Supplementary Materials Up-regulated endonuclease Regnase-1 suppresses osteoarthritis by forming negative feedback loop of catabolic signaling in chondrocytes Jeong-In Yang and Jang-Soo Chun Supplementary Figure 1-4 Supplementary Table 1-6 1 A B C ZC3H12A (Regnase-1) HIF-2 ZIP8 ZC3H12A (Regnase-1) ZC3H12A (Regnase-1) ZC3H12B ZC3H12B ZC3H12B ZC3H12C ZC3H12C ZC3H12C ZC3H12D ZC3H12D ZC3H12D GAPDH GAPDH GAPDH 0 3 0 6 12 24 0.1 1.0 0.5 400 800 200 400 800 200 IL1 (ng/ml, 24h) IL1 (h, 1 ng/ml) (MOI) (MOI) Ad-C 800 Ad-C 800 Ad-HIF-2(36 h) Ad-ZIP8 (36 h) Supplementary Fig. 1. Upregulation of Regnase-1 in chondrocytes treated with OA-associated catabolic factors. A–C RT-PCR analysis of ZC3H12 family members in chondrocytes treated with IL-1 (A)or infected with Ad-HIF-2α (B)orAd-ZIP8(C). Images are representative of the results obtained from five independent primary cultures of chondrocytes. A B Regnase-1 MMP3 MMP13 ADAMTS5 SOX9 Coll-II Aggrecan -actin Ad-shC Ad-shRegnase-1 Ad-HIF-2 400 200 800 (MOI) Ad-shRegnase-1 Ad-shC 800 Supplementary Fig. 2. Knockdown of Regnase-1 alone in joint tissues is not sufficient to cause OA-like changes in mice. A Representative Safranin-O staining images of joint sections from mice IA-injected with Ad-shScramble (Ad-shC), Ad-shRegnase-1, or Ad-HIF-2α (n = 10 mice per group). IA injection of Ad-HIF-2α was used as a positive control. B Representative RT- PCR images (n = 4) of the indicated molecules in primary-culture chondrocytes infected with Ad-shC or Ad-shRegnase-1. A Intron 1 Exon 1 Exon 2 Aaagcctgtccaagaatccaaccccaccatgagtctgtggagtcttgaggacagacacagcagccagggtcgacctcagccagac caggatcctgtggctaaagaggcccctacttccgagctgcagatgaaggtggactttttccgtaaactggggtactcgtcctctgagatcc acagtgtcctgcagaagctgggagtccaagcagacaccaacacggtgctaggggaattggtgaagcatggctcagctactgaacga gaatgccaggccctgacggcccccagcccccagccccctctggtgccccggggtggaagcacccccaagccttccactctagaacc ctcactcccagaggaggacagagagggcagcgacctgagacctgtggtcatcgacggaagcaatgtggccatgaggtatgtgt … (68-bp deletion in Exon2) B C Genotype Regnase-1 -actin mRNA +/+ +/- -/- Zc3h12a Zc3h12a+/+ Zc3h12a+/- Zc3h12a-/- Supplementary Fig. 3. Characterization of Regnase-1 knockout mice. A A 68-bp deletion in exon 2 of the Regnase-1 gene was used to generate Zc3h12a-/- mice. B Genotypes and mRNA levels of Regnase-1 in Zc3h12a homozygous (-/-) KO mice, heterozygous (+/-) KO mice, and their WT (+/+) littermates. C Skeletal staining of E18.5 embryos of Zc3h12a homozygous (-/-) KO mice, heterozygous (+/-) KO mice, and