DOCSLIB.ORG

Supplementary Materials Up-Regulated Endonuclease

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Materials Up-Regulated Endonuclease Supplementary Materials Up-regulated endonuclease Regnase-1 suppresses osteoarthritis by forming negative feedback loop of catabolic signaling in chondrocytes Jeong-In Yang and Jang-Soo Chun Supplementary Figure 1-4 Supplementary Table 1-6 1 A B C ZC3H12A (Regnase-1) HIF-2 ZIP8 ZC3H12A (Regnase-1) ZC3H12A (Regnase-1) ZC3H12B ZC3H12B ZC3H12B ZC3H12C ZC3H12C ZC3H12C ZC3H12D ZC3H12D ZC3H12D GAPDH GAPDH GAPDH 0 3 0 6 12 24 0.1 1.0 0.5 400 800 200 400 800 200 IL1 (ng/ml, 24h) IL1 (h, 1 ng/ml) (MOI) (MOI) Ad-C 800 Ad-C 800 Ad-HIF-2(36 h) Ad-ZIP8 (36 h) Supplementary Fig. 1. Upregulation of Regnase-1 in chondrocytes treated with OA-associated catabolic factors. A–C RT-PCR analysis of ZC3H12 family members in chondrocytes treated with IL-1 (A)or infected with Ad-HIF-2α (B)orAd-ZIP8(C). Images are representative of the results obtained from five independent primary cultures of chondrocytes. A B Regnase-1 MMP3 MMP13 ADAMTS5 SOX9 Coll-II Aggrecan -actin Ad-shC Ad-shRegnase-1 Ad-HIF-2 400 200 800 (MOI) Ad-shRegnase-1 Ad-shC 800 Supplementary Fig. 2. Knockdown of Regnase-1 alone in joint tissues is not sufficient to cause OA-like changes in mice. A Representative Safranin-O staining images of joint sections from mice IA-injected with Ad-shScramble (Ad-shC), Ad-shRegnase-1, or Ad-HIF-2α (n = 10 mice per group). IA injection of Ad-HIF-2α was used as a positive control. B Representative RT- PCR images (n = 4) of the indicated molecules in primary-culture chondrocytes infected with Ad-shC or Ad-shRegnase-1. A Intron 1 Exon 1 Exon 2 Aaagcctgtccaagaatccaaccccaccatgagtctgtggagtcttgaggacagacacagcagccagggtcgacctcagccagac caggatcctgtggctaaagaggcccctacttccgagctgcagatgaaggtggactttttccgtaaactggggtactcgtcctctgagatcc acagtgtcctgcagaagctgggagtccaagcagacaccaacacggtgctaggggaattggtgaagcatggctcagctactgaacga gaatgccaggccctgacggcccccagcccccagccccctctggtgccccggggtggaagcacccccaagccttccactctagaacc ctcactcccagaggaggacagagagggcagcgacctgagacctgtggtcatcgacggaagcaatgtggccatgaggtatgtgt … (68-bp deletion in Exon2) B C Genotype Regnase-1 -actin mRNA +/+ +/- -/- Zc3h12a Zc3h12a+/+ Zc3h12a+/- Zc3h12a-/- Supplementary Fig. 3. Characterization of Regnase-1 knockout mice. A A 68-bp deletion in exon 2 of the Regnase-1 gene was used to generate Zc3h12a-/- mice. B Genotypes and mRNA levels of Regnase-1 in Zc3h12a homozygous (-/-) KO mice, heterozygous (+/-) KO mice, and their WT (+/+) littermates. C