Mot3, a Zn Finger Transcription Factor That Modulates Gene Expression and Attenuates Mating Pheromone Signaling in Saccharomyces Cerevisiae

Mot3, a Zn Finger Transcription Factor That Modulates Gene Expression and Attenuates Mating Pheromone Signaling in Saccharomyces cerevisiae

Anatoly V. Grishin, Michael Rothenberg,1 Maureen A. Downs and Kendall J. Blumer Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, Missouri 63110 Manuscript received January 13, 1998 Accepted for publication March 4, 1998

ABSTRACT In the yeast Saccharomyces cerevisiae, mating pheromone response is initiated by activation of a G protein- and mitogen-activated protein (MAP) kinase-dependent signaling pathway and attenuated by several mechanisms that promote adaptation or desensitization. To identify genes whose products negatively regulate pheromone signaling, we screened for mutations that suppress the hyperadaptive phenotype of wild-type cells overexpressing signaling-defective G protein ␤ subunits. This identiﬁed recessive mutations

in MOT3, which encodes a nuclear protein with two Cys2-His2 Zn fingers. MOT3 was found to be a dosage- dependent inhibitor of pheromone response and pheromone-induced gene expression and to require an intact signaling pathway to exert its effects. Several results suggested that Mot3 attenuates expression of pheromone-responsive genes by mechanisms distinct from those used by the negative transcriptional regulators Cdc36, Cdc39, and Mot2. First, a Mot3-lexA fusion functions as a transcriptional activator. Second, Mot3 is a dose-dependent activator of several genes unrelated to pheromone response, including CYC1, SUC2, and LEU2. Third, insertion of consensus Mot3 binding sites (C/A/T)AGG(T/C)A activates a promoter in a MOT3-dependent manner. These findings, and the fact that consensus binding sites are found in the 5Ј flanking regions of many yeast genes, suggest that Mot3 is a globally acting transcriptional regulator. We hypothesize that Mot3 regulates expression of factors that attenuate signaling by the pheromone response pathway.

HE pheromone response pathway of the yeast Sac- gradients, allowing mating to occur preferentially be- Tcharomyces cerevisiae is controlled by a complex inter- tween partners that produce high levels of pheromone play of positive and negative regulators of signal trans- or to resume proliferation if mating is unsuccessful duction (Bardwell et al. 1994). Secreted oligopeptide (Jackson et al. 1991; Segall 1993; Bardwell et al. mating pheromones (␣-factor and a-factor) induce the 1994). Desensitization or adaptation in yeast can occur expression of genes required for mating, inhibit cell by several mechanisms, including pheromone proteoly- proliferation, and trigger a differentiation program nec- sis (Ciejek and Thorner 1979; MacKay et al. 1988), essary for conjugation of haploid yeast cells of opposite receptor phosphorylation and downregulation (Jen- mating type. Pheromones exert their effects by activat- ness and Spatrick 1986; Reneke et al. 1988; Chen and ing a conserved signal transduction pathway consisting Konopka 1996), G protein deactivation by a putative of cell surface receptors, a heterotrimeric guanine nu- GTPase-activating protein Sst2, a member of the regula- cleotide-binding protein (G protein), and a mitogen- tors of G protein signaling (RGS) family (Dohlman et activated protein (MAP) kinase cascade, ultimately im- al. 1996), and MAP kinase dephosphorylation by dual pinging on a cyclin-dependent kinase inhibitor (Far1) specificity and tyrosine-specific protein phosphatases that induces growth arrest and a transcription factor (Doi et al. 1994; Zhan et al. 1997). Because the expres- (Ste12) that activates expression of pheromone-respon- sion of several of these negative regulatory factors is sive genes. pheromone-inducible, transcriptional regulation is Negative regulation of the pheromone response path- likely to be an important part of the adaptive process. way allows cells to adapt or become desensitized to a We have shown previously that adaptation is promoted signal of constant intensity. This is thought to be impor- strongly in wild-type cells that overexpress signaling- tant for cells to respond chemotropically to pheromone defective G protein ␤ subunits (Grishin et al. 1994). The mechanism of this “hyperadaptive” phenotype may be novel because it does not involve pheromone degra- Corresponding author: Anatoly Grishin, Department of Cell Biology dation, receptor phosphorylation or endocytosis, Sst2, and Physiology, Washington University School of Medicine, 660 S. or the dual-specificity phosphatase encoded by MSG5. Euclid Ave., Box 8228, St. Louis, MO 63110-1093. E-mail: [email protected] From our previous studies we hypothesized that overex- 1 Present address: University of California School of Medicine, San pression of mutant G␤ subunits in wild-type cells pro- Francisco, CA 94143. motes an adaptive process that attenuates pheromone

Genetics 149: 879–892 ( June, 1998) 880 A. V. Grishin et al.

TABLE 1 Yeast strains used in this study

Strain Genotype Source or reference W303-1B MATa ade2 his3 ura3 leu2 trp1 R. Rothstein W303az1 W303-1B mot3::URA3 This work AG56 MATa ade2 his3 ura3 leu2 trp1 sst1⌬ Grishin et al. (1994) AG56-5 AG56-46 AG56-58 AG56-80 Hyperadaptation-defective derivatives of AG56 This work AG56-102 AG56-119 AG56-138 AG56-143 AG62 Diploid of cross between AG56 ϫ W303-1B This work AG62z Diploid of cross between AG64 ϫ W303az1 This work AG64 AG56 mot3::URA3 This work AG65a AG56 mot3::ura3 This work AG66 AG65 ste2::LEU2 This work AG67 AG65 ste4::URA3 This work AG68 AG65 ste18-1 This work AG69 AG65 ste20::URA3 This work AG70 AG65 ste11::URA3 This work AG71 AG65 ste7-A1 This work AG72 AG65 ste12::LEU2 This work 31K MATa ade8 ura3 trp1 arg4 This work L40 MATa ade2 his3 leu2 trp1 gal4 gal80 S. Hollenberg

LYS2::(lexAop)4-HIS3 URA3::(lexAop)8-lacZ DC14b MATa his1 Weiner et al. (1993) DC17b MAT␣ his1 Weiner et al. (1993) a A UraϪ derivative of AG64 selected on SD with 5-ﬂuoroorotic acid (0.1%). b Mating type testers.

response. As part of an effort to define this adaptive marked derivative pRS425 FUS1-lacZ (FUS1-lacZ; McCaffrey Meluh Rose mechanism, we report the identification of mutations et al. 1987); pMR1300 (KAR3-lacZ; and 1990). Other newly constructed promoter-lacZ fusions were made by that abrogate the hyperadaptive phenotype. This has using BamHI and EcoRI-cut YEp357R (Myers et al. 1986) as identified the MOT3 gene, a previously uncharacterized a recipient for PCR-generated promoter DNA fragments with gene that encodes a member of the Cys2-His2 Zn finger the following endpoints relative to translation starts: Ϫ517 to family of transcription factors. We present evidence that ϩ132 (CUP1), Ϫ245 to ϩ243 (FUS3), Ϫ811 to ϩ60 (SST2), Mot3 is a transcriptional regulator of several yeast genes, and Ϫ335 to ϩ182 (AGA1), resulting in plasmids pAG33, pAG34, pAG35, and pAG36. ␤-Galactosidase levels for these possibly including those involved in attenuating the ac- plasmids have been reported by others or confirmed by us tivity of the pheromone response pathway. (unpublished results) to correlate with transcript levels. pAG37 was constructed by inserting four lexA operators (Kel- eher et al. 1992) into the SalI site upstream of the GAL1 MATERIALS AND METHODS promoter of pD-lacZ R37 (Singer et al. 1990). To construct pAG38, the oligonucleotides (CTAGAAGCAGGCATTAC Strains and media: Yeast strains used in this study are listed AAGGCACTGACAGGTAAAACAGGTAAAGGCA and CTAGT in Table 1. Growth media (YPD, YPG, supplemented SD, and GCCTTTACCTGTTTTACCTGTCAGTGCCTTGTAATGCCT sporulation media) were prepared as described previously GCTT; Mot3 binding sites are underlined) were annealed and (Sherman 1991). SGal contains galactose (2%) and sucrose the resulting duplex inserted into the XbaI site of pAG33. (0.2%) instead of glucose. Synthetic ␣-factor (Washington pAG40 was constructed by inserting a 2.4-kb EcoRI-SalI frag- University Protein Chemistry Laboratory, St. Louis, MO) was ment encompassing the entire MOT3 gene and its promoter added to media to a final concentration of 1 ␮m, unless indi- into EcoRI and SalI-cut pFAT-RS303ЈbЈ (provided by D. Gott- cated otherwise. schling, Fred Hutchinson Cancer Center, Seattle, WA). To Plasmids: The following plasmids were used as promoter- construct pAG44, the 3Ј part of MOT3 was amplified with lacZ fusion reporters: pLGD312s (CYC1-lacZ ; Guarente and primers CCGCTCGAGTCATCAGACCATAAATATATCC and Hoar 1984), pBM2773 (SUC2-lacZ), pBM2636 (HXT1-lacZ ), CGGGATCCTTGTTAAATGAGTGGGAAGGG and cloned pBM2717 (HXT2-lacZ ), pBM2819 (HXT3-lacZ ), pBM2800 into XhoI and BamHI-cut pET-15b (Novagen). pAG41 was con- (HXT4-lacZ), pBM2832 (LEU2-lacZ ; Ozcan and Johnston structed by amplifying the complete MOT3 open reading 1996a), pJJ13 (PCK1-lacZ ; Mercado and Gancedo 1992); pD- frame (ORF) with primers GGATCCGGACATATCATATTT lacZ R37 (GAL1-lacZ; Singer et al. 1990); pSL307 and its LEU2- GAG and ATCGATTTTGTTGTGACTAACAATAAGGTT and Mot3 Transcription Factor of Yeast 881