their WT (+/+) littermates. A Regnase-1 SAA1 SAA2 SAA3 SAA4 25 1.5 1.5 1.5 1.5 ns 20 1.0 1.0 1.0 1.0 15 10 0.5 0.5 0.5 0.5 (fold change) (fold 5 Relative mRNA levels mRNA Relative 0 0 0 0 0 200 400 200 400 800 800 200 400 200 400 200 400 800 800 800 Ad-C Ad-C Ad-C Ad-C Ad-C (MOI) (MOI) (MOI) (MOI) (MOI) Ad-Regnase-1 Ad-Regnase-1 Ad-Regnase-1 Ad-Regnase-1 Ad-Regnase-1 B Regnase-1 SAA1 SAA2SAA3 SAA4 6 6 6 6 1.5 1.0 4 4 4 4 0.5 2 2 2 2 (fold change) Relative mRNA levels mRNA Relative 0 0 0 0 0 200 400 800 800 800 200 400 200 400 200 400 800 800 200 400 (MOI) (MOI) Ad-shC Ad-shC (MOI) Ad-shC (MOI) Ad-shC Ad-shC (MOI) Ad-shRegnase-1 Ad-shRegnase-1 Ad-shRegnase-1 Ad-shRegnase-1 Ad-shRegnase-1 Supplementary Fig. 4. Regnase-1 modulates the expression levels of SAA family members in chondrocytes. A and B qRT-PCR analysis (n =6)ofSAAfamilymembers(SAA1,SAA2, SAA3, and SAA4) in chondrocytes infected with 800 MOI of control adenovirus (Ad-C or Ad-shC) or the indicated MOI of Ad-Regnase-1 (A) and Ad-shRegnase-1 (B) for 36 hours. Values are means ± s.e.m. with one-way ANOVA and Bonferroni's post hoc test. *p < 0.05, **p < 0.005, ***p < 0.0005. ns, not significant. Supplementary Table 1. PCR primers and conditions. Size AT Genes Strand Primer sequences Origin (bp) (°C) Acan S 5´-CTGTCTTTGTCACCCACACATG-3´ 581 58 Mouse (Aggrecan) AS 5´-GAAGACGACATCACCATCCAG-3´ S 5´-GCCATTGTAATAACCCTGCACC-3´ Adamts5 292 58 Mouse AS 5´-TCAGTCCCATCCGTAACCTTTG-3´ Actb S 5´-ATATCGCTGCGCTGGTCGTC-3´ 517 58 Mouse (β-actin) AS 5´-AGGATGGCGTGAGGGAGAGC-3 S 5´-CACACTGGTAAGTGGGGCAAGACCG-3´ Col2a1 173 57 Mouse AS 5´-GGATTGTGTTGTTTCAGGGTTCGGG-3´ Epas1 S 5´-CGAGAAGAACGACGTGGTGTTC-3´ 333 64 Mouse (HIF-2α) AS 5´-GTGAAGGCTGGCAGGCTCC-3´ S 5´-TGATGGACCTTCTGGTCTTCTGG-3´ Mmp13 473 58 Mouse AS 5´-CATCCACATGGTTGGGAAGTTCT-3´ S 5´-AGGGATGATGATGCTGGTATGG-3´ Mmp3 434 58 Mouse AS 5´-CCATGTTCTCCAACTGCAAAGG-3´ S 5´-TCCTCCTCAAGCAGTTACTACTGCAA-3´ Saa1 423 60 Mouse AS 5´-ATGAAGGAAGCTAACTGGAAAAACTC-3´ S 5´-TCCTCCTCAAGCAGTTACTACTGCTC-3´ Saa2 420 60 Mouse AS 5´-ATGAAGGAAGCTGGCTGGAAAGATGG-3´ S 5´-GCCACCATGAAGCCTTCCATTGCCATCATT-3´ Saa3 375 60 Mouse AS 5´-TCAGTATCTTTTAGGCAGGCCAGCAG-3´ S 5´-GAGGTCTTGCTCGTGATTCACT-3´ Saa4 373 66 Mouse AS 5´-TTTCTGGGTAGCCTGCAGGGTT-3´ Slc39a8 S 5´-GAACAATTGCCTGGATGATCACGC-3´ 430 58 Mouse (ZIP8) AS 5´-AAGCCGGTTAACATCCCTGCATTC-3´ S 5´-CACTGGCAGTTACGGCATCAG-3´ Sox9 457 61 Mouse AS 5´-CATGTAAGTGAAGGTGGAGTAGAGC-3´ S 5´-AGATGTCAGAATTATGGGGCGTGC-3´ Zc3h12a 389 64 Mouse AS 5´-GCGTCTCATTACAGCTTCTACCAGG-3´ S 