Skeletal staining of E18.5 embryos of Zc3h12a homozygous (-/-) KO mice, heterozygous (+/-) KO mice, and their WT (+/+) littermates. A Regnase-1 SAA1 SAA2 SAA3 SAA4 25 1.5 1.5 1.5 1.5 ns 20 1.0 1.0 1.0 1.0 15 10 0.5 0.5 0.5 0.5 (fold change) (fold 5 Relative mRNA levels mRNA Relative 0 0 0 0 0 200 400 200 400 800 800 200 400 200 400 200 400 800 800 800 Ad-C Ad-C Ad-C Ad-C Ad-C (MOI) (MOI) (MOI) (MOI) (MOI) Ad-Regnase-1 Ad-Regnase-1 Ad-Regnase-1 Ad-Regnase-1 Ad-Regnase-1 B Regnase-1 SAA1 SAA2SAA3 SAA4 6 6 6 6 1.5 1.0 4 4 4 4 0.5 2 2 2 2 (fold change) Relative mRNA levels mRNA Relative 0 0 0 0 0 200 400 800 800 800 200 400 200 400 200 400 800 800 200 400 (MOI) (MOI) Ad-shC Ad-shC (MOI) Ad-shC (MOI) Ad-shC Ad-shC (MOI) Ad-shRegnase-1 Ad-shRegnase-1 Ad-shRegnase-1 Ad-shRegnase-1 Ad-shRegnase-1 Supplementary Fig. 4. Regnase-1 modulates the expression levels of SAA family members in chondrocytes. A and B qRT-PCR analysis (n =6)ofSAAfamilymembers(SAA1,SAA2, SAA3, and SAA4) in chondrocytes infected with 800 MOI of control adenovirus (Ad-C or Ad-shC) or the indicated MOI of Ad-Regnase-1 (A) and Ad-shRegnase-1 (B) for 36 hours. Values are means ± s.e.m. with one-way ANOVA and Bonferroni's post hoc test. *p < 0.05, **p < 0.005, ***p < 0.0005. ns, not significant. Supplementary Table 1. PCR primers and conditions. Size AT Genes Strand Primer sequences Origin (bp) (°C) Acan S 5´-CTGTCTTTGTCACCCACACATG-3´ 581 58 Mouse (Aggrecan) AS 5´-GAAGACGACATCACCATCCAG-3´ S 5´-GCCATTGTAATAACCCTGCACC-3´ Adamts5 292 58 Mouse AS 5´-TCAGTCCCATCCGTAACCTTTG-3´ Actb S 5´-ATATCGCTGCGCTGGTCGTC-3´ 517 58 Mouse (β-actin) AS 5´-AGGATGGCGTGAGGGAGAGC-3 S 5´-CACACTGGTAAGTGGGGCAAGACCG-3´ Col2a1 173 57 Mouse AS 5´-GGATTGTGTTGTTTCAGGGTTCGGG-3´ Epas1 S 5´-CGAGAAGAACGACGTGGTGTTC-3´ 333 64 Mouse (HIF-2α) AS 5´-GTGAAGGCTGGCAGGCTCC-3´ S 5´-TGATGGACCTTCTGGTCTTCTGG-3´ Mmp13 473 58 Mouse AS 5´-CATCCACATGGTTGGGAAGTTCT-3´ S 5´-AGGGATGATGATGCTGGTATGG-3´ Mmp3 434 58 Mouse AS 5´-CCATGTTCTCCAACTGCAAAGG-3´ S 5´-TCCTCCTCAAGCAGTTACTACTGCAA-3´ Saa1 423 60 Mouse AS 5´-ATGAAGGAAGCTAACTGGAAAAACTC-3´ S 5´-TCCTCCTCAAGCAGTTACTACTGCTC-3´ Saa2 420 60 Mouse AS 5´-ATGAAGGAAGCTGGCTGGAAAGATGG-3´ S 5´-GCCACCATGAAGCCTTCCATTGCCATCATT-3´ Saa3 375 60 Mouse AS 5´-TCAGTATCTTTTAGGCAGGCCAGCAG-3´ S 5´-GAGGTCTTGCTCGTGATTCACT-3´ Saa4 373 66 Mouse AS 5´-TTTCTGGGTAGCCTGCAGGGTT-3´ Slc39a8 S 5´-GAACAATTGCCTGGATGATCACGC-3´ 430 58 Mouse (ZIP8) AS 5´-AAGCCGGTTAACATCCCTGCATTC-3´ S 5´-CACTGGCAGTTACGGCATCAG-3´ Sox9 457 61 Mouse AS 5´-CATGTAAGTGAAGGTGGAGTAGAGC-3´ S 