cloning the PCR product into BamHI and ClaI-cut pGFP- phates (dNTPs), if necessary. For experiments designed to C-FUS (Niedenthal et al. 1996). pAG42 was constructed define a consensus Mot3 binding site, a set of labeled probes by amplifying the entire MOT3 coding sequence with pri- having the same specific activity was prepared in the following mers GGAATTCGGGACATATCATATTCGAGCAATGAATG way. Oligonucleotides with the sequences GCAACCAGXXXX CGG and GGATCCTTGTTAAATGAGTGGGAAGGG and by XXGACGACAACAACTGTGCTGCTGA, where XXXXXX are cloning the amplification product into EcoRI and BamHI-cut variants of the sequence CAGGCA (2 pmol each) were an- pSH2-1 (Ma and Ptashne 1987). pBM3306 (Ozcan and John- nealed to 0.1 pmol of the primer TCAGCAGCACAGTTGTTG ston 1996b) and pAG3-26 (Grishin et al. 1994) were de- TCGTC, which had been 5Ј-end-labeled (the same prepara- scribed previously. A YCp50-based yeast genomic DNA library tion of labeled primer was used to generate each probe); the (Rose et al. 1987) was used to clone the MOT3 gene. primer was extended with Klenow polymerase and dNTPs. Genetic methods: Ethylmethane sulfonate (EMS) mutagen- Binding reactions (20 ␮l) contained labeled probe (20,000 esis, crosses, and asci dissection were performed as described Cerenkov counts; 0.1 ng or less), purified His-tagged Mot3⌬N previously (Guthrie and Fink 1991). Hyperadaptation-defec- (0.2 ␮g, unless indicated otherwise) or His-tagged Go␣ (0.2 tive mutants that retain the ability to overexpress signaling- ␮g), bovine serum albumin (1 ␮g), competitor DNA as indi- m m m defective G␤ subunits were identified based on their ability to cated, Tris pH 7.5 (10 m ), KCl (50 m ), MgCl2 (10 m ), m adopt shmoo-like morphologies when grown on galactose. ZnSO4 (10 ␮ ), and glycerol (10%). Samples were incubated Based on our previous studies (Grishin et al. 1994), this partial 15 min at 30Њ and separated by electrophoresis through 4% constitutive activation of the pathway apparently occurs be- polyacrylamide gels (80:1 acrylamide:bis) in 0.5ϫ Tris-acetate- cause mutant G␤␥ complexes sequester G␣ subunits, liberating EDTA (TAE) buffer. Gels were dried and exposed to X-ray sufficient wild-type G␤␥ complexes to cause partial constitutive film; alternatively, images were acquired on a Phosphorimager activation of the pathway. Spheroplasts were fused in the pres- II and quantified using ImageQuant software (Molecular Dy- ence of polyethylene glycol according to published methods namics, Sunnyvale, CA). Methylation interference experi- (van Solingen and van der Platt 1977). One of the parents ments used as a probe a double-stranded oligonucleotide cor- carried pAG3-26 and the other parent carried YCp50, allowing responding to the region of the CYC1 promoter between bases fusion diploids to be selected by plating on media lacking Ϫ195 and Ϫ119 (relative to the translational start). This 5Ј- uracil and histidine. Gene disruptions were performed by us- labeled DNA was treated with dimethyl sulfate and subjected ing the one-step replacement technique (Rothstein 1991). to EMSA, as described above. Samples were fractionated elec- The plasmid pBMK8 (provided by D. Levin, Johns Hopkins trophoretically through a 1.5% agarose gel in 0.5ϫ TAE University) was used to disrupt MOT3 with URA3. This plasmid buffer; shifted and unshifted bands were located by autoradi- is a derivative of YEp352 (Hill et al. 1986) carrying a 3-kb ography and excised. These DNA samples were cleaved at genomic BamHI-SphI MOT3 fragment in which a central NotI- guanosine residues by using Maxam-Gilbert chemistry and NheI 800-bp portion of the coding sequence (encoding amino resolved on sequencing gels. acids 116–424, which includes both Zn fingers) was replaced Pheromone response assays: Quantitative mating tests, halo with a 1.1-kb URA3 fragment. A 3-kb SphI-EcoRI fragment con- assays, morphological response assays, and measurement of taining the disrupted MOT3 gene was isolated and used for pheromone-induced gene expression were performed as de- Grishin one-step gene replacement. The STE20 gene was disrupted as scribed previously ( et al. 1994). The following assay follows. A 5.5-kb EcoRI-KpnI partial digestion product of yeast was also used to detect differences in adaptation capacity. genomic DNA carrying the STE20 gene was cloned into EcoRI Exponentially growing cultures were diluted to 500 cells/ml and KpnI-cut pRS314 (Sikorski and Hieter 1989) to make in YPD and 100-␮l aliquots of this diluted culture were dis- pAG5. A 3.2-kb SphI-KpnI fragment encompassing the entire pensed into wells of a sterile 96-well plate. After various STE20 gene was replaced with a 1.1-kb URA3 fragment, re- amounts of synthetic ␣-factor were added to the wells, the sulting in pAG6. pAG6 was cleaved with EcoRI and HindIII plate was covered and incubated at 30Њ for 2 days. The absence and used for one-step gene replacement. The STE4, STE11, of growth indicated the inability to adapt to a given phero- and STE12 genes were disrupted using the following plasmids: mone concentration. PstI and XhoI-cut pAG4 (Grishin et al. 1994), XbaI-cut pNC276 Other methods: RNA isolation from yeast and Northern Rhodes Fields blotting were performed as described (Flick and Johnston ( et al. 1990), and SacI and SphI-cut pSUL16 ( 32 and Herskowitz 1987). All disruptions were confirmed by 1990). As a hybridization probe, a P-labeled 800-bp PstI- PCR or Southern blotting. Derivatives of the strain AG65 car- SacII fragment from MOT3 ORF was used. For fluorescence rying ste18 or ste7 mutations were selected among spontaneous microscopy, wild-type cells (strain 31K) were transformed with pheromone-resistant mutants and identified by complementa- pAG41, transformants grown overnight in SD-uracil, and transferred into SD-uracil-methionine for 5–6 hr to induce expres- tion with M91p1 (STE18)(Whiteway et al. 1989) and pSTE7.2 sion of the Mot3-GFP fusion protein. Cells were harvested by (STE7 )(Teague et al. 1986), respectively. Purification of recombinant His-tagged Mot3⌬N protein, centrifugation at 1000 rpm, fixed with 3.8% formaldehyde for ␮ electrophoretic mobility shift assays (EMSA), and methylation 5 min, and stained with DAPI (0.1 g/ml) for 15 min. Images were obtained using BX60 microscope (ϫ100 objective) interference assays: Escherichia coli [BL21(DE3); Novagen] car- equipped with BX-FLA reflected light fluorescence attach- rying pAG44 were grown to late-log phase, and His-tagged ment (Olympus, Lake Success, NY) and VE-470 camera (Op- Mot3⌬N (residues 339-490, including both Zn fingers) was tronics, Goleta, CA). purified by affinity chromatography on Ni2ϩ-NTA resin, as Nucleotide sequence accession number: The nucleotide se- described previously (Watson et al. 1996). Promoter DNA quence of the MOT3 gene was deposited in GenBank under fragments for EMSA were prepared by using T4 polynucleo- the accession number U25279 (Madison et al. 1998). tide kinase and [␥-32P]ATP to end-label PCR fragments with the following endpoints relative to translation starts: Ϫ295 to ϩ40 (CYC1), Ϫ636 to ϩ34 (SUC2), Ϫ462 to ϩ42 (FUS1), Ϫ517 to ϩ132 (CUP1), Ϫ410 to ϩ13 (LEU2), Ϫ263 to Ϫ17 RESULTS (FUS3), and Ϫ811 to ϩ60 (SST2). Double-stranded oligonucle- Isolation of suppressors of hyperadaptation: Hyper- otide probes were prepared by annealing two completely or partially overlapping complementary oligonucleotides, one of adaptation to pheromone promoted by overexpression which was labeled at the 5Ј end, and by filling in recessed 3Ј of signaling-defective G␤ subunits is independent of sev- ends with Klenow polymerase and deoxynucleoside triphos- eral known adaptive mechanisms in yeast (Grishin et 882 A. V. Grishin et al. al. 1994). We therefore reasoned that identifying genes whose functions are required for hyperadaptation may reveal new negative controls of the pheromone response pathway. We used the following approach to isolate mutants in which the hyperadaptive phenotype is abro- gated. Wild-type MATa cells (AG56) overexpressing signaling-defective G␤ subunits (from the inducible GAL promoter on pAG3-26) were treated with EMS to induce mutations and grown to form colonies. Approximately 50,000 colonies were screened by replica plating for mutants that have lost the ability to grow on media containing ␣-factor at a concentration that inhibits growth of normal but not hyperadaptive cells. Pheno- typic analysis indicated that the majority of these mutants failed to overexpress signaling-defective G␤ subunits, as expected (see materials and methods). However, eight isolates (AG56-5, -46, -58, -80, -102, -119, -138 and -143) were putative hyperadaptation-defective mutants because they retained the ability to overexpress mutant G␤ subunits. This was confirmed by performing pheromone-induced growth arrest (halo) assays under conditions where signaling-defective G␤ subunits were overexpressed. The eight mutants responded relatively normally to pheromone (halo sizes were normal), but they failed to adapt rapidly (halos were clear instead of being turbid; Figure 1 shows the halo phenotype of mutant AG56-5, which was similar to that of the seven other mutants). The failure to form turbid halos was not due to decreased viability upon treatment with pheromone (data not shown). To determine whether the mutations responsible for the hyperadaptation defects were dominant or recessive Figure 1.—Pheromone response phenotypes of wild-type and to assign complementation groups, we fused sphe- cells, hyperadaptation-defective mutants, and MOT3-overex- roplasts of each mutant with spheroplasts of wild-type pressing cells. Pheromone-induced growth arrest (halo) assays MATa cells, or with spheroplasts of the other mutants. were performed using Sgal -histidine -uracil medium. ␣-Fac- The hyperadaptation phenotypes of the resultant fusion tor (1, 0.2, 0.04, 0.008, and 0.0016 ␮g, clockwise from top) was applied on nascent lawns. Plates were incubated 2 days at diploid cells were determined by performing halo assays 30Њ and photographed. (A) Wild-type cells (AG56) containing under conditions where signaling-defective G␤ subunits control plasmids YCp50 and pRS313. (B) Wild-type cells were overexpressed. All of the mutations appeared to (AG56) overexpressing signaling-defective G␤ subunits (from be recessive, because MATa/MATa diploids produced pAG3-26) and carrying YCp50. (C) Hyperadaptation-defective by fusion of mutants with wild-type cells formed turbid mutant (AG56-5) overexpressing signaling-defective G␤ subunits (from pAG3-26) and carrying YCp50. (D) Hyperadapta- halos (data not shown). Assays of diploids produced by tion-defective mutant (AG56-5) overexpressing signaling- pairwise fusions of the mutants defined two comple- defective G␤ subunits (from pAG3-26) and carrying a genomic mentation groups: seven mutants belong to one com- library plasmid (pAG50⌬R) that corrects the hyperadaptation plementation group and one mutant belongs to the defect. (E) A mot3::ura3 mutant (AG65) overexpressing signal- other complementation group (data not shown). The ing-defective G␤ subunits and carrying YCp50. (F) Wild-type cells (AG56) overexpressing MOT3 from 2␮-based plasmid following sections describe the identification and char- pAG40 and carrying YCp50. acterization of the gene corresponding to the larger complementation group; studies of the second complementation group will be reported elsewhere. Cloning, sequencing, and expression of MOT3: A mids caused pheromone resistance because they result YCp50-based yeast genomic DNA library was screened in expression of the a1/␣2 repressor that turns off ex- for plasmids that corrected the hyperadaptation defect pression of mating-specific genes. The remaining plas- of mutant AG56-5 (restored the ability of cells to form mid contained a 4.5-kb fragment from the right arm colonies on plates containing ␣-factor). Of the eight of chromosome XIII. The minimum complementing plasmids isolated, partial sequencing revealed that seven region of this 4.5-kb fragment (a 2.4-kb EcoRI-SalI sub- contained either the MAT␣ or HML␣ genes. These plas- fragment) contained a single ORF corresponding to Mot3 Transcription Factor of Yeast 883

