0.94 D11Bwg0517e DNA segment, Chr 11, Brigham & Women's Genetics 0517 expressed - yes 0.91 Pvrl4 poliovirus receptor-related 4 yes - 0.91 Mecp2 methyl CpG binding protein 2 yes yes 0.9 Jun Jun oncogene yes - 0.88 Prdm16 PR domain containing 16 - yes 0.88 Flt1 FMS-like tyrosine kinase 1 yes
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Transcriptome Sequencing and Genome-Wide Association Analyses Reveal Lysosomal Function and Actin Cytoskeleton Remodeling in Schizophrenia and Bipolar Disorder
    Molecular Psychiatry (2015) 20, 563–572 © 2015 Macmillan Publishers Limited All rights reserved 1359-4184/15 www.nature.com/mp ORIGINAL ARTICLE Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder Z Zhao1,6,JXu2,6, J Chen3,6, S Kim4, M Reimers3, S-A Bacanu3,HYu1, C Liu5, J Sun1, Q Wang1, P Jia1,FXu2, Y Zhang2, KS Kendler3, Z Peng2 and X Chen3 Schizophrenia (SCZ) and bipolar disorder (BPD) are severe mental disorders with high heritability. Clinicians have long noticed the similarities of clinic symptoms between these disorders. In recent years, accumulating evidence indicates some shared genetic liabilities. However, what is shared remains elusive. In this study, we conducted whole transcriptome analysis of post-mortem brain tissues (cingulate cortex) from SCZ, BPD and control subjects, and identified differentially expressed genes in these disorders. We found 105 and 153 genes differentially expressed in SCZ and BPD, respectively. By comparing the t-test scores, we found that many of the genes differentially expressed in SCZ and BPD are concordant in their expression level (q ⩽ 0.01, 53 genes; q ⩽ 0.05, 213 genes; q ⩽ 0.1, 885 genes). Using genome-wide association data from the Psychiatric Genomics Consortium, we found that these differentially and concordantly expressed genes were enriched in association signals for both SCZ (Po10 − 7) and BPD (P = 0.029). To our knowledge, this is the first time that a substantially large number of genes show concordant expression and association for both SCZ and BPD. Pathway analyses of these genes indicated that they are involved in the lysosome, Fc gamma receptor-mediated phagocytosis, regulation of actin cytoskeleton pathways, along with several cancer pathways.
    [Show full text]
  • Supplementary Figures 1-14 and Supplementary References
    SUPPORTING INFORMATION Spatial Cross-Talk Between Oxidative Stress and DNA Replication in Human Fibroblasts Marko Radulovic,1,2 Noor O Baqader,1 Kai Stoeber,3† and Jasminka Godovac-Zimmermann1* 1Division of Medicine, University College London, Center for Nephrology, Royal Free Campus, Rowland Hill Street, London, NW3 2PF, UK. 2Insitute of Oncology and Radiology, Pasterova 14, 11000 Belgrade, Serbia 3Research Department of Pathology and UCL Cancer Institute, Rockefeller Building, University College London, University Street, London WC1E 6JJ, UK †Present Address: Shionogi Europe, 33 Kingsway, Holborn, London WC2B 6UF, UK TABLE OF CONTENTS 1. Supplementary Figures 1-14 and Supplementary References. Figure S-1. Network and joint spatial razor plot for 18 enzymes of glycolysis and the pentose phosphate shunt. Figure S-2. Correlation of SILAC ratios between OXS and OAC for proteins assigned to the SAME class. Figure S-3. Overlap matrix (r = 1) for groups of CORUM complexes containing 19 proteins of the 49-set. Figure S-4. Joint spatial razor plots for the Nop56p complex and FIB-associated complex involved in ribosome biogenesis. Figure S-5. Analysis of the response of emerin nuclear envelope complexes to OXS and OAC. Figure S-6. Joint spatial razor plots for the CCT protein folding complex, ATP synthase and V-Type ATPase. Figure S-7. Joint spatial razor plots showing changes in subcellular abundance and compartmental distribution for proteins annotated by GO to nucleocytoplasmic transport (GO:0006913). Figure S-8. Joint spatial razor plots showing changes in subcellular abundance and compartmental distribution for proteins annotated to endocytosis (GO:0006897). Figure S-9. Joint spatial razor plots for 401-set proteins annotated by GO to small GTPase mediated signal transduction (GO:0007264) and/or GTPase activity (GO:0003924).
