DOCSLIB.ORG

Mot3, a Zn Finger Transcription Factor That Modulates Gene Expression and Attenuates Mating Pheromone Signaling in Saccharomyces Cerevisiae

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mot3, a Zn Finger Transcription Factor That Modulates Gene Expression and Attenuates Mating Pheromone Signaling in Saccharomyces Cerevisiae Copyright 1998 by the Genetics Society of America Mot3, a Zn Finger Transcription Factor That Modulates Gene Expression and Attenuates Mating Pheromone Signaling in Saccharomyces cerevisiae Anatoly V. Grishin, Michael Rothenberg,1 Maureen A. Downs and Kendall J. Blumer Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, Missouri 63110 Manuscript received January 13, 1998 Accepted for publication March 4, 1998 ABSTRACT In the yeast Saccharomyces cerevisiae, mating pheromone response is initiated by activation of a G protein- and mitogen-activated protein (MAP) kinase-dependent signaling pathway and attenuated by several mechanisms that promote adaptation or desensitization. To identify genes whose products negatively regulate pheromone signaling, we screened for mutations that suppress the hyperadaptive phenotype of wild-type cells overexpressing signaling-defective G protein b subunits. This identi®ed recessive mutations in MOT3, which encodes a nuclear protein with two Cys2-His2 Zn ®ngers. MOT3 was found to be a dosage- dependent inhibitor of pheromone response and pheromone-induced gene expression and to require an intact signaling pathway to exert its effects. Several results suggested that Mot3 attenuates expression of pheromone-responsive genes by mechanisms distinct from those used by the negative transcriptional regulators Cdc36, Cdc39, and Mot2. First, a Mot3-lexA fusion functions as a transcriptional activator. Second, Mot3 is a dose-dependent activator of several genes unrelated to pheromone response, including CYC1, SUC2, and LEU2. Third, insertion of consensus Mot3 binding sites (C/A/T)AGG(T/C)A activates a promoter in a MOT3-dependent manner. These ®ndings, and the fact that consensus binding sites are found in the 59 ¯anking regions of many yeast genes, suggest that Mot3 is a globally acting transcriptional regulator. We hypothesize that Mot3 regulates expression of factors that attenuate signaling by the phero- mone response pathway. HE pheromone response pathway of the yeast Sac- gradients, allowing mating to occur preferentially be- Tcharomyces cerevisiae is controlled by a complex inter- tween partners that produce high levels of pheromone play of positive and negative regulators of signal trans- or to resume proliferation if mating is unsuccessful duction (Bardwell et al. 1994). Secreted oligopeptide (Jackson et al. 1991; Segall 1993; Bardwell et al. mating pheromones (a-factor and a-factor) induce the 1994). Desensitization or adaptation in yeast can occur expression of genes required for mating, inhibit cell by several mechanisms, including pheromone proteoly- proliferation, and trigger a differentiation program nec- sis (Ciejek and Thorner 1979; MacKay et al. 1988), essary for conjugation of haploid yeast cells of opposite receptor phosphorylation and downregulation (Jen- mating type. Pheromones exert their effects by activat- ness and Spatrick 1986; Reneke et al. 1988; Chen and ing a conserved signal transduction pathway consisting Konopka 1996), G protein deactivation by a putative of cell surface receptors, a heterotrimeric guanine nu- GTPase-activating protein Sst2, a member of the regula- cleotide-binding protein (G protein), and a mitogen- tors of G protein signaling (RGS) family (Dohlman et activated protein (MAP) kinase cascade, ultimately im- al. 1996), and MAP kinase dephosphorylation by dual pinging on a cyclin-dependent kinase inhibitor (Far1) speci®city and tyrosine-speci®c protein phosphatases that induces growth arrest and a transcription factor (Doi et al. 1994; Zhan et al. 1997). Because the