Figure 3.—Adaptation phenotypes of wild-type, mot3::ura3 mutant, and MOT3-overexpressing cells. Wild-type (AG56), mot3::ura3 (AG65), and MOT3-overexpressing (AG56 con- Figure 2.—Structure of Mot3 and its similarity to other Zn taining MOT3 on the high-copy plasmid pAG40) cells were 100ف finger proteins. (A) Structural features of Mot3. Black, Zn analyzed. Wells of a 96-well plate were inoculated with fingers; vertical lines, glutamine-rich region; shaded, aspara- cells of the indicated genotypes in 100 ␮l of YPD, and the gine-rich regions; hatched, region rich in proline residues. indicated levels of ␣-factor were added. The plate was incu- The positions of the N and the C termini are indicated (posi- bated 2 days at 30Њ and photographed. Cells that adapted to tions 1 and 490, respectively). (B) Alignment of the Zn fingers a given level of pheromone grew to form turbid cultures, of Mot3 with related Zn finger transcription factors. Amino which appear black when photographed in transmitted light; acid sequences are aligned to match the conserved cysteine cultures that did not adapt and failed to grow appear white. and histidine residues. Gaps were introduced to maximize similarity. Identical and similar residues are boxed in black. Asterisks mark residues involved in DNA recognition according to the Zn finger recognition code. PLAG1, human are responsible for the hyperadaptation defects of the Zn finger protein (accession number U65002); ROAZ, rat Zn original mutants, we studied genetic linkage between finger protein (U92564); ZNF6, human transcription factor one of the mutations and the MOT3 locus. MOT3 was (S25409); ZFP64, mouse Zn finger protein (U49046); MAZ, disrupted with the URA3 gene (in W303-1B; the dis- human Zn finger protein (U33819). Numbers on the right ruptants were viable), and the resultant strain was indicate positions of Zn fingers in the amino acid sequence of each protein. crossed with the mutant AG56-5. Twenty haploid MATa UraϪ meiotic segregants derived from this cross were transformed with a plasmid (pAG3-26) that overex- presses signaling-defective G␤ subunits. The results of YMR070W. This ORF encodes a polypeptide of 490 halo assays showed that all 20 UraϪ segregants were amino acids with two Cys2-His2 Zn finger motifs (consen- hyperadaptation-defective (clear halos; data not shown), Klug Rhodes sus CX(2-4)CX(9)LX(2)HX(3-4)H( and 1987) indicating that the original mutation in AG56-5 and the in the C-terminal half of the molecule (Figure 2). Zn mot3::URA3 disruption are tightly linked. We also found fingers of this class form DNA binding domains of a that mutants carrying the mot3::URA3 allele and the large family of transcription factors (Evans and Hol- original AG56-5 mutant displayed equivalent defects in lenberg 1988), which suggests that the cloned gene hyperadaptation, as indicated by halo assays (Figure encodes a transcription factor. The Zn fingers are most 1E). Therefore, MOT3 appeared to be defective in the similar to those of several mammalian Zn finger tran- original mutants. Subsequently, the properties of mot3 scription factors, including MAZ and Zfp64 (Figure 2). mutations were studied using mot3 disruption strains. The yeast gene product has other features of a transcrip- MOT3 negatively regulates pheromone signaling: To tion factor, including regions rich in glutamine or pro- determine whether MOT3 influences pheromone re- line (Tjian and Maniatis 1994), and high concentra- sponses in cells that do not overexpress signaling- tion of positively charged and polar amino acids in the defective G␤ subunits, we examined the effects of mot3 Zn finger domain (Klug and Rhodes 1987). We named mutations on several signaling-related phenotypes. First, the gene MOT3 because subsequent experiments indi- in quantitative mating assays or halo assays, mot3 mutants cated that it is a modulator of transcription. Northern were indistinguishable from isogenic wild-type controls blotting revealed that MOT3 was expressed at similar (data not shown). However, because it can be difficult levels regardless of cell type or pheromone exposure to detect modest differences in adaptation phenotypes (data not shown). by halo assay, a second type of adaptation assay was used To determine whether mutations in the MOT3 gene (see materials and methods). The results indicated 884 A. V. Grishin et al.