    [Show full text]
  • 1 AGING Supplementary Table 2
    SUPPLEMENTARY TABLES Supplementary Table 1. Details of the eight domain chains of KIAA0101. Serial IDENTITY MAX IN COMP- INTERFACE ID POSITION RESOLUTION EXPERIMENT TYPE number START STOP SCORE IDENTITY LEX WITH CAVITY A 4D2G_D 52 - 69 52 69 100 100 2.65 Å PCNA X-RAY DIFFRACTION √ B 4D2G_E 52 - 69 52 69 100 100 2.65 Å PCNA X-RAY DIFFRACTION √ C 6EHT_D 52 - 71 52 71 100 100 3.2Å PCNA X-RAY DIFFRACTION √ D 6EHT_E 52 - 71 52 71 100 100 3.2Å PCNA X-RAY DIFFRACTION √ E 6GWS_D 41-72 41 72 100 100 3.2Å PCNA X-RAY DIFFRACTION √ F 6GWS_E 41-72 41 72 100 100 2.9Å PCNA X-RAY DIFFRACTION √ G 6GWS_F 41-72 41 72 100 100 2.9Å PCNA X-RAY DIFFRACTION √ H 6IIW_B 2-11 2 11 100 100 1.699Å UHRF1 X-RAY DIFFRACTION √ www.aging-us.com 1 AGING Supplementary Table 2. Significantly enriched gene ontology (GO) annotations (cellular components) of KIAA0101 in lung adenocarcinoma (LinkedOmics). Leading Description FDR Leading Edge Gene EdgeNum RAD51, SPC25, CCNB1, BIRC5, NCAPG, ZWINT, MAD2L1, SKA3, NUF2, BUB1B, CENPA, SKA1, AURKB, NEK2, CENPW, HJURP, NDC80, CDCA5, NCAPH, BUB1, ZWILCH, CENPK, KIF2C, AURKA, CENPN, TOP2A, CENPM, PLK1, ERCC6L, CDT1, CHEK1, SPAG5, CENPH, condensed 66 0 SPC24, NUP37, BLM, CENPE, BUB3, CDK2, FANCD2, CENPO, CENPF, BRCA1, DSN1, chromosome MKI67, NCAPG2, H2AFX, HMGB2, SUV39H1, CBX3, TUBG1, KNTC1, PPP1CC, SMC2, BANF1, NCAPD2, SKA2, NUP107, BRCA2, NUP85, ITGB3BP, SYCE2, TOPBP1, DMC1, SMC4, INCENP. RAD51, OIP5, CDK1, SPC25, CCNB1, BIRC5, NCAPG, ZWINT, MAD2L1, SKA3, NUF2, BUB1B, CENPA, SKA1, AURKB, NEK2, ESCO2, CENPW, HJURP, TTK, NDC80, CDCA5, BUB1, ZWILCH, CENPK, KIF2C, AURKA, DSCC1, CENPN, CDCA8, CENPM, PLK1, MCM6, ERCC6L, CDT1, HELLS, CHEK1, SPAG5, CENPH, PCNA, SPC24, CENPI, NUP37, FEN1, chromosomal 94 0 CENPL, BLM, KIF18A, CENPE, MCM4, BUB3, SUV39H2, MCM2, CDK2, PIF1, DNA2, region CENPO, CENPF, CHEK2, DSN1, H2AFX, MCM7, SUV39H1, MTBP, CBX3, RECQL4, KNTC1, PPP1CC, CENPP, CENPQ, PTGES3, NCAPD2, DYNLL1, SKA2, HAT1, NUP107, MCM5, MCM3, MSH2, BRCA2, NUP85, SSB, ITGB3BP, DMC1, INCENP, THOC3, XPO1, APEX1, XRCC5, KIF22, DCLRE1A, SEH1L, XRCC3, NSMCE2, RAD21.
    [Show full text]
  • Knockdown of EIF5A2 Inhibits the Malignant Potential of Non-Small Cell Lung Cancer Cells
    ONCOLOGY LETTERS 15: 4541-4549, 2018 Knockdown of EIF5A2 inhibits the malignant potential of non-small cell lung cancer cells CHENG CHEN1*, BOJIA ZHANG2*, SHANSHAN WU3, YONGXIANG SONG1 and JIAN LI1 1Department of Thoracic Surgery, Affiliated Hospital of Zunyi Medical College, Zunyi, Guizhou 563000; 2Department of Infectious Disease, Shanghai 10th People's Hospital, Tongji University School of Medicine, Shanghai 200072; 3Department of Nursing, Affiliated Hospital of Zunyi Medical College, Zunyi, Guizhou 563000, P.R. China Received March 16, 2016; Accepted February 23, 2017 DOI: 10.3892/ol.2018.7832 Abstract. Eukaryotic translation initiation factor 5A2 through these proteins. EIF5A2 may therefore serve as a novel (EIF5A2) has been demonstrated to be upregulated in therapeutic target for the treatment of NSCLC. numerous types of human cancer and is associated with cancer progression. However, the expression and role of Introduction EIF5A2 in non-small cell lung cancer (NSCLC) remains unclear. In the present study, the role of EIF5A2 in NSCLC Non-small cell lung cancer (NSCLC) accounts for 85% of was investigated, in addition to the underlying molecular pulmonary malignancies (1) and is one of the leading causes of mechanisms by which EIF5A2 acts. Relative EIF5A2 expres- cancer-associated mortality worldwide. Recurrent and meta- sion levels were determined in NSCLC cells and compared static disease is the main cause of mortality, and the 5-year with levels in non-cancerous lung tissues. Short interfering survival rate for lung cancer is 15% (2). Therefore, in order to (si)RNA targeted against EIF5A2 was used to knock down improve the prognosis for patients with NSCLC, it is impor- EIF5A2 levels in NSCLC cells.
    [Show full text]
  • WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT (51) International Patent Classification: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, C12Q 1/68 (2018.01) A61P 31/18 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, C12Q 1/70 (2006.01) HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/US2018/056167 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (22) International Filing Date: SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 16 October 2018 (16. 10.2018) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, (30) Priority Data: UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 62/573,025 16 October 2017 (16. 10.2017) US TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, ΓΕ , IS, IT, LT, LU, LV, (71) Applicant: MASSACHUSETTS INSTITUTE OF MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TECHNOLOGY [US/US]; 77 Massachusetts Avenue, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, Cambridge, Massachusetts 02139 (US).
    [Show full text]