5´-AGATGTCAGAATTATGGGGCGTGC-3´ Zc3h12a 389 64 Mouse AS 5´-GCGTCTCATTACAGCTTCTACCAGG-3´ S 5´-GAGGGTGGTCTGCTATGATGA-3´ Zc3h12b 217 60 Mouse AS 5´-GAAATTCTCAAGGCTCGGACC-3´ S 5´-CTCAGGATCAAAGACCACAGG-3´ Zc3h12c 120 60 Mouse AS 5´-AATATCCAACGTCAACAGGGG-3´ S 5´-GGCGATCTCGGGTCTCCAAT-3´ Zc3h12d 212 60 Mouse AS 5´-GGTTGTGCTGACTCCGAAGG-3´ AT, annealing temperature; S, sense; AS, antisense 1 Supplementary Table 2. mRNA levels of RNases in chondrocytes treated with IL-1β (1 ng/ml, 36 h) or infected with 800 MOI of Ad-HIF-2α or Ad-ZIP8 (36 h). Fold change Gene Definition symbol IL-1β Ad-HIF-2α Ad-ZIP8 Endonuclease Ago2 Argonaute RISC catalytic subunit 2 1.069 ± 0.08 1.143 ± 0.13 1.033 ± 0.12 Ang2 Angiogenin, ribonuclease A family, member 2 1.219 ± 0.20 1.074 ± 0.43 1.280 ± 0.76 Ang4 Angiogenin, ribonuclease A family, member 4 0.757 ± 0.65 0.991 ± 0.63 0.876 ± 0.30 Ang5 Angiogenin, ribonuclease A family, member 5 0.973 ± 0.14 1.025 ± 0.31 1.121 ± 0.31 Ang6 Angiogenin, ribonuclease A family, member 6 1.117 ± 0.24 0.987 ± 0.26 0.919 ± 0.32 Apex1 Apurinic/apyrimidinic endonuclease 1 0.818 ± 0.18 0.985 ± 0.07 1.149 ± 0.06 Apex2 Apurinic/apyrimidinic endonuclease 2 0.898 ± 0.08 0.924 ± 0.11 0.871 ± 0.15 Cpsf3 Cleavage and polyadenylation specificity factor 3 0.868 ± 0.12 0.881 ± 0.10 0.903 ± 0.13 Dclre1c DNA cross-link repair 1C, PSO2 homolog 1.363 ± 0.22 1.052 ± 0.23 1.160 ± 0.18 Dicer1 ElaC homolog 2 (E. coli) 0.600 ± 0.22 0.792 ± 0.15 0.779 ± 0.16 Ear1 Eosinophil-associated, ribonuclease A family, member 1 0.919 ± 0.49 1.156 ± 0.59 1.050 ± 0.65 Ear10 Eosinophil-associated, ribonuclease A family, member 10 0.917 ± 0.16 0.958 ± 0.32 1.091 ± 0.40 Ear11 Eosinophil-associated, ribonuclease A family, member 11 - 1.286 ± 0.21 1.190 ± 0.33 Ear2 Eosinophil-associated, ribonuclease A family, member 2 1.055 ± 0.21 1.031 ± 0.20 1.071 ± 0.22 Ear4 Eosinophil-associated, ribonuclease A family, member 4 - 0.950 ± 0.37 0.914 ± 0.29 Ear5 Eosinophil-associated, ribonuclease A family, member 5 - 0.977 ± 0.21 0.975 ± 0.36 Ear7 Eosinophil-associated, ribonuclease A family, member 7 - 1.125 ± 0.40 1.156 ± 0.41 Elac1 Zinc phosphodiesterase ELAC protein 1 1.117 ± 0.16 1.101 ± 0.15 1.002 ± 0.20 Elac2 Zinc phosphodiesterase ELAC protein 2 0.779 ± 0.12 0.829 ± 0.05 0.830 ± 0.07 Eme1 Essential meiotic endonuclease 1 homolog 1 0.853 ± 0.27 1.142 ± 0.35 1.017 ± 0.24 Endod1 Endonuclease domain containing 1 0.991 ± 0.11 1.068 ± 0.14 1.049 ± 0.17 Endog Endonuclease G 0.769 ± 0.16 0.924 ± 0.19 0.873 ± 0.18 Endou Endonuclease, polyU-specific 1.050 ± 