Figure 4.—Effects of MOT3 on pheromone re- sponses. Dose-response curves for ␣-factor-induced expression of SST2-lacZ (A) and FUS1-lacZ (B). The strains used were AG56 (WT), AG65 (mot3⌬), and AG56[pAG40] (2␮-MOT3). Cells grown to early log phase (Klett ϭ 10) in appro- priately supplemented SD media were incubated for 2 hr at the indicated pheromone concentrations prior to assaying ␤-galactosidase activity. Squares, mot3⌬; cir- cles, 2␮-MOT3; diamonds, wild type.

that wild-type cells were able to grow (adapt) at a two- stimulated adaptation, as judged by the formation of fold higher concentration of ␣-factor than could mot3 smaller, turbid halos (Figure 1F) and by the ability of mutants (Figure 3). Similarly, mot3 mutants were three- cells to grow in liquid media containing higher concen- fold more sensitive to pheromone, as indicated by dose- trations of ␣-factor (Figure 3). These lines of evidence response curves for pheromone-induced morphological suggest that MOT3 is a dosage-dependent regulator of changes (shmoo formation; data not shown). pheromone signaling and/or adaptation. MOT3 overexpression had the opposite effects. It MOT3 represses expression of pheromone-induced markedly decreased sensitivity to pheromone and/or genes and activates expression of other yeast genes:

TABLE 2 Effects of MOT3 disruption and overexpression on gene expression

␤-Galactosidase activity (Miller units) Reporter Growth condition mot3⌬ WT 2␮-MOT3 Repressed reporters: SST2-lacZ SD 70 Ϯ 10 25 Ϯ 310Ϯ2 FUS1-lacZ SD 14 Ϯ 2 5.3 Ϯ 1 1.6 Ϯ 0.3 AGA1-lacZ SD 28 Ϯ 4 5.0 Ϯ 1 1.3 Ϯ 0.1 FUS3-lacZ SD 33 Ϯ 214Ϯ2 5.5 Ϯ 1 KAR3-lacZ SD 6.2 Ϯ 1 3.8 Ϯ 0.5 2.2 Ϯ 0.3 Activated reporters: SUC2-lacZ SGal ϩ 0.1% glucose 3.2 Ϯ 112Ϯ233Ϯ4 CYC1-lacZ SGal 9.0 Ϯ 233Ϯ3 118 Ϯ 11 LEU2-lacZ SD 34 Ϯ 577Ϯ10 180 Ϯ 20 HXT2-lacZ SGal ϩ 0.1% glucose 60 Ϯ 565Ϯ5 500 Ϯ 100 HXT3-lacZ SD (4% glucose) 500 Ϯ 100 550 Ϯ 100 1100 Ϯ 150 HXT4-lacZ SGal ϩ 0.1% glucose 130 Ϯ 20 150 Ϯ 25 380 Ϯ 50 Unaffected reporters: PCK1-lacZ SGal 3.9 Ϯ 2.3 4.4 Ϯ 0.8 NDa HXT1-lacZ SD 75 Ϯ 15 75 Ϯ 20 75 Ϯ 20 GAL1-lacZ SD Ͻ1 Ͻ1 Ͻ1 GAL1-lacZ SGal 350 Ϯ 20 365 Ϯ 20 350 Ϯ 20 CUP1-lacZ SD 60 Ϯ 665Ϯ10 65 Ϯ 10 Unaffected reporter with introduced artiﬁcial Mot3 binding sites: CUP1 SD 60 Ϯ 6 272 Ϯ 30 NDa (5ϫ MBS)-lacZ b a ND, not determined. b CUP1 promoter with ﬁve copies of a consensus Mot3 binding site (5ϫ MBS). Mot3 Transcription Factor of Yeast 885