expres- (Ste12) that activates expression of pheromone-respon- sion of several of these negative regulatory factors is sive genes. pheromone-inducible, transcriptional regulation is Negative regulation of the pheromone response path- likely to be an important part of the adaptive process. way allows cells to adapt or become desensitized to a We have shown previously that adaptation is promoted signal of constant intensity. This is thought to be impor- strongly in wild-type cells that overexpress signaling- tant for cells to respond chemotropically to pheromone defective G protein b subunits (Grishin et al. 1994). The mechanism of this ªhyperadaptiveº phenotype may be novel because it does not involve pheromone degra- Corresponding author: Anatoly Grishin, Department of Cell Biology dation, receptor phosphorylation or endocytosis, Sst2, and Physiology, Washington University School of Medicine, 660 S. or the dual-speci®city phosphatase encoded by MSG5. Euclid Ave., Box 8228, St. Louis, MO 63110-1093. E-mail: [email protected] From our previous studies we hypothesized that overex- 1 Present address: University of California School of Medicine, San pression of mutant Gb subunits in wild-type cells pro- Francisco, CA 94143. motes an adaptive process that attenuates pheromone Genetics 149: 879±892 ( June, 1998) 880 A. V. Grishin et al. TABLE 1 Yeast strains used in this study Strain Genotype Source or reference W303-1B MATa ade2 his3 ura3 leu2 trp1 R. Rothstein W303az1 W303-1B mot3::URA3 This work AG56 MATa ade2 his3 ura3 leu2 trp1 sst1D Grishin et al. (1994) AG56-5 AG56-46 AG56-58 AG56-80 Hyperadaptation-defective derivatives of AG56 This work AG56-102 AG56-119 AG56-138 AG56-143 AG62 Diploid of cross between AG56 3 W303-1B This work AG62z Diploid of cross between AG64 3 W303az1 This work AG64 AG56 mot3::URA3 This work AG65a AG56 mot3::ura3 This work AG66 AG65 ste2::LEU2 This work AG67 AG65 ste4::URA3 This work AG68 AG65 ste18-1 This work AG69 AG65 ste20::URA3 This work AG70 AG65 ste11::URA3 This work AG71 AG65 ste7-A1 This work AG72 AG65 ste12::LEU2 This work 31K MATa ade8 ura3 trp1 arg4 This work L40 MATa ade2 his3 leu2 trp1 gal4 gal80 S. Hollenberg LYS2::(lexAop)4-HIS3 URA3::(lexAop)8-lacZ DC14b MATa his1 Weiner et al. (1993) DC17b MATa his1 Weiner et al. (1993) a A Ura2 derivative of AG64 selected on SD with 5-¯uoroorotic acid (0.1%). b Mating type testers. response. As part of an effort to de®ne this adaptive marked derivative pRS425 FUS1-lacZ (FUS1-lacZ; McCaffrey Meluh Rose mechanism, we report the identi®cation of mutations et al. 1987); pMR1300 (KAR3-lacZ; and 1990). Other newly constructed promoter-lacZ fusions were made by that abrogate the hyperadaptive phenotype. This has using BamHI and EcoRI-cut YEp357R (Myers et al. 1986) as identi®ed the MOT3 gene, a previously uncharacterized a recipient for PCR-generated promoter DNA fragments with gene that encodes a member of the Cys2-His2 Zn ®nger the following endpoints relative to translation starts: 2517 to family of transcription factors. We present evidence that 1132 (CUP1), 2245 to 1243 (FUS3), 2811 to 160 (SST2), Mot3 is a transcriptional regulator of several yeast genes, and 2335 to 1182 (AGA1), resulting in plasmids pAG33, pAG34, pAG35, and pAG36. b-Galactosidase levels for these possibly including those involved in attenuating the ac- plasmids have been reported by others or con®rmed by us tivity of the pheromone response pathway. (unpublished results) to correlate with transcript levels. pAG37 was constructed by inserting four lexA operators (Kel- eher et al. 1992) into the SalI site upstream of the GAL1 MATERIALS AND METHODS promoter of pD-lacZ R37 (Singer et al. 1990). To construct pAG38, the oligonucleotides (CTAGAAGCAGGCATTAC Strains and media: Yeast strains used in this study are listed AAGGCACTGACAGGTAAAACAGGTAAAGGCA and CTAGT in Table 1. Growth media (YPD, YPG, supplemented SD, and GCCTTTACCTGTTTTACCTGTCAGTGCCTTGTAATGCCT