0.21 1.097 ± 0.15 0.994 ± 0.25 Endov Inosine-specific endoribonuclease 1.017 ± 0.04 0.839 ± 0.17 0.893 ± 0.17 Ern2 Endoplasmic reticulum (ER) to nucleus signaling 2 - 1.006 ± 0.21 1.001 ± 0.28 Exo1 Exonuclease 1 0.496 ± 0.26 1.687 ± 0.24 1.944 ± 0.24 Exog Exo/endonuclease G 0.617 ± 0.20 0.773 ± 0.14 0.757 ± 0.17 Fan1 FANCD2/FANCI-associated nuclease 1 0.900 ± 0.35 0.938 ± 0.19 0.888 ± 0.26 Fen1 Flap structure specific endonuclease 1 0.622 ± 0.32 1.216 ± 0.16 1.163 ± 0.13 Hrsp12 Heat-responsive protein 12 1.250 ± 0.13 1.019 ± 0.16 1.000 ± 0.13 Mre11a Meiotic recombination 11 homolog A (S. cerevisiae) 0.735 ± 0.23 0.927 ± 0.19 0.950 ± 0.12 Mrpl44 Mitochondrial ribosomal protein L44 1.009 ± 0.09 0.880 ± 0.13 0.975 ± 0.16 Mus81 MUS81 endonuclease homolog (yeast) 1.049 ± 0.16 1.013 ± 0.15 0.920 ± 0.18 Pelo Pelota MRNA surveillance and ribosome rescue factor 0.906 ± 0.06 0.869 ± 0.11 0.863 ± 0.14 Pld6 Phospholipase D family, member 6 0.946 ± 0.18 0.971 ± 0.19 1.121 ± 0.18 2 Rnase4 Ribonuclease, RNase A family 4 - 0.907 ± 0.39 1.431 ± 0.36 Rnase6 Ribonuclease, RNase A family, 6 0.966 ± 0.40 1.001 ± 0.19 1.042 ± 0.13 Rnaseh1 Ribonuclease H1 - 0.904 ± 0.07 0.934 ± 0.08 Rnasel Ribonuclease L 1.597 ± 0.31 1.337 ± 0.27 1.363 ± 0.32 Rnaset2b Ribonuclease T2 0.827 ± 0.33 0.866 ± 0.17 0.886 ± 0.19 Slx4 SLX4 structure-specific endonuclease subunit 1.008 ± 0.08 0.957 ± 0.17 0.990 ± 0.17 Tsen34 tRNA splicing endonuclease 34 homolog 0.869 ± 0.18 1.138 ± 0.11 1.052 ± 0.13 Tsn Translin RNase 0.894 ± 0.18 0.978 ± 0.14 1.016 ± 0.10 Zc3h12a Zinc finger CCCH type containing 12A 7.781 ± 0.14 4.744 ± 0.47 3.949 ± 0.44 Zc3h12b Zinc finger CCCH type containing 12B 1.323 ± 0.37 0.940 ± 0.34 1.025 ± 0.29 Zc3h12c Zinc finger CCCH type containing 12C 0.948 ± 0.20 1.208 ± 0.16 1.163 ± 0.19 Exonucleases Apex1 apurinic/apyrimidinic endonuclease 1 0.818 ± 0.18 0.985 ± 0.07 1.149 ± 0.06 Apex2 apurinic/apyrimidinic endonuclease 2 0.898 ± 0.08 0.924 ± 0.11 0.871 ± 0.15 Cnot6 CCR4-NOT transcription complex, subunit 6 0.966 ± 0.24 0.968 ± 0.17 0.962 ± 0.14 Cnot6l CCR4-NOT transcription complex, subunit 6-like 1.006 ± 0.12 0.975 ± 0.10 0.941 ± 0.13 Cnot7 CCR4-NOT transcription complex, subunit 7 1.279 ± 0.17 0.918 ± 0.07 0.892 ± 0.08 Cnot8 CCR4-NOT transcription complex, subunit 8 0.881 ± 0.17 0.821 ± 0.16 0.807 ± 0.13 Cpsf3 cleavage and polyadenylation specificity factor 3 0.868 ± 0.12 0.881 ± 0.10 0.903 ± 0.13 Ddx1 DEAD (Asp-Glu-Ala-Asp) box polypeptide 1 0.798 ± 0.08 0.938 ± 0.10 0.909 ± 0.09 Dis3 DIS3 mitotic control homolog (S.
