Copyright 1998 by the Genetics Society of America Mot3, a Zn Finger Transcription Factor That Modulates Gene Expression and Attenuates Mating Pheromone Signaling in Saccharomyces cerevisiae Anatoly V. Grishin, Michael Rothenberg,1 Maureen A. Downs and Kendall J. Blumer Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, Missouri 63110 Manuscript received January 13, 1998 Accepted for publication March 4, 1998 ABSTRACT In the yeast Saccharomyces cerevisiae, mating pheromone response is initiated by activation of a G protein- and mitogen-activated protein (MAP) kinase-dependent signaling pathway and attenuated by several mechanisms that promote adaptation or desensitization. To identify genes whose products negatively regulate pheromone signaling, we screened for mutations that suppress the hyperadaptive phenotype of wild-type cells overexpressing signaling-defective G protein b subunits. This identi®ed recessive mutations in MOT3, which encodes a nuclear protein with two Cys2-His2 Zn ®ngers. MOT3 was found to be a dosage- dependent inhibitor of pheromone response and pheromone-induced gene expression and to require an intact signaling pathway to exert its effects. Several results suggested that Mot3 attenuates expression of pheromone-responsive genes by mechanisms distinct from those used by the negative transcriptional regulators Cdc36, Cdc39, and Mot2. First, a Mot3-lexA fusion functions as a transcriptional activator. Second, Mot3 is a dose-dependent activator of several genes unrelated to pheromone response, including CYC1, SUC2, and LEU2. Third, insertion of consensus Mot3 binding sites (C/A/T)AGG(T/C)A activates a promoter in a MOT3-dependent manner. These ®ndings, and the fact that consensus binding sites are found in the 59 ¯anking regions of many yeast genes, suggest that Mot3 is a globally acting transcriptional regulator. We hypothesize that Mot3 regulates expression of factors that attenuate signaling by the phero- mone response pathway. HE pheromone response pathway of the yeast Sac- gradients, allowing mating to occur preferentially be- Tcharomyces cerevisiae is controlled by a complex inter- tween partners that produce high levels of pheromone play of positive and negative regulators of signal trans- or to resume proliferation if mating is unsuccessful duction (Bardwell et al. 1994). Secreted oligopeptide (Jackson et al. 1991; Segall 1993; Bardwell et al. mating pheromones (a-factor and a-factor) induce the 1994). Desensitization or adaptation in yeast can occur expression of genes required for mating, inhibit cell by several mechanisms, including pheromone proteoly- proliferation, and trigger a differentiation program nec- sis (Ciejek and Thorner 1979; MacKay et al. 1988), essary for conjugation of haploid yeast cells of opposite receptor phosphorylation and downregulation (Jen- mating type. Pheromones exert their effects by activat- ness and Spatrick 1986; Reneke et al. 1988; Chen and ing a conserved signal transduction pathway consisting Konopka 1996), G protein deactivation by a putative of cell surface receptors, a heterotrimeric guanine nu- GTPase-activating protein Sst2, a member of the regula- cleotide-binding protein (G protein), and a mitogen- tors of G protein signaling (RGS) family (Dohlman et activated protein (MAP) kinase cascade, ultimately im- al. 1996), and MAP kinase dephosphorylation by dual pinging on a cyclin-dependent kinase inhibitor (Far1) speci®city and tyrosine-speci®c protein phosphatases that induces growth arrest and a transcription factor (Doi et al. 1994; Zhan et al. 1997). Because the expres- (Ste12) that activates expression of pheromone-respon- sion of several of these negative regulatory factors is sive genes. pheromone-inducible, transcriptional regulation is Negative regulation of the pheromone response path- likely to be an important part of the adaptive process. way allows cells to adapt or become desensitized to a We have shown previously that adaptation is promoted signal of constant intensity. This is thought to be impor- strongly in wild-type cells that overexpress signaling- tant for cells to respond chemotropically to pheromone defective G protein b subunits (Grishin et al. 1994). The mechanism of this ªhyperadaptiveº phenotype may be novel because it does not involve pheromone degra- Corresponding author: Anatoly Grishin, Department of Cell Biology dation, receptor phosphorylation or endocytosis, Sst2, and Physiology, Washington University School of Medicine, 660 S. or the dual-speci®city phosphatase encoded by MSG5. Euclid Ave., Box 8228, St. Louis, MO 63110-1093. E-mail: [email protected] From our previous studies we hypothesized that overex- 1 Present address: University of California School of Medicine, San pression of