sporulation media) were prepared as described previously GCTT; Mot3 binding sites are underlined) were annealed and (Sherman 1991). SGal contains galactose (2%) and sucrose the resulting duplex inserted into the XbaI site of pAG33. (0.2%) instead of glucose. Synthetic a-factor (Washington pAG40 was constructed by inserting a 2.4-kb EcoRI-SalI frag- University Protein Chemistry Laboratory, St. Louis, MO) was ment encompassing the entire MOT3 gene and its promoter added to media to a ®nal concentration of 1 mm, unless indi- into EcoRI and SalI-cut pFAT-RS3039b9 (provided by D. Gott- cated otherwise. schling, Fred Hutchinson Cancer Center, Seattle, WA). To Plasmids: The following plasmids were used as promoter- construct pAG44, the 39 part of MOT3 was ampli®ed with lacZ fusion reporters: pLGD312s (CYC1-lacZ ; Guarente and primers CCGCTCGAGTCATCAGACCATAAATATATCC and Hoar 1984), pBM2773 (SUC2-lacZ), pBM2636 (HXT1-lacZ ), CGGGATCCTTGTTAAATGAGTGGGAAGGG and cloned pBM2717 (HXT2-lacZ ), pBM2819 (HXT3-lacZ ), pBM2800 into XhoI and BamHI-cut pET-15b (Novagen). pAG41 was con- (HXT4-lacZ), pBM2832 (LEU2-lacZ ; Ozcan and Johnston structed by amplifying the complete MOT3 open reading 1996a), pJJ13 (PCK1-lacZ ; Mercado and Gancedo 1992); pD- frame (ORF) with primers GGATCCGGACATATCATATTT lacZ R37 (GAL1-lacZ; Singer et al. 1990); pSL307 and its LEU2- GAG and ATCGATTTTGTTGTGACTAACAATAAGGTT and Mot3 Transcription Factor of Yeast 881 cloning the PCR product into BamHI and ClaI-cut pGFP- phates (dNTPs), if necessary. For experiments designed to C-FUS (Niedenthal et al. 1996). pAG42 was constructed de®ne a consensus Mot3 binding site, a set of labeled probes by amplifying the entire MOT3 coding sequence with pri- having the same speci®c activity was prepared in the following mers GGAATTCGGGACATATCATATTCGAGCAATGAATG way. Oligonucleotides with the sequences GCAACCAGXXXX CGG and GGATCCTTGTTAAATGAGTGGGAAGGG and by XXGACGACAACAACTGTGCTGCTGA, where XXXXXX are cloning the ampli®cation
Load more

Recommended publications
  • Epigenome-Wide Exploratory Study of Monozygotic Twins Suggests Differentially Methylated Regions to Associate with Hand Grip Strength
    Biogerontology (2019) 20:627–647 https://doi.org/10.1007/s10522-019-09818-1 (0123456789().,-volV)( 0123456789().,-volV) RESEARCH ARTICLE Epigenome-wide exploratory study of monozygotic twins suggests differentially methylated regions to associate with hand grip strength Mette Soerensen . Weilong Li . Birgit Debrabant . Marianne Nygaard . Jonas Mengel-From . Morten Frost . Kaare Christensen . Lene Christiansen . Qihua Tan Received: 15 April 2019 / Accepted: 24 June 2019 / Published online: 28 June 2019 Ó The Author(s) 2019 Abstract Hand grip strength is a measure of mus- significant CpG sites or pathways were found, how- cular strength and is used to study age-related loss of ever two of the suggestive top CpG sites were mapped physical capacity. In order to explore the biological to the COL6A1 and CACNA1B genes, known to be mechanisms that influence hand grip strength varia- related to muscular dysfunction. By investigating tion, an epigenome-wide association study (EWAS) of genomic regions using the comb-p algorithm, several hand grip strength in 672 middle-aged and elderly differentially methylated regions in regulatory monozygotic twins (age 55–90 years) was performed, domains were identified as significantly associated to using both individual and twin pair level analyses, the hand grip strength, and pathway analyses of these latter controlling the influence of genetic variation. regions revealed significant pathways related to the Moreover, as measurements of hand grip strength immune system, autoimmune disorders, including performed over 8 years were available in the elderly diabetes type 1 and viral myocarditis, as well as twins (age 73–90 at intake), a longitudinal EWAS was negative regulation of cell differentiation.