Load more

Recommended publications
  • Genotyping for Response to Physical Training
    Wright State University CORE Scholar Browse all Theses and Dissertations Theses and Dissertations 2019 Genotyping for Response to Physical Training Stacy Simmons Wright State University Follow this and additional works at: https://corescholar.libraries.wright.edu/etd_all Part of the Molecular Biology Commons Repository Citation Simmons, Stacy, "Genotyping for Response to Physical Training" (2019). Browse all Theses and Dissertations. 2109. https://corescholar.libraries.wright.edu/etd_all/2109 This Thesis is brought to you for free and open access by the Theses and Dissertations at CORE Scholar. It has been accepted for inclusion in Browse all Theses and Dissertations by an authorized administrator of CORE Scholar. For more information, please contact [email protected]. GENOTYPING FOR RESPONSE TO PHYSICAL TRAINING A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science By STACY SIMMONS B.S., Wright State University, 2014 _________________________________________________________ 2019 Wright State University WRIGHT STATE UNIVERSITY GRADUATE SCHOOL July 29, 2019 I HEREBY RECOMMEND THAT THE THESIS PREPARED UNDER MY SUPERVISION BY Stacy Simmons ENTITLED Genotyping for Response to Physical Training BE ACCEPTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF Master of Science. ___________________________________ Michael Markey, Ph.D. Thesis Director ____________________________________ Madhavi P. Kadakia, Ph.D. Committee on Chair, Department of Biochemistry Final Examination and
    [Show full text]
  • Katalog 2015 Cover Paul Lin *Hinweis Förderung.Indd
    Product List 2015 WE LIVE SERVICE Certificates quartett owns two productions sites that are certified according to EN ISO 9001:2008 Quality management systems - Requirements EN ISO 13485:2012 + AC:2012 Medical devices - Quality management systems - Requirements for regulatory purposes GMP Conformity Our quality management guarantees products of highest quality! 2 Foreword to the quartett product list 2015 quartett Immunodiagnostika, Biotechnologie + Kosmetik Vertriebs GmbH welcomes you as one of our new business partners as well as all of our previous loyal clients. You are now member of quartett´s worldwide customers. First of all we would like to introduce ourselves to you. Founded as a family-run company in 1986, quartett ensures for more than a quarter of a century consistent quality of products. Service and support of our valued customers are our daily businesses. And we will continue! In the end 80´s quartett offered radioimmunoassay and enzyme immunoassay kits from different manufacturers in the USA. In the beginning 90´s the company changed its strategy from offering products for routine diagnostic to the increasing field of research and development. Setting up a production plant in 1997 and a second one in 2011 supported this decision. The company specialized its product profile in the field of manufacturing synthetic peptides for antibody production, peptides such as protease inhibitors, biochemical reagents and products for histology, cytology and immunohistology. All products are exclusively manufactured in Germany without outsourcing any production step. Nowadays, we expand into all other diagnostic and research fields and supply our customers in universities, government institutes, pharmaceutical and biotechnological companies, hospitals, and private doctor offices.
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • TITLE PAGE Oxidative Stress and Response to Thymidylate Synthase
    Downloaded from molpharm.aspetjournals.org at ASPET Journals on October 2, 2021 -Targeted -Targeted 1 , University of of , University SC K.W.B., South Columbia, (U.O., Carolina, This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • The Role of DIS3L2 in the Degradation of the Uridylated RNA Species in Humans
    MASARYK UNIVERSITY Faculty of Science National Center for Biomedical Research Dmytro Ustianenko The role of DIS3L2 in the degradation of the uridylated RNA species in humans Ph.D. THESIS SUPERVISOR doc. Mgr. ŠTĚPÁNKA VAŇÁČOVÁ, Ph.D. BRNO, 2014 _______________________________ Cover: A schematic representation of the RNA degradation process which oc- curs in the cytoplasm. Copyright © 2014 Dmytro Ustianenko, Masaryk University, All rights reserved. _______________________________ Copyright © Dmytro Ustianenko, Masaryk University Bibliographic entry Author: Mgr. Dmytro Ustianenko Faculty of Science, Masaryk University National Centre for Biomolecular Research Central European Institute of Technology Title of Dissertation: The role of DIS3L2 in the degradation of the uridylat- ed RNA species in humans. Degree Programme: Biochemistry Field of Study: Biomolecular chemistry Supervisor: Doc. Mgr. Štěpánka Vaňáčová, Ph.D. Academic Year: 2014 Number of Pages: 131 Keywords: RNA degradation, DIS3L2, uridylation, humans, miRNA, let-7 Bibliografický záznam Autor: Mgr. Dmytro Ustianenko Přírodovědecká fakulta, Masarykova univerzita Národní centrum pro výzkum biomolekul Středoevropský technologický institut Název práce: The role of DIS3L2 in the degradation of the uridylat- ed RNA species in humans. Studijní program: Biochemie Studijní obor: Biomolekulární chemie Školitel: doc. Mgr. Štěpánka Vaňáčová, Ph.D. Akademický rok: 2014 Počet stran: 131 Klíčová slova: RNA degradace, DIS3L2, uridylace, mikro RNA, let-7 Acknowledgements I would like to thank to all the people who have contributed to this work. Foremost I would like to thank my supervisor Stepanka Vanacova for her enthusiasm, support and patience though all of my studies. I would like to acknowledge the members of the RNA processing and degradation group for their support and help in achieving this goal.