mutants for a variety of phenotypes, including growth Figure 5.—Effects of rate in YPD, YPD ϩ 1 m KCl, YP ϩ glycerol, and synthetic MOT3 onCYC1 and SUC2 tran- media; growth at 37Њ or 14Њ; sensitivity to heat shock script levels. Total RNA (10 ␮g m per lane) from AG64 (mot3⌬), (45Њ for 30 min); survival rate after transfer from 1 AG56 [YCp50] (WT), and sorbitol to water; survival upon irradiation with short- AG56 [YEp352-MOT3]was wave ultraviolet light at 20 mJ/cm2; survival in stationary treated with glyoxal, electro- phase; and effects on cell morphology or sporulation phoresed through a 1.2% aga- efficiency. Wild-type cells and mot3 mutants were indis- rose gel, and transferred to a charged Nylon membrane. tinguishable with regard to these phenotypes (data not Northern blots were hybrid- shown). However, when isogenic wild-type and mot3 mu- ized to end-labeled 50-mer tants were continuously cocultivated in YPD for 100 antisense oligonucleotides cor- generations, the proportion of mutant cells dropped responding to coding se- from 50 to 30%, indicating a slight selective disadvan- quences of the indicated genes. Radioactivity present in tage conferred by the disruption. each band was measured using MOT3 requires an intact signaling pathway to affect a Phosphorimager; relative ra- expression of pheromone-induced genes: Previous in- dioactivity values are shown be- vestigations have revealed that basal expression of pher- low each panel. omone-induced genes is controlled in part by mechanisms that require an intact signaling pathway, as well as mechanisms that do not (Bardwell et al. 1994). To determine which of these mechanisms may be affected Consistent with the effects of MOT3 on pheromone- by MOT3, we constructed a set of isogenic strains in induced growth arrest and morphological changes, we which a mot3::ura3 disruption was combined with reces- found that MOT3 negatively regulates expression of sive mutations affecting various components of the pheromone-induced genes. In mot3 mutants, basal and pheromone response pathway [G protein ␤- and ␥-sub- pheromone-induced (at low pheromone concentra- units (ste4 and ste18 mutations, respectively), a PAK tion) expression of FUS1-lacZ and SST2-lacZ reporters homolog (ste20 mutation), an MEKK homolog (ste11 was increased (Figure 4). Similar increases in basal gene mutation), MEK homolog (ste7 mutation), or the phero- expression were observed with several other pheromone-regulated transcription factor (ste12 mutation)]. mone-inducible promoters (AGA1, FUS3, and KAR3) These strains were used to measure the basal expression driving expression of lacZ (Table 2), indicating that a of a pheromone-inducible reporter (FUS1-lacZ). Unlike mot3 mutation is likely to have similar effects on most, what we observed with cells containing an intact signal- if not all, pheromone-induced promoters. Conversely, ing pathway, disruption of MOT3 failed to increase basal MOT3 overexpression inhibited expression of phero- gene expression when the pathway was disrupted at mone-induced genes about threefold, as indicated by the G protein level or points downstream (Table 3). shifts in dose-response curves (Figure 4B) and basal Therefore, the effects of a mot3 mutation were similar to expression levels (Table 2). To determine whether MOT3 specifically regulates pheromone-inducible genes, we examined the expres- TABLE 3 sion of genes unrelated to pheromone response or mat- Effects of ste mutations on basal expression of ing. As shown in Table 2 and Figure 5, the expression FUS1-lacZ in mot3 null mutants of several genes was affected by MOT3. Surprisingly, the effects of MOT3 on these promoters were opposite of Basal ␤-galactosidase activity what was observed with pheromone-responsive promot- (Miller units) ers. A mot3 mutation decreased expression from the Relevant genotype pSL307 pRS425-FUS1-lacZ CYC1, SUC2, and LEU2 promoters an average of threefold. Conversely, MOT3 overexpression increased ex- STE 5.3 Ϯ 1 5.0 Ϯ 1 pression from the CYC1, SUC2, LEU2, HXT2, HXT3, ste4::URA3 Ͻ1 and HXT4 promoters, with HXT2 being induced most ste7-A1 Ͻ1 Ͻ strongly (eightfold). However, the expression of other ste11::URA3 1 ste12::LEU2 Ͻ1 genes, including PKC1, HXT1, GAL1, and CUP1, was ste18-A1 Ͻ1 unaffected by MOT3. Therefore, MOT3 represses pher- ste20::URA3 Ͻ1 omone-inducible genes and activates a subset of genes unrelated to pheromone signaling or mating. mot3::ura3 (AG65) cells and isogenic ste mutant derivatives were transformed with pSL307 or pRS425-FUS1-lacZ, depending Because MOT3 regulates a significant proportion of on the disruption. Cultures used for ␤-galactosidase assays the promoters we examined, it may affect expression were grown to mid-log phase (Klett ϭ 40) in SD-uracil or SD- of many yeast genes. Accordingly, we examined mot3 leucine. 886 A. V. Grishin et al. those of cdc36, cdc39, and mot2 mutations, which elevate binding domain (amino acids 1–87). To test for activator basal expression of pheromone-responsive genes in a function, we used a GAL1-lacZ reporter in which lexA pathway-dependent manner (de Barros Lopes et al. binding sites replace the normal GAL1 upstream activa- 1990; Neiman et al. 1990; Cade and Errede 1994; Irie tion sequence (UAS). As shown in Table 4, this reporter et al. 1994; Leberer et al. 1994). This is distinct from was induced ෂfivefold in cells expressing the lexA-Mot3 the effects of a mot1 mutation, which elevates basal tran- fusion protein. To test for repressor activity, we used a scription of pheromone-responsive genes indepen- GAL1-lacZ reporter plasmid in which lexA binding sites dently of the pheromone response pathway (Davis et were placed immediately upstream of the GAL1 UAS. al. 1992). Expression from this reporter was unaffected by the Mot3-GFP localizes to the nucleus: We fused green presence of lexA-Mot3. In contrast, this reporter was fluorescent protein (GFP) to the C terminus of Mot3 repressed about twofold when Rgt1, a known repressor (the chimeric protein was functional, as indicated by its protein, was fused to lexA. Expression of either lexA or ability to correct the hyperadaptation defect of a mot3 Mot3 alone had no effect on either reporter. These null mutant). Mot3-GFP fluorescence was restricted results suggest that Mot3 can function as a transcrip- mostly to the nucleus, as indicated by costaining with tional activator. They do not rule out that Mot3 can DAPI (Figure 6), consistent with Mot3 functioning as a also function as a transcriptional repressor. transcription factor. DNA binding activity of Mot3: To determine whether Mot3 is a transcriptional activator: The preceding Mot3 is likely to function as a sequence-specific tran- results indicate that Mot3 is a nuclear protein that re- scription factor, we examined the ability of purified His- presses or activates gene expression, depending on the tagged Mot3⌬N (residues 339–490, containing both Zn promoter being examined. To investigate whether tran- fingers) to bind DNA in electrophoretic mobility shift scriptional repressor and/or activator function is intrin- assays (EMSA). Four promoter probes were used: CYC1, sic to the Mot3 polypeptide, we determined whether SUC2, and FUS1, which are affected by MOT3, and CUP1, Mot3 activates or represses gene expression when it is which is not. Promoter DNA fragments from all four recruited to a heterologous promoter. This was done genes bound His-tagged Mot3⌬N, as indicated by the by fusing Mot3 to the C terminus of the lexA DNA appearance of one or more slower migrating bands relative to unbound DNA probe bands. A control protein

(His-tagged Go␣ purified in an identical manner) did not bind the probes. Binding was specific because unlabeled probe DNAs were effective competitors, whereas poly(dA)·poly(dT) and poly(dIdC)·poly(dIdC) were not (Figure 7). Poly(dG)·poly(dC) was an effective competitor for binding to the SUC2 probe (Figures 7 and 8) or other labeled probes (data not shown), suggesting that Mot3 binding sites may be GC-rich. Although all four promoters we tested bound His- tagged Mot3⌬N, several pieces of evidence suggested that their relative binding affinities differ. First, the CYC1 and SUC2 probes were shifted to multiple retarded positions, whereas FUS1 and CUP1 probes were only shifted to a single retarded position (Figure 7). Second, at a concentration of Mot3⌬N that was sufficient to bind nearly all of the CYC1 and SUC2 probes, only a fraction of the FUS1 or CUP1 probes was shifted (Figure 7). Third, competition experiments indicated that unlabeled CYC1 and SUC2 promoter fragments were efficient competitors for binding to a labeled SUC2 promoter fragment, whereas FUS1 and CUP1 fragments were inefficient competitors (Figure 8). Similarly, a fragment of the LEU2 promoter, which is positively regulated by MOT3, bound His-tagged Mot3⌬N relatively efficiently (multiple shifted bands) and was an effective competitor for binding to the SUC2 probe (data not Figure 6.—Nuclear localization of Mot3-GFP. Wild-type shown). Therefore, efficient binding of Mot3⌬N to the cells (31K) containing pAG41 (top), pGFP-C-FUS (middle), CYC1, SUC2, and LEU2 promoters in vitro correlated or YCp50 (bottom) were grown overnight in SD-uracil and then for 6 hr in SD -uracil -methionone. Cells were fixed with with the ability of MOT3 to stimulate expression of these formaldehyde, stained with DAPI, and observed under the genes, suggesting that Mot3 may bind these promoters fluorescence microscope. to activate them. Mot3 Transcription Factor of Yeast 887

TABLE 4 Effects of Mot3-lexA on expression from promoters containing lexA operators

Yeast Reporter DNA binding ␤-Galactosidase activity strain constructa proteinb (Miller units)c Test for activator function:

L40 lexAop-GAL1⌬UAS-lacZ None 1.1 Ϯ 0.2 L40 lexAop-GAL1⌬UAS-lacZ lexA1-87 1.3 Ϯ 0.2 L40 lexAop-GAL1⌬UAS-lacZ lexA1-87-Mot3 5.2 Ϯ 0.6 L40 lexAop-GAL1⌬UAS-lacZ Mot3 1.1 Ϯ 0.2 Test for repressor function: AG56 lexAop-GAL1-lacZ None 360 Ϯ 40 AG56 lexAop-GAL1-lacZ lexA1-87 380 Ϯ 40 AG56 lexAop-GAL1-lacZ lexA1-87-Mot3 360 Ϯ 40 AG56 lexAop-GAL1-lacZ Mot3 350 Ϯ 40 AG56 lexAop-GAL1-lacZ lexA1-87-Rgt1 200 Ϯ 20 a The reporter construct used to detect activator function in strain L40 is integrated, whereas that used to detect repressor activity in strain AG56 is caried on plasmid pAG37. b DNA binding proteins were expressed from the following plasmids: pSH2-1 (lexA1-87), pAG42 (lexA1-87- Mot3), pBM3306 (lexA1-87-Rgt1), pAG40 (Mot3). Control cells contained pRS313 to allow growth in the absence of histidine. c ␤-Galactosidase activities were determined in cultures grown to Klett 40 in SD-histidine (UAS-less construct) or SGal-uracil-histidine (intact promoter construct).