    [Show full text]
  • The Function and Evolution of C2H2 Zinc Finger Proteins and Transposons
    The function and evolution of C2H2 zinc finger proteins and transposons by Laura Francesca Campitelli A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Molecular Genetics University of Toronto © Copyright by Laura Francesca Campitelli 2020 The function and evolution of C2H2 zinc finger proteins and transposons Laura Francesca Campitelli Doctor of Philosophy Department of Molecular Genetics University of Toronto 2020 Abstract Transcription factors (TFs) confer specificity to transcriptional regulation by binding specific DNA sequences and ultimately affecting the ability of RNA polymerase to transcribe a locus. The C2H2 zinc finger proteins (C2H2 ZFPs) are a TF class with the unique ability to diversify their DNA-binding specificities in a short evolutionary time. C2H2 ZFPs comprise the largest class of TFs in Mammalian genomes, including nearly half of all Human TFs (747/1,639). Positive selection on the DNA-binding specificities of C2H2 ZFPs is explained by an evolutionary arms race with endogenous retroelements (EREs; copy-and-paste transposable elements), where the C2H2 ZFPs containing a KRAB repressor domain (KZFPs; 344/747 Human C2H2 ZFPs) are thought to diversify to bind new EREs and repress deleterious transposition events. However, evidence of the gain and loss of KZFP binding sites on the ERE sequence is sparse due to poor resolution of ERE sequence evolution, despite the recent publication of binding preferences for 242/344 Human KZFPs. The goal of my doctoral work has been to characterize the Human C2H2 ZFPs, with specific interest in their evolutionary history, functional diversity, and coevolution with LINE EREs.
    [Show full text]
  • Whole Exome Sequencing Reveals NOTCH1 Mutations in Anaplastic Large Cell Lymphoma and Points to Notch Both As a Key Pathway and a Potential Therapeutic Target
    Non-Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing reveals NOTCH1 mutations in anaplastic large cell lymphoma and points to Notch both as a key pathway and a potential therapeutic target Hugo Larose, 1,2 Nina Prokoph, 1,2 Jamie D. Matthews, 1 Michaela Schlederer, 3 Sandra Högler, 4 Ali F. Alsulami, 5 Stephen P. Ducray, 1,2 Edem Nuglozeh, 6 Mohammad Feroze Fazaludeen, 7 Ahmed Elmouna, 6 Monica Ceccon, 2,8 Luca Mologni, 2,8 Carlo Gambacorti-Passerini, 2,8 Gerald Hoefler, 9 Cosimo Lobello, 2,10 Sarka Pospisilova, 2,10,11 Andrea Janikova, 2,11 Wilhelm Woessmann, 2,12 Christine Damm-Welk, 2,12 Martin Zimmermann, 13 Alina Fedorova, 14 Andrea Malone, 15 Owen Smith, 15 Mariusz Wasik, 2,16 Giorgio Inghirami, 17 Laurence Lamant, 18 Tom L. Blundell, 5 Wolfram Klapper, 19 Olaf Merkel, 2,3 G. A. Amos Burke, 20 Shahid Mian, 6 Ibraheem Ashankyty, 21 Lukas Kenner 2,3,22 and Suzanne D. Turner 1,2,10 1Department of Pathology, University of Cambridge, Cambridge, UK; 2European Research Initiative for ALK Related Malignancies (ERIA; www.ERIALCL.net ); 3Department of Pathology, Medical University of Vienna, Vienna, Austria; 4Unit of Laboratory Animal Pathology, Uni - versity of Veterinary Medicine Vienna, Vienna, Austria; 5Department of Biochemistry, University of Cambridge, Tennis Court Road, Cam - bridge, UK; 6Molecular Diagnostics and Personalised Therapeutics Unit, Colleges of Medicine and Applied Medical Sciences, University of Ha’il, Ha’il, Saudi Arabia; 7Neuroinflammation Research Group, Department of Neurobiology, A.I Virtanen Institute
    [Show full text]
  • Beyond Gene Expression
    Beyond gene expression Citation for published version (APA): Gupta, R. (2021). Beyond gene expression: novel methods and applications of transcript expression analyses in RNA-Seq. Maastricht University. https://doi.org/10.26481/dis.20210304rg Document status and date: Published: 01/01/2021 DOI: 10.26481/dis.20210304rg Document Version: Publisher's PDF, also known as Version of record Please check the document version of this publication: • A submitted manuscript is the version of the article upon submission and before peer-review. There can be important differences between the submitted version and the official published version of record. People interested in the research are advised to contact the author for the final version of the publication, or visit the DOI to the publisher's website. • The final author version and the galley proof are versions of the publication after peer review. • The final published version features the final layout of the paper including the volume, issue and page numbers. Link to publication General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal.