    [Show full text]
  • (P -Value<0.05, Fold Change≥1.4), 4 Vs. 0 Gy Irradiation
    Table S1: Significant differentially expressed genes (P -Value<0.05, Fold Change≥1.4), 4 vs. 0 Gy irradiation Genbank Fold Change P -Value Gene Symbol Description Accession Q9F8M7_CARHY (Q9F8M7) DTDP-glucose 4,6-dehydratase (Fragment), partial (9%) 6.70 0.017399678 THC2699065 [THC2719287] 5.53 0.003379195 BC013657 BC013657 Homo sapiens cDNA clone IMAGE:4152983, partial cds. [BC013657] 5.10 0.024641735 THC2750781 Ciliary dynein heavy chain 5 (Axonemal beta dynein heavy chain 5) (HL1). 4.07 0.04353262 DNAH5 [Source:Uniprot/SWISSPROT;Acc:Q8TE73] [ENST00000382416] 3.81 0.002855909 NM_145263 SPATA18 Homo sapiens spermatogenesis associated 18 homolog (rat) (SPATA18), mRNA [NM_145263] AA418814 zw01a02.s1 Soares_NhHMPu_S1 Homo sapiens cDNA clone IMAGE:767978 3', 3.69 0.03203913 AA418814 AA418814 mRNA sequence [AA418814] AL356953 leucine-rich repeat-containing G protein-coupled receptor 6 {Homo sapiens} (exp=0; 3.63 0.0277936 THC2705989 wgp=1; cg=0), partial (4%) [THC2752981] AA484677 ne64a07.s1 NCI_CGAP_Alv1 Homo sapiens cDNA clone IMAGE:909012, mRNA 3.63 0.027098073 AA484677 AA484677 sequence [AA484677] oe06h09.s1 NCI_CGAP_Ov2 Homo sapiens cDNA clone IMAGE:1385153, mRNA sequence 3.48 0.04468495 AA837799 AA837799 [AA837799] Homo sapiens hypothetical protein LOC340109, mRNA (cDNA clone IMAGE:5578073), partial 3.27 0.031178378 BC039509 LOC643401 cds. [BC039509] Homo sapiens Fas (TNF receptor superfamily, member 6) (FAS), transcript variant 1, mRNA 3.24 0.022156298 NM_000043 FAS [NM_000043] 3.20 0.021043295 A_32_P125056 BF803942 CM2-CI0135-021100-477-g08 CI0135 Homo sapiens cDNA, mRNA sequence 3.04 0.043389246 BF803942 BF803942 [BF803942] 3.03 0.002430239 NM_015920 RPS27L Homo sapiens ribosomal protein S27-like (RPS27L), mRNA [NM_015920] Homo sapiens tumor necrosis factor receptor superfamily, member 10c, decoy without an 2.98 0.021202829 NM_003841 TNFRSF10C intracellular domain (TNFRSF10C), mRNA [NM_003841] 2.97 0.03243901 AB002384 C6orf32 Homo sapiens mRNA for KIAA0386 gene, partial cds.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • A Short Splicing Isoform of HBS1L Links the Cytoplasmic Exosome and SKI Complexes in Humans Katarzyna Kalisiak1,2, Tomasz M
    Nucleic Acids Research Advance Access published September 26, 2016 Nucleic Acids Research, 2016 1 doi: 10.1093/nar/gkw862 A short splicing isoform of HBS1L links the cytoplasmic exosome and SKI complexes in humans Katarzyna Kalisiak1,2, Tomasz M. Kulinski´ 1,2,Rafa-l Tomecki1,2, Dominik Cysewski1,2, Zbigniew Pietras1,2,3, Aleksander Chlebowski1,2, Katarzyna Kowalska1,2 and Andrzej Dziembowski1,2,* 1Laboratory of RNA Biology and Functional Genomics, Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawinskiego 5a, 02-106 Warsaw, Poland, 2Institute of Genetics and Biotechnology, Faculty of Biology, University of Warsaw, Pawinskiego 5a, 02-106 Warsaw, Poland and 3International Institute of Molecular and Cell