Identification of a consensus Mot3 binding site: To (Choo and Klug 1997). The sequence of the Mot3 Zn identify promoter elements that may be bound by Mot3, fingers suggested that the Mot3 binding site is a 6-bp we initially used the recognition code for Cys2-His2 Zn element in which the second, third, fourth, and sixth finger proteins to deduce a putative Mot3 binding site positions are likely to be A, G, G, and G, respectively. Because the other two positions of the putative recognition site could not be deduced by the Zn finger recog-

Figure 8.—Competition of various DNAs for binding His- tagged Mot3⌬N. Binding reactions were performed with a 32P- labeled DNA fragment from the SUC2 promoter, His-tagged Figure 7.—Electrophoretic mobility shift assays (EMSA) Mot3⌬N, and varying amounts of the indicated unlabeled using His-tagged Mot3⌬N and various promoter DNA frag- promoter DNA fragments as competitor DNAs. Promoter fragments. DNA fragments derived from the indicated promoters ments used as probes and competitors were the same as those were amplified from genomic DNA using PCR. These frag- in Figure 7. Binding reactions were resolved on a native poly- ments were end-labeled with 32P for use as probes or left acrylamide gel, and the amounts of label migrating at the unlabeled for use as cold competitor DNAs. Binding reactions positions of bound and unbound probes were determined were resolved on acrylamide gels, and gels were dried and using a Phosphorimager. Data (average of three experiments, subjected to autoradiography. Arrowheads indicate positions with individual points differing 20% or less) are presented as of unbound probes. the percentage of the probe that was unbound. 888 A. V. Grishin et al. nition code, and because Zn finger-DNA interactions reporter plasmid. This promoter was chosen because could differ from predictions (Griesman and Pabo its transcription is independent of MOT3 (Table 2) and 1997), we determined the recognition sequence of Mot3 it lacks close matches to a consensus Mot3 binding site. empirically. First, we analyzed small fragments of one We found that expression of this reporter was four- to ofthe promoters (CYC1) that appeared to contain multi- fivefold higher in wild-type cells than in mot3 mutants ple Mot3 binding sites (yielded multiple shifted bands), (Table 2). Thus, Mot3 binding sites can function as with the goal of identifying several single binding sites upstream activation sequences to drive gene expression. whose sequences could be compared. We started with a 335-bp CYC1 fragment (Ϫ295 to ϩ40; designated here and elsewhere relative to the translational start) that DISCUSSION yielded the EMSA pattern shown in Figure 7. Synthetic We have identified the MOT3 gene, which encodes

DNA duplexes corresponding to smaller portions of this a member of the Cys2-His2 Zn finger protein family, in fragment were used in EMSA to identify putative Mot3 a screen for mutations that abrogate the hyperadaptive binding sites. This identified three 30-bp fragments phenotype of yeast cells overexpressing signaling-defec- (Ϫ195 to Ϫ166, Ϫ104 to Ϫ75, and Ϫ75 to Ϫ46), each tive G protein ␤ subunits. We have shown that Mot3 is containing at least one Mot3 binding site (data not a nuclear DNA binding protein that can function as a shown). As predicted by the code, each of these DNA fragments contained the sequence AGG. However, none matched the predicted NAGGNG motif, because they contained A, T, or C at position 6. The fragment that displayed the strongest binding (Ϫ195 to Ϫ166; data not shown) contained the sequence CAGGCA. To determine whether the sequence CAGGCA in the CYC1 promoter actually binds Mot3, we used the methylation interference assay. The probe was a synthetic duplex spanning positions Ϫ195 to Ϫ119. The results indi- Figure 9.—Methylation inter- cated that Mot3 binds the CAGGCA sequence, because ference mapping of a Mot3 bind- methylation of the two central guanosine residues of ing site in the CYC1 promoter. An this sequence interfered with Mot3 binding (Figure 9). oligonucleotide corresponding to To define a Mot3 binding site further, we prepared a region of the CYC1 promoter (Ϫ195 to Ϫ119; top strand) was a set of duplex DNAs in which variants of the CAGGCA labeled at the 5Ј end and annealed sequence were placed in a DNA fragment that otherwise with the unlabeled complemen- does not bind His-tagged Mot3⌬N, and used them as tary oligonucleotide. Guanosine probes in EMSA experiments. The labeled probes we residues were methylated substoi- used had the same specific activities (see materials chiometrically with dimethylsul- and methods fate, and the double-stranded ), allowing direct comparisons of relative DNA fragment was subjected to binding efficiencies to be made. Binding efficiencies EMSA using His-tagged Mot3⌬N. were expressed as the percentage of the total probe that DNAs migrating at the positions was shifted to a reduced mobility. of bound and free probe were ex- The results of these experiments are shown in Figure cised individually from an agarose gel, extracted, and cleaved with pi- 10, leading to the following conclusions. First, the AGG peridine. Cleavage products were core sequence (positions 2–4) was important because resolved on a sequencing gel. U, Mot3⌬N bound poorly to derivatives in which any posi- DNA from unshifted (free probe); tion in this sequence was altered (CBGGCA, CAHGCA, S, DNA from shifted (bound) or CAGHCA, where B is G, C, or T in equal proportion, band. Arrowheads indicate two guanosine residues whose methyl- and H is A, C, or T in equal proportion). Second, an ation appears to inhibit the bind- A at position 6 was strongly preferred over other bases. ing of His-tagged Mot3⌬N. The se- Third, C, A, or T at position 1 and T or C at position 5 quence spanning these residues is permitted relatively high affinity binding, with CAGGTA marked by the vertical line. Part showing the highest apparent affinity. The results there- of the sequence is shown on the left (5Ј end is at the bottom). fore suggested that a consensus binding site for Mot3 is (CϾAϾT)AGG(TϾC)A. Consensus Mot3 binding sites confer MOT3-dependent activation of a heterologous promoter: To establish a causal relationship between Mot3 binding and transcriptional regulation, we inserted five artificial Mot3 binding sites into the CUP1 promoter in a CUP1-lacZ Mot3 Transcription Factor of Yeast 889 transcriptional activator; we cannot rule out repressor binding sites should occur on average every 724 bp in function for Mot3. Whereas Mot3 directly or indirectly the yeast genome, such that many promoter regions are represses expression of pheromone-responsive genes, it likely to contain at least one putative Mot3 binding site. activates expression of several yeast genes unrelated to Indeed, examination of the promoter sequences of 45 pheromone response and mating. The implications of yeast genes, which control a variety of processes includ- these findings in terms of the regulatory mechanisms ing mating, proliferation, transcription, cytoskeletal that control gene expression and mating pheromone function, and stress response, reveals that several con- signaling in yeast are discussed below. tain three or more consensus Mot3 binding sites (STE2, Mot3 is a globally acting transcription factor: Based FAR1, CLN1, MOT2, MYO1, and SSA4). Interestingly, on several findings, Mot3 appears to be a globally acting the 5Ј-flanking region upstream of the MOT3 ORF has transcription factor that affects the expression of several three sites, suggesting that autoregulation of the gene yeast genes. First, a Mot3 binding site matching the could occur. consensus sequence (C/T/A)AGG(T/C)A promotes More strikingly, approximately half of the promoters Mot3-dependent transcriptional activation when pres- we studied that contain putative Mot3 binding sites are ent in multiple copies in a promoter that otherwise affected by MOT3. Three patterns of MOT3-dependent is insensitive to Mot3. Based on this consensus, Mot3 regulation have been found. Class 1 promoters (e.g., HXT2, HXT3, and HXT4) show relatively weak positive regulation because they are unaffected by a mot3 null mutation, but they are stimulated upon MOT3 overexpression. Class 2 promoters (e.g., CYC1, SUC2, and LEU2) exhibit stronger positive regulation because their activities