    [Show full text]
  • Zfp64 Participates in Notch Signaling and Regulates Differentiation in Mesenchymal Cells
    Research Article 1613 Zfp64 participates in Notch signaling and regulates differentiation in mesenchymal cells Kei Sakamoto*, Yoshihiro Tamamura, Ken-ichi Katsube and Akira Yamaguchi Section of Oral Pathology, Graduate School, Tokyo Medical and Dental University, 1-5-45 Yushima, Bunkyo-ku, Tokyo 113-8549, Japan *Author for correspondence (e-mail: [email protected]) Accepted 1 March 2008 Journal of Cell Science 121, 1613-1623 Published by The Company of Biologists 2008 doi:10.1242/jcs.023119 Summary Notch signaling is required for multiple aspects of tissue and downstream target of Runx2 and, (2) its cognate protein acts cell differentiation. In this study, we identified zinc finger as a coactivator of Notch1, which suggests that Zfp64 mediates protein 64 (Zfp64) as a novel coactivator of Notch1. Zfp64 is mesenchymal cell differentiation by modulating Notch associated with the intracellular domain of Notch1, recruited signaling. to the promoters of the Notch target genes Hes1 and Hey1, and transactivates them. Zfp64 expression is under the control of Runx2, and is upregulated by direct transactivation of its Supplementary material available online at promoter. Zfp64 suppresses the myogenic differentiation of http://jcs.biologists.org/cgi/content/full/121/10/1623/DC1 C2C12 cells and promotes their osteoblastic differentiation. Our data demonstrate two functions of Zfp64: (1) it is a Key words: Notch, Runx2, Zinc finger protein 64 Introduction targets, such as the HES-HEY of family transcription factors. Skeletal tissue is composed of many types of mesenchymal cells, NICD consists of several distinct functional modules, including which originate from common pluripotent progenitor cells.
    [Show full text]
  • The DNA Sequence and Comparative Analysis of Human Chromosome 20
    articles The DNA sequence and comparative analysis of human chromosome 20 P. Deloukas, L. H. Matthews, J. Ashurst, J. Burton, J. G. R. Gilbert, M. Jones, G. Stavrides, J. P. Almeida, A. K. Babbage, C. L. Bagguley, J. Bailey, K. F. Barlow, K. N. Bates, L. M. Beard, D. M. Beare, O. P. Beasley, C. P. Bird, S. E. Blakey, A. M. Bridgeman, A. J. Brown, D. Buck, W. Burrill, A. P. Butler, C. Carder, N. P. Carter, J. C. Chapman, M. Clamp, G. Clark, L. N. Clark, S. Y. Clark, C. M. Clee, S. Clegg, V. E. Cobley, R. E. Collier, R. Connor, N. R. Corby, A. Coulson, G. J. Coville, R. Deadman, P. Dhami, M. Dunn, A. G. Ellington, J. A. Frankland, A. Fraser, L. French, P. Garner, D. V. Grafham, C. Grif®ths, M. N. D. Grif®ths, R. Gwilliam, R. E. Hall, S. Hammond, J. L. Harley, P. D. Heath, S. Ho, J. L. Holden, P. J. Howden, E. Huckle, A. R. Hunt, S. E. Hunt, K. Jekosch, C. M. Johnson, D. Johnson, M. P. Kay, A. M. Kimberley, A. King, A. Knights, G. K. Laird, S. Lawlor, M. H. Lehvaslaiho, M. Leversha, C. Lloyd, D. M. Lloyd, J. D. Lovell, V. L. Marsh, S. L. Martin, L. J. McConnachie, K. McLay, A. A. McMurray, S. Milne, D. Mistry, M. J. F. Moore, J. C. Mullikin, T. Nickerson, K. Oliver, A. Parker, R. Patel, T. A. V. Pearce, A. I. Peck, B. J. C. T. Phillimore, S. R. Prathalingam, R. W. Plumb, H. Ramsay, C. M.