Biology in Warsaw, Ks. Trojdena 4, 02-109 Warsaw, Poland Received April 18, 2016; Revised August 25, 2016; Accepted September 20, 2016 Downloaded from ABSTRACT INTRODUCTION The exosome complex is a major eukaryotic exori- Messenger RNA (mRNA) molecules exist largely to pro- duce proteins. Since steady-state mRNA levels are deter- bonuclease that requires the SKI complex for its http://nar.oxfordjournals.org/ activity in the cytoplasm. In yeast, the Ski7 protein mined by the rates of synthesis and decay, cytoplasmic links both complexes, whereas a functional equiva- degradation of mRNA plays a fundamental role in the reg- lent of the Ski7 has remained unknown in the human ulation of gene expression. Multiple enzymes, particularly nucleases, participate in genome. eukaryotic mRNA decay. Nucleases involved in 3 -5 cyto- Proteomic analysis revealed that a previously plasmic mRNA degradation pathways can act individually uncharacterized short splicing isoform of HBS1L (e.g. the DIS3L2 protein) (1,2), or be constituents of mul- (HBS1LV3) is the long-sought factor linking the tisubunit complexes.
    [Show full text]
  • Strand Breaks for P53 Exon 6 and 8 Among Different Time Course of Folate Depletion Or Repletion in the Rectosigmoid Mucosa
    SUPPLEMENTAL FIGURE COLON p53 EXONIC STRAND BREAKS DURING FOLATE DEPLETION-REPLETION INTERVENTION Supplemental Figure Legend Strand breaks for p53 exon 6 and 8 among different time course of folate depletion or repletion in the rectosigmoid mucosa. The input of DNA was controlled by GAPDH. The data is shown as ΔCt after normalized to GAPDH. The higher ΔCt the more strand breaks. The P value is shown in the figure. SUPPLEMENT S1 Genes that were significantly UPREGULATED after folate intervention (by unadjusted paired t-test), list is sorted by P value Gene Symbol Nucleotide P VALUE Description OLFM4 NM_006418 0.0000 Homo sapiens differentially expressed in hematopoietic lineages (GW112) mRNA. FMR1NB NM_152578 0.0000 Homo sapiens hypothetical protein FLJ25736 (FLJ25736) mRNA. IFI6 NM_002038 0.0001 Homo sapiens interferon alpha-inducible protein (clone IFI-6-16) (G1P3) transcript variant 1 mRNA. Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15 GALNTL5 NM_145292 0.0001 (GALNT15) mRNA. STIM2 NM_020860 0.0001 Homo sapiens stromal interaction molecule 2 (STIM2) mRNA. ZNF645 NM_152577 0.0002 Homo sapiens hypothetical protein FLJ25735 (FLJ25735) mRNA. ATP12A NM_001676 0.0002 Homo sapiens ATPase H+/K+ transporting nongastric alpha polypeptide (ATP12A) mRNA. U1SNRNPBP NM_007020 0.0003 Homo sapiens U1-snRNP binding protein homolog (U1SNRNPBP) transcript variant 1 mRNA. RNF125 NM_017831 0.0004 Homo sapiens ring finger protein 125 (RNF125) mRNA. FMNL1 NM_005892 0.0004 Homo sapiens formin-like (FMNL) mRNA. ISG15 NM_005101 0.0005 Homo sapiens interferon alpha-inducible protein (clone IFI-15K) (G1P2) mRNA. SLC6A14 NM_007231 0.0005 Homo sapiens solute carrier family 6 (neurotransmitter transporter) member 14 (SLC6A14) mRNA.