are decreased in mot3 mutants and increased in cells overexpressing MOT3. The stronger positive regulation of Class 2 promoters correlates with strong Mot3 binding and multiple shifted bands in EMSA. Class 2 promoters may be regulated more strongly because they apparently contain more consensus Mot3 binding sites (three to five sites) than Class 1 promoters (one or two sites). We currently favor this explanation because other than the number of consensus Mot3 binding sites, there are no clear differences between Class 1 and Class 2 promoters in terms of the location of Mot3 binding sites relative to TATA elements or binding sites of other known transcription factors. However, because we do not know whether Mot3 binds either type of promoter in vivo, we cannot rule out that more complex, indirect effects of Mot3 are responsible for the differences we observe between Class 1 and Class 2 promoters. In contrast to Class 1 and Class 2 promoters, Class 3 promoters (e.g., FUS1, FUS3, AGA1, SST2, and KAR3, which are all induced by mating pheromone) show modest negative regulation by MOT3. Their basal activities are increased in mot3 mutants and decreased in cells overexpressing MOT3. Whether Mot3 directly represses these promoters is unclear. Although we found that a Mot3-lexA fusion lacks detectable repressor activity, the repressor activity of Mot3 could be promoter-specific. Indeed, in mot3 mutants the expression of genes with promoter insertions of Ty or ␦-elements is elevated Madison Figure 10.—Determination of a consensus binding site of ( et al. 1998). Alternatively, Mot3 could func- His-tagged Mot3⌬N. Labeled double-stranded oligonucleo- tion indirectly to inhibit expression from pheromone- tides containing the indicated 6-bp sequences were used as responsive promoters (see below). probes for EMSA with His-tagged Mot3⌬N. The percentage Finally, some promoters (e.g., CUP1, PCK1, HXT1, of each labeled probe migrating at the position of bound and GAL1) are unaffected by Mot3. All these promoters and unbound DNA was determined using a Phosphorimager. (Top) Autoradiogram showing representative results. Arrow- lack matches (CUP1, GAL1) or have only one match heads indicate the positions of the unbound probes. (Bottom) (PCK1, HXT1) to the Mot3 consensus binding site we Quantitation of the amount of each probe that was bound. have defined. The CUP1 promotor displays weak bind- 890 A. V. Grishin et al. ing of Mot3 in EMSA, which may be explained by the and mot2 mutations all require an intact pheromone presence of a number of weaker noncanonical sites. It signaling pathway to increase basal activity of pher- is possible that low affinity binding of Mot3 to these omone-inducible promoters. However, whether Mot3 promotors is insufficient to cause detectable changes in regulates pheromone signaling by a mechanism similar their expression. to that used by Cdc36, Cdc39, or Mot2 is presently un- Consistent with its proposed function as a globally clear because the biochemical functions of these pro- acting transcription factor, Mot3 has been identified by teins remain to be determined. others as a high copy suppressor in two different con- How might Mot3 negatively regulate the expression texts. MOT3 overexpression suppresses the cell wall in- of pheromone-inducible genes? Because currently there tegrity defect of mpk1⌬ mutants (D. Levin, personal is no direct evidence that Mot3 can act as a repressor, communication), which are defective in a MAP kinase- we suggest that it negatively regulates signaling by induc- dependent signaling pathway. MOT3 overexpression ing the expression of factors that inhibit pheromone also suppresses the lethal phenotype of mot1 spt3 double response. The target genes activated by Mot3 to inhibit mutants (Madison et al. 1998), which are defective in signaling are probably not GPA1, SST2,orMSG5, which factors that regulate the distribution of TATA-binding encode known negative regulators of the pheromone protein (TBP) at strong vs. weak promoters (Collart response pathway. This is suggested by our finding that 1996; Madison and Winston 1997). Mot3 inhibits rather than activates basal expression of Although Mot3 is likely to affect the expression of a these or other pheromone-inducible genes. Mot3 may number of yeast genes, it may have a modulatory rather therefore promote the expression of other negative reg- than an essential role in governing the efficiency of ulatory factors that impinge on the pheromone re- transcription. We suggest this because mot3 null mutants sponse pathway. An example of such a negative factor exhibit only mild defects in growth rate, and because could be the G1 cyclin Cln2, whose overexpression has none of the Cys2-His2 Zn-finger proteins encoded by the been shown to inhibit the pheromone response pathway yeast genome is an obvious structural homolog that at some point downstream of the G protein (Oehlen might be functionally redundant with Mot3. Potentially, and Cross 1994). Mot3 is used to “fine tune” or coordinate expression of What is the role of Mot3 in mediating the hyperadap- a number of yeast genes. Mot3 could also be the major tive phenotype caused by overexpression of signal- transcriptional activator of genes that are important for ing-defective G␤ subunits? One possibility is that mot3 physiological functions we have not yet investigated. mutations suppress the hyperadaptive phenotype non- Role of MOT3 in pheromone signaling: Disruption of specifically simply by increasing pheromone sensitivity, MOT3 has a relatively modest effect (two- to threefold) allowing the signal to be sustained longer. This is an on pheromone signaling. It increases pheromone sensi- unlikely explanation because the hyperadaptive pheno- tivity and the basal expression of pheromone-responsive type is not suppressed by other mutations, such as sst2 promoters and causes a slight defect in adaptation. How- or receptor tail truncations, that increase pheromone ever, this does not necessarily indicate that Mot3 has a sensitivity much more dramatically (10- to 100-fold) relatively minor role in regulating pheromone signal- than mot3 mutations (Grishin et al. 1994). Alternatively, ing. For example, Mot3 could functionally overlap with certain target genes activated by MOT3 may be required structurally distinct transcription factors, which to- specifically to mediate hyperadaptation. Defining these gether exert a relatively prominent effect on phero- genes and characterizing their products may reveal new mone signaling. This would be analogous to the overlap- mechanisms that control the pheromone response path- ping functions of structurally distinct classes of protein way and other G protein and MAP kinase-dependent phosphatases (the dual-specificity phosphatase Msg5 signaling pathways. and the tyrosine phosphatases Ptp2 and Ptp3), which We thank David Levin and Fred Winston for communicating together have an important role in attenuating phero- results prior to publication; David Levin, Mark Johnston, Beverly mone signaling by dephosphorylating the MAP kinase Errede, and Mark Rose for gifts of plasmids, and Mark Johnston homologs, Fus3 and Kss1 (Doi et al. 1994; Zhan et al. for critical reading of the manuscript. This work was supported by 1997). grants from the National Institutes of Health and the American Cancer In principle, Mot3 could be functionally redundant Society (K.J.B.). K.J.B. is an Established Investigator of the American Heart Association. with other transcriptional regulators, such as Cdc36, Cdc39, or Mot2, that are known to negatively regulate the expression of pheromone-induced genes. Indeed, the effects of a mot3 mutation on pheromone-regulated LITERATURE CITED promoters are similar to those caused by cdc36, cdc39, Bardwell, L., J. G. Cook, C. J. Inouye and J. Thorner, 1994 Signal or mot2 mutations (de Barros Lopes et al. 1990; Neiman propagation and regulation in the mating pheromone response et al. 1990; Cade and Errede 1994; Irie et al. 1994; pathway of the yeast Saccharomyces cerevisiae. Dev. Biol. 166: 363– Leberer 379. et al. 1994), all of which affect expression of a Cade, R. M., and B. Errede, 1994 MOT2 encodes a negative regula- number of yeast genes. Furthermore, mot3, cdc36, cdc39, tor ofgene expressionthat affects basal expression ofpheromone- Mot3 Transcription Factor of Yeast 891