    [Show full text]
  • Identification of Potential Core Genes in Sevoflurance Induced Myocardial
    Identication of Potential core genes in Sevourance induced Myocardial Energy Metabolism in Patients Undergoing Off-pump Coronary Artery Bypass Graft Surgery using Bioinformatics analysis Hua Lin ( [email protected] ) Tianjin Medical University General Hospital Airport Site Research article Keywords: sevourane, Myocardial Energy Metabolism, Off-pump Coronary Artery Bypass Graft Surgery Posted Date: November 18th, 2019 DOI: https://doi.org/10.21203/rs.2.17434/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/15 Abstract Background: Myocardial ischemia-reperfusion injury always happened after Off-pump coronary artery bypass graft(OPCABG), and this can not be avoided altogether. In this study, we tried to detect potential genes of sevourane-induced myocardial energy metabolism in patients undergoing OPCABG using bioinformatics analysis. Methods: We download and analyze the gene expression prole data from the Gene Expression Omnibus(GEO) database using bioinformatics methods. We downloded the gene expression data from the Gene Expression Omnibus(GEO) database using bioinformatics methods. Gene Ontology(GO) functional annotation analysis and Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway enrichment analysis were used to analysis the screened differentially expressed genes(DEGs). Then, we established a protein–protein interaction (PPI) network to nd hub genes associated with myocardial energy metabolism. Results: Through PPI network, we nd ten hub genes, including JUN, EGR1, ATF3, FOSB, JUNB, DUSP1, EGR2, NR4A1, BTG2, NR4A2. Conclusions: In conclusion, the proteins encoded by EGR1ATF3c-FosBtg2JunBDUSP1NR4A1BTG2 and NR4A2 were related to cardiac function. ATF3, FOSB, JUNB, DUSP1, NR4A1, NR4A2 are related to apoptosis of cardiomyocytes. The protein encoded by BTG2 is related to hypertrophy.
    [Show full text]
  • Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection
    Content Based Search in Gene Expression Databases and a Meta-analysis of Host Responses to Infection A Thesis Submitted to the Faculty of Drexel University by Francis X. Bell in partial fulfillment of the requirements for the degree of Doctor of Philosophy November 2015 c Copyright 2015 Francis X. Bell. All Rights Reserved. ii Acknowledgments I would like to acknowledge and thank my advisor, Dr. Ahmet Sacan. Without his advice, support, and patience I would not have been able to accomplish all that I have. I would also like to thank my committee members and the Biomed Faculty that have guided me. I would like to give a special thanks for the members of the bioinformatics lab, in particular the members of the Sacan lab: Rehman Qureshi, Daisy Heng Yang, April Chunyu Zhao, and Yiqian Zhou. Thank you for creating a pleasant and friendly environment in the lab. I give the members of my family my sincerest gratitude for all that they have done for me. I cannot begin to repay my parents for their sacrifices. I am eternally grateful for everything they have done. The support of my sisters and their encouragement gave me the strength to persevere to the end. iii Table of Contents LIST OF TABLES.......................................................................... vii LIST OF FIGURES ........................................................................ xiv ABSTRACT ................................................................................ xvii 1. A BRIEF INTRODUCTION TO GENE EXPRESSION............................. 1 1.1 Central Dogma of Molecular Biology........................................... 1 1.1.1 Basic Transfers .......................................................... 1 1.1.2 Uncommon Transfers ................................................... 3 1.2 Gene Expression ................................................................. 4 1.2.1 Estimating Gene Expression ............................................ 4 1.2.2 DNA Microarrays ......................................................