    [Show full text]
  • Identification of Genomic Targets of Krüppel-Like Factor 9 in Mouse Hippocampal
    Identification of Genomic Targets of Krüppel-like Factor 9 in Mouse Hippocampal Neurons: Evidence for a role in modulating peripheral circadian clocks by Joseph R. Knoedler A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Neuroscience) in the University of Michigan 2016 Doctoral Committee: Professor Robert J. Denver, Chair Professor Daniel Goldman Professor Diane Robins Professor Audrey Seasholtz Associate Professor Bing Ye ©Joseph R. Knoedler All Rights Reserved 2016 To my parents, who never once questioned my decision to become the other kind of doctor, And to Lucy, who has pushed me to be a better person from day one. ii Acknowledgements I have a huge number of people to thank for having made it to this point, so in no particular order: -I would like to thank my adviser, Dr. Robert J. Denver, for his guidance, encouragement, and patience over the last seven years; his mentorship has been indispensable for my growth as a scientist -I would also like to thank my committee members, Drs. Audrey Seasholtz, Dan Goldman, Diane Robins and Bing Ye, for their constructive feedback and their willingness to meet in a frequently cold, windowless room across campus from where they work -I am hugely indebted to Pia Bagamasbad and Yasuhiro Kyono for teaching me almost everything I know about molecular biology and bioinformatics, and to Arasakumar Subramani for his tireless work during the home stretch to my dissertation -I am grateful for the Neuroscience Program leadership and staff, in particular
    [Show full text]
  • ( 12 ) United States Patent
    US010363295B2 (12 ) United States Patent ( 10 ) Patent No. : US 10 , 363, 295 B2 Schoor et al. ( 45 ) Date of Patent: Jul. 30 , 2019 ( 54 ) PEPTIDES AND COMBINATION OF ( 58 ) Field of Classification Search PEPTIDES FOR USE IN IMMUNOTHERAPY ??? . .. A61K 39 /00 AGAINST NHL AND OTHER CANCERS USPC . .. .. .. .. 424 / 1 . 41 See application file for complete search history . (71 ) Applicant: Immatics Biotechnologies GmbH , Tuebingen (DE ) (56 ) References Cited ( 72 ) Inventors : Oliver Schoor , Tuebingen ( DE ) ; Andrea Mahr , Tuebingen (DE ); Toni U . S . PATENT DOCUMENTS Weinschenk , Aichwald (DE ) ; Anita 9 ,023 , 803 B2 5 / 2015 Singh et al. Wiebe , Ruebgarten (DE ) ; Jens 9 , 056 , 069 B2 6 / 2015 Singh et al . Fritsche , Dusslingen (DE ) ; Harpreet 9 , 791, 443 B2 10 / 2017 Weinschenk et al. Singh , Muenchen Schwabing (DE ) 9 ,791 , 444 B2 10 / 2017 Weinschenk et al. 2008/ 0039413 A1 2 / 2008 Morris et al. 2011/ 0257890 A1 10 / 2011 Weinschenk et al. ( 73 ) Assignee: IMMATICS BIOTECHNOLOGIES 2012 /0027684 A12 / 2012 Singh et al. GMBH , Tuebingen (DE ) 2013 / 0096016 A1 4 /2013 Weinschenk et al . 2013/ 0164254 A1* 6 / 2013 Pieczykolan .. CO7K 14 /70575 ( * ) Notice : Subject to any disclaimer, the term of this 424 / 85 . 1 patent is extended or adjusted under 35 2013 /0177525 A1 7 /2013 Singh et al . U . S . C . 154 ( b ) by 0 days . FOREIGN PATENT DOCUMENTS ( 21 ) Appl. No .: 16 / 193 , 334 EP 1589100 Al 10 /2005 WO 0157273 A2 8 / 2001 ( 22 ) Filed : Nov . 16 , 2018 WO 2011037827 A2 3 / 2011 WO 2011 / 128448 A 10 / 2011 (65 ) Prior Publication Data WO 2011/ 151403 Al 12 / 2011 WO 2015 / 150327 A1 10 / 2015 US 2019 /0076514 A1 Mar .
    [Show full text]