mutant Gb subunits in wild-type cells pro- Francisco, CA 94143. motes an adaptive process that attenuates pheromone Genetics 149: 879±892 ( June, 1998) 880 A. V. Grishin et al. TABLE 1 Yeast strains used in this study Strain Genotype Source or reference W303-1B MATa ade2 his3 ura3 leu2 trp1 R. Rothstein W303az1 W303-1B mot3::URA3 This work AG56 MATa ade2 his3 ura3 leu2 trp1 sst1D Grishin et al. (1994) AG56-5 AG56-46 AG56-58 AG56-80 Hyperadaptation-defective derivatives of AG56 This work AG56-102 AG56-119 AG56-138 AG56-143 AG62 Diploid of cross between AG56 3 W303-1B This work AG62z Diploid of cross between AG64 3 W303az1 This work AG64 AG56 mot3::URA3 This work AG65a AG56 mot3::ura3 This work AG66 AG65 ste2::LEU2 This work AG67 AG65 ste4::URA3 This work AG68 AG65 ste18-1 This work AG69 AG65 ste20::URA3 This work AG70 AG65 ste11::URA3 This work AG71 AG65 ste7-A1 This work AG72 AG65 ste12::LEU2 This work 31K MATa ade8 ura3 trp1 arg4 This work L40 MATa ade2 his3 leu2 trp1 gal4 gal80 S. Hollenberg LYS2::(lexAop)4-HIS3 URA3::(lexAop)8-lacZ DC14b MATa his1 Weiner et al. (1993) DC17b MATa his1 Weiner et al. (1993) a A Ura2 derivative of AG64 selected on SD with 5-¯uoroorotic acid (0.1%). b Mating type testers. response. As part of an effort to de®ne this adaptive marked derivative pRS425 FUS1-lacZ (FUS1-lacZ; McCaffrey Meluh Rose mechanism, we report the identi®cation of mutations et al. 1987); pMR1300 (KAR3-lacZ; and 1990). Other newly constructed promoter-lacZ fusions were made by that abrogate the hyperadaptive phenotype. This has using BamHI and EcoRI-cut YEp357R (Myers et al. 1986) as identi®ed the MOT3 gene, a previously uncharacterized a recipient for PCR-generated promoter DNA fragments with gene that encodes a member of the Cys2-His2 Zn ®nger the following endpoints relative to translation starts: 2517 to family of transcription factors. We present evidence that 1132 (CUP1), 2245 to 1243 (FUS3), 2811 to 160 (SST2), Mot3 is a transcriptional regulator of several yeast genes, and 2335 to 1182 (AGA1), resulting in plasmids pAG33, pAG34, pAG35, and pAG36. b-Galactosidase levels for these possibly including those involved in attenuating the ac- plasmids have been reported by others or con®rmed by us tivity of the pheromone response pathway. (unpublished results) to correlate with transcript levels. pAG37 was constructed by inserting four lexA operators (Kel- eher et al. 1992) into the SalI site upstream of the GAL1 MATERIALS AND METHODS promoter of pD-lacZ R37 (Singer et al. 1990). To construct pAG38, the oligonucleotides (CTAGAAGCAGGCATTAC Strains and media: Yeast strains used in this study are listed AAGGCACTGACAGGTAAAACAGGTAAAGGCA and CTAGT in Table 1. Growth media (YPD, YPG, supplemented SD, and GCCTTTACCTGTTTTACCTGTCAGTGCCTTGTAATGCCT sporulation media) were prepared as described previously GCTT; Mot3 binding sites are underlined) were annealed and (Sherman 1991). SGal contains galactose (2%) and sucrose the resulting duplex inserted into the XbaI site of pAG33. (0.2%) instead of glucose. Synthetic a-factor (Washington pAG40 was constructed by inserting a 2.4-kb EcoRI-SalI frag- University Protein Chemistry Laboratory, St. Louis, MO) was ment encompassing the entire MOT3 gene and its promoter added to media to a ®nal concentration of 1 mm, unless indi- into EcoRI and SalI-cut pFAT-RS3039b9 (provided by D. Gott- cated otherwise. schling, Fred Hutchinson Cancer Center, Seattle, WA). To Plasmids: The following plasmids were used as promoter- construct pAG44, the 39 part of MOT3 was ampli®ed with lacZ fusion reporters: pLGD312s (CYC1-lacZ ; Guarente and primers CCGCTCGAGTCATCAGACCATAAATATATCC and Hoar 1984), pBM2773 (SUC2-lacZ), pBM2636 (HXT1-lacZ ), CGGGATCCTTGTTAAATGAGTGGGAAGGG and cloned pBM2717 (HXT2-lacZ ), pBM2819 (HXT3-lacZ ), pBM2800 into XhoI and BamHI-cut pET-15b (Novagen). pAG41 was con- (HXT4-lacZ), pBM2832 (LEU2-lacZ ; Ozcan and Johnston structed by amplifying the complete MOT3 open reading 1996a), pJJ13 (PCK1-lacZ ; Mercado and Gancedo 1992); pD- frame (ORF) with primers GGATCCGGACATATCATATTT lacZ R37 (GAL1-lacZ; Singer et al. 1990); pSL307 and its LEU2- GAG and ATCGATTTTGTTGTGACTAACAATAAGGTT and Mot3 Transcription Factor of Yeast 881 cloning the PCR product into BamHI and ClaI-cut pGFP- phates (dNTPs), if necessary. For experiments designed to C-FUS (Niedenthal et al. 1996). pAG42 was constructed de®ne a consensus Mot3 binding site, a set of labeled probes by amplifying the entire MOT3 coding sequence with pri- having the same speci®c activity was prepared in the following mers GGAATTCGGGACATATCATATTCGAGCAATGAATG way. Oligonucleotides with the sequences GCAACCAGXXXX CGG and GGATCCTTGTTAAATGAGTGGGAAGGG and by XXGACGACAACAACTGTGCTGCTGA, where XXXXXX are cloning the ampli®cation