    [Show full text]
  • The Diversity of Zinc-Finger Genes on Human Chromosome 19 Provides
    Cell Death and Differentiation (2014) 21, 381–387 OPEN & 2014 Macmillan Publishers Limited All rights reserved 1350-9047/14 www.nature.com/cdd The diversity of zinc-finger genes on human chromosome 19 provides an evolutionary mechanism for defense against inherited endogenous retroviruses S Lukic*1, J-C Nicolas1 and AJ Levine1 Endogenous retroviruses (ERVs) are remnants of ancient retroviral infections of the germ line that can remain capable of replication within the host genome. In the soma, DNA methylation and repressive chromatin keep the majority of this parasitic DNA transcriptionally silent. However, it is unclear how the host organism adapts to recognize and silence novel invading retroviruses that enter the germ line. Krueppel-Associated Box (KRAB)-associated protein 1 (KAP1) is a transcriptional regulatory factor that drives the epigenetic repression of many different loci in mammalian genomes. Here, we use published experimental data to provide evidence that human KAP1 is recruited to endogenous retroviral DNA by KRAB-containing zinc-finger transcription factors (TFs). Many of these zinc-finger genes exist in clusters associated with human chromosome 19. We demonstrate that these clusters are located at hotspots for copy number variation (CNV), generating a large and continuing diversity of zinc-finger TFs with new generations. These zinc-finger genes possess a wide variety of DNA binding affinities, but their role as transcriptional repressors is conserved. We also perform a computational study of the different ERVs that invaded the human genome during primate evolution. We find candidate zinc-finger repressors that arise in the genome for each ERV family that enters the genomes of primates.
    [Show full text]
  • Detection of H3k4me3 Identifies Neurohiv Signatures, Genomic
    viruses Article Detection of H3K4me3 Identifies NeuroHIV Signatures, Genomic Effects of Methamphetamine and Addiction Pathways in Postmortem HIV+ Brain Specimens that Are Not Amenable to Transcriptome Analysis Liana Basova 1, Alexander Lindsey 1, Anne Marie McGovern 1, Ronald J. Ellis 2 and Maria Cecilia Garibaldi Marcondes 1,* 1 San Diego Biomedical Research Institute, San Diego, CA 92121, USA; [email protected] (L.B.); [email protected] (A.L.); [email protected] (A.M.M.) 2 Departments of Neurosciences and Psychiatry, University of California San Diego, San Diego, CA 92103, USA; [email protected] * Correspondence: [email protected] Abstract: Human postmortem specimens are extremely valuable resources for investigating trans- lational hypotheses. Tissue repositories collect clinically assessed specimens from people with and without HIV, including age, viral load, treatments, substance use patterns and cognitive functions. One challenge is the limited number of specimens suitable for transcriptional studies, mainly due to poor RNA quality resulting from long postmortem intervals. We hypothesized that epigenomic Citation: Basova, L.; Lindsey, A.; signatures would be more stable than RNA for assessing global changes associated with outcomes McGovern, A.M.; Ellis, R.J.; of interest. We found that H3K27Ac or RNA Polymerase (Pol) were not consistently detected by Marcondes, M.C.G. Detection of H3K4me3 Identifies NeuroHIV Chromatin Immunoprecipitation (ChIP), while the enhancer H3K4me3 histone modification was Signatures, Genomic Effects of abundant and stable up to the 72 h postmortem. We tested our ability to use H3K4me3 in human Methamphetamine and Addiction prefrontal cortex from HIV+ individuals meeting criteria for methamphetamine use disorder or not Pathways in Postmortem HIV+ Brain (Meth +/−) which exhibited poor RNA quality and were not suitable for transcriptional profiling.