5´-GAGGGTGGTCTGCTATGATGA-3´ Zc3h12b 217 60 Mouse AS 5´-GAAATTCTCAAGGCTCGGACC-3´ S 5´-CTCAGGATCAAAGACCACAGG-3´ Zc3h12c 120 60 Mouse AS 5´-AATATCCAACGTCAACAGGGG-3´ S 5´-GGCGATCTCGGGTCTCCAAT-3´ Zc3h12d 212 60 Mouse AS 5´-GGTTGTGCTGACTCCGAAGG-3´ AT, annealing temperature; S, sense; AS, antisense 1 Supplementary Table 2. mRNA levels of RNases in chondrocytes treated with IL-1β (1 ng/ml, 36 h) or infected with 800 MOI of Ad-HIF-2α or Ad-ZIP8 (36 h). Fold change Gene Definition symbol IL-1β Ad-HIF-2α Ad-ZIP8 Endonuclease Ago2 Argonaute RISC catalytic subunit 2 1.069 ± 0.08 1.143 ± 0.13 1.033 ± 0.12 Ang2 Angiogenin, ribonuclease A family, member 2 1.219 ± 0.20 1.074 ± 0.43 1.280 ± 0.76 Ang4 Angiogenin, ribonuclease A family, member 4 0.757 ± 0.65 0.991 ± 0.63 0.876 ± 0.30 Ang5 Angiogenin, ribonuclease A family, member 5 0.973 ± 0.14 1.025 ± 0.31 1.121 ± 0.31 Ang6 Angiogenin, ribonuclease A family, member 6 1.117 ± 0.24 0.987 ± 0.26 0.919 ± 0.32 Apex1 Apurinic/apyrimidinic endonuclease 1 0.818 ± 0.18 0.985 ± 0.07 1.149 ± 0.06 Apex2 Apurinic/apyrimidinic endonuclease 2 0.898 ± 0.08 0.924 ± 0.11 0.871 ± 0.15 Cpsf3 Cleavage and polyadenylation specificity factor 3 0.868 ± 0.12 0.881 ± 0.10 0.903 ± 0.13 Dclre1c DNA cross-link repair 1C, PSO2 homolog 1.363 ± 0.22 1.052 ± 0.23 1.160 ± 0.18 Dicer1 ElaC homolog 2 (E. coli) 0.600 ± 0.22 0.792 ± 0.15 0.779 ± 0.16 Ear1 Eosinophil-associated, ribonuclease A family, member 1 0.919 ± 0.49 1.156 ± 0.59 1.050 ± 0.65 Ear10 Eosinophil-associated, ribonuclease A family, member 10 0.917 ± 0.16 0.958 ± 0.32 1.091 ± 0.40 Ear11 Eosinophil-associated, ribonuclease A family, member 11 - 1.286 ± 0.21 1.190 ± 0.33 Ear2 Eosinophil-associated, ribonuclease A family, member 2 1.055 ± 0.21 1.031 ± 0.20 1.071 ± 0.22 Ear4 Eosinophil-associated, ribonuclease A family, member 4 - 0.950 ± 0.37 0.914 ± 0.29 Ear5 Eosinophil-associated, ribonuclease A family, member 5 - 0.977 ± 0.21 0.975 ± 0.36 Ear7 Eosinophil-associated, ribonuclease A family, member 7 - 1.125 ± 0.40 1.156 ± 0.41 Elac1 Zinc phosphodiesterase ELAC protein 1 1.117 ± 0.16 1.101 ± 0.15 1.002 ± 0.20 Elac2 Zinc phosphodiesterase ELAC protein 2 0.779 ± 0.12 0.829 ± 0.05 0.830 ± 0.07 Eme1 Essential meiotic endonuclease 1 homolog 1 0.853 ± 0.27 1.142 ± 0.35 1.017 ± 0.24 Endod1 Endonuclease domain containing 1 0.991 ± 0.11 1.068 ± 0.14 1.049 ± 0.17 Endog Endonuclease G 0.769 ± 0.16 0.924 ± 0.19 0.873 ± 0.18 Endou Endonuclease, polyU-specific 1.050 ± 0.21 1.097 ± 0.15 0.994 ± 0.25 Endov