responsive genes in Saccharomyces cerevisiae. Mol. Cell. Biol. 14: exported protein with homology to pepsin. Proc. Natl. Acad. Sci. 3139–3149. USA 85: 55–59. Chen, Q., and J. B. Konopka, 1996 Regulation of the G-protein- Madison, J. M., and F. Winston, 1997 Evidence that Spt3 function- couple alpha-factor pheromone receptor by phosphorylation. ally interacts with Mot1, TFIIA, and TATA-binding protein to Mol. Cell. Biol. 16: 247–257. confer promoter-specific transcriptional control in Saccharomyces Choo, Y., and A. Klug, 1997 Physical basis of a protein-DNA recogni- cerevisiae. Mol. Cell. Biol. 17: 287–295. tion code. Curr. Op. Struct. Biol. 7: 117–125. Madison, J. M., A. Dudley, C. Hongay and F. Winston, 1998 Iden- Ciejek, E., and J. Thorner, 1979 Recovery of S. cerevisiae a cells tification and analysis of Mot3, a zinc finger protein that binds from G1 arrest by alpha factor phermone requires endopeptidase retrotransposon Ty LTR (␦)inSaccharomyces cerevisiae. Mol. Cell. action. Cell 18: 623–635. Biol. 18: 1879–1890. Collart, M. A., 1996 The NOT, SPT3, and MOT1 genes functionally McCaffrey, G., F. J. Clay, K. Kelsay and G. J. Sprague, 1987 Identi- interact to regulate transcription at core promoters. Mol. Cell. fication and regulation of a gene required for cell fusion during Biol. 16: 6668–6676. mating of the yeast Saccharomyces cerevisiae. Mol. Cell. Biol. 7: Davis, J. L., R. Kunisawa and J. Thorner, 1992 A presumptive 2680–2690. helicase (MOT1 gene product) affects gene expression and is Meluh, P. B., and M. D. Rose, 1990 KAR3, a kinesin-related gene require for ivability in the yeast Saccharomyces cerevisiae. Mol. Cell. required for yeast nuclear fusion. Cell 60: 1029–1041. Biol. 12: 1879–1892. Mercado, J. J., and J. M. Gancedo, 1992 Regulatory regions in the de Barros Lopes, M., J. Y. Ho and S. I. Reed, 1990 Mutations in cell yeast FBP1 and PCK1 genes. FEBS Lett. 311: 110–114. division cycle genes CDC36 and CDC39 activate the Saccharomyces Myers, A. M., A. Tzagoloff, D. M. Kinney and C. J. Lusty, 1986 cerevisiae mating pheromone response pathway. Mol. Cell. Biol. Yeast shuttle and integrative vectors with multiple cloning sites 10: 2966–2972. suitable for construction of lacZ fusions. Gene 45: 299–310. Dohlman, H. G., J. Song, D. Ma, W. E. Courchesne and J. Thorner, Neiman, A. M., F. Chang, K. Komachi and I. Herskowitz, 1990 1996 Sst2, a negative regulator of pheromone signaling in the CDC36 and CDC39 are negative elements in the signal transduc- yeast Saccharomyces cerevisiae : expression, localization, genetic in- tion pathway of yeast. Cell Reg. 1: 391–401. teraction and physical association with Gpa1 (G protein alpha Niedenthal, R. K., L. Riles, M. Johnston and J. H. Hegemann, 1996 subunit). Mol. Cell. Biol. 16: 5194–5209. Green fluorescent protein as a marker for gene expression and Doi, K., A. Gartner, G. Ammerer, B. Errede, H. Shinkawa et al., subcellular localization in budding yeast. Yeast 12: 773–786. 1994 MSG5, a novel protein phosphatase promotes adaption to Oehlen, L. J. W. M., and F. R. Cross, 1994 G1 cyclins Cln1 and pheromone response in S. cerevisiae. EMBO J. 13: 61–70. Cln2 repress the mating factor response pathway at Start in the Evans, R. M., and S. M. Hollenberg, 1988 Zinc fingers: gilt by yeast cell cycle. Genes Dev. 8: 1058–1070. association. Cell 52: 1–3. Ozcan, S., and M. Johnston, 1996a Two different repressors collab- Fields, S., and I. Herskowitz, 1987 Regulation by the yeast mating- orate to restrict expression of the yeast glucose transporter genes type locus of STE12, a gene required for cell-type-specific expres- HXT2 and HXT4 to low levels of glucose. Mol. Cell. Biol. 16: sion. Mol. Cell. Biol. 7: 3818–3821. 5536–5545. Flick, J. S., and M. Johnston, 1990 Two systems of glucose repres- Ozcan, S., and M. Johnston, 1996b Rgt1p of Saccharomyces cerevisiae, sion of the GAL1 promoter in Saccharomyces cerevisiae. Mol. Cell. a key regulator of glucose-induced genes, is both an activator Biol. 10: 4757–4569. and a repressor of transcription. Mol. Cell. Biol. 16: 6419–6424. Greisman, H. A., and C. O. Pabo, 1997 A general strategy for select- Reneke, J. E., K. J. Blumer, W. E. Courchesne and J. Thorner, 1988 ing high-affinity zinc finger proteins for diverse DNA target sites. The carboxy-terminal segment of the yeast alpha-factor receptor Science 275: 657–661. is a regulatory domain. Cell 55: 221–234. Grishin, A. V., J. L. Weiner and K. J. Blumer, 1994 Control of Rhodes, N., L. Connell and B. Errede, 1990 STE11 is a protein adaptation to mating pheromone by G protein beta subunites of kinase required for cell-type-specific transcription and signal Sacchraomyces cerevisiae. Genetics 138: 1081–1092. transduction in yeast. Genes Dev. 4: 1862–1874. Guarente, L., and E. Hoar, 1984 Upstream activation sites of the Rose, M. D., P. Novick, J. H. Thomas, D. Botstein and G. R. Fink, CYC1 gene of Saccharomyces cerevisiae are active when inverted but 1987 A Saccharomyces cerevisiae genomic plasmid bank based on not when placed downstream of the “TATA box.” Proc. Natl. a centromere-containing shuttle vector. Gene 60: 237–243. Acad. Sci. USA 81: 7860–7864. Rothstein, R., 1991 Targeting, disruption, replacement, and allele Guthrie, C., and G. R. Fink, 1991 Guide to Yeast Genetics and rescue: integrative DNA transformation in yeast. Meth. Enzymol. Molecular Biology. Meth. Enzymol. 194: 1–933. 194: 281–301. Hill, J. E., A. M. Myers, T. J. Koerner and A. Tzagoloff, 1986 Segall, J. E., 1993 Polarization of yeast cells in spatial gradients of Yeast/E. coli shuttle vectors with multiple unique restriction sites. alpha mating factor. Proc. Natl. Acad. Sci. USA 90: 8332–8336. Yeast 2: 163–167. Sherman, F., 1991 Getting started with yeast. Meth. Enzymol. 194: Irie, K., K. Yamaguchi, K. Kawase and K. Matsumoto, 1994 The 3–21. yeast MOT2 gene encodes a putative zinc finger protein that Sikorski, R. S., and P. Hieter, 1989 A system of shuttle vectors and serves as a global negative regulator affecting expression of several yeast host strains designed for efficient manipulation of DNA in categories of genes, including mating-pheromone-responsive Saccharomyces cerevisiae. Genetics 122: 19–27. genes. Mol. Cell. Biol. 14: 3150–3157. Singer, V. L., C. R. Wobbe and K. Struhl, 1990 A wide variety of Jackson, C. L., J. B. Konopka and L. H. Hartwell, 1991 S. cerevisiae DNA sequences can functionally replace a yeast TATA element alpha pheromone receptors activate a novel signal transduction for transcriptional activation. Genes Dev. 4: 636–645. pathway for mating partner discrimination. Cell 67: 389–402. Teague, M. A., D. T. Chaleff and B. Errede, 1986 Nucleotide Jenness, D. D., and P. Spatrick, 1986 Down regulation of the alpha- sequence of the yeast regulatory gene STE7 predicts a protein factor pheromone recpetor in S. cerevisiae. Cell 46: 345–353. homologous to protein kinases. Proc. Natl. Acad. Sci. USA 83: Keleher, C. A., M. J. Redd, J. Schultz, M. Carlson and A. D. 7371–7375. Johnson, 1992 Ssn6-Tup1 is a general repressor of transcription Tjian, R., and T. Maniatis, 1994 Transcriptional activation: a com- in yeast. Cell 68: 709–719. plex puzzle with few easy pieces. Cell 77: 5–8. Klug, A., and D. Rhodes, 1987 Zinc fingers: a novel protein fold van Solingen, P., and J. B. van der Platt, 1977 Fusion of yeast for nucleic acid recognition. Cold Spring Harbor Symp. Quant. spheroplasts. J. Bacteriol. 130: 946–947. Biol. 52: 473–482. Watson, N., M. E. Linder, K. M. Druey, J. H. Kehrl and K. J. Leberer, E., D. Dignard, D. Harcus, M. Whiteway and D. Y. Blumer, 1996 RGS family members: GTPase-activating proteins Thomas, 1994 Molecular characterization of SIG1,aSaccharo- for heterotrimeric G-protein alpha-subunites. Nature 383: 172– myces cerevisiae gene involved in negative regulation of G-protein- 175. mediated signal transduction. EMBO J. 13: 3050–3064. Weiner, J. L., C. Guttierez-Steil and K. J. Blumer, 1993 Disrup- Ma, J., and M. Ptashne, 1987 A new class of yeast transcriptional tion of receptor-G protein coupling in yeast promotes the func- activators. Cell 51: 113–119. tion of an SST2-dependent adaptation pathway. J. Biol. Chem. MacKay, V. L., S. K. Welch, M. Y. Insley, T. R. Manney, J. Holly 268: 8070–8077. et al., 1988 The Sacchraomyces cerevisiae BAR1 gene encodes an Whiteway, M., L. Hougan, D. Dignard, D. Y. Thomas, L. Bell et 892 A. V. Grishin et al.

al., 1989 The STE4 and STE18 genes of yeast encode potential Ptp2/Ptp3 and dual-speciﬁcity phosphatase Msg5 in Saccharomyces beta and gamma subunits of the mating factor receptor-coupled cerevisiae. Genes Dev. 11: 1690–1702. G protein. Cell 56: 467–477. Zhan, X. L., R. J. Deschenes and K. L. Guan, 1997 Differential Communicating editor: F. Winston regulation of Fus3 MAP kinase by tyrosine-speciﬁc phosphatases