    [Show full text]
  • Genetic Aberration Analysis in Thai Colorectal Adenoma and Early-Stage Adenocarcinoma Patients by Whole-Exome Sequencing
    cancers Article Genetic Aberration Analysis in Thai Colorectal Adenoma and Early-Stage Adenocarcinoma Patients by Whole-Exome Sequencing Thoranin Intarajak 1,2,3, Wandee Udomchaiprasertkul 4, Chakrit Bunyoo 2, Jutamas Yimnoon 5, Kamonwan Soonklang 6, Kriangpol Wiriyaukaradecha 4, Wisut Lamlertthon 7, Thaniya Sricharunrat 8, Worawit Chaiwiriyawong 9, Bunchorn Siriphongpreeda 7, Sawannee Sutheeworapong 1,3, Kanthida Kusonmano 1,3,10, Weerayuth Kittichotirat 1,3 , Chinae Thammarongtham 11, Piroon Jenjaroenpun 12 , Thidathip Wongsurawat 12 , Intawat Nookaew 12,13,14, Chirayu Auewarakul 7,* and Supapon Cheevadhanarak 3,10,* 1 Bioinformatics and Systems Biology Program, School of Bioresources and Technology and School of Information Technology, King Mongkut’s University of Technology Thonburi, Bangkok 10150, Thailand 2 Bioinformatics Unit for Genomic Analysis, Division of Research and International Relations, HRH Princess Chulabhorn College of Medical Science, Chulabhorn Royal Academy, Bangkok 10210, Thailand 3 Systems Biology and Bioinformatics Research Group, Pilot Plant Development and Training Institute, King Mongkut’s University of Technology Thonburi, Bangkok 10150, Thailand 4 Molecular Biology and Genomic Laboratory, Division of Research and International Relations, HRH Princess Chulabhorn College of Medical Science, Chulabhorn Royal Academy, Bangkok 10210, Thailand 5 Cytogenetics Unit, Central Research Laboratory, Division of Research and International Relations, HRH Princess Chulabhorn College of Medical Science, Chulabhorn Royal Academy,
    [Show full text]
  • HER2 Is Not a Cancer Subtype but Rather a Pan-Cancer Event and Is Highly Enriched in AR-Driven Breast Tumors Anneleen Daemen* and Gerard Manning*
    Daemen and Manning Breast Cancer Research (2018) 20:8 DOI 10.1186/s13058-018-0933-y RESEARCHARTICLE Open Access HER2 is not a cancer subtype but rather a pan-cancer event and is highly enriched in AR-driven breast tumors Anneleen Daemen* and Gerard Manning* Abstract Background: Approximately one in five breast cancers are driven by amplification and overexpression of the human epidermal growth factor receptor 2 (HER2) receptor kinase, and HER2-enriched (HER2E) is one of four major transcriptional subtypes of breast cancer. We set out to understand the genomics of HER2 amplification independent of subtype, and the underlying drivers and biology of HER2E tumors. Methods: We investigated published genomic data from 3155 breast tumors and 5391 non-breast tumors. Results: HER2 amplification is a distinct driver event seen in all breast cancer subtypes, rather than a subtype marker, with major characteristics restricted to amplification and overexpression of HER2 and neighboring genes. The HER2E subtype has a distinctive transcriptional landscape independent of HER2A that reflects androgen receptor signaling as replacement for estrogen receptor (ER)-driven tumorigenesis. HER2 amplification is also an event in 1.8% of non-breast tumors. Conclusions: These discoveries reveal therapeutic opportunities for combining anti-HER2 therapy with anti-androgen agents in breast cancer, and highlight the potential for broader therapeutic use of HER2 inhibitors. Keywords: Breast cancer, Cancer, Amplification, ERBB2, Genomic characterization, PAM50, Molecular apocrine, HER2- targeted treatment Background based on copy number and transcriptional profiling are Transcriptional profiling has enabled the classification of the 10 integrative clusters (IntClusts), with distinct copy many cancers into distinct gene expression subtypes, number profiles and genomic drivers, and with HER2+ allowing improved diagnosis and treatment selection.
    [Show full text]