Inosine-specific endoribonuclease 1.017 ± 0.04 0.839 ± 0.17 0.893 ± 0.17 Ern2 Endoplasmic reticulum (ER) to nucleus signaling 2 - 1.006 ± 0.21 1.001 ± 0.28 Exo1 Exonuclease 1 0.496 ± 0.26 1.687 ± 0.24 1.944 ± 0.24 Exog Exo/endonuclease G 0.617 ± 0.20 0.773 ± 0.14 0.757 ± 0.17 Fan1 FANCD2/FANCI-associated nuclease 1 0.900 ± 0.35 0.938 ± 0.19 0.888 ± 0.26 Fen1 Flap structure specific endonuclease 1 0.622 ± 0.32 1.216 ± 0.16 1.163 ± 0.13 Hrsp12 Heat-responsive protein 12 1.250 ± 0.13 1.019 ± 0.16 1.000 ± 0.13 Mre11a Meiotic recombination 11 homolog A (S. cerevisiae) 0.735 ± 0.23 0.927 ± 0.19 0.950 ± 0.12 Mrpl44 Mitochondrial ribosomal protein L44 1.009 ± 0.09 0.880 ± 0.13 0.975 ± 0.16 Mus81 MUS81 endonuclease homolog (yeast) 1.049 ± 0.16 1.013 ± 0.15 0.920 ± 0.18 Pelo Pelota MRNA surveillance and ribosome rescue factor 0.906 ± 0.06 0.869 ± 0.11 0.863 ± 0.14 Pld6 Phospholipase D family, member 6 0.946 ± 0.18 0.971 ± 0.19 1.121 ± 0.18 2 Rnase4 Ribonuclease, RNase A family 4 - 0.907 ± 0.39 1.431 ± 0.36 Rnase6 Ribonuclease, RNase A family, 6 0.966 ± 0.40 1.001 ± 0.19 1.042 ± 0.13 Rnaseh1 Ribonuclease H1 - 0.904 ± 0.07 0.934 ± 0.08 Rnasel Ribonuclease L 1.597 ± 0.31 1.337 ± 0.27 1.363 ± 0.32 Rnaset2b Ribonuclease T2 0.827 ± 0.33 0.866 ± 0.17 0.886 ± 0.19 Slx4 SLX4 structure-specific endonuclease subunit 1.008 ± 0.08 0.957 ± 0.17 0.990 ± 0.17 Tsen34 tRNA splicing endonuclease 34 homolog 0.869 ± 0.18 1.138 ± 0.11 1.052 ± 0.13 Tsn Translin RNase 0.894 ± 0.18 0.978 ± 0.14 1.016 ± 0.10 Zc3h12a Zinc finger CCCH type containing 12A 7.781 ± 0.14 4.744 ± 0.47 3.949 ± 0.44 Zc3h12b Zinc finger CCCH type containing 12B 1.323 ± 0.37 0.940 ± 0.34 1.025 ± 0.29 Zc3h12c Zinc finger CCCH type containing 12C 0.948 ± 0.20 1.208 ± 0.16 1.163 ± 0.19 Exonucleases Apex1 apurinic/apyrimidinic endonuclease 1 0.818 ± 0.18 0.985 ± 0.07 1.149 ± 0.06 Apex2 apurinic/apyrimidinic endonuclease 2 0.898 ± 0.08 0.924 ± 0.11 0.871 ± 0.15 Cnot6 CCR4-NOT transcription complex, subunit 6 0.966 ± 0.24 0.968 ± 0.17 0.962 ± 0.14 Cnot6l CCR4-NOT transcription complex, subunit 6-like 1.006 ± 0.12 0.975 ± 0.10 0.941 ± 0.13 Cnot7 CCR4-NOT transcription complex, subunit 7 1.279 ± 0.17 0.918 ± 0.07 0.892 ± 0.08 Cnot8 CCR4-NOT transcription complex, subunit 8 0.881 ± 0.17 0.821 ± 0.16 0.807 ± 0.13 Cpsf3 cleavage and polyadenylation specificity factor 3 0.868 ± 0.12 0.881 ± 0.10 0.903 ± 0.13 Ddx1 DEAD (Asp-Glu-Ala-Asp) box polypeptide 1 0.798 ± 0.08 0.938 ± 0.10 0.909 ± 0.09 Dis3 DIS3 mitotic control homolog (S.